Wiki/Notebook wetlab.html

From 2014.igem.org

(Difference between revisions)

Revision as of 21:46, 1 August 2014

Contents:

	 Biosynthesis
	 Trichome promoter
	 Switch

Biosynthesis

06/09/2014

The enzymes involved in the biosynthesis pathways are AtrΔ11, HarFAR, FAO1, EaDAcT.

The design of the GBlocks was performed taking into account the following considerations:

Codon optimization
Inner restriction sites eliminations by finding synonymous mutations
Addition of GB endings

06/10/2014

Codes for IDT known. MEGAGEM2014 - 25% off one order, up to $800

GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).

06/11/2014

We ordered the following gBlocks and primers.

EaDAcT: Eunymus alatus (adapted for GB) 1127 bp
HarFAR: Helicoverpa armigera (adapted for GB) 1400 bp
AtrΔ11: Amyelois transitella (order primers for GB) 1000 bp

I14Jun03 AtrΔ11 F1
I14Jun04 AtrΔ11 R1

FAO1: N.benthamiana primers

I14Jun01 FAO1 F1
I14Jun02 FAO1 R1

Name	Sequence	Lenght	Tm (NTI)	Tm (Phusion)
I14Jun01_FAO1_F1	cgccgtctcgctcgaatggagaaaaagagccatcc	35	49.9	62.4
I14Jun02_FAO1_R1	cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc	46	54.5	63.7
I14Jun03Atr_D11_F1	gcgccgtctcgctcgaatggttcctaataag	31	54.5	65.3
I14Jun04Atr_D11_R1	gcgccgtctcgctcgaagctcaacgtttc	29	57	69.1

06/24/2014

We thought which parts of the GB collection could we use.

Strategy 1:

pP35S, pT35s (x2)
pAtUbq10, pTAtHSP18.2

Strategy 2:

pP35S, pT35s
pP35s, pTAtHSP18.2
pAtUbq10, pTAtHSP18.2

Strategy 3:

pP35S, pT35s
pP35s, pTTctp
pAtUbq10, pTAtHSP18.2

Pieces to take from GB2.0 colection:

pDGB2α1	GB0483	Kan
pDGB2α2	GB0484	Kan
pP35s	GB0030	Amp
pT35s	GB0036	Amp
pAtUbq10	GB0223	Amp
pTAtHSP18.2	GB0035	Amp
pTTctp	GB0081	Amp
pUPD	GB0317	Amp

Later we will need:

pDGB2Ω1	GB0487	Smp
pDGB2Ω2	GB0488	Smp

Prepare plaques with antibiotics Kan, Spm, Amp

06/25/2014

Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).

06/26/2014

Culture in agar Petri dish. 2 plaques: Amp and Kan.

Minipreps with EZNA Plasmid DNA MiniKit I.

Expected digestions:

pP35s	GB0030	NotI	Buffer: Orange	2981, 1105
pT35s	GB0036	NotI	Buffer: Orange	2981, 304
pAtUbq10	GB0223	NotI	Buffer: Orange	2981, 714
pTAtHSP18.2	GB0035	NotI	Buffer: Orange	2981, 328
pTTctp	GB0081	NotI	Buffer: Orange	2981, 487

Electrophoresis analysis.

We got the expected bands in all cases.

01/07/2014

AtrΔ11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence.

We made a PCR amplification using the AtrΔ11 gene as a template and the oligos: R +F

Reagents needed:

32.5 μL of H2O miliQ
10 μL HF buffer
2 μL dNTPs
2.5 μL Reverse primer
2.5 μL Forward primer
1 μL template (AtrΔ11 gene)
0.5 μL phusion (polimerase)

PCR parameters: The annealing temperature was 60ºC and the extension temperature was 65ºC.

Electrophoresis performed to check the PCR product, which was expected to be around 1 kb.

pUPD ligation of EaDAcT, HarFar and AtrΔ11

Reagents needed for the reaction of ligation:

1 μL pUPD
1 μL PCR product/gblock product
1.2 μL buffer 10x
1 μL BsmBI
1 μL T4 ligase
6.8 μL H2O miliQ

Vfinal= 12 μL

Termocycler parameters: The ligase temperature was 16ºC and the BsmBI temperature was 37ºC.

As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and AtrΔ11.

07/02/2014

E. coli transformation

This step is performed in a laminar air flow cabinet (LAF).

We have used an electrocompetent E. coli strain (DH5α) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.

Reagents needed:

E. coli aliquot
1.5 μL of ligation in pUPD (for each gene: EaDAcT, HarFAR, AtrΔ11)

Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 μL of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.

After incubation, culture in Petri plates (always in a LAF).

2 cell-culture dishes per transformation (with Ampicillin), one with 50 μL and the other with the remaining volume.

Petri plates are incubated at 37ºC for 16 h.

07/03/2014

Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 μL Amp. This step is repeated three times:

3x 1 colony of EaDAcT in pUPD + LB + Amp
3x 1 colony of HarFAR in pUPD + LB + Amp
3x 1 colony of AtrΔ11 in pUPD + LB + Amp

All tubes are incubated at 37ºC overnight in agitation.

07/04/2014

Digestions in silico using Vector NTI to check after minipreps if ligations are correct.

EaDAcT	NotI	2981, 1167
	RsaI	1876, 1343, 532, 306, 91
HarFAR	NotI	2981, 1440
	PvuII	2564, 1394, 463
AtrΔ11	NotI	2981, 1056
	BanII	2570, 803, 351, 314

Digestion reagents:

0.5 μL restriction enzyme
2.5 μL buffer
21 μL H20 (miliQ)
1 μL sample

Preparation of master mixes

Master mix for NotI

5 μL NotI
25 μL Orange
210 μL H20

Master mix for RsaI

1.5 μL RsaI
7.5 μL Tango
63 μL H20

Master mix for PvuII

1.5 μL PvuII
7.5 μL Green
63 μL H20

Master mix for BanII

1.5 μL BanII
7.5 μL Tango
63 μL H20

Perform electrophoresis to check if the size of the fragments from the digestions is correct.

Comments:

We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.
For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.

07/06/2014

We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:

3.5 mL LB
7 μL Amp
7 μL X-Gal
3.5 μL IPTG (turns the tube blue if the colonies picked were blue)

07/07/2014

We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and AtrΔ11 2, 3.

Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.

EaDAcT	NotI	2981, 1167
	RsaI	1876, 1343, 532, 306, 91
HarFAR	NotI	2981, 1440
	PvuII	2564, 1394, 463
AtrΔ11	NotI	2981, 1056
	RsaI	1879, 1310, 467, 327, 54

Preparation of master mixes

Master mix for NotI

3.5 μL NotI
17.5 μL Orange
147 μL H20

Master mix for RsaI

2 μL RsaI
10 μL Tango
84 μL H20

Master mix for PvuII

2 μL PvuII
10 μL Green
84 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK. We sent AtrΔ11 (3), HarFAR (3) and EaDAcT (3) to sequence.

07/08/2014

Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.

The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an α or Ω vector.

Reagents needed for ligation:

1 μL promoter 75 ng/μL
1 μL terminator 75 ng/μL
1 μL CDS 75 ng/μL
1 μL vector α
1.2 μL ligase buffer 10x
1 μL T4
1 μL BsaI
4.2 μL H20

Total: 12 μL

Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different α vector.

Strategy Promoter-Terminator:

AtrΔ11	P35s	T35s	40.41
HarFAR	P35s	TatHSP	39.68
EaDAcT	PAtUbq	TatHSP	32.27

Adjust concentrations to 75 ng/μL for ligation reaction

Initial concentrations (nanodrop):

Piece	Concentrations	Volume	Volume of H20 to add
PAtUpb	442.6 ng/μL	34 μL	166.6 μL
pTatHSP	235.4 ng/μL	36 μL	77 μL
T35s	194.9 ng/μL	37.5 μL	60 μL
P35s	454.7 ng/μL	36 μL	182 μL
2α1	57.1 ng/μL	-	We will need to put 1.5 μL of this one
2α2	104.0 ng/μL	38 μL	14.7 μL
AtrΔ11	359.3 ng/μL	20 μL	75.8 μL
HarFAR	404.4 ng/μL	15 μL	65.9 μL
EaDAcT	155.6 ng/μL	10 μL	10.7 μL

Ligation reaction

P35s:AtrΔ11:T35s in 2α1

1 μL P35s
1 μL T35s
1 μL AtrΔ11
1.5 μL 2α1
1.2 μL ligase buffer 10x
1 μL T4
1 μL BsaI
3.7 μL H20

P35s:HarFAR:TatHSP in 2α2

1 μL P35s
1 μL TatHSP
1 μL HarFAR
1 μL 2α2
1.2 μL ligase buffer 10x
1 μL T4
1 μL BsaI
4.2 μL H20

PAtUbq:EaDAcT:TatHSP in 2α2

1 μL PAtUbq
1 μL TatHSP
1 μL EaDAcT
1 μL 2α2
1.2 μL ligase buffer 10x
1 μL T4
1 μL BsaI
4.2 μL H20

07/09/2014

Transformation of constructions in E. coli

We finally got the sequencing results from 07/07/2014.

Mutation in AtrΔ11 -> We threw away the colonies and transformed cells. We picked again white colonies.
HarFAR -> Sequencing correct
EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!

We took vectors 2Ω1 (GB0487) and 2Ω2 (GB0488) parts from the GB colection.

Worked in the LAF
Cultivated in a Petri dish with Spm
Let them grow for one day

Cultivate transformated cells in two Kan plaques (Kan matches vector α)

50 mL transformation in one plaque
Rest of the culture in another (250 μL aprox)
Let them grow for one day

07/10/2014

Pick colonies and grow them in liquid medium.

6 from AtrΔ11 (repetition because of mutation)

3.5 mL LB
7 μL Amp
7 μL X-gal
3.5 μL IPTG

1 colony from 2Ω1

3.5 mL LB
7 μL Spm

1 colony from 2Ω2

3.5 mL LB
7 μL Spm

3 colonies from P35s:HarFAR:TatHSP

3.5 mL LB
7 μL Kan

3 colonies from PAtUbq:EaDAcT:TatHSP

3.5 mL LB
7 μL Kan

Grow at 37ºC in agitation overnight.

We have checked the promoters and terminators are both compatible with GB and BioBricks.

Only P35s and T35s work for both. pPnos could also work.

Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.

07/11/2014

We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes AtrΔ11 3 and 6; 2Ω1; 2Ω2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.

Additionally, we have cultured each of the colonies named above to store them.

07/14/2014

We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.

Parts	Retriction enzyme	Expected Bands
PAtUbq:EaDAcT:TatHSP in 2α2	HindIII	6322, 1722, 736, 221
P35s:HarFAR:TatHSP in 2 α2	HindIII	6322, 1794, 221
AtrΔ11	NotI	2961, 1056
2Ω1	BamHI	6652, 382, 239
2Ω2	EcoRV	6652, 621

Preparation of master mixes

Master mix for HindIII

3.5 μL HindIII
17.5 μL Red
147 μL H20

Master mix for NotI

1.5 μL NotI
7.5 μL Orange
63 μL H20

Mix for EcoRV

0.5 μL EcoRV
2.5 μL Red
21 μL H20

Mix for BamHI

0.5 μL PvuII
2.5 μL Green
21 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK except the AtrΔ11 (3), which had some partial digestion. It was the reason we sent AtrΔ11 (6) to sequence.

07/15/2014

We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation.

Reagents needed for the reaction of ligation (Total volume = 12 μL):

P35s:AtrΔ11:T35s in 2α1

1 μL P35s
1 μL T35s
1 μL AtrΔ11
1.5 μL 2α1
1.2 μL ligase buffer 10x
1 μL T4
1 μL BsaI
3.7 μL H20

P35s:HarFAR:T35s in 2α2

1 μL P35s
1 μL T35s
1 μL HarFAR
1 μL 2α2
1.2 μL ligase buffer 10x
1 μL T4
1 μL BsaI
4.2 μL H20

P35s:EaDAcT:T35s in 2α2

1 μL P35s
1 μL T35s
1 μL EaDAcT
1 μL 2α2
1.2 μL ligase buffer 10x
1 μL T4
1 μL BsaI
4.2 μL H20

Note: Concentrations were previously adjusted to 75 ng/μL. Only the AtrΔ11 was adjusted from 250.2 ng/μL.

Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:

Amp

pAtrΔ11 (6)
pEaDAcT (3)
pHarFAR (3)

Kan

P35:HarFAR:TatHSP in 2α2 (3)
PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)

07/16/2014

Storage in glycerol of the HarFAR (GB1018), AtrΔ11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2α2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2α2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve.

The procedure is to mix 700 μL of culture with 300 μL of glycerol 50%, spin it and store it in the -80ºC.

07/17/2014

Pick 3 colonies of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.

Digestions in silico.

Transcriptional units	Restriction enzymes	Expected bands
P35s:AtrΔ11:T35s	EcoRI	6323, 2269
	NcoI	390, 8202
P35s:HarFAR:T35s	HindIII	933, 6322, 1722
	NcoI	8587, 390
P35s:EaDAcT:T35s	HindIII	6322, 2366
	EcoRV	683, 8021

Preparation of reagents needed for genomic extraction of Candida tropicalis for FAO1.

07/18/2014

Mistake in P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.

07/19/2014

Minipreps of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.

Transcriptional unit	DNA concentration (ng/μL)
P35s:AtrΔ11:T35s (1)	164 ng/μL
P35s:AtrΔ11:T35s (2)	168 ng/μL
P35s:AtrΔ11:T35s (3)	147.4 ng/μL
P35s:HarFAR:T35s (1)	125.3 ng/μL
P35s:HarFAR:T35s (2)	114.5 ng/μL
P35s:HarFAR:T35s (3)	140.3 ng/μL
P35s:EaDAcT:T35s (1)	144.2 ng/μL
P35s:EaDAcT:T35s (2)	137.9 ng/μL
P35s:EaDAcT:T35s (3)	128.5 ng/μL
Stuffer fragment	135.5 ng/μL
2Ω1	196.8 ng/μL
2Ω2	175.4 ng/μL

Digestions of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.

All digestions were correct except P35s:EaDAcT:T35s (2).

Ligation in Ω vectors.

P35s:AtrΔ11:T35s + P35s:HarFAR:T35s in 2Ω1

1 μL P35s:AtrΔ11:T35s (75 ng/μL)
1 μL P35s:HarFAR:T35s (75 ng/μL)
1 μL 2Ω1 (75 ng/μL)
1 μL BsmBI (5-10 ud)
1 μL T4 ligase (5-10 ud)
1 μL buffer ligase (3 ud)
4 μL H20

P35s:EaDAcT:T35s in 2Ω2

1 μL stuffer fragment (75 ng/μL)
1 μL P35s:EaDAcT:T35s (75 ng/μL)
1 μL 2Ω2 (75 ng/μL)
1 μL BsmBI (5-10 ud)
1 μL T4 ligase (5-10 ud)
1 μL buffer ligase (3 ud)
4 μL H20

Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).

Omega vectors include a resistance to spectinomycin.

07/20/2014

Transform and grow in Petri dishes yesterday's ligations: P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 and P35S:EaDAcT:T35S in 2Ω2.

07/21/2014

Pick colonies of P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 (3) and P35S:EaDAcT:T35S in 2Ω2 (2).

07/22/2014

We made minipreps of yesterday's liquid culture. Selected tubes:

P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1(Tubes 1, 2 and 3)
P35S:EaDAcT:T35S in 2Ω2 (Tubes 1 and 2)

Additionally, we have cultured each of the colonies named above in order to store them.

Digestions in silico made to check the transcriptional units:

Transcriptional units	Restriction enzyme	Expected bands
P35S:AtrΔ11:T35S+P35S:HarFAR:T35S in 2Ω1	EcoRV	9307, 2251
	BamHI	6652, 4906
P35S:EaDAcT:T35S in 2Ω2	EcoRV	6652, 1044, 817, 683
	NcoI	8806, 390

Digestion master mixes:

Master mix for NotI

1.5 μL NotI
7.5 μL Orange buffer
63 μL H20

Master mix for NcoI

1.5 μL NcoI
7.5 μL Tango buffer
63 μL H20

Master mix for BamHI

2 μL BamHI
10 μL Green buffer
84 μL H20

Master mix for EcoRV

4 μL EcoRV
20 μL Red buffer
168 μL H20

Note: Trichome promoter digestion preparation included.

