"
Team:USyd-Australia/Notebook/Primers
From 2014.igem.org
(Difference between revisions)
| Line 13: | Line 13: | ||
<center> | <center> | ||
{|class="wikitable" | {|class="wikitable" | ||
| - | ! Name !! Sequence !! Theoretical Tm !! Purpose | + | ! Name !! Sequence (5'-3') !! Theoretical Tm !! Purpose |
|- | |- | ||
|iGEM16 || GAGTGCCACCTGACGTCTAAGAAACC || 60.9C || For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM [http://parts.igem.org/Part:BBa_G00100 VF2] primer | |iGEM16 || GAGTGCCACCTGACGTCTAAGAAACC || 60.9C || For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM [http://parts.igem.org/Part:BBa_G00100 VF2] primer | ||
| Line 31: | Line 31: | ||
|iGEM1406 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | |iGEM1406 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
|- | |- | ||
| - | |iGEM1407 || | + | |iGEM1407 || CTATATCTATGATCTCGCAGTCTCC || 53.8C || PCR primers over the junction between aacC1 (G block) and pSB1C3 vector, for validation of successful G block insertion by PCR screening |
|- | |- | ||
| - | |iGEM1408 || | + | |iGEM1408 || GCCTTTTGCTCACATGTTCTTTC || 55.2C || PCR primers over the junction between aacC1 (G block) and pSB1C3 vector, for validation of successful G block insertion by PCR screening |
|- | |- | ||
| - | |iGEM1409 || | + | |iGEM1409 || GTTTTTTTGGATGGAGTGAAACGATGGCGATTG || 61.7C || Amplification of iGEM-IntI1 gBlock forward primer |
|- | |- | ||
| - | |iGEM1410 || | + | |iGEM1410 || TGACACCTTGCCCTTTTTTGCCG || 60.9C || Amplification of iGEM-IntI1 gBlock reverse primer |
|- | |- | ||
|iGEM1411 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | |iGEM1411 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
Revision as of 02:10, 3 October 2014
 |
Primers |
| Name | Sequence (5'-3') | Theoretical Tm | Purpose |
|---|---|---|---|
| iGEM16 | GAGTGCCACCTGACGTCTAAGAAACC | 60.9C | For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM [http://parts.igem.org/Part:BBa_G00100 VF2] primer |
| iGEM25 | CCCTGATTCTGTGGATAACCGTATTACCG | 60.0C | For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM [http://parts.igem.org/Part:BBa_G00101 VR] primer |
| iGEM1401 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1402 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1403 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1404 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1405 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1406 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1407 | CTATATCTATGATCTCGCAGTCTCC | 53.8C | PCR primers over the junction between aacC1 (G block) and pSB1C3 vector, for validation of successful G block insertion by PCR screening |
| iGEM1408 | GCCTTTTGCTCACATGTTCTTTC | 55.2C | PCR primers over the junction between aacC1 (G block) and pSB1C3 vector, for validation of successful G block insertion by PCR screening |
| iGEM1409 | GTTTTTTTGGATGGAGTGAAACGATGGCGATTG | 61.7C | Amplification of iGEM-IntI1 gBlock forward primer |
| iGEM1410 | TGACACCTTGCCCTTTTTTGCCG | 60.9C | Amplification of iGEM-IntI1 gBlock reverse primer |
| iGEM1411 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1412 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1413 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1414 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1415 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1416 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1417 | AAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAG | 67.6C | Linearisation of pSB1C3, containing full BioBrick prefix and suffix |
| iGEM1418 | AAACTCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGC | 66.9C | Linearisation of pSB1C3, containing full BioBrick prefix and suffix |
| iGEM1419 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1420 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1421 | GGGAATTCAAATCTAGAGACACCATCG | 57.1C | Amplification of LacI-Plac-AttI gBlock forward primer |
| iGEM1422 | CCTGCAGTTTACTAGTTTTGCCTAACTTTGTTTTAG | 59.4C | Amplification of LacI-Plac-AttI gBlock forward primer |
| iGEM1423 | CAGGCTTTACACTTTATGCTTCCG | 56.3C | lacI-Plac-attI RHJ-F right hand junction forward primer (use with iGEM25) |
| iGEM1424 | AATGTAATTCAGCTCCGCCATC | 55.5C | lacI-Plac-attI LHJ-R left hand junction reverse primer (use with iGEM16) |
| iGEM1425 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1426 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1427 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
| iGEM1428 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx |
With thanks to:
