Team:Valencia UPV/Notebook wetlab.html

From 2014.igem.org

(Difference between revisions)
Line 2: Line 2:
<html>
<html>
<head>
<head>
-
<style>
+
    <style>
-
.table_notebook{
+
        .table_notebook{
-
background:transparent;
+
          background:transparent;
-
white-space:nowrap;
+
          white-space:nowrap;
-
border: none;
+
          border: none;
-
    margin-top: 10px;
+
          margin-top: 10px;
-
    margin-bottom: 10px;
+
          margin-bottom: 10px;
-
}
+
      }
-
.td_notebook{
+
      .td_notebook{
-
    background:transparent;
+
        background:transparent;
-
    white-space:nowrap;
+
        white-space:nowrap;
-
    border:none;
+
        border:none;
-
    padding-right: 25px;
+
        padding-right: 25px;
-
}
+
    }
-
.section_notebook{
+
    .section_notebook{
-
    color: red;
+
        color: red;
-
    text-align: left;
+
        text-align: left;
-
    font-size: 16pt;
+
        font-size: 16pt;
-
}
+
    }
-
.date_notebook {
+
    .date_notebook {
-
    color: green;
+
        color: green;
-
    text-align: left;
+
        text-align: left;
-
    font-size: 12pt;
+
        font-size: 12pt;
-
}
+
    }
-
.p_notebook {
+
    .p_notebook {
-
    margin-top: 10px;
+
        margin-top: 10px;
-
    margin-bottom: 10px;
+
        margin-bottom: 10px;
-
    margin-right: 0px;
+
        margin-right: 0px;
-
    margin-left: 0px;  
+
        margin-left: 0px;  
-
}
+
    }
-
.strong_notebook {
+
    .strong_notebook {
-
    color: red;
+
        color: red;
-
    margin-top: 5px;
+
        margin-top: 5px;
-
    margin-bottom: 5px;
+
        margin-bottom: 5px;
-
    margin-right: 0px;
+
        margin-right: 0px;
-
    margin-left: 0px;  
+
        margin-left: 0px;  
-
}
+
    }
-
.img_notebook {
+
    .img_notebook {
-
    margin-top: 10px;
+
        margin-top: 10px;
-
    margin-bottom: 10px;
+
        margin-bottom: 10px;
-
    margin-right: 0px;
+
        margin-right: 0px;
-
    margin-left: 0px;  
+
        margin-left: 0px;  
-
}
+
    }
-
.box_above_notebook{
+
    .box_above_notebook{
-
    border: 2px dashed blue;
+
        border: 2px dashed blue;
-
    margin: 10px;
+
        margin: 10px;
-
    padding: 10px;
+
        padding: 10px;
-
    background-color: #b0c4de;
+
        background-color: #b0c4de;
-
}
+
    }
-
+
   
-
.ul_notebook {
+
    .ul_notebook {
-
    list-style: square;
+
        list-style: square;
-
    list-style-position: inside;
+
        list-style-position: inside;
-
}
+
    }
-
.ul_ul_notebook {
+
    .ul_ul_notebook {
-
    list-style: square;
+
        list-style: square;
-
    list-style-position: inside;
+
        list-style-position: inside;
-
    margin-left: 1.5em;
+
        margin-left: 1.5em;
-
}
+
    }
-
.ul_ul_ul_notebook {
+
    .ul_ul_ul_notebook {
-
    list-style: square;
+
        list-style: square;
-
    list-style-position: inside;
+
        list-style-position: inside;
-
    margin-left: 3.0em;
+
        margin-left: 3.0em;
-
}
+
    }
-
.ul_ul_ul_ul_notebook {
+
    .ul_ul_ul_ul_notebook {
-
    list-style: square;
+
        list-style: square;
-
    list-style-position: inside;
+
        list-style-position: inside;
-
    margin-left: 4.5em;
+
        margin-left: 4.5em;
-
}
+
    }
</style>
</style>
Line 90: Line 90:
-
<div align="center"><div class="c-box" id="cn-box" align="center"></br><div id="main" class="c-box" align="justify" style="border: 5px;">
+
    <div align="center"><div class="c-box" id="cn-box" align="center"></br><div id="main" class="c-box" align="justify" style="border: 5px;">
-
<div class="box_above_notebook">
+
        <div class="box_above_notebook">
-
Contents:
+
            Contents:
-
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis">Biosynthesis</a></li> <li> <a href="#Trichome_promoter">Trichome promoter</a></li> <li> <a href="#Switch">Switch</a></li> <li> <a href="#Biosafety">Biosafety</a></li> <li> <a href="#Translator_to_BioBricks">Translator to BioBricks</a></li></ul>
+
            <ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis">Biosynthesis</a></li> <li> <a href="#Trichome_promoter">Trichome promoter</a></li> <li> <a href="#Switch">Switch</a></li> <li> <a href="#Biosafety">Biosafety</a></li> <li> <a href="#Translator_to_BioBricks">Translator to BioBricks</a></li></ul>
-
</div><a name="Biosynthesis"></a></br></br><h3 class="section_notebook">Biosynthesis</h3></br><h4 class="date_notebook">06/09/2014</h4>
+
        </div><a name="Biosynthesis"></a></br></br><h3 class="section_notebook">Biosynthesis</h3></br><h4 class="date_notebook">06/09/2014</h4>
-
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p>
+