All digestions were correct except the transcriptional unit of EaDAcT in 2Ω2 (P35s:EaDAcT:T35S).

Miniprep quantification:

Piece	Tube	Concentration (ng/μL)	Volume (μL)
Trichome promoter in pUPD	1	317.1	26
Trichome promoter in pUPD	3	354.8	32
P35S:EaDAcT:T35S in 2Ω2	1	350.7	33
P35S:EaDAcT:T35S in 2Ω2	2	271.1	33
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	1	306.3	31
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	2	296.6	28
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	3	246.0	33

All of the pieces named above were adjusted at 75 ng/μL.

Piece	Tube number	Final Volume (μL)	Volume to be added (μL)
Trichome promoter in pUPD	1	109.93	83.93
Trichome promoter in pUPD	3	151.40	119.4
P35S:EaDAcT:T35S in 2Ω2	1	154.30	121.3
P35S:EaDAcT:T35S in 2Ω2	2	119.30	86.30
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	1	126.60	95.60
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	2	110.70	82.70
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1	3	108.24	75.20

As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step.

We transformed the same TU in a E. coli competent strain (DH5α). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight.

Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:

With Amp:

pTNos (GB0037)
pGFP (GB0059)
pLuciferase (GB0096)

With Kan:

P35S:Rosea:TNos
TA29:Barnase:TNos (GoldenBraid 1.0 piece)

Finally, in order to obtain the FAO1 gene, we want to extract the Candida tropicalis genome, so we have picked a colony of C. tropicalis. To check the extraction protocol, we used a yeast previously tested, Saccharomyces cerevisiae. We have cultured C. tropicalis in YPD media and S. cerevisiae in YPDA media at 28 ºC (5 mL).

07/23/2014

Candida genome extraction

Saccharomyces cerevisiae is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.

Cultures measured at 600 nm:

S. cerevisiae Abs = 1.07
C. tropicalis Abs = 0.39

S. cerevisiae is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of S. cerevisiae culture. The mix has to grow at 28 ºC until the exponential phase is reached.

The absorbance was measured again:

S. cerevisiae Abs = 0.52
C. tropicalis Abs = 0.40

Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:

Grow yeast in 2 or 5 mL YPD to exponential phase.
Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).
Wash once with 1 mL sterile water.
Resuspend cells in 200 μL protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 μL beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups.
Add 200 μL of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).
Incubate at 65 ºC for 20 min and cool inmediately on ice.
Add 200 μL of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice.
Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.
Add 2 μL RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.
Add 600 μL isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s).
Remove the supernatant and wash with 70% ethanol (10 min at room temperature).
Centrifuge (13,000 rpm, 30 s) and remove the supernatant.
Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 μL TE-buffer.
Store chromosomal DNA at 4 ºC (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).

Genomic quantification:

Organism	Concentration
S. cerevisiae	72.2 ng/μL
C. tropicalis	1397.1 ng/μL

Electrophoresis made to check the extraction quality was correct.

We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.

EaDAcT and collection pieces made yesterday were recultured in liquid media.

07/24/2014

The genomic quality of both organisms (C. tropicalis and S. cerevisiae) was checked in an agarose gel again.

We got the Candida genome band, however, the Saccharomyces genome band was not present.

Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate.

P35S:EaDAcT:T35S in 2Ω2 (tubes 1, 2, 3)
Collection pieces:

pTNos (GB0037)
pGFP (GB0059)
pLuciferase (GB0096)
P35:Rosea:TNos
TA29:Barnase:TNos

Miniprep checking is going to be done tomorrow.

07/25/2014

Digestions in silico made for checking yesterday's minipreps:

Pieces/TU	Restriction enzyme	Expected bands
P35S:EaDAcT:T35S	EcoRV	6652, 1044, 817, 683
	NcoI	8806, 390
pTNos	NotI	2981, 570
pGFP	NotI	2981, 795
pLuciferase	NotI	2981, 1731
P35S:Rosea:TNos	BglII	2495, 2302
	NcoI	4407, 390
TA29:Barnase:TNos	BglII	2825, 2245

Digestion master mixes:

Master mix for NotI

2 μL NotI
10 μL Orange buffer
84 μL H20

Master mix for NcoI

2 μL NcoI
10 μL Tango buffer
84 μL H20

Master mix for BglII

2 μL BglII
10 μL Orange buffer
84 μL H20

Master mix for EcoRV

1.5 μL EcoRV
7.5 μL Red buffer
63 μL H20

An agarose gel was made to check the transcriptional unit and the other pieces:

All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.

07/28/2014

Once the Candida tropicalis genome DNA is obtained, the FAO1 gene can be amplified by PCR.

PCR reaction reagents:

FAO1-PCR1

Genomic 0.5 μL
Buffer HF (5X) 10.0 μL
dNTPs 2.0 μL
Oligo R (JUL06) 2.5 μL
Oligo F (JUL05) 2.5 μL
Phusion polymerase 0.5 μL
H2O 32.0 μL

FAO1-PCR2

Genomic 0.5 μL
Buffer HF (5X) 10.0 μL
dNTPs 2.0 μL
Oligo R (JUL08) 2.5 μL
Oligo F (JUL07) 2.5 μL
Phusion polymerase 0.5 μL
H2O 32.0 μL

Annealing temperatures

FAO1-PCR1: 59 ºC
FAO1-PCR2: 64 ºC

PCR products were checked using an electrophoresis. Expected bands:

FAO1-PCR1: 1157 bp
FAO1-PCR2: 1015 bp

Both FAO1 PCR products were not correct.

As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:

Reagent	Volume
Trichome promoter	1 μL
GFP	1 μL
TNos	1 μL
BsaI	1 μL
p2α2	1 μL
T4 ligase	1 μL
Ligase buffer	1 μL
H2O	3 μL
Total Volume	10 μL

07/29/2014

As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:

Reagent	FAO1-PCR1	FAO1-PCR2
C. tropicalis genome	2.5 μL	2.5 μL
HF Buffer	30 μL	30 μL
dNTPs	10 μL	10 μL
Oligo R	12.5 μL	12.5 μL
Oligo F	12.5 μL	12.5 μL
Phusion polymerase	1.5 μL	1.5 μL
H2O	181 μL	181 μL

PCR temperatures, 25 cycles:

Step	Temperature (ºC)	Time
Initialization	98	2 min
Denaturation	98	20 s
Annealing	50, 55, 60, 65	??
Extension	72	45 s
Final elongation	72	7 min

We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product.

EaDAcT Transcriptional Unit (TU) transformation

Using an electrocompetent E. coli strain (DH5α) and 1.5 ul ligation (P35S:EaDAcT:T35S in 2Ω2), the mix is electroporated at 1500 V. Then, 300 μL of SOC are added and stored at 37 ºC with agitation.

07/30/2014

Trichome promoter

07/03/2014

Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.

Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.
Introduce the disks inside the tube.
Introduce the two tubes in liquid nitrogen.
Remove them from the liquid nitrogen and store at -80ºC until use.
Remove one tube from -80ºC and re-introduce them in liquid nitrogen.
Grind the disks.
Add 600 μL of CTAB (2%) buffer (pre-heat at 65ºC.)
Grind the mixture.
Add RNAse (1.6 μL at M = 100 ug/μL for each mL of CTAB buffer).
Vortex it and maintain at 65ºC for 45 min. Mix it by inversion 5-15 min.
Add 600 μL cloroform:isoamilic alcohol. Vortex it.
Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.
Recover the supernatant by aspiration (with a 200 μL pipet).
Repeat the last three steps.
Add one volume o isopropanol and mix well by inversion (10 times).
To precipitate, maintain 20 min on ice or at -80ºC during 5 min.
Centrifuge 10 min at 13000 rpm (4ºC).
Discard the supernatant by decantation (be carefull with the pellet).
Wash with 600 μL ethanol (80%).
Centrifuge 5 min at 13000 rpm.
Discard the ethanol by pipeting and let it dry a few minutes.
Resuspend it in 50-100 μL H2O miliQ or with TE buffer.
Store at -20ºC.

Measurement of genomic concentration with nanodrop.

Tabacco 1: 182 ng/μL (Thrown away)
Tabacco 2: 620 ng/μL (Stored at -20ÂºC)

Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).

It is correct.

07/10/2014

PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.

Ordered primers

IGEMJULO1
IGEMJULO2

Ajust primers to a 100 uM concentration:

IGEMJUL01 + 566 μL miliQ H2O
IGEMJUL02 + 691 μL miliQ H2O

Use a 1:10 alicuot for PCR (10 uM).

Reagents needed for PCR:

0.5 μL template
10 μL buffer HF 5x
2 μL dNTPs
2.5 μL oligo R
2.5 μL oligo F
0.5 μL Pfu
32 μL miliQ H2O

Final volume: 50 μL

Parameters:

98 ºC (2 min)
35 cycles

98 ºC (10 sec)
59 ºC (15 sec)
72 ºC (45 sec)

72 ºC (7 min)

We didn't get PCR product.

07/11/2014

Repeat PCR with different parameters.

	1	2	3	4	5
Template	0.5 μL	0.5 μL	0.5 μL	0.5 μL	0.5 μL
Buffer (5x)	0.5 μL	0.5 μL	0.5 μL	0.5 μL	0.5 μL
dNTPs	2 μL	2 μL	2 μL	2 μL	2 μL
Oligo R	2.5 μL	2.5 μL	2.5 μL	2.5 μL	2.5 μL
Oligo F	2.5 μL	2.5 μL	2.5 μL	2.5 μL	2.5 μL
Phu	0.5 μL	0.5 μL	0.5 μL	0.5 μL	0.5 μL
Buffer	32 μL	32 μL	32 μL	32 μL	32 μL

1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.

PCR parameters

98 ºC (2 min)
35 cycles

98 ºC (10 sec)
1, 3, 5 -> 59 ºC (15 sec). 2, 4 -> 55 ºC (15 sec)
72 ºC (45 sec)

72 ºC (7 min)

No PCR products again.

Repeat PCR again with other parameters.

	Buffer HF	Buffer GC
Template	2 μL	2 μL
Buffer (5x)	40 μL	40 μL
dNTPs	8 μL	8 μL
Oligo R	10 μL	10 μL
Oligo F	10 μL	10 μL
Phu	2	2 μL μL
Buffer	128 μL	128 μL

Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.

98 ºC (2 min)
35 cycles

98 ºC (10 sec)
49, 52, 55, 60 ºC (15 sec)
72 ºC (45 sec)

72 ºC (7 min)

No PCR products again.

07/14/2014

Repeat PCR again with more genomic.

Buffer HF	Buffer GC
Template	5	5
Buffer (5x)	50	50
dNTPs	10	10
Oligo R	12.5	12.5
Oligo F	12.5	12.5
Phu	2.5	2.5
Buffer	107.5	107.5

Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 ºC.

We still without having any amplification.

07/18/2014

Repeat the PCR with other enzyme.

12.5 μL Q5 Master mix (2x).
1.25 μL forward primer 10 uM
1.25 μL reverse primer 10 uM
0.5 μL template 620 ng/μL
9.5 μL H2O

Set 4 reactions at 50, 53, 55, 59 ºC.

98 ºC (30 sec)
35 cycles

98 ºC (10 sec)
50, 53, 55, 59 ºC (15 sec)
72 ºC (45 sec)

72 ºC (2 min)

The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 ºC reactions.

07/19/2014

Trichome promoter PCR product ligation in pUPD.

1 μL pUPD
1 μL PCR product
1 μL BsmBI (5-10 ud)
1 μL T4 ligase (5-10 ud)
1.2 μL buffer ligase (3 ud)
6.8 μL H20

Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).

07/20/2014

Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.

07/21/2014

We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.

07/22/2014

We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media.

Digestions in silico made to check the insertion:

Piece	Restriction enzyme	Expected bands
Trichome Promoter in pUPD	NotI	2981, 1523
	EcoRV	3942, 562

Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.

07/23/2014

Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.

07/24/2014

Results of sequencing the promoter were obtained:

Mutation	Position
T insertion	??
T insertion	??

07/28/2014

Collection pieces were quantified (minipreps made on 07/24/2014, see the Biosynthesis part for further details).

Piece	Concentration (ng/μL)	Initial Volume (μL)	Final Volume (μL)
GFP	318.8	35	148.8
Tnos	400.8	35	186.5

The following table shows ligation details of the trichome promoter:

Reagent	Volume
Trichome promoter	1 μL
GFP	1 μL
TNos	1 μL
BsaI	1 μL
p2α2	1 μL
T4 ligase	1 μL
Ligase buffer	1 μL
H2O	3 μL
Total Volume	10 μL

07/29/2014

Trichome Promoter transformation

Using an electrocompetent E. coli strain (DH5α) and 1.5 ul ligation (PTrich:GFP:TNos in 2α2), the mix is electroporated at 1500 V. Then, 300 μL of SOC are added and stored at 37 ºC with agitation.

Switch

07/04/2014

Adquisition of S. cerevisiae genomic DNA. (5 μL, stored in the fridge)

07/28/2014

We had the genome of S. cerevisiae, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).

Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast.

PCR reaction reagents:

Reagent	CUP1-PCR1	CUP2-PCR2
Template	0.5 μL	0.5 μL
Buffer HF (5X)	10.0 μL	10.0 μL
dNTPs	2.0 μL	2.0 μL
Oligo R (JUL06)	2.5 μL	2.5 μL
Oligo F (JUL05)	2.5 μL	2.5 μL
Phusion polymerase	0.5 μL	0.5 μL
H2O	32.0 μL	32.0 μL

Annealing temperature: both 61 ºC

PCR products were checked using an electrophoresis. Expected bands:

CUP1-PCR1: 386 bp
CUP2-PCR2: 348 bp

Both PCR products were correct.

