Team:AMU-Poznan/Modeling

From 2014.igem.org

(Difference between revisions)
 
(18 intermediate revisions not shown)
Line 1: Line 1:
-
{{CSS/Main}}
 
-
 
-
 
<html>
<html>
 +
<style>
 +
body {
 +
background-color: #dddddd;
 +
}
 +
</style>
-
<!--main content -->
+
<head>
-
<table width="70%" align="center">
+
<meta http-equiv="Content-Type" content="text/html;charset=UTF-8" >
-
 
+
</head>
-
<tr>
+
-
 
+
-
<!--navigation menu -->
+
-
<td align="center" colspan="3">
+
-
 
+
-
<img src="https://static.igem.org/mediawiki/2014/d/d4/Logoamu.png">
+
-
<table  width="100%">
+
-
<tr heigth="15px"></tr>
+
-
<tr heigth="75px">
+
-
 
+
-
 
+
-
<td style="border:1px solid black;" align="center" height ="45px" onMouseOver="this.bgColor='#ffffff'" onMouseOut="this.bgColor='#ffffff'" bgColor=#ffffff>
+
-
<a href="https://2014.igem.org/Team:AMU-Poznan"style="color:#000000">Home </a> </td>
+
-
<td style="border:1px solid black;" align="center" height ="45px" onMouseOver="this.bgColor='#ffffff'" onMouseOut="this.bgColor='#ffffff'" bgColor=#ffffff>  
+
<body>
-
<a href="https://2014.igem.org/Team:AMU-Poznan/Team"style="color:#000000"> Team </a> </td>
+
<table id="menu" width="100%" cellspacing="0" height="135px">
 +
<tr>
 +
<td  bgColor="#FFFFFF"></td>
 +
<td valign="bottom" width="975px" align="center" bgColor="#FFFFFF">
 +
<table align="center">
-
<td style="border:1px solid black;" align="center" height ="45px"  onMouseOver="this.bgColor='#ffffff'" onMouseOut="this.bgColor='#ffffff'" bgColor=#ffffff>  
+
<tr height="50px">
-
<a href="https://igem.org/Team.cgi?year=2014&team_name=AMU-Poznan"style="color:#000000"> Official Team Profile </a></td>
+
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >  
 +
<a href="https://2014.igem.org/Team:AMU-Poznan"style="text-decoration:none;color:#1C140D">HOME </a> </td>  
-
<td style="border:1px solid black" align="center"  height ="45px" onMouseOver="this.bgColor='#ffffff'" onMouseOut="this.bgColor='#ffffff'" bgColor=#ffffff>
+
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >  
-
<a href="https://2014.igem.org/Team:AMU-Poznan/Project"style="color:#000000"> Project</a></td>
+
<a href="https://2014.igem.org/Team:AMU-Poznan/Project" style="text-decoration:none;color:#1C140D">PROJECT</a> </td>
-
<td style="border:1px solid black;" align="center"  height ="45px" onMouseOver="this.bgColor='#ffffff'" onMouseOut="this.bgColor='#ffffff'" bgColor=#ffffff>  
+
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >  
-
<a href="https://2014.igem.org/Team:AMU-Poznan/Parts"style="color:#000000"> Parts</a></td>
+
<a href="https://2014.igem.org/Team:AMU-Poznan/Parts" style="text-decoration:none;color:#1C140D">PARTS</a></td>  
-
<td style="border:1px solid black;" align="center" height ="45px" onMouseOver="this.bgColor='#ffffff'" onMouseOut="this.bgColor='#ffffff'" bgColor=#ffffff>  
+
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >  
-
<a href="https://2014.igem.org/Team:AMU-Poznan/Modeling"style="color:#000000"> Modeling</a></td>
+
<a href="https://2014.igem.org/Team:AMU-Poznan/Team" style="text-decoration:none;color:#1C140D">TEAM </a> </td>
-
<td style="border:1px solid black;" align="center" height ="45px" onMouseOver="this.bgColor='#ffffff'" onMouseOut="this.bgColor='#ffffff'" bgColor=#ffffff>
+
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >  
-
<a href="https://2014.igem.org/Team:AMU-Poznan/Notebook"style="color:#000000"> Notebook</a></td>
+