        <p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p>
-
<p class="p_notebook"></br></p>
+
        <p class="p_notebook"></br></p>
-
<img class="img_notebook"src=http://2014.igem.org/wiki/images/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300">
+
        <img class="img_notebook"src=http://2014.igem.org/wiki/images/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300">
-
<p class="p_notebook"></br></p>
+
        <p class="p_notebook"></br></p>
-
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p>
+
        <p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p>
-
<ul class="ul_notebook"><li>Codon optimization</li>
+
        <ul class="ul_notebook"><li>Codon optimization</li>
-
<li>Inner restriction sites eliminations by finding synonymous mutations</li>
+
            <li>Inner restriction sites eliminations by finding synonymous mutations</li>
-
<li>Addition of GB endings</li>
+
            <li>Addition of GB endings</li>
-
</ul>
+
        </ul>
-
</br><h4 class="date_notebook">06/10/2014</h4>
+
    </br><h4 class="date_notebook">06/10/2014</h4>
-
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p>
+
    <p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p>
-
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p>
+
    <p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p>
Line 147: Line 147:
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li>
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li>
-
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li>
+
    <li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li>
-
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li>
+
    <li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li>
-
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li>
+
    <ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li>
-
<li>I14Jun04 Atr&Delta;11 R1</li>
+
        <li>I14Jun04 Atr&Delta;11 R1</li>
-
</ul><li>FAO1: <i>N. benthamiana</i> primers</li>
+
    </ul><li>FAO1: <i>N. benthamiana</i> primers</li>
-
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li>
+
    <ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li>
-
<li>I14Jun02 FAO1 R1</li>
+
        <li>I14Jun02 FAO1 R1</li>
-
</ul></ul>
+
    </ul></ul>
-
<table class="table_notebook">
+
    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr>
-
</table>
+
    </table>
Line 193: Line 193:
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li>
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li>
-
<li>pAtUbq10, pTAtHSP18.2</li>
+
    <li>pAtUbq10, pTAtHSP18.2</li>
</ul>
</ul>
Line 203: Line 203:
<ul class="ul_notebook"><li>pP35S, pT35s</li>
<ul class="ul_notebook"><li>pP35S, pT35s</li>
-
<li>pP35s, pTAtHSP18.2</li>
+
    <li>pP35s, pTAtHSP18.2</li>
-
<li>pAtUbq10, pTAtHSP18.2</li>
+
    <li>pAtUbq10, pTAtHSP18.2</li>
</ul>
</ul>
Line 215: Line 215:
<ul class="ul_notebook"><li>pP35S, pT35s</li>
<ul class="ul_notebook"><li>pP35S, pT35s</li>
-
<li>pP35s, pTTctp</li>
+
    <li>pP35s, pTTctp</li>
-
<li>pAtUbq10, pTAtHSP18.2</li>
+
    <li>pAtUbq10, pTAtHSP18.2</li>
</ul>
</ul>
Line 227: Line 227:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr>
</table>
</table>
Line 253: Line 253:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr>
</table>
</table>
Line 295: Line 295:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr>
</table>
</table>
Line 341: Line 341:
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li>
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li>
-
<li>10 &mu;L HF buffer </li>
+
    <li>10 &mu;L HF buffer </li>
-
<li>2 &mu;L dNTPs</li>
+
    <li>2 &mu;L dNTPs</li>
-
<li>2.5 &mu;L Reverse primer</li>
+
    <li>2.5 &mu;L Reverse primer</li>
-
<li>2.5 &mu;L Forward primer</li>
+
    <li>2.5 &mu;L Forward primer</li>
-
<li>1 &mu;L template (Atr&Delta;11 gene)</li>
+
    <li>1 &mu;L template (Atr&Delta;11 gene)</li>
-
<li>0.5 &mu;L phusion (polimerase)</li>
+
    <li>0.5 &mu;L phusion (polimerase)</li>
</ul>
</ul>
-
<p class="p_notebook">PCR parameters: The annealing temperature was 60ºC and the extension temperature was 65ºC. </p>
+
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p>
Line 377: Line 377:
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
-
<li>1 &mu;L PCR product/gblock product  </li>
+
    <li>1 &mu;L PCR product/gblock product  </li>
-
<li>1.2 &mu;L buffer 10x</li>
+
    <li>1.2 &mu;L buffer 10x</li>
-
<li>1 &mu;L BsmBI</li>
+
    <li>1 &mu;L BsmBI</li>
-
<li>1 &mu;L T4 ligase</li>
+
    <li>1 &mu;L T4 ligase</li>
-
<li>6.8 &mu;L H2O miliQ</li>
+
    <li>6.8 &mu;L H2O miliQ</li>
</ul>
</ul>
Line 393: Line 393:
-
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16ºC and the BsmBI temperature was 37ºC. </p>