@@ Line 1: / Line 1: @@
 [[File:Igem.png|100px|right|igem_logo|link=https://igem.org/Main_Page]]
 <html>
 <head>
@@ Line 27: / Line 26: @@
-<p>The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.
+<p>The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p>
-</p>
-<p></br>
+<p></br></p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"
+<img src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300">
->
-<p></br>
+<p></br></p>
-</p>
-<p>The design of the GBlocks was performed taking into account the following considerations:
+<p>The design of the GBlocks was performed taking into account the following considerations:</p>
-</p>
-<ul><li>Codon optimization
+<ul><li>Codon optimization</li>
-</li>
-<li>Inner restriction sites eliminations by finding synonymous mutations
+<li>Inner restriction sites eliminations by finding synonymous mutations</li>
-</li>
-<li>Addition of GB endings
+<li>Addition of GB endings</li>
-</li>
 </ul>
@@ Line 65: / Line 56: @@
-<p>Codes for IDT known. MEGAGEM2014 - 25% off one order, up to $800
+<p>Codes for IDT known. MEGAGEM2014 - 25% off one order, up to $800</p>
-</p>
-<p>GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).
+<p>GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p>
-</p>
@@ Line 79: / Line 68: @@
-<p>We ordered the following gBlocks and primers.
+<p>We ordered the following gBlocks and primers.</p>
-</p>
-<ul><li>EaDAcT: Eunymus alatus (adapted for GB) 1127 bp
+<ul><li>EaDAcT: Eunymus alatus (adapted for GB) 1127 bp</li>
-</li>
-<li>HarFAR: Helicoverpa armigera (adapted for GB) 1400 bp
+<li>HarFAR: Helicoverpa armigera (adapted for GB) 1400 bp</li>
-</li>
-<li>Atr&Delta;11: Amyelois transitella (order primers for GB) 1000 bp
+<li>Atr&Delta;11: Amyelois transitella (order primers for GB) 1000 bp</li>
-</li>
-<ul><li>I14Jun03 Atr&Delta;11 F1
+<ul><li>I14Jun03 Atr&Delta;11 F1</li>
-</li>
-<li>I14Jun04 Atr&Delta;11 R1
+<li>I14Jun04 Atr&Delta;11 R1</li>
-</li>
-</ul><li>FAO1: N.benthamiana primers
+</ul><li>FAO1: N.benthamiana primers</li>
-</li>
-<ul><li>I14Jun01 FAO1 F1
+<ul><li>I14Jun01 FAO1 F1</li>
-</li>
-<li>I14Jun02 FAO1 R1
+<li>I14Jun02 FAO1 R1</li>
-</li>
 </ul></ul>
@@ Line 112: / Line 92: @@
 <table style="width:300px">
-<tr><td>Name</td><td>Sequence</td><td>Lenght</td><td>Tm (NTI)</td><td>Tm (Phusion)
+<tr><td>Name</td><td>Sequence</td><td>Lenght</td><td>Tm (NTI)</td><td>Tm (Phusion)</td></tr>
-</td></tr>
-<tr><td>I14Jun01_FAO1_F1</td><td>cgccgtctcgctcgaatggagaaaaagagccatcc</td><td>35</td><td>49.9</td><td>62.4
+<tr><td>I14Jun01_FAO1_F1</td><td>cgccgtctcgctcgaatggagaaaaagagccatcc</td><td>35</td><td>49.9</td><td>62.4</td></tr>
-</td></tr>
-<tr><td>I14Jun02_FAO1_R1</td><td>cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td>46</td><td>54.5</td><td>63.7
+<tr><td>I14Jun02_FAO1_R1</td><td>cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td>46</td><td>54.5</td><td>63.7</td></tr>
-</td></tr>
-<tr><td>I14Jun03Atr_D11_F1</td><td>gcgccgtctcgctcgaatggttcctaataag</td><td>31</td><td>54.5</td><td>65.3
+<tr><td>I14Jun03Atr_D11_F1</td><td>gcgccgtctcgctcgaatggttcctaataag</td><td>31</td><td>54.5</td><td>65.3</td></tr>
-</td></tr>
-<tr><td>I14Jun04Atr_D11_R1</td><td>gcgccgtctcgctcgaagctcaacgtttc</td><td>29</td><td>57</td><td>69.1
+<tr><td>I14Jun04Atr_D11_R1</td><td>gcgccgtctcgctcgaagctcaacgtttc</td><td>29</td><td>57</td><td>69.1</td></tr>
-</td></tr>
 </table>
@@ Line 135: / Line 110: @@
-<p>We thought which parts of the GB collection could we use.
+<p>We thought which parts of the GB collection could we use.</p>
-</p>
-<p>Strategy 1:
+<p>Strategy 1:</p>
-</p>
-<ul><li>pP35S, pT35s (x2)
+<ul><li>pP35S, pT35s (x2)</li>
-</li>
-<li>pAtUbq10, pTAtHSP18.2
+<li>pAtUbq10, pTAtHSP18.2</li>
-</li>
 </ul>
-<p>Strategy 2:
+<p>Strategy 2:</p>
-</p>
-<ul><li>pP35S, pT35s
+<ul><li>pP35S, pT35s</li>
-</li>
-<li>pP35s, pTAtHSP18.2
+<li>pP35s, pTAtHSP18.2</li>
-</li>
-<li>pAtUbq10, pTAtHSP18.2
+<li>pAtUbq10, pTAtHSP18.2</li>
-</li>
 </ul>
-<p>Strategy 3:
+<p>Strategy 3:</p>
-</p>
-<ul><li>pP35S, pT35s
+<ul><li>pP35S, pT35s</li>
-</li>
-<li>pP35s, pTTctp
+<li>pP35s, pTTctp</li>
-</li>
-<li>pAtUbq10, pTAtHSP18.2
+<li>pAtUbq10, pTAtHSP18.2</li>
-</li>
 </ul>
-<p>Pieces to take from GB2.0 colection:
+<p>Pieces to take from GB2.0 colection:</p>
-</p>
@@ Line 192: / Line 154: @@
 <table style="width:300px">
-<tr><td>pDGB2&alpha;1</td><td>GB0483</td><td>Kan
+<tr><td>pDGB2&alpha;1</td><td>GB0483</td><td>Kan</td></tr>
-</td></tr>
-<tr><td>pDGB2&alpha;2</td><td>GB0484</td><td>Kan
+<tr><td>pDGB2&alpha;2</td><td>GB0484</td><td>Kan</td></tr>
-</td></tr>
-<tr><td>pP35s</td><td>GB0030</td><td>Amp
+<tr><td>pP35s</td><td>GB0030</td><td>Amp</td></tr>
-</td></tr>
-<tr><td>pT35s</td><td>GB0036</td><td>Amp
+<tr><td>pT35s</td><td>GB0036</td><td>Amp</td></tr>
-</td></tr>
-<tr><td>pAtUbq10</td><td>GB0223</td><td>Amp
+<tr><td>pAtUbq10</td><td>GB0223</td><td>Amp</td></tr>
-</td></tr>
-<tr><td>pTAtHSP18.2</td><td>GB0035</td><td>Amp
+<tr><td>pTAtHSP18.2</td><td>GB0035</td><td>Amp</td></tr>
-</td></tr>
-<tr><td>pTTctp</td><td>GB0081</td><td>Amp
+<tr><td>pTTctp</td><td>GB0081</td><td>Amp</td></tr>
-</td></tr>
-<tr><td>pUPD</td><td>GB0317</td><td>Amp
+<tr><td>pUPD</td><td>GB0317</td><td>Amp</td></tr>
-</td></tr>
 </table>
@@ Line 220: / Line 174: @@
-<p>Later we will need:
+<p>Later we will need:</p>
-</p>
@@ Line 227: / Line 180: @@
 <table style="width:300px">
-<tr><td>pDGB2&Omega;1</td><td>GB0487</td><td>Smp
+<tr><td>pDGB2&Omega;1</td><td>GB0487</td><td>Smp</td></tr>
-</td></tr>
-<tr><td>pDGB2&Omega;2</td><td>GB0488</td><td>Smp
+<tr><td>pDGB2&Omega;2</td><td>GB0488</td><td>Smp</td></tr>
-</td></tr>
 </table>
@@ Line 237: / Line 188: @@
-<p>Prepare plaques with antibiotics Kan, Spm, Amp
+<p>Prepare plaques with antibiotics Kan, Spm, Amp</p>
-</p>
@@ Line 248: / Line 198: @@
-<p>Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).
+<p>Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p>
-</p>
@@ Line 259: / Line 208: @@
-<p>Culture in agar Petri dish. 2 plaques: Amp and Kan.
+<p>Culture in agar Petri dish. 2 plaques: Amp and Kan.</p>
-</p>
-<p>Minipreps with EZNA Plasmid DNA MiniKit I.
+<p>Minipreps with EZNA Plasmid DNA MiniKit I.</p>
-</p>
-<p>Expected digestions:
+<p>Expected digestions:</p>
-</p>
@@ Line 276: / Line 222: @@
 <table style="width:300px">
-<tr><td>pP35s </td><td>GB0030</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 1105
+<tr><td>pP35s </td><td>GB0030</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 1105</td></tr>
-</td></tr>
-<tr><td>pT35s </td><td>GB0036</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 304
+<tr><td>pT35s </td><td>GB0036</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 304</td></tr>
-</td></tr>
-<tr><td>pAtUbq10 </td><td>GB0223</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 714
+<tr><td>pAtUbq10 </td><td>GB0223</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 714</td></tr>
-</td></tr>
-<tr><td>pTAtHSP18.2 </td><td>GB0035</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 328
+<tr><td>pTAtHSP18.2 </td><td>GB0035</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 328</td></tr>
-</td></tr>
-<tr><td>pTTctp </td><td>GB0081</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 487
+<tr><td>pTTctp </td><td>GB0081</td><td>NotI</td><td>Buffer: Orange</td><td>2981, 487</td></tr>
-</td></tr>
 </table>
@@ Line 297: / Line 238: @@
-<p>Electrophoresis analysis.
+<p>Electrophoresis analysis.</p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"
+<img src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388">
->
-<p>We got the expected bands in all cases.
+<p>We got the expected bands in all cases.</p>
-</p>
@@ Line 318: / Line 256: @@
-<p>Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence.
+<p>Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p>
-</p>
-<p>We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F
+<p>We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p>
-</p>
-<p>Reagents needed:
+<p>Reagents needed:</p>
-</p>
-<ul><li>32.5 &mu;L of H2O miliQ
+<ul><li>32.5 &mu;L of H2O miliQ</li>
-</li>
-<li>10 &mu;L HF buffer
+<li>10 &mu;L HF buffer </li>
-</li>
-<li>2 &mu;L dNTPs
+<li>2 &mu;L dNTPs</li>
-</li>
-<li>2.5 &mu;L Reverse primer
+<li>2.5 &mu;L Reverse primer</li>
-</li>
-<li>2.5 &mu;L Forward primer
+<li>2.5 &mu;L Forward primer</li>
-</li>
-<li>1 &mu;L template (Atr&Delta;11 gene)
+<li>1 &mu;L template (Atr&Delta;11 gene)</li>
-</li>
-<li>0.5 &mu;L phusion (polimerase)
+<li>0.5 &mu;L phusion (polimerase)</li>
-</li>
 </ul>
-<p>PCR parameters: The annealing temperature was 60ºC and the extension temperature was 65ºC.
+<p>PCR parameters: The annealing temperature was 60ºC and the extension temperature was 65ºC. </p>
-</p>
-<p>Electrophoresis performed to check the PCR product, which was expected to be around 1 kb.
+<p>Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png
+<img src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png>
->
-<p>pUPD ligation of EaDAcT, HarFar and Atr&Delta;11
+<p>pUPD ligation of EaDAcT, HarFar and Atr&Delta;11</p>
-</p>
-<p>Reagents needed for the reaction of ligation:
+<p>Reagents needed for the reaction of ligation:</p>
-</p>
-<ul><li>1 &mu;L pUPD
+<ul><li>1 &mu;L pUPD</li>
-</li>
-<li>1 &mu;L PCR product/gblock product
+<li>1 &mu;L PCR product/gblock product  </li>
-</li>
-<li>1.2 &mu;L buffer 10x
+<li>1.2 &mu;L buffer 10x</li>
-</li>
-<li>1 &mu;L BsmBI
+<li>1 &mu;L BsmBI</li>
-</li>
-<li>1 &mu;L T4 ligase
+<li>1 &mu;L T4 ligase</li>
-</li>
-<li>6.8 &mu;L H2O miliQ
+<li>6.8 &mu;L H2O miliQ</li>
-</li>
 </ul>
-<p>Vfinal= 12 &mu;L
+<p>Vfinal= 12 &mu;L</p>
-</p>
-<p>Termocycler parameters: The ligase temperature was 16ºC and the BsmBI temperature was 37ºC.
+<p>Termocycler parameters: The ligase temperature was 16ºC and the BsmBI temperature was 37ºC. </p>
-</p>
-<p>As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.
+<p>As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p>
-</p>
@@ Line 420: / Line 334: @@
-<p>E. coli transformation
+<p>E. coli transformation</p>
-</p>
-<p>This step is performed in a laminar air flow cabinet (LAF).
+<p>This step is performed in a laminar air flow cabinet (LAF). </p>
-</p>
-<p>We have used an electrocompetent E. coli strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.
+<p>We have used an electrocompetent E. coli strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p>
-</p>
-<p>Reagents needed:
+<p>Reagents needed:</p>
-</p>
-<ul><li>E. coli aliquot
+<ul><li>E. coli aliquot</li>
-</li>
-<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)
+<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li>
-</li>
 </ul>
-<p>Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.
+<p>Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.</p>
-</p>
-<p>After incubation, culture in Petri plates (always in a LAF).
+<p>After incubation, culture in Petri plates (always in a LAF).</p>
-</p>
-<p>2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume.
+<p>2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p>
-</p>
-<p>Petri plates are incubated at 37ºC for 16 h.
+<p>Petri plates are incubated at 37ºC for 16 h.</p>
-</p>
@@ Line 466: / Line 370: @@
-<p>Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:
+<p>Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p>
-</p>
-<ul><li>3x 1 colony of EaDAcT in pUPD + LB + Amp
+<ul><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li>
-</li>
-<li>3x 1 colony of HarFAR in pUPD + LB + Amp
+<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li>
-</li>
-<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp
+<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li>
-</li>
 </ul>
-<p>All tubes are incubated at 37ºC overnight in agitation.
+<p>All tubes are incubated at 37ºC overnight in agitation.</p>
-</p>
@@ Line 493: / Line 392: @@
-<p>Digestions in silico using Vector NTI to check after minipreps if ligations are correct.
+<p>Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p>
-</p>
@@ Line 500: / Line 398: @@
 <table style="width:300px">
-<tr><td>EaDAcT</td><td>NotI</td><td>2981, 1167
+<tr><td>EaDAcT</td><td>NotI</td><td>2981, 1167</td></tr>
-</td></tr>
-<tr><td></td><td>RsaI</td><td>1876, 1343, 532, 306, 91
+<tr><td></td><td>RsaI</td><td>1876, 1343, 532, 306, 91</td></tr>
-</td></tr>
-<tr><td>HarFAR</td><td>NotI</td><td>2981, 1440
+<tr><td>HarFAR</td><td>NotI</td><td>2981, 1440</td></tr>
-</td></tr>
-<tr><td></td><td>PvuII</td><td>2564, 1394, 463
+<tr><td></td><td>PvuII</td><td>2564, 1394, 463</td></tr>
-</td></tr>
-<tr><td>Atr&Delta;11</td><td>NotI</td><td>2981, 1056
+<tr><td>Atr&Delta;11</td><td>NotI</td><td>2981, 1056</td></tr>
-</td></tr>
-<tr><td></td><td>BanII</td><td>2570, 803, 351, 314
+<tr><td></td><td>BanII</td><td>2570, 803, 351, 314</td></tr>
-</td></tr>
 </table>
@@ Line 522: / Line 414: @@
-<p>Digestion reagents:
+<p>Digestion reagents:</p>
-</p>
-<ul><li>0.5 &mu;L restriction enzyme
+<ul><li>0.5 &mu;L restriction enzyme</li>
-</li>
-<li>2.5 &mu;L buffer
+<li>2.5 &mu;L buffer</li>
-</li>
-<li>21 &mu;L H20 (miliQ)
+<li>21 &mu;L H20 (miliQ)</li>
-</li>
-<li>1 &mu;L sample
+<li>1 &mu;L sample</li>
-</li>
 </ul>
-<p>Preparation of master mixes
+<p>Preparation of master mixes</p>
-</p>
-<ul><li>Master mix for NotI
+<ul><li>Master mix for NotI</li>
-</li>
-<ul><li>5 &mu;L NotI
+<ul><li>5 &mu;L NotI</li>
-</li>
-<li>25 &mu;L Orange
+<li>25 &mu;L Orange</li>
-</li>
-<li>210 &mu;L H20
+<li>210 &mu;L H20</li>
-</li>
-</ul><li>Master mix for RsaI