<a href="https://igem.org/Team.cgi?year=2014&team_name=AMU-Poznan" style="text-decoration:none;color:#1C140D">OFFICIAL TEAM PROFILE</a> </td>
-
<td style="border:1px solid black;" align="center"  height ="45px" onMouseOver="this.bgColor='#ffffff'" onMouseOut="this.bgColor='#ffffff'" bgColor=#ffffff>  
+
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >
-
<a href="https://2014.igem.org/Team:AMU-Poznan/Safety"style=" color:#000000"> Safety </a></td>
+
<a href="https://2014.igem.org/Team:AMU-Poznan/Notebook" style="text-decoration:none;color:#1C140D">NOTEBOOK </a> </td>
-
<td style="border:1px solid black;" align="center"  height ="45px" onMouseOver="this.bgColor='#ffffff'" onMouseOut="this.bgColor='#ffffff'" bgColor=#ffffff>  
+
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed >
-
<a href="https://2014.igem.org/Team:AMU-Poznan/Attributions"style="color:#000000"> Attributions </a></td>
+
<a href="https://2014.igem.org/wiki/index.php?title=Team:AMU-Poznan/Safety" style="text-decoration:none;color:#1C140D">SAFETY </a></td>
 +
<td width="162px" align="center" onMouseOver="this.bgColor='#FEE5AD'" onMouseOut="this.bgColor='#e9eaed'" bgColor=#e9eaed > 
 +
<a href="https://2014.igem.org/Team:AMU-Poznan/Modeling" style="text-decoration:none;color:#1C140D">MODELING & SURVEY </a></td>
 +
</tr>
-
<td align ="center"> <a href="https://2014.igem.org/Main_Page"> <img src="https://static.igem.org/mediawiki/igem.org/6/60/Igemlogo_300px.png" width="55px"></a> </td>
+
<img src="https://static.igem.org/mediawiki/2014/d/d4/Logoamu.png" width="60%">
-
</tr>
+
-
</table>
+
-
<!--end navigation menu -->
+
<tr> <td colspan="5"></td>  
-
</tr>
+
</tr>
-
</tr>
+
-
</td>
+
-
<tr> <td colspan="3" height="15px"> </td></tr>
+
</table>
-
<tr><td bgColor="#e7e7e7" colspan="3" height="1px"> </tr>
+
<br> <br>
-
<tr> <td colspan="3"  height="5px"> </td></tr>
+
<div class="home" style="margin-left:10%; margin-right:50%; backgrand-color:#FFFFFF">
 +
<table  width="100%">
 +
<tr width="100%"><td align="center">
 +
<center><div id="surveyMonkeyInfo"><div><script src="https://www.surveymonkey.com/jsEmbed.aspx?sm=cov0Yd9Ab4plze4zPqDvYg_3d_3d"> </script></div>Create your free online surveys with <a href="https://www.surveymonkey.com">SurveyMonkey</a> , the world's leading questionnaire tool.</div></center></td></tr>
 +
</table>
 +
</div>
 +
</br> Here we present Survey results and Modeling results (for Modeling results please scroll down the page)</br>
-
<!--modeling content -->
+
<br /><h1>Survey</h1><br /><br />
-
<tr><td colspan="3"> <h3>Modeling</h3></td></tr>
+
14.10.2014<br />
-
</tr>
+
31 survey responses:<br />
 +
</br></br>what survey answerers think that RNAi is</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/d/d9/Chart10.png" width="60%"></br>
 +
</br></br>what they think that sh-miRs are</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/0/03/Chart8.png" width="60%"></br>
 +
</br></br>what they think that shRNAs are</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/4/47/Chart9.png" width="60%"></br>
 +
</br></br>what literature do they know about sh-miRs</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/6/69/Chart7.png" width="60%"></br>
-
<tr>
+
</br></br>what they find important in bioinformatic software</br></br>
-
<td width="45%" valign="top">  
+
<img src="https://static.igem.org/mediawiki/2014/0/0a/Chart6.png" width="60%"></br>
-