+
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p>
Line 417: Line 417:
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li>
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li>
-
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li>
+
    <li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li>
</ul>
</ul>
-
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.</p>
+
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p>
Line 429: Line 429:
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p>
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p>
-
<p class="p_notebook">Petri plates are incubated at 37ºC for 16 h.</p>
+
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p>
Line 443: Line 443:
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li>
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li>
-
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li>
+
    <li>3x 1 colony of HarFAR in pUPD + LB + Amp</li>
-
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li>
+
    <li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li>
</ul>
</ul>
-
<p class="p_notebook">All tubes are incubated at 37ºC overnight in agitation.</p>
+
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p>
Line 465: Line 465:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr>
</table>
</table>
Line 487: Line 487:
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li>
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li>
-
<li>2.5 &mu;L buffer</li>
+
    <li>2.5 &mu;L buffer</li>
-
<li>21 &mu;L H20 (miliQ)</li>
+
    <li>21 &mu;L H20 (miliQ)</li>
-
<li>1 &mu;L sample</li>
+
    <li>1 &mu;L sample</li>
</ul>
</ul>
Line 501: Line 501:
<ul class="ul_notebook"><li>Master mix for NotI</li>
<ul class="ul_notebook"><li>Master mix for NotI</li>
-
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li>
+
    <ul class="ul_ul_notebook"><li>5 &mu;L NotI</li>
-
<li>25 &mu;L Orange</li>
+
        <li>25 &mu;L Orange</li>
-
<li>210 &mu;L H20</li>
+
        <li>210 &mu;L H20</li>
-
</ul><li>Master mix for RsaI</li>
+
    </ul><li>Master mix for RsaI</li>
-
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li>
+
    <ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li>
-
<li>7.5 &mu;L Tango</li>
+
        <li>7.5 &mu;L Tango</li>
-
<li>63 &mu;L H20</li>
+
        <li>63 &mu;L H20</li>
-
</ul><li>Master mix for PvuII</li>
+
    </ul><li>Master mix for PvuII</li>
-
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li>
+
    <ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li>
-
<li>7.5 &mu;L Green</li>
+
        <li>7.5 &mu;L Green</li>
-
<li>63 &mu;L H20</li>
+
        <li>63 &mu;L H20</li>
-
</ul><li>Master mix for BanII</li>
+
    </ul><li>Master mix for BanII</li>
-
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li>
+
    <ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li>
-
<li>7.5 &mu;L Tango</li>
+
        <li>7.5 &mu;L Tango</li>
-
<li>63 &mu;L H20</li>
+
        <li>63 &mu;L H20</li>
-
</ul></ul>
+
    </ul></ul>
-
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p>
+
    <p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140704_digestiones_ligaciones.png>
+
    <img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140704_digestiones_ligaciones.png>
-
<p class="p_notebook">Comments:</p>
+
    <p class="p_notebook">Comments:</p>
-
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li>
+
    <ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li>
-
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li>
+
        <li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li>
-
</ul>
+
    </ul>
</br><h4 class="date_notebook">07/06/2014</h4>
</br><h4 class="date_notebook">07/06/2014</h4>
Line 559: Line 559:
<ul class="ul_notebook"><li>3.5 mL LB</li>
<ul class="ul_notebook"><li>3.5 mL LB</li>
-
<li>7 &mu;L Amp</li>
+
    <li>7 &mu;L Amp</li>
-
<li>7 &mu;L X-Gal</li>
+
    <li>7 &mu;L X-Gal</li>
-
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li>
+
    <li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li>
</ul>
</ul>
Line 581: Line 581:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr>
</table>
</table>
Line 603: Line 603:
<ul class="ul_notebook"><li>Master mix for NotI</li>
<ul class="ul_notebook"><li>Master mix for NotI</li>
-
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li>
+
    <ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li>
-
<li>17.5 &mu;L Orange</li>
+
        <li>17.5 &mu;L Orange</li>
-
<li>147 &mu;L H20</li>
+
        <li>147 &mu;L H20</li>
-
</ul><li>Master mix for RsaI</li>
+
    </ul><li>Master mix for RsaI</li>
-
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li>