+</ul><li>Master mix for RsaI</li>
-</li>
-<ul><li>1.5 &mu;L RsaI
+<ul><li>1.5 &mu;L RsaI</li>
-</li>
-<li>7.5 &mu;L Tango
+<li>7.5 &mu;L Tango</li>
-</li>
-<li>63 &mu;L H20
+<li>63 &mu;L H20</li>
-</li>
-</ul><li>Master mix for PvuII
+</ul><li>Master mix for PvuII</li>
-</li>
-<ul><li>1.5 &mu;L PvuII
+<ul><li>1.5 &mu;L PvuII</li>
-</li>
-<li>7.5 &mu;L Green
+<li>7.5 &mu;L Green</li>
-</li>
-<li>63 &mu;L H20
+<li>63 &mu;L H20</li>
-</li>
-</ul><li>Master mix for BanII
+</ul><li>Master mix for BanII</li>
-</li>
-<ul><li>1.5 &mu;L BanII
+<ul><li>1.5 &mu;L BanII</li>
-</li>
-<li>7.5 &mu;L Tango
+<li>7.5 &mu;L Tango</li>
-</li>
-<li>63 &mu;L H20
+<li>63 &mu;L H20</li>
-</li>
 </ul></ul>
-<p>Perform electrophoresis to check if the size of the fragments from the digestions is correct.
+<p>Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png
+<img src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png>
->
-<p>Comments:
+<p>Comments:</p>
-</p>
-<ul><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.
+<ul><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li>
-</li>
-<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.
+<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li>
-</li>
 </ul>
@@ Line 621: / Line 486: @@
-<p>We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us)  liquid medium. Those tubes contain:
+<p>We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us)  liquid medium. Those tubes contain:</p>
-</p>
-<ul><li>3.5 mL LB
+<ul><li>3.5 mL LB</li>
-</li>
-<li>7 &mu;L Amp
+<li>7 &mu;L Amp</li>
-</li>
-<li>7 &mu;L X-Gal
+<li>7 &mu;L X-Gal</li>
-</li>
-<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)
+<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li>
-</li>
 </ul>
@@ Line 644: / Line 504: @@
-<p>We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.
+<p>We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p>
-</p>
-<p>Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.
+<p>Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p>
-</p>
@@ Line 656: / Line 514: @@
 <table style="width:300px">
-<tr><td>EaDAcT</td><td>NotI</td><td>2981, 1167
+<tr><td>EaDAcT</td><td>NotI</td><td>2981, 1167</td></tr>
-</td></tr>
-<tr><td></td><td>RsaI</td><td>1876, 1343, 532, 306, 91
+<tr><td></td><td>RsaI</td><td>1876, 1343, 532, 306, 91</td></tr>
-</td></tr>
-<tr><td>HarFAR</td><td>NotI</td><td>2981, 1440
+<tr><td>HarFAR</td><td>NotI</td><td>2981, 1440</td></tr>
-</td></tr>
-<tr><td></td><td>PvuII</td><td>2564, 1394, 463
+<tr><td></td><td>PvuII</td><td>2564, 1394, 463</td></tr>
-</td></tr>
-<tr><td>Atr&Delta;11</td><td>NotI</td><td>2981, 1056
+<tr><td>Atr&Delta;11</td><td>NotI</td><td>2981, 1056</td></tr>
-</td></tr>
-<tr><td></td><td>RsaI</td><td>1879, 1310, 467, 327, 54
+<tr><td></td><td>RsaI</td><td>1879, 1310, 467, 327, 54</td></tr>
-</td></tr>
 </table>
@@ Line 678: / Line 530: @@
-<p>Preparation of master mixes
+<p>Preparation of master mixes</p>
-</p>
-<ul><li>Master mix for NotI
+<ul><li>Master mix for NotI</li>
-</li>
-<ul><li>3.5 &mu;L NotI
+<ul><li>3.5 &mu;L NotI</li>
-</li>
-<li>17.5 &mu;L Orange
+<li>17.5 &mu;L Orange</li>
-</li>
-<li>147 &mu;L H20
+<li>147 &mu;L H20</li>
-</li>
-</ul><li>Master mix for RsaI
+</ul><li>Master mix for RsaI</li>
-</li>
-<ul><li>2 &mu;L RsaI
+<ul><li>2 &mu;L RsaI</li>
-</li>
-<li>10 &mu;L Tango
+<li>10 &mu;L Tango</li>
-</li>
-<li>84 &mu;L H20
+<li>84 &mu;L H20</li>
-</li>
-</ul><li>Master mix for PvuII
+</ul><li>Master mix for PvuII</li>
-</li>
-<ul><li>2 &mu;L PvuII
+<ul><li>2 &mu;L PvuII</li>
-</li>
-<li>10 &mu;L Green
+<li>10 &mu;L Green</li>
-</li>
-<li>84 &mu;L H20
+<li>84 &mu;L H20</li>
-</li>
 </ul></ul>
-<p>We run the electrophoresis gel to check if this time we have done it correctly.
+<p>We run the electrophoresis gel to check if this time we have done it correctly.</p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png
+<img src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png>
->
-<p>Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.
+<p>Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p>
-</p>
@@ Line 740: / Line 576: @@
-<p>Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.
+<p>Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p>
-</p>
-<p>The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.
+<p>The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p>
-</p>
-<p>Reagents needed for ligation:
+<p>Reagents needed for ligation:</p>
-</p>
-<ul><li>1 &mu;L promoter 75 ng/&mu;L
+<ul><li>1 &mu;L promoter 75 ng/&mu;L</li>
-</li>
-<li>1 &mu;L terminator 75 ng/&mu;L
+<li>1 &mu;L terminator 75 ng/&mu;L</li>
-</li>
-<li>1 &mu;L CDS 75 ng/&mu;L
+<li>1 &mu;L CDS 75 ng/&mu;L</li>
-</li>
-<li>1 &mu;L vector &alpha;
+<li>1 &mu;L vector &alpha;</li>
-</li>
-<li>1.2 &mu;L ligase buffer 10x
+<li>1.2 &mu;L ligase buffer 10x</li>
-</li>
-<li>1 &mu;L T4
+<li>1 &mu;L T4</li>
-</li>
-<li>1 &mu;L BsaI
+<li>1 &mu;L BsaI</li>
-</li>
-<li>4.2 &mu;L H20
+<li>4.2 &mu;L H20</li>
-</li>
 </ul>
-<p>Total: 12 &mu;L
+<p>Total: 12 &mu;L</p>
-</p>
-<p>Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.
+<p>Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p>
-</p>
-<p>Strategy Promoter-Terminator:
+<p>Strategy Promoter-Terminator:</p>
-</p>
@@ Line 798: / Line 620: @@
 <table style="width:300px">
-<tr><td>Atr&Delta;11</td><td>P35s</td><td>T35s</td><td>40.41
+<tr><td>Atr&Delta;11</td><td>P35s</td><td>T35s</td><td>40.41</td></tr>
-</td></tr>
-<tr><td>HarFAR</td><td>P35s</td><td>TatHSP</td><td>39.68
+<tr><td>HarFAR</td><td>P35s</td><td>TatHSP</td><td>39.68</td></tr>
-</td></tr>
-<tr><td>EaDAcT</td><td>PAtUbq</td><td>TatHSP</td><td>32.27
+<tr><td>EaDAcT</td><td>PAtUbq</td><td>TatHSP</td><td>32.27</td></tr>
-</td></tr>
 </table>
@@ Line 811: / Line 630: @@
-<p>Adjust concentrations to 75 ng/&mu;L for ligation reaction
+<p>Adjust concentrations to 75 ng/&mu;L for ligation reaction</p>
-</p>
-<p>Initial concentrations (nanodrop):
+<p>Initial concentrations (nanodrop):</p>
-</p>
@@ Line 823: / Line 640: @@
 <table style="width:300px">
-<tr><td>Piece</td><td>Concentrations</td><td>Volume</td><td>Volume of H20 to add
+<tr><td>Piece</td><td>Concentrations</td><td>Volume</td><td>Volume of H20 to add</td></tr>
-</td></tr>
-<tr><td>PAtUpb</td><td>442.6 ng/&mu;L</td><td>34 &mu;L</td><td>166.6 &mu;L
+<tr><td>PAtUpb</td><td>442.6 ng/&mu;L</td><td>34 &mu;L</td><td>166.6 &mu;L</td></tr>
-</td></tr>
-<tr><td>pTatHSP</td><td>235.4 ng/&mu;L</td><td>36 &mu;L</td><td>77 &mu;L
+<tr><td>pTatHSP</td><td>235.4 ng/&mu;L</td><td>36 &mu;L</td><td>77 &mu;L</td></tr>
-</td></tr>
-<tr><td>T35s</td><td>194.9 ng/&mu;L</td><td>37.5 &mu;L</td><td>60 &mu;L
+<tr><td>T35s</td><td>194.9 ng/&mu;L</td><td>37.5 &mu;L</td><td>60 &mu;L</td></tr>
-</td></tr>
-<tr><td>P35s</td><td>454.7 ng/&mu;L</td><td>36 &mu;L</td><td>182 &mu;L
+<tr><td>P35s</td><td>454.7 ng/&mu;L</td><td>36 &mu;L</td><td>182 &mu;L</td></tr>
-</td></tr>
-<tr><td>2&alpha;1</td><td>57.1 ng/&mu;L</td><td>-</td><td>We will need to put 1.5 &mu;L of this one
+<tr><td>2&alpha;1</td><td>57.1 ng/&mu;L</td><td>-</td><td>We will need to put 1.5 &mu;L of this one</td></tr>
-</td></tr>
-<tr><td>2&alpha;2</td><td>104.0 ng/&mu;L</td><td>38 &mu;L</td><td>14.7 &mu;L
+<tr><td>2&alpha;2</td><td>104.0 ng/&mu;L</td><td>38 &mu;L</td><td>14.7 &mu;L</td></tr>
-</td></tr>
-<tr><td>Atr&Delta;11</td><td>359.3 ng/&mu;L</td><td>20 &mu;L</td><td>75.8 &mu;L
+<tr><td>Atr&Delta;11</td><td>359.3 ng/&mu;L</td><td>20 &mu;L</td><td>75.8 &mu;L</td></tr>
-</td></tr>
-<tr><td>HarFAR</td><td>404.4 ng/&mu;L</td><td>15 &mu;L</td><td>65.9 &mu;L
+<tr><td>HarFAR</td><td>404.4 ng/&mu;L</td><td>15 &mu;L</td><td>65.9 &mu;L</td></tr>
-</td></tr>
-<tr><td>EaDAcT</td><td>155.6 ng/&mu;L</td><td>10 &mu;L</td><td>10.7 &mu;L
+<tr><td>EaDAcT</td><td>155.6 ng/&mu;L</td><td>10 &mu;L</td><td>10.7 &mu;L</td></tr>
-</td></tr>
 </table>
@@ Line 857: / Line 664: @@
-<p>Ligation reaction
+<p>Ligation reaction</p>
-</p>
-<ul><li>P35s:Atr&Delta;11:T35s in 2&alpha;1
+<ul><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
-</li>
-<ul><li>1 &mu;L P35s
+<ul><li>1 &mu;L P35s</li>
-</li>
-<li>1 &mu;L T35s
+<li>1 &mu;L T35s</li>
-</li>
-<li>1 &mu;L Atr&Delta;11
+<li>1 &mu;L Atr&Delta;11</li>
-</li>
-<li>1.5 &mu;L 2&alpha;1
+<li>1.5 &mu;L 2&alpha;1</li>
-</li>
-<li>1.2 &mu;L ligase buffer 10x
+<li>1.2 &mu;L ligase buffer 10x</li>
-</li>
-<li>1 &mu;L T4
+<li>1 &mu;L T4</li>
-</li>
-<li>1 &mu;L BsaI
+<li>1 &mu;L BsaI</li>
-</li>
-<li>3.7 &mu;L H20
+<li>3.7 &mu;L H20</li>
-</li>
 </ul></ul>
-<ul><li>P35s:HarFAR:TatHSP in 2&alpha;2
+<ul><li>P35s:HarFAR:TatHSP in 2&alpha;2</li>
-</li>
-<ul><li>1 &mu;L P35s
+<ul><li>1 &mu;L P35s</li>
-</li>
-<li>1 &mu;L TatHSP
+<li>1 &mu;L TatHSP</li>
-</li>
-<li>1 &mu;L HarFAR
+<li>1 &mu;L HarFAR</li>
-</li>
-<li>1 &mu;L 2&alpha;2
+<li>1 &mu;L 2&alpha;2</li>
-</li>
-<li>1.2 &mu;L ligase buffer 10x
+<li>1.2 &mu;L ligase buffer 10x</li>
-</li>
-<li>1 &mu;L T4
+<li>1 &mu;L T4</li>
-</li>
-<li>1 &mu;L BsaI
+<li>1 &mu;L BsaI</li>
-</li>
-<li>4.2 &mu;L H20
+<li>4.2 &mu;L H20</li>
-</li>
 </ul></ul>
-<ul><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2
+<ul><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li>
-</li>
-<ul><li>1 &mu;L PAtUbq
+<ul><li>1 &mu;L PAtUbq</li>
-</li>
-<li>1 &mu;L TatHSP
+<li>1 &mu;L TatHSP</li>
-</li>
-<li>1 &mu;L EaDAcT
+<li>1 &mu;L EaDAcT</li>
-</li>
-<li>1 &mu;L 2&alpha;2
+<li>1 &mu;L 2&alpha;2</li>
-</li>
-<li>1.2 &mu;L ligase buffer 10x
+<li>1.2 &mu;L ligase buffer 10x</li>
-</li>
-<li>1 &mu;L T4
+<li>1 &mu;L T4</li>
-</li>
-<li>1 &mu;L BsaI
+<li>1 &mu;L BsaI</li>
-</li>
-<li>4.2 &mu;L H20
+<li>4.2 &mu;L H20</li>
-</li>
 </ul></ul>
@@ Line 953: / Line 732: @@
-<p>Transformation of constructions in E. coli
+<p>Transformation of constructions in E. coli</p>
-</p>
-<p>We finally got the sequencing results from 07/07/2014.
+<p>We finally got the sequencing results from 07/07/2014.</p>
-</p>
-<ul><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.
+<ul><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li>
-</li>
-<li>HarFAR -> Sequencing correct
+<li>HarFAR -> Sequencing correct</li>
-</li>
-<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!
+<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li>
-</li>
 </ul>
-<p>We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.
+<p>We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p>
-</p>
-<ul><li>Worked in the LAF
+<ul><li>Worked in the LAF</li>
-</li>
-<li>Cultivated in a Petri dish with Spm
+<li>Cultivated in a Petri dish with Spm</li>
-</li>
-<li>Let them grow for one day
+<li>Let them grow for one day</li>
-</li>
 </ul>
-<p>Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)
+<p>Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p>
-</p>
-<ul><li>50 mL transformation in one plaque
+<ul><li>50 mL transformation in one plaque</li>
-</li>
-<li>Rest of the culture in another (250 &mu;L aprox)
+<li>Rest of the culture in another (250 &mu;L aprox)</li>
-</li>
-<li>Let them grow for one day
+<li>Let them grow for one day</li>
-</li>
 </ul>
@@ Line 1,010: / Line 776: @@
-<p>Pick colonies and grow them in liquid medium.
+<p>Pick colonies and grow them in liquid medium.</p>
-</p>
-<ul><li>6 from Atr&Delta;11 (repetition because of mutation)
+<ul><li>6 from Atr&Delta;11 (repetition because of mutation)</li>
-</li>
-<ul><li>3.5 mL LB
+<ul><li>3.5 mL LB</li>
-</li>
-<li>7 &mu;L Amp
+<li>7 &mu;L Amp</li>
-</li>
-<li>7 &mu;L X-gal
+<li>7 &mu;L X-gal</li>
-</li>
-<li>3.5 &mu;L IPTG
+<li>3.5 &mu;L IPTG</li>
-</li>
-</ul><li>1 colony from 2&Omega;1
+</ul><li>1 colony from 2&Omega;1</li>
-</li>
-<ul><li>3.5 mL LB
+<ul><li>3.5 mL LB</li>
-</li>
-<li>7 &mu;L Spm
+<li>7 &mu;L Spm</li>
-</li>
 </ul></ul>
-<ul><li>1 colony from 2&Omega;2
+<ul><li>1 colony from 2&Omega;2</li>
-</li>
-<ul><li>3.5 mL LB
+<ul><li>3.5 mL LB</li>
-</li>
-<li>7 &mu;L Spm
+<li>7 &mu;L Spm</li>
-</li>
-</ul><li>3 colonies from P35s:HarFAR:TatHSP
+</ul><li>3 colonies from P35s:HarFAR:TatHSP</li>
-</li>
-<ul><li>3.5 mL LB
+<ul><li>3.5 mL LB</li>
-</li>
-<li>7 &mu;L Kan
+<li>7 &mu;L Kan</li>
-</li>
-</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP
+</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li>
-</li>
-<ul><li>3.5 mL LB
+<ul><li>3.5 mL LB</li>
-</li>
-<li>7 &mu;L Kan
+<li>7 &mu;L Kan</li>
-</li>
 </ul></ul>
-<p>Grow at 37ºC in agitation overnight.
+<p>Grow at 37ºC in agitation overnight.</p>
-</p>
-<p>We have checked the promoters and terminators are both compatible with GB and BioBricks.
+<p>We have checked the promoters and terminators are both compatible with GB and BioBricks.</p>
-</p>
-<p>Only P35s and T35s work for both. pPnos could also work.
+<p>Only P35s and T35s work for both. pPnos could also work.</p>
-</p>
-<p>Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.
+<p>Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p>
-</p>
@@ Line 1,092: / Line 836: @@
-<p>We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.
+<p>We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p>
-</p>
-<p>Additionally, we have cultured each of the colonies named above to store them.
+<p>Additionally, we have cultured each of the colonies named above to store them.</p>
-</p>
@@ Line 1,106: / Line 848: @@
-<p>We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.
+<p>We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p>
-</p>
@@ Line 1,113: / Line 854: @@
 <table style="width:300px">
-<tr><td>Parts</td><td>Retriction enzyme</td><td>Expected Bands
+<tr><td>Parts</td><td>Retriction enzyme</td><td>Expected Bands</td></tr>
