Team:Paris Bettencourt/Notebook/TMAU

June

June 24th

oPB.010 received
oPB.010
tmm Fw for BioBrick vector
TATAGAATTCGCGGCCGCTTCTAGAGCTGACAGCTAGCTCAGTCCTAG

June 29th

Goal: to PCR ilvBN gene from MG1655

Procedure:
1. Picked 2 colonies from the plate MG1655 115+GFP
2. inoculate them each in 50 ul of NF H2O
3. Boiled for 3 mins at 98 degree
4. use the solution as DNA template
5. follow standard PCR protocol from this step on

Reagent Volume 1x
Nuclease-free water 63 ul
5x Phusion HF Buffer 20 ul
10 mM dNTPs 2 ul
Forward Primer (10 uM) 5 ul
Reverse Primer (10 uM) 5 ul
Genomic DNA template 1 ul
DMSO 3 ul
Phusion DNA Polymerase 1 ul
Total Volume 100 ul

Thermocycler protocol: NEB Phusion
Temp Time
Start 98 ° C 30 sec Melt

35 Cycles
Cycle 1 98 ° C 10 sec Melt
Cycle 2 52 ° C 30 sec Anneal
Cycle 3 72 ° C 2 minutes Extend

Finish 72 ° C 5 min Extend
Blind 10 ° C Forever
Blind

outcome:

bands seen at expected length.

July

July 3rd

We made a PCR of our tmm gBlock using this protocol:

We used this thermocycle:

After gel migration, we got this:

The PCR worked.

Miniprep using Thermo scientific kits in order to concentrate pSB1C3 1- Resuspend the pelleted cells in 250 μL of the Resuspension Solution. Transfer the cell suspension to a microcentrifuge tube. The bacteria should be resuspended completely by vortexing or pipetting up and down until no cell clumps remain.
Note: Ensure RNase A has been added to the Resuspension Solution (as described on p.3)
2- Add 250 μL of the Lysis Solution and mix thoroughly by inverting the tube 4-6 times until the solution becomes viscous and slightly clear.
Note:. Do not vortex to avoid shearing of chromosomal DNA. Do not incubate for more than 5min to avoid denaturation of supercoiled plasmid DNA.
3- Add 350 μL of the Neutralization Solution and mix immediately and thoroughly by inverting the tube 4-6 times.
Note: It is important to mix thoroughly and gently after the addition of the Neutralization Solution to avoid localized precipitation of bacterial cell debris.The neutralized bacterial lysate should become cloudy.
4- Centrifuge for 5 min to pellet cell debris and chromosomal DNA.
5- Transfer the supernatant to the supplied GeneJET spin column by decanting or pipetting. Avoid disturbing or transferring the white precipitate.
Note. Close the bag with GeneJET Spin Columns tightly after each use!
6- Centrifuge for 1 min. Discard the flow-through and place the column back into the same collection tube.
Note: Do not add bleach to the flow-through, see p.7 for Safety Information.
7- Add 500 μL of the Wash Solution (diluted with ethanol prior to first use as described on p.3) to the GeneJET spin column. Centrifuge for 30-60 seconds and discard the flow-through. Place the column back into the same collection tube.
8- Repeat the wash procedure (step 7) using 500 μL of the Wash Solution.
9- Discard the flow-through and centrifuge for an additional 1 min to remove residual. Wash Solution. This step is essential to avoid residual ethanol in plasmid preps.
10- Transfer the GeneJET spin column into a fresh 1.5 mL microcentrifuge tube (not included). Add 50 μL of the Elution Buffer to the center of GeneJET spin column membrane to elute the plasmid DNA. Take care not to contact the membrane with the pipette tip. Incubate for 2 min at room temperature and centrifuge for 2 min. (HERE I USED 30 uL OF HOT WATER).
Note: An additional elution step (optional) with Elution Buffer or water will recover residual DNA from the membrane and increase the overall yield by10-20%. For elution of plasmids or cosmids >20 kb, prewarm Elution Buffer to 70°C before applying to silica membrane.
11- Discard the column and store the purified plasmid DNA at -20°C.

