Team:NEAU-Harbin/protocols.html

• Notebook
• Protocols
• Parts

1.PCR amplification

① PCR amplification of amilCP (BBa_K592009)
Primers:
Sense: GGGCCCATGAGTGTGATCGCTAAACAAAT
Antisense: GGTACCAAGCTTAGGCGACCACAGGTTTG
Reaction system:

PCR condition:

② PCR amplification of cjBlue (BBa_K592011)
Primers:
Sense: GAATTCGGTAGCGGCTCCGGAAGCGGTTCCGGCAGCatggcttccaaaataagcg
Antisense: GGTACCAAGCTTAGGCGACCACAGGTTTG
Reaction system:

PCR condition

③ PCR amplification of GlaA3
Primers:
Sense: AGATCT ACAATCAATCCATTTCGCTATAG
Antisense: TCTAGA CATAAGGCGGGTTCACATC
Reaction system:

PCR condition:

④ PCR amplification of eGFP
Primers:
Sense:GAATTCGGTAGCGGCTCCGGAAGCGGTTCCGGCAGCATGGTGAGCAAGGGCGAG
Antisense: GGATCCTTAGGACTTGTACAGCTCGTCC
Reaction system:

PCR condition:

2.Purification of PCR product

After separation on 0.9% agarose gel, the PCR product was purified using Qiagen Purification Kit.
① Dissolve the gel-slice in 3 volumes of chaotropic agent at 50 °C for 10 minutes.
② Apply the solution to a spin-column and spin for 1 minute (the DNA remains in the column).
③ Wash the column by passing 70% ethanol through (the DNA remains in the column, salt and impurities are washed out).
④ Elute the DNA in a small volume (30 µL) of water or buffer, spin to collect.

3.DNA Ligation

4.Transformation of E. coli

① Prepare LB Agar plates, autoclave, cool agar to 42 ºC, add antibiotics (ampicillin (100 mg/L) and kanamycin (100 mg/L)), pour liquid agar into 4 plates, and let agar harden for 1-2 hours.
② Thaw competent cells (DH5α) slowly on ice.
③ Add 50 µL competent cells (DH5α) and 1 µL plasmid into sterile eppendorf tube and incubate on ice for 30 min.
④ Place cells in water bath and rapidly raise temperature to 42 °C for 90 seconds (water bath), and cool cells on ice for 2 min immediately.
⑤ Add the transformation mixture into 800 μL LB broth in sterile culture tube, grow cells with shaking (200 rpm) for 1 hour at 37 °C.
⑥ Spread 100 µL of cells onto LB agar plate (previously prepared and containing ampicillin and kanamycin) and let cells grow 24 hours at 37 °C.

5.Plasmid Extraction

DNA Plasmid Miniprep Protocol
① Pick single colony and inoculate 5 ml of LB broth containing 200 g/l ampicillin or 1mg/5ml. Optional: Use a 15ml conical tube with a loosened cap and a piece of tape to hold it in place. Shake at 250 RPM 37 °C overnight.
② Centrifuge 1.5 mL cells in 1.5 mL Eppendorf tube at top speed for 1 minute. Aspirate supernatant.
③ Resuspend cell pellet in 100 µL of GTE buffer (50 mM Glucose, 25 mM Tris-Cl, 10 mM EDTA, pH 8). Vortex gently if necessary.
④ Add 200 µL of NaOH/SDS lysis solution (0.2 M NaOH, 1% SDS). Invert tube 6-8 times.
⑤ IMMEDIATELY add 150 µL of 5 M potassium acetate solution (pH 4.8). This solution neutralizes NaOH in the previous lysis step while precipitating the genomic DNA and SDS in an insoluble white, rubbery precipitate. Spin at top speed 1 min.
⑥ Transfer supernatant to new tube, being careful not to pick up any white flakes. Precipitate the nucleic acids with 0.5 mL of isopropanol on ice for 10 minutes and centrifuge at top speed for 1 minute.
⑦ Aspirate off all the isopropanol supernatant. Dissolve the pellet in 0.4 ml of TE buffer (10 mM Tris-Cl, 1 mM EDTA, pH 7.5). Add 10 µL of RNAse A solution (20 mg/ml stock stored at -20 °C), vortex and incubate at 37 °C for 20 to 30 minutes to digest remaining RNA.
⑧ Extract proteins from the plasmid DNA using PCIA (phenol/chloroform/isoamyl alcohol) by adding about 0.3 ml. Vortex vigorously for 30 seconds. Centrifuge at full speed for 5 minutes at room temperature. Note organic PCIA layer will be at the bottom of the tube.
⑨ Remove upper aqueous layer containing the plasmid DNA carefully avoiding the white precipitated protein layer above the PCIA layer, transferring to a clean 1.5 ml epindorf tube. Add 100 ml of 7.5 M ammonium acetate solution and 1 ml of absolute ethanol to precipitate the plasmid DNA on ice for 10 minutes. Centrifuge at full speed for 5 minutes at room temperature.
⑩ Aspirate off ethanol solution and resuspend or dissolve DNA pellet in 50 µL of DNA. Dissolve 5 µL in 995 µL of water, and spec (blank spectrophotometer to water). The absorbance at 260 nm multiplied by ten is the concentration of the DNA in units of mg/ml for a 1 cm pathlength cuvette (i.e. 50 mg/ml/OD 260nm).