-</td></tr>
-<tr><td>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td>HindIII</td><td>6322, 1722, 736, 221
+<tr><td>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td>HindIII</td><td>6322, 1722, 736, 221</td></tr>
-</td></tr>
-<tr><td>P35s:HarFAR:TatHSP in 2 &alpha;2</td><td>HindIII</td><td>6322, 1794, 221
+<tr><td>P35s:HarFAR:TatHSP in 2 &alpha;2</td><td>HindIII</td><td>6322, 1794, 221</td></tr>
-</td></tr>
-<tr><td>Atr&Delta;11</td><td>NotI</td><td>2961, 1056
+<tr><td>Atr&Delta;11</td><td>NotI</td><td>2961, 1056</td></tr>
-</td></tr>
-<tr><td>2&Omega;1</td><td>BamHI</td><td>6652, 382, 239
+<tr><td>2&Omega;1</td><td>BamHI</td><td>6652, 382, 239</td></tr>
-</td></tr>
-<tr><td>2&Omega;2</td><td>EcoRV</td><td>6652, 621
+<tr><td>2&Omega;2</td><td>EcoRV</td><td>6652, 621</td></tr>
-</td></tr>
 </table>
@@ Line 1,135: / Line 870: @@
-<p>Preparation of master mixes
+<p>Preparation of master mixes</p>
-</p>
-<ul><li>Master mix for HindIII
+<ul><li>Master mix for HindIII</li>
-</li>
-<ul><li>3.5 &mu;L HindIII
+<ul><li>3.5 &mu;L HindIII</li>
-</li>
-<li>17.5 &mu;L Red
+<li>17.5 &mu;L Red</li>
-</li>
-<li>147 &mu;L H20
+<li>147 &mu;L H20</li>
-</li>
-</ul><li>Master mix for NotI
+</ul><li>Master mix for NotI</li>
-</li>
-<ul><li>1.5 &mu;L NotI
+<ul><li>1.5 &mu;L NotI</li>
-</li>
-<li>7.5 &mu;L Orange
+<li>7.5 &mu;L Orange</li>
-</li>
-<li>63 &mu;L H20
+<li>63 &mu;L H20</li>
-</li>
-</ul><li>Mix for EcoRV
+</ul><li>Mix for EcoRV</li>
-</li>
-<ul><li>0.5 &mu;L EcoRV
+<ul><li>0.5 &mu;L EcoRV</li>
-</li>
-<li>2.5 &mu;L Red
+<li>2.5 &mu;L Red</li>
-</li>
-<li>21 &mu;L H20
+<li>21 &mu;L H20</li>
-</li>
-</ul><li>Mix for BamHI
+</ul><li>Mix for BamHI</li>
-</li>
-<ul><li>0.5 &mu;L PvuII
+<ul><li>0.5 &mu;L PvuII</li>
-</li>
-<li>2.5 &mu;L Green
+<li>2.5 &mu;L Green</li>
-</li>
-<li>21 &mu;L H20
+<li>21 &mu;L H20</li>
-</li>
 </ul></ul>
@@ Line 1,192: / Line 910: @@
-<p>We run the electrophoresis gel to check if this time we have done it correctly.
+<p>We run the electrophoresis gel to check if this time we have done it correctly.</p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png
+<img src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png>
->
-<p>Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.
+<p>Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p>
-</p>
@@ Line 1,211: / Line 926: @@
-<p>We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation.
+<p>We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p>
-</p>
-<p>Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):
+<p>Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p>
-</p>
-<ul><li>P35s:Atr&Delta;11:T35s in 2&alpha;1
+<ul><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
-</li>
-<ul><li>1 &mu;L P35s
+<ul><li>1 &mu;L P35s</li>
-</li>
-<li>1 &mu;L T35s
+<li>1 &mu;L T35s</li>
-</li>
-<li>1 &mu;L Atr&Delta;11
+<li>1 &mu;L Atr&Delta;11</li>
-</li>
-<li>1.5 &mu;L 2&alpha;1
+<li>1.5 &mu;L 2&alpha;1</li>
-</li>
-<li>1.2 &mu;L ligase buffer 10x
+<li>1.2 &mu;L ligase buffer 10x</li>
-</li>
-<li>1 &mu;L T4
+<li>1 &mu;L T4</li>
-</li>
-<li>1 &mu;L BsaI
+<li>1 &mu;L BsaI</li>
-</li>
-<li>3.7 &mu;L H20
+<li>3.7 &mu;L H20</li>
-</li>
-</ul><li>P35s:HarFAR:T35s in 2&alpha;2
+</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li>
-</li>
-<ul><li>1 &mu;L P35s
+<ul><li>1 &mu;L P35s</li>
-</li>
-<li>1 &mu;L T35s
+<li>1 &mu;L T35s</li>
-</li>
-<li>1 &mu;L HarFAR
+<li>1 &mu;L HarFAR</li>
-</li>
-<li>1 &mu;L 2&alpha;2
+<li>1 &mu;L 2&alpha;2</li>
-</li>
-<li>1.2 &mu;L ligase buffer 10x
+<li>1.2 &mu;L ligase buffer 10x</li>
-</li>
-<li>1 &mu;L T4
+<li>1 &mu;L T4</li>
-</li>
-<li>1 &mu;L BsaI
+<li>1 &mu;L BsaI</li>
-</li>
-<li>4.2 &mu;L H20
+<li>4.2 &mu;L H20</li>
-</li>
-</ul><li>P35s:EaDAcT:T35s in 2&alpha;2
+</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li>
-</li>
-<ul><li>1 &mu;L P35s
+<ul><li>1 &mu;L P35s</li>
-</li>
-<li>1 &mu;L T35s
+<li>1 &mu;L T35s</li>
-</li>
-<li>1 &mu;L EaDAcT
+<li>1 &mu;L EaDAcT</li>
-</li>
-<li>1 &mu;L 2&alpha;2
+<li>1 &mu;L 2&alpha;2</li>
-</li>
-<li>1.2 &mu;L ligase buffer 10x
+<li>1.2 &mu;L ligase buffer 10x</li>
-</li>
-<li>1 &mu;L T4
+<li>1 &mu;L T4</li>
-</li>
-<li>1 &mu;L BsaI
+<li>1 &mu;L BsaI</li>
-</li>
-<li>4.2 &mu;L H20
+<li>4.2 &mu;L H20</li>
-</li>
 </ul></ul>
-<p>Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.
+<p>Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p>
-</p>
-<p>Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:
+<p>Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p>
-</p>
-<ul><li>Amp
+<ul><li>Amp</li>
-</li>
-<ul><li>pAtr&Delta;11 (6)
+<ul><li>pAtr&Delta;11 (6)</li>
-</li>
-<li>pEaDAcT (3)
+<li>pEaDAcT (3)</li>
-</li>
-<li>pHarFAR (3)
+<li>pHarFAR (3)</li>
-</li>
-</ul><li>Kan
+</ul><li>Kan</li>
-</li>
-<ul><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)
+<ul><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li>
-</li>
-<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)
+<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li>
-</li>
 </ul></ul>
@@ Line 1,341: / Line 1,018: @@
-<p>Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve.
+<p>Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p>
-</p>
-<p>The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80ºC.
+<p>The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80ºC.</p>
-</p>
@@ Line 1,355: / Line 1,030: @@
-<p>Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.
+<p>Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p>
-</p>
-<p>Digestions in silico.
+<p>Digestions in silico.</p>
-</p>
@@ Line 1,367: / Line 1,040: @@
 <table style="width:300px">
-<tr><td>Transcriptional units</td><td>Restriction enzymes</td><td>Expected bands
+<tr><td>Transcriptional units</td><td>Restriction enzymes</td><td>Expected bands</td></tr>
-</td></tr>
-<tr><td>P35s:Atr&Delta;11:T35s</td><td>EcoRI</td><td>6323, 2269
+<tr><td>P35s:Atr&Delta;11:T35s</td><td>EcoRI</td><td>6323, 2269</td></tr>
-</td></tr>
-<tr><td></td><td>NcoI</td><td>390, 8202
+<tr><td></td><td>NcoI</td><td>390, 8202</td></tr>
-</td></tr>
-<tr><td>P35s:HarFAR:T35s</td><td>HindIII</td><td>933, 6322, 1722
+<tr><td>P35s:HarFAR:T35s</td><td>HindIII</td><td>933, 6322, 1722</td></tr>
-</td></tr>
-<tr><td></td><td>NcoI</td><td>8587, 390
+<tr><td></td><td>NcoI</td><td>8587, 390</td></tr>
-</td></tr>
-<tr><td>P35s:EaDAcT:T35s</td><td>HindIII</td><td>6322, 2366
+<tr><td>P35s:EaDAcT:T35s</td><td>HindIII</td><td>6322, 2366</td></tr>
-</td></tr>
-<tr><td></td><td>EcoRV</td><td>683, 8021
+<tr><td></td><td>EcoRV</td><td>683, 8021</td></tr>
-</td></tr>
 </table>
@@ Line 1,392: / Line 1,058: @@
-<p>Preparation of reagents needed for genomic extraction of Candida tropicalis for FAO1.
+<p>Preparation of reagents needed for genomic extraction of Candida tropicalis for FAO1.</p>
-</p>
@@ Line 1,401: / Line 1,066: @@
-<p>Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.
+<p>Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p>
-</p>
@@ Line 1,412: / Line 1,076: @@
-<p>Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.
+<p>Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p>
-</p>
@@ Line 1,419: / Line 1,082: @@
 <table style="width:300px">
-<tr><td>Transcriptional unit </td><td>DNA concentration (ng/&mu;L)
+<tr><td>Transcriptional unit </td><td>DNA concentration (ng/&mu;L)</td></tr>
-</td></tr>
-<tr><td>P35s:Atr&Delta;11:T35s (1)</td><td>164 ng/&mu;L
+<tr><td>P35s:Atr&Delta;11:T35s (1)</td><td>164 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>P35s:Atr&Delta;11:T35s (2)</td><td>168 ng/&mu;L
+<tr><td>P35s:Atr&Delta;11:T35s (2)</td><td>168 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>P35s:Atr&Delta;11:T35s (3)</td><td>147.4 ng/&mu;L
+<tr><td>P35s:Atr&Delta;11:T35s (3)</td><td>147.4 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>P35s:HarFAR:T35s (1)</td><td>125.3 ng/&mu;L
+<tr><td>P35s:HarFAR:T35s (1)</td><td>125.3 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>P35s:HarFAR:T35s (2)</td><td>114.5 ng/&mu;L
+<tr><td>P35s:HarFAR:T35s (2)</td><td>114.5 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>P35s:HarFAR:T35s (3)</td><td>140.3 ng/&mu;L
+<tr><td>P35s:HarFAR:T35s (3)</td><td>140.3 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>P35s:EaDAcT:T35s (1)</td><td>144.2 ng/&mu;L
+<tr><td>P35s:EaDAcT:T35s (1)</td><td>144.2 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>P35s:EaDAcT:T35s (2)</td><td>137.9 ng/&mu;L
+<tr><td>P35s:EaDAcT:T35s (2)</td><td>137.9 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>P35s:EaDAcT:T35s (3)</td><td>128.5 ng/&mu;L
+<tr><td>P35s:EaDAcT:T35s (3)</td><td>128.5 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>Stuffer fragment</td><td>135.5 ng/&mu;L
+<tr><td>Stuffer fragment</td><td>135.5 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>2&Omega;1</td><td>196.8 ng/&mu;L
+<tr><td>2&Omega;1</td><td>196.8 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>2&Omega;2</td><td>175.4 ng/&mu;L
+<tr><td>2&Omega;2</td><td>175.4 ng/&mu;L</td></tr>
-</td></tr>
 </table>
@@ Line 1,462: / Line 1,112: @@
-<p>Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.
+<p>Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png
+<img src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png>
->
-<p>All digestions were correct except P35s:EaDAcT:T35s (2).
+<p>All digestions were correct except P35s:EaDAcT:T35s (2).</p>
-</p>
-<p>Ligation in &Omega; vectors.
+<p>Ligation in &Omega; vectors.</p>
-</p>
-<ul><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1
+<ul><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li>
-</li>
-<ul><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)
+<ul><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li>
-</li>
-<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)
+<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li>
-</li>
-<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)
+<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li>
-</li>
-<li>1 &mu;L BsmBI (5-10 ud)
+<li>1 &mu;L BsmBI (5-10 ud)</li>
-</li>
-<li>1 &mu;L T4 ligase (5-10 ud)
+<li>1 &mu;L T4 ligase (5-10 ud)</li>
-</li>
-<li>1 &mu;L buffer ligase (3 ud)
+<li>1 &mu;L buffer ligase (3 ud)</li>
-</li>
-<li>4 &mu;L H20
+<li>4 &mu;L H20</li>
-</li>
-</ul><li>P35s:EaDAcT:T35s in 2&Omega;2
+</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li>
-</li>
-<ul><li>1 &mu;L stuffer fragment (75 ng/&mu;L)
+<ul><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li>
-</li>
-<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)
+<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li>
-</li>
-<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)
+<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li>
-</li>
-<li>1 &mu;L BsmBI (5-10 ud)
+<li>1 &mu;L BsmBI (5-10 ud)</li>
-</li>
-<li>1 &mu;L T4 ligase (5-10 ud)
+<li>1 &mu;L T4 ligase (5-10 ud)</li>
-</li>
-<li>1 &mu;L buffer ligase (3 ud)
+<li>1 &mu;L buffer ligase (3 ud)</li>
-</li>
-<li>4 &mu;L H20
+<li>4 &mu;L H20</li>
-</li>
 </ul></ul>
-<p>Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).
+<p>Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).</p>
-</p>
-<p>Omega vectors include a resistance to spectinomycin.
+<p>Omega vectors include a resistance to spectinomycin.</p>
-</p>
@@ Line 1,546: / Line 1,174: @@
-<p>Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.
+<p>Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p>
-</p>
@@ Line 1,555: / Line 1,182: @@
-<p>Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).
+<p>Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p>
-</p>
@@ Line 1,564: / Line 1,190: @@
-<p>We made minipreps of yesterday's liquid culture. Selected tubes:
+<p>We made minipreps of yesterday's liquid culture. Selected tubes: </p>
-</p>
-<ul><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)
+<ul><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li>
-</li>
-<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)
+<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li>
-</li>
 </ul>
-<p>Additionally, we have cultured each of the colonies named above in order to store them.
+<p>Additionally, we have cultured each of the colonies named above in order to store them.</p>
-</p>
-<p>Digestions in silico made to check the transcriptional units:
+<p>Digestions in silico made to check the transcriptional units:</p>
-</p>
@@ Line 1,587: / Line 1,208: @@
 <table style="width:300px">
-<tr><td>Transcriptional units</td><td>Restriction enzyme</td><td>Expected bands
+<tr><td>Transcriptional units</td><td>Restriction enzyme</td><td>Expected bands</td></tr>
-</td></tr>
-<tr><td>P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td>EcoRV</td><td>9307, 2251
+<tr><td>P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td>EcoRV</td><td>9307, 2251</td></tr>
-</td></tr>
-<tr><td></td><td>BamHI</td><td>6652, 4906
+<tr><td></td><td>BamHI</td><td>6652, 4906</td></tr>
-</td></tr>
-<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>EcoRV</td><td>6652, 1044, 817, 683
+<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>EcoRV</td><td>6652, 1044, 817, 683</td></tr>
-</td></tr>
-<tr><td></td><td>NcoI</td><td>8806, 390
+<tr><td></td><td>NcoI</td><td>8806, 390</td></tr>
-</td></tr>
 </table>
@@ Line 1,606: / Line 1,222: @@
-<p>Digestion master mixes:
+<p>Digestion master mixes:</p>
-</p>
-<ul><li>Master mix for NotI
+<ul><li>Master mix for NotI</li>
-</li>
-<ul><li>1.5 &mu;L NotI
+<ul><li>1.5 &mu;L NotI</li>
-</li>
-<li>7.5 &mu;L Orange buffer