Digestion using EcoR1 and Pst1

Extracted plasmids from miniprep 22 uL 30uL
FD Buffer 5uL 5uL
Pst1 2.5uL 2.5uL
EcoR1 2.5uL 2.5uL
NF Water 18uL 10uL

Incubation for 5min 37°C and 2 hours at room temperature.

Ligation of gBlock into Vector

PCR product: tmm gBlock with oPB.010 and oPB.012
Vector: pSB1C3 linearized

Concentration:
-digested PSB1C3: 4.6ng/uL
-digested tmm: 13.7ng/uL

Cohesive Ends
5X Ligase Reaction Buffer 4 μl

Insert: Vector Molar Ratio 3:1

Vector Ends 5ul

Insert Ends 5ul

Total DNA 0.092ug(0.01-0.1 μg)

T4 DNA Ligase 0.1 unit

Autoclaved distilled water to 20 μl

Incubate at 24°C for O/N.

Note: For optimal transformation, dilute the ligation reaction ≥ 5-fold, to at least 100 μl, before adding to competent cells

July 5th

Transformation of the part.

Strain: E.coli MG1655
plasmid: pPB.011

Heat Shock Transformation of E. coli

This protocol can be used to transform chemically competent (i.e. from CaCl2) with a miniprepped plasmid or a ligation product.

Note: Never vortex competent cells. Mix cells by gentle shaking.

Thaw competent cells on ice. These can be prepared using the CaCl2 protocol.
Place 20 ul of cells in a pre-chilled Eppendorf tube.
For a Ligation Product: Add 2-3 ul to the chilled cells.
Mix gently by flicking the tube.
Chill on ice for 10 minutes. This step is optional, but can improve yields when transforming a ligation product.
Heat shock at 42 °C for 30 seconds.
Return to ice for 2 minutes.
Add 200 ul LB medium and recover the cells by shaking at 37 °C.
Chloramphenicol: 60-120 minutes
Plate out the cells on selective LB.
Use glass beads to spread the cells.
The volume of cells plated depends on what is being transformed.
For a Ligation Product: Lower transformation efficiencies are expected. Therefore you can plate the entire 200 ul volume of recovered cells.
Note: 200 ul is the maximum volume of liquid that an LB plate can absorb.
Incubate at 37 °C. Transformants should appear within 12 hrs.

No colonies after 24h, this might be due to the low concentration of reagents

July 12th

We transformed NEB and MG1655 with our ligation product according to this protocol

We finally had no colonies.

July 10th

1) Mini prep to extract plasmids (Qiagen)

I used this protocol. I made 2 tubes and got 163.2 and 242 ng/uL as concentrations.

2) Digestion of miniprep product with EcoR1 & Pst1

3) Gel migration

I had the digested pSB1C3 run on a gel using 0.5X TBE (2H-50V). We clearly saw a band at 2kb corresponding to pSB1C3. I cut the gel and stored it at 4°C.

July 11th

1) Gel purification of digested pSB1C3

I used this protocol

Result: I got concentrations of 59.6 and 55.1 ng/uL.

2) Ligation of digested tmm and digested pSB1C3

I used NEBiocalculator to calculate the mass of insert and vector I had to put (Insert length: 1488 bp, Vector length: 2037 bp, Vector DNA mass: 0,3 ug, Ratio insert:vector: 2:1). I need to put 450ng of insert and 300 ng of vector.

I incubated overnight at room temperature

July 14th

July 15th

1) Gel extraction of pSB1C3 digested plasmid

I used this protocol. I finally got 2 tubes with 13.9 and 19.8ng/uL concentrations.

2) PCR purification

I purified the PCR product of July 14th using this protocol.

3) Ligation of tmm PCR product and pSB1C3

I used NEBiocalculator to to calculate the needed amount of insert and vector with the values:

• Insert length: 1488 bp
• Vector length: 2037 bp
• Vector DNA mass: 50 ng
• Ratio insert: I made 1 ligation of ratio 1:1, 2:1 and 3:1 (insert:vector).