+
    <ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li>
-
<li>10 &mu;L Tango</li>
+
        <li>10 &mu;L Tango</li>
-
<li>84 &mu;L H20</li>
+
        <li>84 &mu;L H20</li>
-
</ul><li>Master mix for PvuII</li>
+
    </ul><li>Master mix for PvuII</li>
-
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li>
+
    <ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li>
-
<li>10 &mu;L Green</li>
+
        <li>10 &mu;L Green</li>
-
<li>84 &mu;L H20</li>
+
        <li>84 &mu;L H20</li>
-
</ul></ul>
+
    </ul></ul>
-
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p>
+
    <p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140707_digestiones_ligaciones2.png>
+
    <img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140707_digestiones_ligaciones2.png>
-
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p>
+
    <p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p>
Line 657: Line 657:
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li>
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li>
-
<li>1 &mu;L terminator 75 ng/&mu;L</li>
+
    <li>1 &mu;L terminator 75 ng/&mu;L</li>
-
<li>1 &mu;L CDS 75 ng/&mu;L</li>
+
    <li>1 &mu;L CDS 75 ng/&mu;L</li>
-
<li>1 &mu;L vector &alpha;</li>
+
    <li>1 &mu;L vector &alpha;</li>
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
    <li>1.2 &mu;L ligase buffer 10x</li>
-
<li>1 &mu;L T4</li>
+
    <li>1 &mu;L T4</li>
-
<li>1 &mu;L BsaI</li>
+
    <li>1 &mu;L BsaI</li>
-
<li>4.2 &mu;L H20</li>
+
    <li>4.2 &mu;L H20</li>
</ul>
</ul>
Line 687: Line 687:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr>
</table>
</table>
Line 707: Line 707:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr>
</table>
</table>
Line 737: Line 737:
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
+
    <ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
-
<li>1 &mu;L T35s</li>
+
        <li>1 &mu;L T35s</li>
-
<li>1 &mu;L Atr&Delta;11</li>
+
        <li>1 &mu;L Atr&Delta;11</li>
-
<li>1.5 &mu;L 2&alpha;1</li>
+
        <li>1.5 &mu;L 2&alpha;1</li>
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
        <li>1.2 &mu;L ligase buffer 10x</li>
-
<li>1 &mu;L T4</li>
+
        <li>1 &mu;L T4</li>
-
<li>1 &mu;L BsaI</li>
+
        <li>1 &mu;L BsaI</li>
-
<li>3.7 &mu;L H20</li>
+
        <li>3.7 &mu;L H20</li>
-
</ul></ul>
+
    </ul></ul>
-
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li>
+
    <ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
+
        <ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
-
<li>1 &mu;L TatHSP</li>
+
            <li>1 &mu;L TatHSP</li>
-
<li>1 &mu;L HarFAR</li>
+
            <li>1 &mu;L HarFAR</li>
-
<li>1 &mu;L 2&alpha;2</li>
+
            <li>1 &mu;L 2&alpha;2</li>
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
            <li>1.2 &mu;L ligase buffer 10x</li>
-
<li>1 &mu;L T4</li>
+
            <li>1 &mu;L T4</li>
-
<li>1 &mu;L BsaI</li>
+
            <li>1 &mu;L BsaI</li>
-
<li>4.2 &mu;L H20</li>
+
            <li>4.2 &mu;L H20</li>
-
</ul></ul>
+
        </ul></ul>
-
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li>
+
        <ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li>
+
            <ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li>
-
<li>1 &mu;L TatHSP</li>
+
                <li>1 &mu;L TatHSP</li>
-
<li>1 &mu;L EaDAcT</li>
+
                <li>1 &mu;L EaDAcT</li>
-
<li>1 &mu;L 2&alpha;2</li>
+
                <li>1 &mu;L 2&alpha;2</li>
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
                <li>1.2 &mu;L ligase buffer 10x</li>
-
<li>1 &mu;L T4</li>
+
                <li>1 &mu;L T4</li>
-
<li>1 &mu;L BsaI</li>
+
                <li>1 &mu;L BsaI</li>
-
<li>4.2 &mu;L H20</li>
+
                <li>4.2 &mu;L H20</li>
-
</ul></ul>
+
            </ul></ul>
-
</br><h4 class="date_notebook">07/09/2014</h4>
+
        </br><h4 class="date_notebook">07/09/2014</h4>
-
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p>
+
        <p class="p_notebook">Transformation of constructions in <i>E. coli</i></p>
-
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p>
+
        <p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p>
-
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li>
+
        <ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li>
-
<li>HarFAR -> Sequencing correct</li>
+
            <li>HarFAR -> Sequencing correct</li>
-
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li>
+
            <li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li>
-
</ul>
+
        </ul>
-
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p>
+