+<li>7.5 &mu;L Orange buffer</li>
-</li>
-<li>63 &mu;L H20
+<li>63 &mu;L H20</li>
-</li>
-</ul><li>Master mix for NcoI
+</ul><li>Master mix for NcoI</li>
-</li>
-<ul><li>1.5 &mu;L NcoI
+<ul><li>1.5 &mu;L NcoI</li>
-</li>
-<li>7.5 &mu;L Tango buffer
+<li>7.5 &mu;L Tango buffer</li>
-</li>
-<li>63 &mu;L H20
+<li>63 &mu;L H20</li>
-</li>
-</ul><li>Master mix for BamHI
+</ul><li>Master mix for BamHI</li>
-</li>
-<ul><li>2 &mu;L BamHI
+<ul><li>2 &mu;L BamHI</li>
-</li>
-<li>10 &mu;L Green buffer
+<li>10 &mu;L Green buffer</li>
-</li>
-<li>84 &mu;L H20
+<li>84 &mu;L H20</li>
-</li>
-</ul><li>Master mix for EcoRV
+</ul><li>Master mix for EcoRV</li>
-</li>
-<ul><li>4 &mu;L EcoRV
+<ul><li>4 &mu;L EcoRV</li>
-</li>
-<li>20 &mu;L Red buffer
+<li>20 &mu;L Red buffer</li>
-</li>
-<li>168 &mu;L H20
+<li>168 &mu;L H20</li>
-</li>
 </ul></ul>
-<p>Note: Trichome promoter digestion preparation included.
+<p>Note: Trichome promoter digestion preparation included. </p>
-</p>
-<p>All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S).
+<p>All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p>
-</p>
@@ Line 1,673: / Line 1,270: @@
-<img src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png
+<img src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png>
->
@@ Line 1,682: / Line 1,278: @@
-<p>Miniprep quantification:
+<p>Miniprep quantification:</p>
-</p>
@@ Line 1,689: / Line 1,284: @@
 <table style="width:300px">
-<tr><td>Piece</td><td>Tube</td><td>Concentration (ng/&mu;L)</td><td>Volume (&mu;L)
+<tr><td>Piece</td><td>Tube</td><td>Concentration (ng/&mu;L)</td><td>Volume (&mu;L)</td></tr>
-</td></tr>
-<tr><td>Trichome promoter in pUPD</td><td>1</td><td>317.1</td><td>26
+<tr><td>Trichome promoter in pUPD</td><td>1</td><td>317.1</td><td>26</td></tr>
-</td></tr>
-<tr><td>Trichome promoter in pUPD</td><td>3</td><td>354.8</td><td>32
+<tr><td>Trichome promoter in pUPD</td><td>3</td><td>354.8</td><td>32</td></tr>
-</td></tr>
-<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>1</td><td>350.7</td><td>33
+<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>1</td><td>350.7</td><td>33</td></tr>
-</td></tr>
-<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>2</td><td>271.1</td><td>33
+<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>2</td><td>271.1</td><td>33</td></tr>
-</td></tr>
-<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>1</td><td>306.3</td><td>31
+<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>1</td><td>306.3</td><td>31</td></tr>
-</td></tr>
-<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>2</td><td>296.6</td><td>28
+<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>2</td><td>296.6</td><td>28</td></tr>
-</td></tr>
-<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>3</td><td>246.0</td><td>33
+<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>3</td><td>246.0</td><td>33</td></tr>
-</td></tr>
 </table>
@@ Line 1,717: / Line 1,304: @@
-<p>All of the pieces named above were adjusted at 75 ng/&mu;L.
+<p>All of the pieces named above were adjusted at 75 ng/&mu;L.</p>
-</p>
@@ Line 1,724: / Line 1,310: @@
 <table style="width:300px">
-<tr><td>Piece </td><td>Tube number</td><td>Final Volume (&mu;L)</td><td>Volume to be added (&mu;L)
+<tr><td>Piece </td><td>Tube number</td><td>Final Volume (&mu;L)</td><td>Volume to be added (&mu;L)</td></tr>
-</td></tr>
-<tr><td>Trichome promoter in pUPD</td><td>1</td><td>109.93</td><td>83.93
+<tr><td>Trichome promoter in pUPD</td><td>1</td><td>109.93</td><td>83.93</td></tr>
-</td></tr>
-<tr><td>Trichome promoter in pUPD</td><td>3</td><td>151.40</td><td>119.4
+<tr><td>Trichome promoter in pUPD</td><td>3</td><td>151.40</td><td>119.4</td></tr>
-</td></tr>
-<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>1</td><td>154.30</td><td>121.3
+<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>1</td><td>154.30</td><td>121.3</td></tr>
-</td></tr>
-<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>2</td><td>119.30</td><td>86.30
+<tr><td>P35S:EaDAcT:T35S in 2&Omega;2</td><td>2</td><td>119.30</td><td>86.30</td></tr>
-</td></tr>
-<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>1</td><td>126.60</td><td>95.60
+<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>1</td><td>126.60</td><td>95.60</td></tr>
-</td></tr>
-<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>2</td><td>110.70</td><td>82.70
+<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>2</td><td>110.70</td><td>82.70</td></tr>
-</td></tr>
-<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>3</td><td>108.24</td><td>75.20
+<tr><td>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td>3</td><td>108.24</td><td>75.20</td></tr>
-</td></tr>
 </table>
@@ Line 1,754: / Line 1,332: @@
-<p>As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step.
+<p>As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p>
-</p>
-<p>We transformed the same TU in a E. coli competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight.
+<p>We transformed the same TU in a E. coli competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight. </p>
-</p>
-<p>Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:
+<p>Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p>
-</p>
-<p>With Amp:
+<p>With Amp:</p>
-</p>
-<ul><li>pTNos	(GB0037)
+<ul><li>pTNos	(GB0037)</li>
-</li>
-<li>pGFP	(GB0059)
+<li>pGFP	(GB0059)</li>
-</li>
-<li>pLuciferase	(GB0096)
+<li>pLuciferase	(GB0096)</li>
-</li>
 </ul>
-<p>With Kan:
+<p>With Kan:</p>
-</p>
-<ul><li>P35S:Rosea:TNos
+<ul><li>P35S:Rosea:TNos</li>
-</li>
-<li>TA29:Barnase:TNos (GoldenBraid 1.0 piece)
+<li>TA29:Barnase:TNos (GoldenBraid 1.0 piece)</li>
-</li>
 </ul>
-<p>Finally, in order to obtain the FAO1 gene, we want to extract the Candida tropicalis genome, so we have picked a colony of C. tropicalis. To check the extraction protocol, we used a yeast previously tested, Saccharomyces cerevisiae. We have cultured C. tropicalis in YPD media and S. cerevisiae in YPDA media at 28 ºC (5 mL).
+<p>Finally, in order to obtain the FAO1 gene, we want to extract the Candida tropicalis genome, so we have picked a colony of C. tropicalis. To check the extraction protocol, we used a yeast previously tested, Saccharomyces cerevisiae. We have cultured C. tropicalis in YPD media and S. cerevisiae in YPDA media at 28 ºC (5 mL).</p>
-</p>
@@ Line 1,803: / Line 1,370: @@
-<p>Candida genome extraction
+<p>Candida genome extraction</p>
-</p>
-<p>Saccharomyces cerevisiae is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.
+<p>Saccharomyces cerevisiae is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p>
-</p>
-<p>Cultures measured at 600 nm:
+<p>Cultures measured at 600 nm:</p>
-</p>
-<ul><li>S. cerevisiae	Abs = 1.07
+<ul><li>S. cerevisiae	Abs = 1.07 </li>
-</li>
-<li>C. tropicalis Abs = 0.39
+<li>C. tropicalis Abs = 0.39</li>
-</li>
 </ul>
-<p>S. cerevisiae is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of S. cerevisiae culture. The mix has to grow at 28 ºC until the exponential phase is reached.
+<p>S. cerevisiae is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of S. cerevisiae culture. The mix has to grow at 28 ºC until the exponential phase is reached. </p>
-</p>
-<p>The absorbance was measured again:
+<p>The absorbance was measured again:</p>
-</p>
-<ul><li>S. cerevisiae	Abs = 0.52
+<ul><li>S. cerevisiae	Abs = 0.52</li>
-</li>
-<li>C. tropicalis Abs = 0.40
+<li>C. tropicalis Abs = 0.40</li>
-</li>
 </ul>
-<p>Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:
+<p>Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p>
-</p>
-<ul><li>Grow yeast in 2 or 5 mL YPD to exponential phase.
+<ul><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li>
-</li>
-<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).
+<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li>
-</li>
-<li>Wash once with 1 mL sterile water.
+<li>Wash once with 1 mL sterile water.</li>
-</li>
-<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups.
+<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups. </li>
-</li>
-<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).
+<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li>
-</li>
-<li>Incubate at 65 ºC for 20 min and cool inmediately on ice.
+<li>Incubate at 65 ºC for 20 min and cool inmediately on ice.</li>
-</li>
-<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice.
+<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li>
-</li>
-<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.
+<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li>
-</li>
-<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.
+<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.</li>
-</li>
-<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s).
+<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li>
-</li>
-<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature).
+<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li>
-</li>
-<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.
+<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li>
-</li>
-<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer.
+<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li>
-</li>
-<li>Store chromosomal DNA at 4 ºC (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).
+<li>Store chromosomal DNA at 4 ºC (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li>
-</li>
 </ul>
-<p>Genomic quantification:
+<p>Genomic quantification:</p>
-</p>
@@ Line 1,896: / Line 1,438: @@
 <table style="width:300px">
-<tr><td>Organism</td><td>Concentration
+<tr><td>Organism</td><td>Concentration </td></tr>
-</td></tr>
-<tr><td>S. cerevisiae</td><td>72.2 ng/&mu;L
+<tr><td>S. cerevisiae</td><td>72.2 ng/&mu;L</td></tr>
-</td></tr>
-<tr><td>C. tropicalis</td><td>1397.1 ng/&mu;L
+<tr><td>C. tropicalis</td><td>1397.1 ng/&mu;L</td></tr>
-</td></tr>
 </table>
@@ Line 1,909: / Line 1,448: @@
-<p>Electrophoresis made to check the extraction quality was correct.
+<p>Electrophoresis made to check the extraction quality was correct. </p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png
+<img src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png>
->
-<p>We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.
+<p>We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p>
-</p>
-<p>EaDAcT and collection pieces made yesterday were recultured in liquid media.
+<p>EaDAcT and collection pieces made yesterday were recultured in liquid media.</p>
-</p>
@@ Line 1,933: / Line 1,468: @@
-<p>The genomic quality of both organisms (C. tropicalis and S. cerevisiae) was checked in an agarose gel again.
+<p>The genomic quality of both organisms (C. tropicalis and S. cerevisiae) was checked in an agarose gel again.</p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png
+<img src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png>
->
-<p>We got the Candida genome band, however, the Saccharomyces genome band was not present.
+<p>We got the Candida genome band, however, the Saccharomyces genome band was not present.</p>
-</p>
@@ Line 1,950: / Line 1,482: @@
-<p>Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate.
+<p>Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p>
-</p>
-<ul><li>P35S:EaDAcT:T35S in 2&Omega;2 (tubes 1, 2, 3)
+<ul><li>P35S:EaDAcT:T35S in 2&Omega;2 (tubes 1, 2, 3)</li>
-</li>
-<li>Collection pieces:
+<li>Collection pieces:</li>
-</li>
-<ul><li>pTNos (GB0037)
+<ul><li>pTNos (GB0037) </li>
-</li>
-<li>pGFP (GB0059)
+<li>pGFP (GB0059) </li>
-</li>
-<li>pLuciferase (GB0096)
+<li>pLuciferase (GB0096)</li>
-</li>
-<li>P35:Rosea:TNos
+<li>P35:Rosea:TNos</li>
-</li>
-<li>TA29:Barnase:TNos
+<li>TA29:Barnase:TNos</li>
-</li>
 </ul></ul>
-<p>Miniprep checking is going to be done tomorrow.
+<p>Miniprep checking is going to be done tomorrow.</p>
-</p>
@@ Line 1,987: / Line 1,510: @@
-<p>Digestions in silico made for checking yesterday's minipreps:
+<p>Digestions in silico made for checking yesterday's minipreps:</p>
-</p>
@@ Line 1,994: / Line 1,516: @@
 <table style="width:300px">
-<tr><td>Pieces/TU</td><td>Restriction enzyme</td><td>Expected bands
+<tr><td>Pieces/TU</td><td>Restriction enzyme</td><td>Expected bands</td></tr>
-</td></tr>
-<tr><td>P35S:EaDAcT:T35S</td><td>EcoRV</td><td>6652, 1044, 817, 683
+<tr><td>P35S:EaDAcT:T35S</td><td>EcoRV</td><td>6652, 1044, 817, 683</td></tr>
-</td></tr>
-<tr><td></td><td>NcoI</td><td>8806, 390
+<tr><td></td><td>NcoI</td><td>8806, 390</td></tr>
-</td></tr>
-<tr><td>pTNos</td><td>NotI</td><td>2981, 570
+<tr><td>pTNos</td><td>NotI</td><td>2981, 570</td></tr>
-</td></tr>
-<tr><td>pGFP</td><td>NotI</td><td>2981, 795
+<tr><td>pGFP</td><td>NotI</td><td>2981, 795</td></tr>
-</td></tr>
-<tr><td>pLuciferase</td><td>NotI</td><td>2981, 1731
+<tr><td>pLuciferase</td><td>NotI</td><td>2981, 1731</td></tr>
-</td></tr>
-<tr><td>P35S:Rosea:TNos</td><td>BglII</td><td>2495, 2302
+<tr><td>P35S:Rosea:TNos</td><td>BglII</td><td>2495, 2302</td></tr>
-</td></tr>
-<tr><td></td><td>NcoI</td><td>4407, 390
+<tr><td></td><td>NcoI</td><td>4407, 390</td></tr>
-</td></tr>
-<tr><td>TA29:Barnase:TNos</td><td>BglII</td><td>2825, 2245
+<tr><td>TA29:Barnase:TNos</td><td>BglII</td><td>2825, 2245</td></tr>
-</td></tr>
 </table>
@@ Line 2,025: / Line 1,538: @@
-<p>Digestion master mixes:
+<p>Digestion master mixes:</p>
-</p>
-<ul><li>Master mix for NotI
+<ul><li>Master mix for NotI</li>
-</li>
-<ul><li>2 &mu;L NotI
+<ul><li>2 &mu;L NotI</li>
-</li>
-<li>10 &mu;L Orange buffer
+<li>10 &mu;L Orange buffer</li>
-</li>
-<li>84 &mu;L H20
+<li>84 &mu;L H20</li>
-</li>
-</ul><li>Master mix for NcoI
+</ul><li>Master mix for NcoI</li>
-</li>
-<ul><li>2 &mu;L NcoI
+<ul><li>2 &mu;L NcoI</li>
-</li>
-<li>10 &mu;L Tango buffer
+<li>10 &mu;L Tango buffer</li>
-</li>
-<li>84 &mu;L H20
+<li>84 &mu;L H20</li>
-</li>
-</ul><li>Master mix for BglII
+</ul><li>Master mix for BglII</li>
-</li>
-<ul><li>2 &mu;L BglII
+<ul><li>2 &mu;L BglII</li>
-</li>
-<li>10 &mu;L Orange buffer
+<li>10 &mu;L Orange buffer</li>
-</li>
-<li>84 &mu;L H20
+<li>84 &mu;L H20</li>
-</li>
-</ul><li>Master mix for EcoRV
+</ul><li>Master mix for EcoRV</li>
-</li>
-<ul><li>1.5 &mu;L EcoRV
+<ul><li>1.5 &mu;L EcoRV</li>
-</li>
-<li>7.5 &mu;L Red buffer
+<li>7.5 &mu;L Red buffer</li>
-</li>
-<li>63 &mu;L H20
+<li>63 &mu;L H20</li>
-</li>
 </ul></ul>
-<p>An agarose gel was made to check the transcriptional unit and the other pieces:
+<p>An agarose gel was made to check the transcriptional unit and the other pieces:</p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png
+<img src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png>
->
-<p>All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.
+<p>All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p>
-</p>
@@ Line 2,099: / Line 1,592: @@
-<p>Once the Candida tropicalis genome DNA is obtained, the FAO1 gene can be amplified by PCR.
+<p>Once the Candida tropicalis genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p>
-</p>
-<p>PCR reaction reagents:
+<p>PCR reaction reagents:</p>
-</p>
-<ul><li>FAO1-PCR1
+<ul><li>FAO1-PCR1</li>
-</li>
-<ul><li>Genomic	0.5 &mu;L
+<ul><li>Genomic	0.5 &mu;L</li>
-</li>
-<li>Buffer HF (5X)	10.0 &mu;L
+<li>Buffer HF (5X)	10.0 &mu;L</li>
-</li>
-<li>dNTPs	2.0 &mu;L
+<li>dNTPs	2.0 &mu;L</li>
-</li>
-<li>Oligo R (JUL06)	2.5 &mu;L
+<li>Oligo R (JUL06)	2.5 &mu;L</li>
-</li>
-<li>Oligo F (JUL05)	2.5 &mu;L
+<li>Oligo F (JUL05)	2.5 &mu;L</li>
-</li>
-<li>Phusion polymerase	0.5 &mu;L
+<li>Phusion polymerase	0.5 &mu;L</li>
-</li>
-<li>H2O	32.0 &mu;L
+<li>H2O	32.0 &mu;L</li>
-</li>
-</ul><li>FAO1-PCR2
+</ul><li>FAO1-PCR2</li>
-</li>
-<ul><li>Genomic	0.5 &mu;L
+<ul><li>Genomic	0.5 &mu;L</li>
-</li>
-<li>Buffer HF (5X)	10.0 &mu;L
+<li>Buffer HF (5X)	10.0 &mu;L</li>
-</li>
-<li>dNTPs	2.0 &mu;L
+<li>dNTPs	2.0 &mu;L</li>
-</li>
-<li>Oligo R (JUL08)	2.5 &mu;L
+<li>Oligo R (JUL08)	2.5 &mu;L</li>
-</li>
-<li>Oligo F (JUL07)	2.5 &mu;L
+<li>Oligo F (JUL07)	2.5 &mu;L</li>
-</li>
-<li>Phusion polymerase	0.5 &mu;L
+<li>Phusion polymerase	0.5 &mu;L</li>
-</li>
-<li>H2O	32.0 &mu;L
+<li>H2O	32.0 &mu;L</li>
-</li>
 </ul></ul>
@@ Line 2,161: / Line 1,636: @@
-<p>Annealing temperatures
+<p>Annealing temperatures</p>
-</p>
-<ul><li>FAO1-PCR1: 59 ºC
+<ul><li>FAO1-PCR1: 59 ºC</li>
-</li>
-<li>FAO1-PCR2: 64 ºC
+<li>FAO1-PCR2: 64 ºC</li>
-</li>
 </ul>
-<p>PCR products were checked using an electrophoresis. Expected bands:
+<p>PCR products were checked using an electrophoresis. Expected bands:</p>
-</p>
-<ul><li>FAO1-PCR1: 1157 bp
+<ul><li>FAO1-PCR1: 1157 bp</li>
-</li>
-<li>FAO1-PCR2: 1015 bp
+<li>FAO1-PCR2: 1015 bp</li>
-</li>
 </ul>
-<img src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png
+<img src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png>
->
-<p>Both FAO1 PCR products were not correct.
+<p>Both FAO1 PCR products were not correct.</p>
-</p>
-<p>As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:
+<p>As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p>
-</p>
@@ Line 2,202: / Line 1,668: @@
 <table style="width:300px">
-<tr><td>Reagent</td><td>Volume
+<tr><td>Reagent</td><td>Volume</td></tr>
-</td></tr>
-<tr><td>Trichome promoter</td><td>1 &mu;L
+<tr><td>Trichome promoter</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>GFP</td><td>1 &mu;L
+<tr><td>GFP</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>TNos</td><td>1 &mu;L
+<tr><td>TNos</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>BsaI</td><td>1 &mu;L
+<tr><td>BsaI</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>p2&alpha;2</td><td>1 &mu;L
+<tr><td>p2&alpha;2</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>T4 ligase</td><td>1 &mu;L
+<tr><td>T4 ligase</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>Ligase buffer</td><td>1 &mu;L
+<tr><td>Ligase buffer</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>H2O</td><td>3 &mu;L
+<tr><td>H2O</td><td>3 &mu;L</td></tr>
-</td></tr>
-<tr><td>Total Volume</td><td>10 &mu;L
+<tr><td>Total Volume</td><td>10 &mu;L</td></tr>
-</td></tr>
 </table>
@@ Line 2,240: / Line 1,696: @@
-<p>As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:
+<p>As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p>
-</p>
@@ Line 2,247: / Line 1,702: @@
 <table style="width:300px">
-<tr><td>Reagent</td><td>FAO1-PCR1</td><td>FAO1-PCR2
+<tr><td>Reagent</td><td>FAO1-PCR1</td><td>FAO1-PCR2</td></tr>
-</td></tr>
-<tr><td>C. tropicalis genome</td><td>2.5 &mu;L</td><td>2.5 &mu;L
+<tr><td>C. tropicalis genome</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>HF Buffer</td><td>30 &mu;L</td><td>30 &mu;L
+<tr><td>HF Buffer</td><td>30 &mu;L</td><td>30 &mu;L</td></tr>
-</td></tr>
-<tr><td>dNTPs</td><td>10 &mu;L</td><td>10 &mu;L
+<tr><td>dNTPs</td><td>10 &mu;L</td><td>10 &mu;L</td></tr>
-</td></tr>
-<tr><td>Oligo R</td><td>12.5 &mu;L</td><td>12.5 &mu;L
+<tr><td>Oligo R</td><td>12.5 &mu;L</td><td>12.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>Oligo F</td><td>12.5 &mu;L</td><td>12.5 &mu;L
+<tr><td>Oligo F</td><td>12.5 &mu;L</td><td>12.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>Phusion polymerase</td><td>1.5 &mu;L</td><td>1.5 &mu;L
+<tr><td>Phusion polymerase</td><td>1.5 &mu;L</td><td>1.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>H2O</td><td>181 &mu;L</td><td>181 &mu;L
+<tr><td>H2O</td><td>181 &mu;L</td><td>181 &mu;L</td></tr>
-</td></tr>
 </table>
@@ Line 2,275: / Line 1,722: @@
-<p>PCR temperatures, 25 cycles:
+<p>PCR temperatures, 25 cycles:</p>
-</p>
@@ Line 2,282: / Line 1,728: @@
 <table style="width:300px">
-<tr><td>Step</td><td>Temperature (ºC)</td><td>Time
+<tr><td>Step</td><td>Temperature (ºC)</td><td>Time </td></tr>
-</td></tr>
-<tr><td>Initialization</td><td>98</td><td>2 min
+<tr><td>Initialization</td><td>98</td><td>2 min</td></tr>
-</td></tr>
-<tr><td>Denaturation</td><td>98</td><td>20 s
+<tr><td>Denaturation</td><td>98</td><td>20 s</td></tr>
-</td></tr>
-<tr><td>Annealing</td><td>50, 55, 60, 65</td><td>??
+<tr><td>Annealing</td><td>50, 55, 60, 65</td><td>??</td></tr>
-</td></tr>
-<tr><td>Extension</td><td>72</td><td>45 s
+<tr><td>Extension</td><td>72</td><td>45 s</td></tr>
-</td></tr>
-<tr><td>Final elongation</td><td>72</td><td>7 min
+<tr><td>Final elongation</td><td>72</td><td>7 min</td></tr>
-</td></tr>
 </table>
@@ Line 2,304: / Line 1,744: @@
-<p>We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product.
+<p>We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p>
-</p>
-<p>EaDAcT Transcriptional Unit (TU) transformation
+<p>EaDAcT Transcriptional Unit (TU) transformation</p>
-</p>
-<p>Using an electrocompetent E. coli strain (DH5&alpha;) and 1.5 ul ligation (P35S:EaDAcT:T35S in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 ºC with agitation.
+<p>Using an electrocompetent E. coli strain (DH5&alpha;) and 1.5 ul ligation (P35S:EaDAcT:T35S in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 ºC with agitation. </p>
-</p>
@@ Line 2,335: / Line 1,772: @@
-<p>Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.
+<p>Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p>
-</p>
-<ul><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.
+<ul><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li>
-</li>
-<li>Introduce the disks inside the tube.
+<li>Introduce the disks inside the tube.</li>
-</li>
-<li>Introduce the two tubes in liquid nitrogen.
+<li>Introduce the two tubes in liquid nitrogen.</li>
-</li>
-<li>Remove them from the liquid nitrogen and store at -80ºC until use.
+<li>Remove them from the liquid nitrogen and store at -80ºC until use.</li>
-</li>
-<li>Remove one tube from -80ºC and re-introduce them in liquid nitrogen.
+<li>Remove one tube from -80ºC and re-introduce them in liquid nitrogen. </li>
-</li>
-<li>Grind the disks.
+<li>Grind the disks.</li>
-</li>
-<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65ºC.)
+<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65ºC.)</li>
-</li>
-<li>Grind the mixture.
+<li>Grind the mixture.</li>
-</li>
-<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer).
+<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li>
-</li>
-<li>Vortex it and maintain at 65ºC for 45 min. Mix it by inversion 5-15 min.
+<li>Vortex it and maintain at 65ºC for 45 min. Mix it by inversion 5-15 min.</li>
-</li>
-<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.
+<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li>
-</li>
-<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.
+<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li>
-</li>
-<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).
+<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li>
-</li>
-<li>Repeat the last three steps.
+<li>Repeat the last three steps.</li>
-</li>
-<li>Add one volume o isopropanol and mix well by inversion (10 times).
+<li>Add one volume o isopropanol and mix well by inversion (10 times). </li>
-</li>
-<li>To precipitate, maintain 20 min on ice or at -80ºC during 5 min.
+<li>To precipitate, maintain 20 min on ice or at -80ºC during 5 min.</li>
-</li>
-<li>Centrifuge 10 min at 13000 rpm (4ºC).
+<li>Centrifuge 10 min at 13000 rpm (4ºC).</li>
-</li>
-<li>Discard the supernatant by decantation (be carefull with the pellet).
+<li>Discard the supernatant by decantation (be carefull with the pellet).</li>
-</li>
-<li>Wash with 600 &mu;L ethanol (80%).
+<li>Wash with 600 &mu;L ethanol (80%).</li>
-</li>
-<li>Centrifuge 5 min at 13000 rpm.
+<li>Centrifuge 5 min at 13000 rpm. </li>
-</li>
-<li>Discard the ethanol by pipeting and let it dry a few minutes.
+<li>Discard the ethanol by pipeting and let it dry a few minutes. </li>
-</li>
-<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.
+<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li>
-</li>
-<li>Store at -20ºC.
+<li>Store at -20ºC.  </li>
-</li>
 </ul>
-<p>Measurement of genomic concentration with nanodrop.
+<p>Measurement of genomic concentration with nanodrop.</p>
-</p>
-<ul><li>Tabacco 1: 182 ng/&mu;L (Thrown away)
+<ul><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li>
-</li>
-<li>Tabacco 2: 620 ng/&mu;L (Stored at -20ÂºC)
+<li>Tabacco 2: 620 ng/&mu;L (Stored at -20ÂºC)</li>
-</li>
 </ul>
-<p>Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).
+<p>Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png
+<img src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png>
->
-<p>It is correct.
+<p>It is correct.</p>
-</p>
@@ Line 2,443: / Line 1,850: @@
-<p>PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.
+<p>PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p>
-</p>
-<p>Ordered primers
+<p>Ordered primers</p>
-</p>
-<ul><li>IGEMJULO1
+<ul><li>IGEMJULO1</li>
-</li>
-<li>IGEMJULO2
+<li>IGEMJULO2</li>
-</li>
 </ul>
-<p>Ajust primers to a 100 uM concentration:
+<p>Ajust primers to a 100 uM concentration:</p>
-</p>
-<ul><li>IGEMJUL01 + 566 &mu;L miliQ H2O
+<ul><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li>
-</li>
-<li>IGEMJUL02 + 691 &mu;L miliQ H2O
+<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li>
-</li>
 </ul>
-<p>Use a 1:10 alicuot for PCR (10 uM).
+<p>Use a 1:10 alicuot for PCR (10 uM).</p>
-</p>
-<p>Reagents needed for PCR:
+<p>Reagents needed for PCR:</p>
-</p>
-<ul><li>0.5 &mu;L template
+<ul><li>0.5 &mu;L template</li>
-</li>
-<li>10 &mu;L buffer HF 5x
+<li>10 &mu;L buffer HF 5x</li>
-</li>
-<li>2 &mu;L dNTPs
+<li>2 &mu;L dNTPs</li>
-</li>
-<li>2.5 &mu;L oligo R
+<li>2.5 &mu;L oligo R</li>
-</li>
-<li>2.5 &mu;L oligo F
+<li>2.5 &mu;L oligo F</li>
-</li>
-<li>0.5 &mu;L Pfu
+<li>0.5 &mu;L Pfu</li>
-</li>
-<li>32 &mu;L miliQ H2O
+<li>32 &mu;L miliQ H2O</li>
-</li>
 </ul>
-<p>Final volume: 50 &mu;L
+<p>Final volume: 50 &mu;L</p>
-</p>
-<p>Parameters:
+<p>Parameters:</p>
-</p>
-<ul><li>98 ºC (2 min)
+<ul><li>98 ºC (2 min)</li>
-</li>
-<li>35 cycles
+<li>35 cycles</li>
-</li>
-<ul><li>98 ºC (10 sec)
+<ul><li>98 ºC (10 sec)</li>
-</li>
-<li>59 ºC (15 sec)
+<li>59 ºC (15 sec)</li>
-</li>
-<li>72 ºC (45 sec)
+<li>72 ºC (45 sec)</li>
-</li>
-</ul><li>72 ºC (7 min)
+</ul><li>72 ºC (7 min)</li>
-</li>
 </ul>
-<img src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png
+<img src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png>
->
-<p>We didn't get PCR product.
+<p>We didn't get PCR product.</p>
-</p>
@@ Line 2,551: / Line 1,932: @@
-<p>Repeat PCR with different parameters.
+<p>Repeat PCR with different parameters.</p>
-</p>
@@ Line 2,558: / Line 1,938: @@
 <table style="width:300px">
-<tr><td> </td><td>1 </td><td>2 </td><td>3 </td><td>4 </td><td>5
+<tr><td> </td><td>1 </td><td>2 </td><td>3 </td><td>4 </td><td>5</td></tr>
-</td></tr>
-<tr><td>Template</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L
+<tr><td>Template</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>Buffer (5x)</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L
+<tr><td>Buffer (5x)</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>dNTPs</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L
+<tr><td>dNTPs</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td><td>2 &mu;L</td></tr>
-</td></tr>