<p>If you choose to create a model during your project, please write about it here. Modeling is not an essential part of iGEM, but we encourage any and all teams to model some aspect of their project. See previous "Best Model" awards for more information.</p>
+
</br></br>what they find important in sh-miR designer</br></br>
-
</td>
+
<img src="https://static.igem.org/mediawiki/2014/9/96/Chart4.png" width="60%"></br>
 +
</br></br>how long will they wait for software response</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/b/b4/Chart5.png" width="60%"></br>
 +
</br></br>survey answerers</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/b/b7/Chart1.png" width="60%"></br>
 +
</br></br>their sex</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/9/9b/Chart2.png" width="60%"></br>
 +
</br></br>and age</br></br>
 +
<img src="https://static.igem.org/mediawiki/2014/8/89/Chart3.png" width="60%"></br>
 +
<h3>Conclusions</h3>
 +
</br>
 +
Knowledge of RNAi is good. however people do not know what exactly sh-miR is.</br>
 +
Users are eager to wait up to 8h, 24h only 50% and 2 days only 20% (work without software will take 2 days).</br>
 +
What are the most important features of bioinformatic software:</br>
 +
user-friendly interface</br>
 +
documentation</br>
 +
easy user-guide</br>
 +
fast response from software</br></br>
 +
what is important in shmiR designer:</br>
 +
speed of software</br>
 +
possibilty to choose miRNA scaffold</br>
 +
experimental evaluation</br>
 +
</br></br></br>
 +
<h1>Modeling</h1>
 +
</br>
 +
<p>We decided to pay more attention to model sh-miR molecules with different RNA 2D structure prediction software (we use RNAfold in our software). Here are our results (however we only show modeling of one molecule the conclusions are obvious - we performed folding for over 10 molecules):</p>
 +
</br></br>
 +
example analyzed sequence:
 +
</br>CTAAAGAAGGTATATTGCTGTTGACAGTGAGCGACTGUUUGUAUUCGCCCUAGCGCCTGTGAAGCCACAGATGGGGCGCUAUGGCGAAUACAAACATGCC</br>TACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCA</br>
 +
We always take first generated structure made with default options</br>
 +
If there is difference in algorithm we always take RNA folding over DNA folding</br>
 +
mfold</br>
 +
<img src="https://static.igem.org/mediawiki/2014/2/20/Mfold.png" width="60%">
 +
</br>
 +
RNAstructure</br>
 +
<img src="https://static.igem.org/mediawiki/2014/2/22/RNAstructure.jpeg" width="60%">
 +
</br>
 +
RNAfold</br>
 +
<img src="https://static.igem.org/mediawiki/2014/6/61/Rnafold.png" width="60%">
 +
</br>
 +
</br>
 +
<img src="" width="60%">
 +
</br>
 +
</br>
 +
<img src="" width="60%">
 +
</br>
 +
</br>
 +
<img src="" width="60%">
 +
</br>
 +
<h3>Conclusions</h3>
 +
</br>
 +
Different algorithms gives very different results. To have the most reliable structure it recommended to check the structure</br>
 +
with different software.</br>
 +
</br>
 +
<div class="footer">
 +
<br>
 +
<hr>
 +
<a href="https://igem.org/"><img src="https://static.igem.org/mediawiki/igem.org/6/60/Igemlogo_300px.png" width="55px"></a>
 +
<a href="https://github.com/igemsoftware/AMU-Poznan2013"><img src="https://assets-cdn.github.com/images/modules/logos_page/GitHub-Mark.png"  width="55px"></a>
 +
<a href="http://international.amu.edu.pl/"><img src="http://siw.amu.edu.pl/__data/assets/file/0005/162752/logo_wersja-uzupeniajca_czarny_2.jpg"  width="55px"></a>
 +
<br>
 +
</div>
 +
</td>
 +
<td  bgColor="#FFFFFF"></td>
 +
</tr>
 +
</table>
 +
</table>
-
<td></td>
+
</body>
-
<td></td>
+
-
</tr>
+
-
</table>
 
</html>
</html>

Latest revision as of 21:02, 16 October 2014