        <p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p>
-
<ul class="ul_notebook"><li>Worked in the LAF</li>
+
        <ul class="ul_notebook"><li>Worked in the LAF</li>
-
<li>Cultivated in a Petri dish with Spm</li>
+
            <li>Cultivated in a Petri dish with Spm</li>
-
<li>Let them grow for one day</li>
+
            <li>Let them grow for one day</li>
-
</ul>
+
        </ul>
-
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p>
+
        <p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p>
-
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li>
+
        <ul class="ul_notebook"><li>50 mL transformation in one plaque</li>
-
<li>Rest of the culture in another (250 &mu;L aprox)</li>
+
            <li>Rest of the culture in another (250 &mu;L aprox)</li>
-
<li>Let them grow for one day</li>
+
            <li>Let them grow for one day</li>
-
</ul>
+
        </ul>
-
</br><h4 class="date_notebook">07/10/2014</h4>
+
    </br><h4 class="date_notebook">07/10/2014</h4>
-
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p>
+
    <p class="p_notebook">Pick colonies and grow them in liquid medium.</p>
-
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li>
+
    <ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li>
-
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
+
        <ul class="ul_ul_notebook"><li>3.5 mL LB</li>
-
<li>7 &mu;L Amp</li>
+
            <li>7 &mu;L Amp</li>
-
<li>7 &mu;L X-gal</li>
+
            <li>7 &mu;L X-gal</li>
-
<li>3.5 &mu;L IPTG</li>
+
            <li>3.5 &mu;L IPTG</li>
-
</ul><li>1 colony from 2&Omega;1</li>
+
        </ul><li>1 colony from 2&Omega;1</li>
-
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
+
        <ul class="ul_ul_notebook"><li>3.5 mL LB</li>
-
<li>7 &mu;L Spm</li>
+
            <li>7 &mu;L Spm</li>
-
</ul></ul>
+
        </ul></ul>
-
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li>
+
        <ul class="ul_notebook"><li>1 colony from 2&Omega;2</li>
-
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
+
            <ul class="ul_ul_notebook"><li>3.5 mL LB</li>
-
<li>7 &mu;L Spm</li>
+
                <li>7 &mu;L Spm</li>
-
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li>
+
            </ul><li>3 colonies from P35s:HarFAR:TatHSP</li>
-
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
+
            <ul class="ul_ul_notebook"><li>3.5 mL LB</li>
-
<li>7 &mu;L Kan</li>
+
                <li>7 &mu;L Kan</li>
-
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li>
+
            </ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li>
-
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
+
            <ul class="ul_ul_notebook"><li>3.5 mL LB</li>
-
<li>7 &mu;L Kan</li>
+
                <li>7 &mu;L Kan</li>
-
</ul></ul>
+
            </ul></ul>
-
<p class="p_notebook">Grow at 37ºC in agitation overnight.</p>
+
            <p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p>
-
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p>
+
            <p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p>
-
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p>
+
            <p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p>
-
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p>
+
            <p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p>
-
</br><h4 class="date_notebook">07/11/2014</h4>
+
        </br><h4 class="date_notebook">07/11/2014</h4>
-
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p>
+
        <p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p>
-
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p>
+
        <p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p>
-
</br><h4 class="date_notebook">07/14/2014</h4>
+
    </br><h4 class="date_notebook">07/14/2014</h4>
-
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p>
+
    <p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p>
-
<table class="table_notebook">
+
    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr>
-
</table>
+
    </table>
-
<p class="p_notebook">Preparation of master mixes</p>
+
    <p class="p_notebook">Preparation of master mixes</p>
-
<ul class="ul_notebook"><li>Master mix for HindIII</li>
+
    <ul class="ul_notebook"><li>Master mix for HindIII</li>
-
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li>
+
        <ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li>
-
<li>17.5 &mu;L Red</li>
+
            <li>17.5 &mu;L Red</li>
-
<li>147 &mu;L H20</li>
+
            <li>147 &mu;L H20</li>
-
</ul><li>Master mix for NotI</li>
+
        </ul><li>Master mix for NotI</li>
-
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li>
+