-<tr><td>Oligo R</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L
+<tr><td>Oligo R</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>Oligo F</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L
+<tr><td>Oligo F</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>Phu</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L
+<tr><td>Phu</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>Buffer</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L
+<tr><td>Buffer</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td><td>32 &mu;L</td></tr>
-</td></tr>
 </table>
@@ Line 2,586: / Line 1,958: @@
-<p>1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.
+<p>1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p>
-</p>
-<p>PCR parameters
+<p>PCR parameters</p>
-</p>
-<ul><li>98 ºC (2 min)
+<ul><li>98 ºC (2 min)</li>
-</li>
-<li>35 cycles
+<li>35 cycles</li>
-</li>
-<ul><li>98 ºC (10 sec)
+<ul><li>98 ºC (10 sec)</li>
-</li>
-<li>1, 3, 5 -> 59 ºC (15 sec). 2, 4 -> 55 ºC (15 sec)
+<li>1, 3, 5 -> 59 ºC (15 sec). 2, 4 -> 55 ºC (15 sec)</li>
-</li>
-<li>72 ºC (45 sec)
+<li>72 ºC (45 sec)</li>
-</li>
-</ul><li>72 ºC (7 min)
+</ul><li>72 ºC (7 min)</li>
-</li>
 </ul>
-<img src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png
+<img src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png>
->
-<p>No PCR products again.
+<p>No PCR products again.</p>
-</p>
-<p>Repeat PCR again with other parameters.
+<p>Repeat PCR again with other parameters.</p>
-</p>
@@ Line 2,633: / Line 1,994: @@
 <table style="width:300px">
-<tr><td> </td><td>Buffer HF </td><td>Buffer GC
+<tr><td> </td><td>Buffer HF </td><td>Buffer GC</td></tr>
-</td></tr>
-<tr><td>Template</td><td>2 &mu;L</td><td>2 &mu;L
+<tr><td>Template</td><td>2 &mu;L</td><td>2 &mu;L</td></tr>
-</td></tr>
-<tr><td>Buffer (5x)</td><td>40 &mu;L</td><td>40 &mu;L
+<tr><td>Buffer (5x)</td><td>40 &mu;L</td><td>40 &mu;L</td></tr>
-</td></tr>
-<tr><td>dNTPs</td><td>8 &mu;L</td><td>8 &mu;L
+<tr><td>dNTPs</td><td>8 &mu;L</td><td>8 &mu;L</td></tr>
-</td></tr>
-<tr><td>Oligo R</td><td>10 &mu;L</td><td>10 &mu;L
+<tr><td>Oligo R</td><td>10 &mu;L</td><td>10 &mu;L</td></tr>
-</td></tr>
-<tr><td>Oligo F</td><td>10 &mu;L</td><td>10 &mu;L
+<tr><td>Oligo F</td><td>10 &mu;L</td><td>10 &mu;L</td></tr>
-</td></tr>
-<tr><td>Phu</td><td>2</td><td>2 &mu;L &mu;L
+<tr><td>Phu</td><td>2</td><td>2 &mu;L &mu;L</td></tr>
-</td></tr>
-<tr><td>Buffer</td><td>128 &mu;L</td><td>128 &mu;L
+<tr><td>Buffer</td><td>128 &mu;L</td><td>128 &mu;L</td></tr>
-</td></tr>
 </table>
@@ Line 2,661: / Line 2,014: @@
-<p>Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.
+<p>Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p>
-</p>
-<ul><li>98 ºC (2 min)
+<ul><li>98 ºC (2 min)</li>
-</li>
-<li>35 cycles
+<li>35 cycles</li>
-</li>
-<ul><li>98 ºC (10 sec)
+<ul><li>98 ºC (10 sec)</li>
-</li>
-<li>49, 52, 55, 60 ºC (15 sec)
+<li>49, 52, 55, 60 ºC (15 sec)</li>
-</li>
-<li>72 ºC (45 sec)
+<li>72 ºC (45 sec)</li>
-</li>
-</ul><li>72 ºC (7 min)
+</ul><li>72 ºC (7 min)</li>
-</li>
 </ul>
-<img src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png
+<img src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png>
->
-<p>No PCR products again.
+<p>No PCR products again.</p>
-</p>
@@ Line 2,700: / Line 2,044: @@
-<p>Repeat PCR again with more genomic.
+<p>Repeat PCR again with more genomic.</p>
-</p>
@@ Line 2,707: / Line 2,050: @@
 <table style="width:300px">
-<tr><td>Buffer HF </td><td>Buffer GC
+<tr><td>Buffer HF </td><td>Buffer GC</td></tr>
-</td></tr>
-<tr><td>Template</td><td>5</td><td>5
+<tr><td>Template</td><td>5</td><td>5</td></tr>
-</td></tr>
-<tr><td>Buffer (5x)</td><td>50</td><td>50
+<tr><td>Buffer (5x)</td><td>50</td><td>50</td></tr>
-</td></tr>
-<tr><td>dNTPs</td><td>10</td><td>10
+<tr><td>dNTPs</td><td>10</td><td>10</td></tr>
-</td></tr>
-<tr><td>Oligo R</td><td>12.5</td><td>12.5
+<tr><td>Oligo R</td><td>12.5</td><td>12.5</td></tr>
-</td></tr>
-<tr><td>Oligo F</td><td>12.5</td><td>12.5
+<tr><td>Oligo F</td><td>12.5</td><td>12.5</td></tr>
-</td></tr>
-<tr><td>Phu</td><td>2.5</td><td>2.5
+<tr><td>Phu</td><td>2.5</td><td>2.5</td></tr>
-</td></tr>
-<tr><td>Buffer</td><td>107.5</td><td>107.5
+<tr><td>Buffer</td><td>107.5</td><td>107.5</td></tr>
-</td></tr>
 </table>
@@ Line 2,735: / Line 2,070: @@
-<p>Same parameters as before except annealing temperatures which are: 50, 53, 57, 59  ºC.
+<p>Same parameters as before except annealing temperatures which are: 50, 53, 57, 59  ºC.</p>
-</p>
-<img src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png
+<img src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png>
->
-<p>We still without having any amplification.
+<p>We still without having any amplification.</p>
-</p>
@@ Line 2,754: / Line 2,086: @@
-<p>Repeat the PCR with other enzyme.
+<p>Repeat the PCR with other enzyme.</p>
-</p>
-<ul><li>12.5 &mu;L Q5 Master mix (2x).
+<ul><li>12.5 &mu;L Q5 Master mix (2x).</li>
-</li>
-<li>1.25 &mu;L forward primer 10 uM
+<li>1.25 &mu;L forward primer 10 uM</li>
-</li>
-<li>1.25 &mu;L reverse primer 10 uM
+<li>1.25 &mu;L reverse primer 10 uM</li>
-</li>
-<li>0.5 &mu;L template 620 ng/&mu;L
+<li>0.5 &mu;L template 620 ng/&mu;L</li>
-</li>
-<li>9.5 &mu;L H2O
+<li>9.5 &mu;L H2O</li>
-</li>
 </ul>
-<p>Set 4 reactions at 50, 53, 55, 59 ºC.
+<p>Set 4 reactions at 50, 53, 55, 59 ºC.</p>
-</p>
-<ul><li>98 ºC (30 sec)
+<ul><li>98 ºC (30 sec)</li>
-</li>
-<li>35 cycles
+<li>35 cycles</li>
-</li>
-<ul><li>98 ºC (10 sec)
+<ul><li>98 ºC (10 sec)</li>
-</li>
-<li>50, 53, 55, 59 ºC (15 sec)
+<li>50, 53, 55, 59 ºC (15 sec)</li>
-</li>
-<li>72 ºC (45 sec)
+<li>72 ºC (45 sec)</li>
-</li>
-</ul><li>72 ºC (2 min)
+</ul><li>72 ºC (2 min)</li>
-</li>
 </ul>
-<img src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png
+<img src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png>
->
-<p>The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 ºC reactions.
+<p>The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 ºC reactions.</p>
-</p>
@@ Line 2,815: / Line 2,132: @@
-<p>Trichome promoter PCR product ligation in pUPD.
+<p>Trichome promoter PCR product ligation in pUPD.</p>
-</p>
-<ul><li>1 &mu;L pUPD
+<ul><li>1 &mu;L pUPD</li>
-</li>
-<li>1 &mu;L PCR product
+<li>1 &mu;L PCR product</li>
-</li>
-<li>1 &mu;L BsmBI (5-10 ud)
+<li>1 &mu;L BsmBI (5-10 ud)</li>
-</li>
-<li>1 &mu;L T4 ligase (5-10 ud)
+<li>1 &mu;L T4 ligase (5-10 ud)</li>
-</li>
-<li>1.2 &mu;L buffer ligase (3 ud)
+<li>1.2 &mu;L buffer ligase (3 ud)</li>
-</li>
-<li>6.8 &mu;L H20
+<li>6.8 &mu;L H20</li>
-</li>
 </ul>
-<p>Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).
+<p>Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).</p>
-</p>
@@ Line 2,849: / Line 2,158: @@
-<p>Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.
+<p>Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p>
-</p>
@@ Line 2,858: / Line 2,166: @@
-<p>We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.
+<p>We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p>
-</p>
@@ Line 2,867: / Line 2,174: @@
-<p>We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media.
+<p>We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p>
-</p>
-<p>Digestions in silico made to check the insertion:
+<p>Digestions in silico made to check the insertion:</p>
-</p>
@@ Line 2,879: / Line 2,184: @@
 <table style="width:300px">
-<tr><td>Piece</td><td>Restriction enzyme</td><td>Expected bands
+<tr><td>Piece</td><td>Restriction enzyme</td><td>Expected bands</td></tr>
-</td></tr>
-<tr><td>Trichome Promoter in pUPD</td><td>NotI</td><td>2981, 1523
+<tr><td>Trichome Promoter in pUPD</td><td>NotI</td><td>2981, 1523</td></tr>
-</td></tr>
-<tr><td></td><td>EcoRV</td><td>3942, 562
+<tr><td></td><td>EcoRV</td><td>3942, 562</td></tr>
-</td></tr>
 </table>
@@ Line 2,892: / Line 2,194: @@
-<p>Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.
+<p>Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p>
-</p>
@@ Line 2,901: / Line 2,202: @@
-<p>Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.
+<p>Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p>
-</p>
@@ Line 2,910: / Line 2,210: @@
-<p>Results of sequencing the promoter were obtained:
+<p>Results of sequencing the promoter were obtained:</p>
-</p>
@@ Line 2,917: / Line 2,216: @@
 <table style="width:300px">
-<tr><td>Mutation</td><td>Position
+<tr><td>Mutation</td><td>Position</td></tr>
-</td></tr>
-<tr><td>T insertion</td><td>??
+<tr><td>T insertion</td><td>??</td></tr>
-</td></tr>
-<tr><td>T insertion</td><td>??
+<tr><td>T insertion</td><td>??</td></tr>
-</td></tr>
 </table>
@@ Line 2,934: / Line 2,230: @@
-<p>Collection pieces were quantified (minipreps made on 07/24/2014, see the Biosynthesis part for further details).
+<p>Collection pieces were quantified (minipreps made on 07/24/2014, see the Biosynthesis part for further details).</p>
-</p>
@@ Line 2,941: / Line 2,236: @@
 <table style="width:300px">
-<tr><td>Piece</td><td>Concentration (ng/&mu;L)</td><td>Initial Volume (&mu;L)</td><td>Final Volume (&mu;L)
+<tr><td>Piece</td><td>Concentration (ng/&mu;L)</td><td>Initial Volume (&mu;L)</td><td>Final Volume (&mu;L)</td></tr>
-</td></tr>
-<tr><td>GFP</td><td>318.8</td><td>35</td><td>148.8
+<tr><td>GFP</td><td>318.8</td><td>35</td><td>148.8</td></tr>
-</td></tr>
-<tr><td>Tnos</td><td>400.8</td><td>35</td><td>186.5
+<tr><td>Tnos</td><td>400.8</td><td>35</td><td>186.5</td></tr>
-</td></tr>
 </table>
@@ Line 2,954: / Line 2,246: @@
-<p>The following table shows ligation details of the trichome promoter:
+<p>The following table shows ligation details of the trichome promoter:</p>
-</p>
@@ Line 2,961: / Line 2,252: @@
 <table style="width:300px">
-<tr><td>Reagent</td><td>Volume
+<tr><td>Reagent</td><td>Volume</td></tr>
-</td></tr>
-<tr><td>Trichome promoter</td><td>1 &mu;L
+<tr><td>Trichome promoter</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>GFP</td><td>1 &mu;L
+<tr><td>GFP</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>TNos</td><td>1 &mu;L
+<tr><td>TNos</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>BsaI</td><td>1 &mu;L
+<tr><td>BsaI</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>p2&alpha;2</td><td>1 &mu;L
+<tr><td>p2&alpha;2</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>T4 ligase</td><td>1 &mu;L
+<tr><td>T4 ligase</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>Ligase buffer</td><td>1 &mu;L
+<tr><td>Ligase buffer</td><td>1 &mu;L</td></tr>
-</td></tr>
-<tr><td>H2O</td><td>3 &mu;L
+<tr><td>H2O</td><td>3 &mu;L</td></tr>
-</td></tr>
-<tr><td>Total Volume</td><td>10 &mu;L
+<tr><td>Total Volume</td><td>10 &mu;L</td></tr>
-</td></tr>
 </table>
@@ Line 2,999: / Line 2,280: @@
-<p>Trichome Promoter transformation
+<p>Trichome Promoter transformation</p>
-</p>
-<p>Using an electrocompetent E. coli strain (DH5&alpha;) and 1.5 ul ligation (PTrich:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 ºC with agitation.
+<p>Using an electrocompetent E. coli strain (DH5&alpha;) and 1.5 ul ligation (PTrich:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 ºC with agitation. </p>
-</p>
@@ Line 3,015: / Line 2,294: @@
-<p>Adquisition of S. cerevisiae genomic DNA. (5 &mu;L, stored in the fridge)
+<p>Adquisition of S. cerevisiae genomic DNA. (5 &mu;L, stored in the fridge)</p>
-</p>
@@ Line 3,024: / Line 2,302: @@
-<p>We had the genome of S. cerevisiae, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).
+<p>We had the genome of S. cerevisiae, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p>
-</p>
-<p>Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast.
+<p>Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p>
-</p>
-<p>
+<p> </p>
-</p>
-<p>PCR reaction reagents:
+<p>PCR reaction reagents:</p>
-</p>
@@ Line 3,040: / Line 2,314: @@
 <table style="width:300px">
-<tr><td>Reagent</td><td>CUP1-PCR1</td><td>CUP2-PCR2
+<tr><td>Reagent</td><td>CUP1-PCR1</td><td>CUP2-PCR2</td></tr>
-</td></tr>
-<tr><td>Template</td><td>0.5 &mu;L</td><td>0.5 &mu;L
+<tr><td>Template</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>Buffer HF (5X)</td><td>10.0 &mu;L</td><td>10.0 &mu;L
+<tr><td>Buffer HF (5X)</td><td>10.0 &mu;L</td><td>10.0 &mu;L</td></tr>
-</td></tr>
-<tr><td>dNTPs</td><td>2.0 &mu;L</td><td>2.0 &mu;L
+<tr><td>dNTPs</td><td>2.0 &mu;L</td><td>2.0 &mu;L</td></tr>
-</td></tr>
-<tr><td>Oligo R (JUL06)</td><td>2.5 &mu;L</td><td>2.5 &mu;L
+<tr><td>Oligo R (JUL06)</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>Oligo F (JUL05)</td><td>2.5 &mu;L</td><td>2.5 &mu;L
+<tr><td>Oligo F (JUL05)</td><td>2.5 &mu;L</td><td>2.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>Phusion polymerase</td><td>0.5 &mu;L</td><td>0.5 &mu;L
+<tr><td>Phusion polymerase</td><td>0.5 &mu;L</td><td>0.5 &mu;L</td></tr>
-</td></tr>
-<tr><td>H2O</td><td>32.0 &mu;L</td><td>32.0 &mu;L
+<tr><td>H2O</td><td>32.0 &mu;L</td><td>32.0 &mu;L</td></tr>
-</td></tr>
 </table>
@@ Line 3,068: / Line 2,334: @@
-<p>Annealing temperature: both 61 ºC
+<p>Annealing temperature: both 61 ºC</p>
-</p>
-<p>PCR products were checked using an electrophoresis. Expected bands:
+<p>PCR products were checked using an electrophoresis. Expected bands:</p>
-</p>
-<ul><li>CUP1-PCR1: 386 bp
+<ul><li>CUP1-PCR1: 386 bp</li>
-</li>
-<li>CUP2-PCR2: 348 bp
+<li>CUP2-PCR2: 348 bp</li>
-</li>
 </ul>
-<img src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png
+<img src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png>
->
-<p>Both PCR products were correct.
+<p>Both PCR products were correct.</p>
-</p>