Team:Yale/Results
From 2014.igem.org
Line 142: | Line 142: | ||
<p> | <p> | ||
<center> | <center> | ||
- | <i><strong>Figure 1.</strong> Preliminary gel screening of Mach 1 strains containing transformed pZE21_A12C_T7RNA plasmids created via Gibson Assembly.</i></center><br></p> | + | <i><strong>Figure 1.</strong> Preliminary gel screening of Mach 1 strains containing transformed pZE21_A12C_T7RNA plasmids created via Gibson Assembly. Used combinations of general pZE21 sequencing primers, F: CAGGGCTTCCCAACCTTAC, R: CGCCTTTGAGTGAGCTGATA, and internal T7 primers, F: TCCCTTACAACATGGACTGGC, R: CCCACCAAGTGTTCTCCAG. The corresponding sizes are labelled on the side. The negative control for the external primers is the ancestor plasmid, which contains chloramphenicol acetyl transferase (CAT) instead of T7, and is 1.1 kb instead of 3.3 kb.</i></center><br></p> |
<center><img src="https://static.igem.org/mediawiki/2014/f/f2/Yale_sequences_1.png"></center> | <center><img src="https://static.igem.org/mediawiki/2014/f/f2/Yale_sequences_1.png"></center> | ||
Line 148: | Line 148: | ||
<p> | <p> | ||
<center> | <center> | ||
- | <i><strong>Figure 2.</strong> Sequencing data for T7 RNA polymerase construct, upstream of the taRNA and crRNA system. Image made using geneious.</i></center></p> | + | <i><strong>Figure 2.</strong> Sequencing data for T7 RNA polymerase construct, using the general pZE21 sequencing primers, which amplify upstream of the taRNA and crRNA system. Sequencing done via Keck Biotechnology Resource Laboratory. Image made using geneious.</i></center></p> |
<p>Currently the riboregulation system may have an issue with the internal T7 sequence, and while sequencing has been done, no successful data has been obtained.</p> | <p>Currently the riboregulation system may have an issue with the internal T7 sequence, and while sequencing has been done, no successful data has been obtained.</p> | ||
Line 161: | Line 161: | ||
<p> | <p> | ||
<center> | <center> | ||
- | <i><strong>Figure 3.</strong> The functionalities behind the GFP assay.</i></center></p> | + | <i><strong>Figure 3.</strong> The functionalities behind the GFP assay as described above.</i></center></p> |
<center><img src="https://static.igem.org/mediawiki/2014/0/03/Yale_figure9.png"></center> | <center><img src="https://static.igem.org/mediawiki/2014/0/03/Yale_figure9.png"></center> | ||
Line 167: | Line 167: | ||
<p> | <p> | ||
<center> | <center> | ||
- | <i><strong>Figure 4.</strong> Conformational assay to test the functionality of the pZA21_T7sfGFP, which is sfGFP placed behind the T7 promoter. The plasmid was transformed into a BL21(DE3) strain, which constitutively expresses T7 RNA polymerase. The strain, as well as untransformed BL21(DE3), were grown overnight and assayed using a Synergy H1 Biotek Platereader. </i></center></p> | + | <i><strong>Figure 4.</strong> Conformational assay to test the functionality of the pZA21_T7sfGFP, which is sfGFP placed behind the T7 promoter. The plasmid was transformed into a BL21(DE3) strain, which constitutively expresses T7 RNA polymerase. The strain, as well as untransformed BL21(DE3), were grown overnight and assayed using a Synergy H1 Biotek Platereader. Fluorescence measurement was taken by exciting the cells at 485 nm and detecting at 528 nm, with a bandpass of 4 nm on each side. The optical density was also taken at 600 nm, and the fluorescence data was normalized by dividing fluorescence by optical density. What is shown is the average of 4 replicates each. </i></center></p> |
Revision as of 03:27, 18 October 2014
Results |
|||||||||||||||||||||||||||||||||||||||||
T7 Riboregulation System
| |||||||||||||||||||||||||||||||||||||||||
Adhesion Testing
|