        <ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li>
-
<li>7.5 &mu;L Orange</li>
+
            <li>7.5 &mu;L Orange</li>
-
<li>63 &mu;L H20</li>
+
            <li>63 &mu;L H20</li>
-
</ul><li>Mix for EcoRV</li>
+
        </ul><li>Mix for EcoRV</li>
-
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li>
+
        <ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li>
-
<li>2.5 &mu;L Red</li>
+
            <li>2.5 &mu;L Red</li>
-
<li>21 &mu;L H20</li>
+
            <li>21 &mu;L H20</li>
-
</ul><li>Mix for BamHI</li>
+
        </ul><li>Mix for BamHI</li>
-
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li>
+
        <ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li>
-
<li>2.5 &mu;L Green</li>
+
            <li>2.5 &mu;L Green</li>
-
<li>21 &mu;L H20</li>
+
            <li>21 &mu;L H20</li>
-
</ul></ul>
+
        </ul></ul>
-
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p>
+
        <p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/7/7a/20140714_digestion_ligaciones.png>
+
        <img class="img_notebook" src=http://2014.igem.org/wiki/images/7/7a/20140714_digestion_ligaciones.png>
-
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p>
+
        <p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p>
-
</br><h4 class="date_notebook">07/15/2014</h4>
+
    </br><h4 class="date_notebook">07/15/2014</h4>
-
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p>
+
    <p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p>
-
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p>
+
    <p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p>
-
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
+
    <ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
+
        <ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
-
<li>1 &mu;L T35s</li>
+
            <li>1 &mu;L T35s</li>
-
<li>1 &mu;L Atr&Delta;11</li>
+
            <li>1 &mu;L Atr&Delta;11</li>
-
<li>1.5 &mu;L 2&alpha;1</li>
+
            <li>1.5 &mu;L 2&alpha;1</li>
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
            <li>1.2 &mu;L ligase buffer 10x</li>
-
<li>1 &mu;L T4</li>
+
            <li>1 &mu;L T4</li>
-
<li>1 &mu;L BsaI</li>
+
            <li>1 &mu;L BsaI</li>
-
<li>3.7 &mu;L H20</li>
+
            <li>3.7 &mu;L H20</li>
-
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li>
+
        </ul><li>P35s:HarFAR:T35s in 2&alpha;2</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
+
        <ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
-
<li>1 &mu;L T35s</li>
+
            <li>1 &mu;L T35s</li>
-
<li>1 &mu;L HarFAR</li>
+
            <li>1 &mu;L HarFAR</li>
-
<li>1 &mu;L 2&alpha;2</li>
+
            <li>1 &mu;L 2&alpha;2</li>
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
            <li>1.2 &mu;L ligase buffer 10x</li>
-
<li>1 &mu;L T4</li>
+
            <li>1 &mu;L T4</li>
-
<li>1 &mu;L BsaI</li>
+
            <li>1 &mu;L BsaI</li>
-
<li>4.2 &mu;L H20</li>
+
            <li>4.2 &mu;L H20</li>
-
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li>
+
        </ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
+
        <ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
-
<li>1 &mu;L T35s</li>
+
            <li>1 &mu;L T35s</li>
-
<li>1 &mu;L EaDAcT</li>
+
            <li>1 &mu;L EaDAcT</li>
-
<li>1 &mu;L 2&alpha;2</li>
+
            <li>1 &mu;L 2&alpha;2</li>
-
<li>1.2 &mu;L ligase buffer 10x</li>
+
            <li>1.2 &mu;L ligase buffer 10x</li>
-
<li>1 &mu;L T4</li>
+
            <li>1 &mu;L T4</li>
-
<li>1 &mu;L BsaI</li>
+
            <li>1 &mu;L BsaI</li>
-
<li>4.2 &mu;L H20</li>
+
            <li>4.2 &mu;L H20</li>
-
</ul></ul>
+
        </ul></ul>
-
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p>
+
        <p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p>
-
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p>
+
        <p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p>
-
<ul class="ul_notebook"><li>Amp</li>
+
        <ul class="ul_notebook"><li>Amp</li>
-
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li>
+
            <ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li>
-
<li>pEaDAcT (3)</li>
+
                <li>pEaDAcT (3)</li>
-
<li>pHarFAR (3)</li>
+
                <li>pHarFAR (3)</li>
-
</ul><li>Kan</li>
+
            </ul><li>Kan</li>
-
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li>
+
            <ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li>
-
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li>
+
                <li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li>
-
</ul></ul>
+
            </ul></ul>
-
</br><h4 class="date_notebook">07/16/2014</h4>
+
        </br><h4 class="date_notebook">07/16/2014</h4>
-
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p>
+
        <p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p>
-
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80ºC.</p>
+
        <p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p>
-
</br><h4 class="date_notebook">07/17/2014</h4>
+
    </br><h4 class="date_notebook">07/17/2014</h4>
-
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p>
+
    <p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p>
-
<p class="p_notebook">Digestions in silico.</p>
+
    <p class="p_notebook">Digestions in silico.</p>
-
<table class="table_notebook">
+
    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr>
-
</table>
+
    </table>
-
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p>
+
    <p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p>
Line 1,149: Line 1,149:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr>
</table>
</table>
Line 1,197: Line 1,197:
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li>
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li>
+
    <ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li>
-
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li>
+
        <li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li>
-
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li>
+
        <li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li>
-
<li>1 &mu;L BsmBI (5-10 ud)</li>
+
        <li>1 &mu;L BsmBI (5-10 ud)</li>
-
<li>1 &mu;L T4 ligase (5-10 ud)</li>
+
        <li>1 &mu;L T4 ligase (5-10 ud)</li>
-
<li>1 &mu;L buffer ligase (3 ud)</li>
+
        <li>1 &mu;L buffer ligase (3 ud)</li>
-
<li>4 &mu;L H20</li>
+
        <li>4 &mu;L H20</li>
-
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li>
+
    </ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li>
+
    <ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li>
-
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li>
+
        <li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li>
-
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li>
+
        <li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li>
-
<li>1 &mu;L BsmBI (5-10 ud)</li>
+
        <li>1 &mu;L BsmBI (5-10 ud)</li>
-
<li>1 &mu;L T4 ligase (5-10 ud)</li>
+
        <li>1 &mu;L T4 ligase (5-10 ud)</li>
-
<li>1 &mu;L buffer ligase (3 ud)</li>
+
        <li>1 &mu;L buffer ligase (3 ud)</li>
-
<li>4 &mu;L H20</li>
+
        <li>4 &mu;L H20</li>
-
</ul></ul>
+
    </ul></ul>
-
<p class="p_notebook">Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).</p>
+
    <p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
-
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p>
+
    <p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p>
Line 1,261: Line 1,261:
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li>
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li>
-
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li>
+
    <li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li>
</ul>
</ul>
Line 1,273: Line 1,273:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr>
</table>
</table>
Line 1,293: Line 1,293:
<ul class="ul_notebook"><li>Master mix for NotI</li>
<ul class="ul_notebook"><li>Master mix for NotI</li>
-
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li>
+
    <ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li>
-
<li>7.5 &mu;L Orange buffer</li>
+
        <li>7.5 &mu;L Orange buffer</li>
-
<li>63 &mu;L H20</li>
+
        <li>63 &mu;L H20</li>
-
</ul><li>Master mix for NcoI</li>
+
    </ul><li>Master mix for NcoI</li>
-
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li>
+
    <ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li>
-
<li>7.5 &mu;L Tango buffer</li>
+
        <li>7.5 &mu;L Tango buffer</li>
-
<li>63 &mu;L H20</li>
+
        <li>63 &mu;L H20</li>
-
</ul><li>Master mix for BamHI</li>
+
    </ul><li>Master mix for BamHI</li>
-
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li>
+
    <ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li>
-
<li>10 &mu;L Green buffer</li>
+
        <li>10 &mu;L Green buffer</li>
-
<li>84 &mu;L H20</li>
+
        <li>84 &mu;L H20</li>
-
</ul><li>Master mix for EcoRV</li>
+
    </ul><li>Master mix for EcoRV</li>
-
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li>
+
    <ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li>
-
<li>20 &mu;L Red buffer</li>
+
        <li>20 &mu;L Red buffer</li>
-
<li>168 &mu;L H20</li>
+
        <li>168 &mu;L H20</li>
-
</ul></ul>
+
    </ul></ul>
-
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p>
+
