Team:USyd-Australia/Notebook/Primers
From 2014.igem.org
(Difference between revisions)
(Created page with "{{Team:USyd-Australia/Template:Style}} {{:Team:USyd-Australia/Template:Banner}} <html> <table> <tr><td> <h2>Primers</h2></td></tr> </tr> </table> </html> {{Team:USyd-Austral...") |
|||
Line 7: | Line 7: | ||
<tr><td> <h2>Primers</h2></td></tr> | <tr><td> <h2>Primers</h2></td></tr> | ||
</tr> | </tr> | ||
- | |||
- | |||
</table> | </table> | ||
</html> | </html> | ||
+ | |||
+ | |||
+ | <center> | ||
+ | {|class="wikitable" | ||
+ | ! Name !! Sequence !! Theoretical Tm !! Purpose | ||
+ | |- | ||
+ | |iGEM16 || GAGTGCCACCTGACGTCTAAGAAACC || 60.9C || For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM VF2 primer | ||
+ | |- | ||
+ | |iGEM25 || CCCTGATTCTGTGGATAACCGTATTACCG || 60.0C || For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM VR primer | ||
+ | |- | ||
+ | |iGEM1401 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1402 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1403 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1404 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1405 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1406 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1407 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1408 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1409 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1410 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1411 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1412 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1413 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1414 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1415 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1416 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1417 || AAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAG || 67.6C || Linearisation of pSB1C3, containing full BioBrick prefix and suffix | ||
+ | |- | ||
+ | |iGEM1418 || AAACTCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGC || 66.9C || Linearisation of pSB1C3, containing full BioBrick prefix and suffix | ||
+ | |- | ||
+ | |iGEM1419 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1420 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1421 || GGGAATTCAAATCTAGAGACACCATCG || 57.1C || Amplification of LacI-Plac-AttI gBlock forward primer | ||
+ | |- | ||
+ | |iGEM1422 || CCTGCAGTTTACTAGTTTTGCCTAACTTTGTTTTAG || 59.4C || Amplification of LacI-Plac-AttI gBlock forward primer | ||
+ | |- | ||
+ | |iGEM1423 || CAGGCTTTACACTTTATGCTTCCG || 56.3C || lacI-Plac-attI RHJ-F right hand junction forward primer (use with iGEM25) | ||
+ | |- | ||
+ | |iGEM1424 || AATGTAATTCAGCTCCGCCATC|| 55.5C || lacI-Plac-attI LHJ-R left hand junction reverse primer (use with iGEM16) | ||
+ | |- | ||
+ | |iGEM1425 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1426 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1427 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |- | ||
+ | |iGEM1428 || xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx || | ||
+ | |} | ||
+ | </center> | ||
{{Team:USyd-Australia/Footer}} | {{Team:USyd-Australia/Footer}} |
Revision as of 09:09, 2 October 2014
Primers |
Name | Sequence | Theoretical Tm | Purpose |
---|---|---|---|
iGEM16 | GAGTGCCACCTGACGTCTAAGAAACC | 60.9C | For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM VF2 primer |
iGEM25 | CCCTGATTCTGTGGATAACCGTATTACCG | 60.0C | For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM VR primer |
iGEM1401 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1402 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1403 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1404 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1405 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1406 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1407 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1408 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1409 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1410 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1411 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1412 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1413 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1414 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1415 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1416 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1417 | AAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAG | 67.6C | Linearisation of pSB1C3, containing full BioBrick prefix and suffix |
iGEM1418 | AAACTCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGC | 66.9C | Linearisation of pSB1C3, containing full BioBrick prefix and suffix |
iGEM1419 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1420 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1421 | GGGAATTCAAATCTAGAGACACCATCG | 57.1C | Amplification of LacI-Plac-AttI gBlock forward primer |
iGEM1422 | CCTGCAGTTTACTAGTTTTGCCTAACTTTGTTTTAG | 59.4C | Amplification of LacI-Plac-AttI gBlock forward primer |
iGEM1423 | CAGGCTTTACACTTTATGCTTCCG | 56.3C | lacI-Plac-attI RHJ-F right hand junction forward primer (use with iGEM25) |
iGEM1424 | AATGTAATTCAGCTCCGCCATC | 55.5C | lacI-Plac-attI LHJ-R left hand junction reverse primer (use with iGEM16) |
iGEM1425 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1426 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1427 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1428 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx |