"
Team:AMU-Poznan/Modeling
From 2014.igem.org
(Difference between revisions)
| Line 101: | Line 101: | ||
<h1>Modeling</h1> | <h1>Modeling</h1> | ||
</br> | </br> | ||
| - | <p>We decided to pay more attention to model sh-miR molecules with different RNA 2D structure prediction software (we use RNAfold in our software). Here are our results:</p> | + | <p>We decided to pay more attention to model sh-miR molecules with different RNA 2D structure prediction software (we use RNAfold in our software). Here are our results (however we only show modeling of one molecule the conclusions are obvious - we performed folding for over 10 molecules):</p> |
</br></br> | </br></br> | ||
| - | analyzed sequence: | + | example analyzed sequence: |
</br>CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCC</br>TACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA</br> | </br>CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCC</br>TACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA</br> | ||
We always take first generated structure made with default options</br> | We always take first generated structure made with default options</br> | ||
| - | If there is difference in | + | If there is difference in algorithm we always take RNA folding over DNA folding</br> |
mfold</br> | mfold</br> | ||
<img src="https://static.igem.org/mediawiki/2014/2/20/Mfold.png" width="60%"> | <img src="https://static.igem.org/mediawiki/2014/2/20/Mfold.png" width="60%"> | ||
Latest revision as of 21:02, 16 October 2014
Survey14.10.2014 31 survey responses: what survey answerers think that RNAi is 
what they think that sh-miRs are
what they think that shRNAs are
what literature do they know about sh-miRs
what they find important in bioinformatic software
what they find important in sh-miR designer
how long will they wait for software response
survey answerers
their sex
and age
ConclusionsKnowledge of RNAi is good. however people do not know what exactly sh-miR is. Users are eager to wait up to 8h, 24h only 50% and 2 days only 20% (work without software will take 2 days). What are the most important features of bioinformatic software: user-friendly interface documentation easy user-guide fast response from software what is important in shmiR designer: speed of software possibilty to choose miRNA scaffold experimental evaluationModelingWe decided to pay more attention to model sh-miR molecules with different RNA 2D structure prediction software (we use RNAfold in our software). Here are our results (however we only show modeling of one molecule the conclusions are obvious - we performed folding for over 10 molecules): example analyzed sequence: CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA We always take first generated structure made with default options If there is difference in algorithm we always take RNA folding over DNA folding mfold
RNAstructure
RNAfold
ConclusionsDifferent algorithms gives very different results. To have the most reliable structure it recommended to check the structure with different software.
|
||||||||||||||||