I made the ligation with the 13.9 ng/uL concentrated insert tube. I used this protocol:

I incubated the tubes at 24°C for 30min.

4) Transformation into NEB and MG1655

I used the Heat Shock transformation protocol to transform NEB and MG1655 with each one of the ligation products with ratios 1:1, 2:1 and 3:1 (I got 6 plates).

July 16th

1) Results of the transformations

We got no colonies in MG1655, big and small colonies for 1:1 and 2:1 ratios and only big colonies with 3:1 ratios. I prepared 5 liquid cultures in LB+Chloramphenicol: 1 for each type of colony for 1:1 and 2:1 ratios, and 1 for big colonies for 3:1 ratio. I incubated them at 37°C.

2) PCR colony

To check if the colonies developped in my plates have tmm gene, I made a PCR with this protocol and I ran a gel. I got nothing on it. I will do miniprep and digestion on July 17th to identify tmm construct into pSB1C3.

July 17th

1) Miniprep using each liquid culture of NEB+tmm-pSB1C3

I used this protocol.

2) Digestion of the plasmids by EcoRI

Then I digested the miniprep product by EcoRI in order to get a linearised plasmid before running it on a gel.

I incubated the tubes at 37°C during 30min.

3) Gel

I ran on a gel each one of the tubes (small and big colonies from 1:1 and 2:1 ratios and big colony from 3:1 ratio). But the plasmids may have not been digested enough because I got many bands.

July 18th

I will try again to identify tmm gene in my transformed bacteria.

1) Digestion of plasmids with EcoRI and PstI.

This time I digested by EcoRI and PstI to be able to directly identify tmm gene on the gel. I nanodroped the miniprep product from 17th. We need 1ug of DNA for the digestion.

Digestion protocol:

1)Gel

I ran all the samples on a gel but I did not get the bands I expected. We have to try a new cloning.

July 22nd

I had prepared liquid cultures to be able to do minipreps.

1) Miniprep of liquid cultures to get pSB1C3

I used this protocol. The Nanodrop gave me a concentration of 317ng/uL.

2) Digestion of pSB1C3 and tmm PCR product by EcoRI and PstI.

• pSB1C3:
  

  Reagent	Volume
  Nuclease free water	25uL
  10X Fast Digest Buffer	5uL
  plasmid DNA	14uL
  EcoRI	2.5uL
  PstI	2.5uL
  Fast AP (phosphatase)	1uL
  TOTAL	40uL



• tmm PCR product
  

  Reagent	Volume
  Nuclease free water	27uL
  10X Fast Digest Buffer	5uL
  plasmid DNA	13uL
  EcoRI	2.5uL
  PstI	2.5uL
  TOTAL	50uL

3)Gel

For pSB1C3 we can see two bands corresponding to 900bp and 2000bp (backbone) fragments. I will be able to extract the 2000bp fragment. But I got nothing for tmm.

4)Gel extraction

July 29th

We need tmm PCR product to be able to do a new cloning.

1) PCR of tmm gBlock

We used this thermocycle:

2) Gel

No bands were visible, even for the ladder. I tried a new one and got a few tiny bands for tube 3, particularly at 1500bp. I tried a gel extraction using this protocol and got 4.7ng/uL (unusable). I tried otherwise:

3) PCR purification

I puridied tube 3 according to this protocol and got a concentration of 11ng/uL which was not enough to do a digestion.

4) New PCR

We used this thermocycle:

3) PCR purification

I puridied tube 3 according to this protocol.

August

August 1st

1)Digestion of purified PCR product

I incubated the digestion at 37°C during 1h.

2) Purification of digested tmm

I used this protocol and got a really low concentration, unusable for ligation.

3) New PCR

I prepared 4 tubes according to this protocol:

We used this thermocycle:

4) Gel

Nothing was visible on the gel.

5) New PCR

We used this thermocycle:

6) Gel

There was a diffused band next to 200bp. Maybe there is a problem of specificity of the primers. We will try a PCR with the very first protocol which worked.