6.Preparation of Agrobacterium competent cells

① Inoculate 5 ml YEB containing Rifampicin (50 mg/L) with a single colony of Agrobacterium (AGL) from a plate streaked out from a glycerol stock. Grow at 28 °C with shaking for about 1-2 days.
② The evening before preparing competent cells, use 300 µL of the preculture to inoculate 300 ml YEB containing 50 mg/L Rifampicin. Grow at 28 °C with shaking to an OD600 of 0.7-0.8.
③ Chill cells on wet ice for 30 min. Then distribute cell suspension into 50 ml Falcon tubes on ice. Centrifuge for 10 min at 3000 rpm in centrifuge cooled to 4 °C. Decant the supernatant.
④ First wash with CaCl2 (20 mM). Add about 5 ml ice-cold 20 mM CaCl2 to each tube and resuspend cells by gentle vortexing. Centrifuge and decant supernatant as in step3.
⑤ Second wash with CaCl2 (20 mM).
⑥ Wash with 10% glycerol. Add about 5 ml ice-cold 10% glycerol to the tube and resuspend cells by gentle vortexing. Add ice-cold 10% glycerol to the tube to total volume of 20 ml, up and down several times. Centrifuge as in step 3. Carefully remove as much of the supernatant as possible by pepetting. Resuspend cell pellet in a total of 1.5 ml ice-cold 10% glycerol by vortexing.
⑦ Dispense 45 µL aliquots of the cell suspension into chilled 0.5 ml tubes and freeze in liquid nitrogen. Store at -80 °C.

7.Transformation of Agrobacterium by freeze-thaw method

① Add 1.0 μL recombinant plasmid DNA into 50 μL Agrobacterium competent cells, mixed gently, and incubate on ice for 5 min.
② Place the mixture into liquid nitrogen for 8 min and put it into 37 °C water bath immediately.
③ Add the transformation mixture into 800 μL YEB liquid in sterile culture tube, grow cells with shaking (200 rpm) for 5 hours at 28 °C.
④ Spread 100 µL of cells onto YEB agar plate (previously prepared and containing Rifampicin (50 mg/L) and Kanamycin (100 mg/L)) and let cells grow 2-3 days at 28 °C.

8.Transformation of A. Niger mediated by Agrobacterium

①Positive transformants were inoculated to liquid YEB medium containing Rifampicin (50 mg/L) and Kanamycin (100 mg/L) and shaking cultured at 28 °C 200 rpm overnight.
② Fresh Agrobacterium solution was inoculated into YEB lipid medium (containing Rifampicin 50 mg/L) at the ratio of 1:10 and cultured at 28°C with shaking to an OD600 of 0.8 -1.0.
③ 200 μL of Aspergillus Niger strain cultured in liquid PDA medium for 4 d and 100 μL Agrobacterium solution were mixed in 1.5 mL EP tubes, and the mixture was centrifuged at 2400×g for 5 min.
④ Discard the supernatant, and the residues of A. niger and Agrobacterium were resuspended by 100 μL liquid PDA medium and mixed well.
⑤ The mixture was coated on cellophane which was laid on solid PDA medium (containing Acetosyringone, AS, 200 μM) and cultured at 28 °C for 2-3 d.

9.Screening of A. niger transformants

① Cellophane laid on PDA co-culture medium was transferred to solid PDA screening medium which contained Hygromycin B (200 mM) and Cefotaxime Sodium (500 mM) and cultured at 32 °C for more than a week untill a significant growth of resistant colonies can be observed clearly.
② Resistant colonies were inoculated to 20 mL liquid PDA medium containing Hygromycin B (200 mM) for secondary screening.
③ Genomic DNA of Aspergillus niger mycelium after two times screening was extracted (Method was based on RESEARCH OF PEPA GENE FROM ASPERGILLUS USAMII EXPRESSION IN ASPERGILLUS NIGER, Shuoran Li, 2012), and PCR method was used to screen the positive transformants.