August 5th

1) PCR of tmm gBlock

We used this thermocycle:

August 6th

We think that that the reverse primer (oPB012) might have a strong secondary structure and that it may prevent the PCR to work as expected. We designed modified versions of oPB010 and oPB012 respectively called oPB056 and oPB057, shorter then the first ones. We removed the first restriction site at each end making sure the other enzyme would still have enough nucleotides to bind. We also shortened the bind part to have a melting temperature around 52°C.

Note:The digestion should now use XbaI and SpeI as EcorI and PstI were removed from the PCR product.

August 13th

We received our new primers (oPB.056 and oPB.057).

1) New PCR with different combinations or primers

We used this protocol:

We used this thermocycle:

August 14th

After having ran the PCR product on a gel, only one PCR seemed to have worked and the yield was very low. We made a new PCR with the same protocol except a longer elongation time (2min) and it worked: after purification, we got a concentration of 584ng/uL.

We also digested tmm PCR product, pSB1C3 and pSEVA351 before doing a ligation:

August 18th

The digestion products were purified and we got these concentrations: 84.1ng/uL for digested tmm, 41.1ng/uL for digested pSEVA351 and 28.6ng/uL digested pSB1C3.

The amounts of vector and insert were calculated thanks to NEBiocalculator with a insert:vector ratio of 2:1

The tubes were incubated at 22°C for 1H and overnight at 16°C.

August 21st

E.coli competent cells (NEB turbo) were transformed with tmm+pSEVA351 and tmm+pSB1C3 ligation products using the Heat Shock transformation protocol. On August 22nd we got 4 colonies of NEB transformed with tmm+pSB1C3.

August 25th

A colony PCR was done with 2 different colonies but the result was not convincing.

August 27th

Miniprep and digestion were done using liquid culture of the 2 colonies.

On the gel we can see a band at 1.5kb for colony 1 but not for colony 2. The cloning seems to have worked.

September

September 1st

tmm also has to be cloned using pSEVA351 so that we can transform into C.striatum.

E.coli was transformed using tmm+pSEVA351 ligation product from August 18th with electroporation. It did not work on the first time.

September 3rd

A new ligation of tmm and pSEVA351 was done:

The tube was incubated 1H at 22°C and overnight at 4°C.

September 4th

A new electroporation was done with the same protocol.Some colonies developped. Two of them were transfered in LB+Chlormaphenicol and two glycerol stocks were made with the strains called sPB.054 and sPB.055.

Text

Text

Date 2

Text

Text

October

October 8th

TMM activity was found in E.coli pSB1C3-TMM (tmm+) but not in E.coli pSB1C3 (tmm-). TMM does not only degrade trimethylamine into trimethylamine-N-oxide, but also converts indole into indigo. To measure the activity of TMM, the growth medium was supplemented with tryptophan, a precursor of indole, which is the substrate of TMM. After 14h of culture, cells were pelleted, washed with water twice, and then resuspended in DMSO and sonicated. TMM activity was determined by measuring the absorbance spectrum of bacterial extractions. Peaks at 620 nm were found in tmm+ cultures supplemented with tryptophan, which was identified as indigo according absorbance spectrum analysis.

Details: we made a overnight preculture of 2 strains (sPB.026: control and sPB.091: pSB1C3+tmm) in LB+Cm. Then, the cells were resuspended and diluted in 3 tubes of each to get a OD600 of 0.2 (beginning of the exponential phase). The resuspension solution was LB or LB supplemented with tryptophane (2g/L): 3 tubes +tmm +TRP, 3 tubes -tmm +TRP, 3 tubes +tmm -TRP and 3 tubes -tmm -TRP. After 14h of culture at 37°C, the cells were washed twice (centrifugation 4000g 10min and resuspension in 10mL of water) and resuspended in 1mL DMSO. After having sonicated the cells, the solution was centrifuged (4000g 10min) and the supernatant was transfered into cuvettes to measure the absorbance spectrum.

Text

Date 2

Text

Text