    <p class="p_notebook">Note: Trichome promoter digestion preparation included. </p>
-
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p>
+
    <p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p>
Line 1,335: Line 1,335:
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png>
+
    <img class="img_notebook" src=http://2014.igem.org/wiki/images/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png>
Line 1,343: Line 1,343:
-
<p class="p_notebook">Miniprep quantification:</p>
+
    <p class="p_notebook">Miniprep quantification:</p>
-
<table class="table_notebook">
+
    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr>
-
</table>
+
    </table>
-
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p>
+
    <p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p>
-
<table class="table_notebook">
+
    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr>
-
</table>
+
    </table>
Line 1,389: Line 1,389:
-
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p>
+
    <p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p>
-
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight. </p>
+
    <p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p>
-
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 ºC (5 mL).</p>
+
    <p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p>
Line 1,417: Line 1,417:
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li>
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li>
-
<li><i>C. tropicalis</i> Abs = 0.39</li>
+
    <li><i>C. tropicalis</i> Abs = 0.39</li>
</ul>
</ul>
-
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 ºC until the exponential phase is reached. </p>
+
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p>
Line 1,429: Line 1,429:
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li>
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li>
-
<li><i>C. tropicalis</i> Abs = 0.40</li>
+
    <li><i>C. tropicalis</i> Abs = 0.40</li>
</ul>
</ul>
Line 1,439: Line 1,439:
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li>
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li>
-
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li>
+
    <li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li>
-
<li>Wash once with 1 mL sterile water.</li>
+
    <li>Wash once with 1 mL sterile water.</li>
-
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups. </li>
+
    <li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li>
-
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li>
+
    <li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li>
-
<li>Incubate at 65 ºC for 20 min and cool inmediately on ice.</li>
+
    <li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li>
-
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li>
+
    <li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li>
-
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li>
+
    <li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li>
-
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.</li>
+
    <li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li>
-
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li>
+
    <li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li>
-
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li>
+
    <li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li>
-
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li>
+
    <li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li>
-
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li>
+
    <li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li>
-
<li>Store chromosomal DNA at 4 ºC (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li>
+
    <li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li>
</ul>
</ul>
Line 1,473: Line 1,473:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr>
</table>
</table>
Line 1,535: Line 1,535:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr>
</table>
</table>
Line 1,551: Line 1,551:
<ul class="ul_notebook"><li>Master mix for NotI</li>
<ul class="ul_notebook"><li>Master mix for NotI</li>
-
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li>
+
    <ul class="ul_ul_notebook"><li>2 &mu;L NotI</li>
-
<li>10 &mu;L Orange buffer</li>
+
        <li>10 &mu;L Orange buffer</li>
-
<li>84 &mu;L H20</li>
+
        <li>84 &mu;L H20</li>
-
</ul><li>Master mix for NcoI</li>
+
    </ul><li>Master mix for NcoI</li>
-
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li>
+
    <ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li>
-
<li>10 &mu;L Tango buffer</li>
+
        <li>10 &mu;L Tango buffer</li>
-
<li>84 &mu;L H20</li>
+
        <li>84 &mu;L H20</li>
-
</ul><li>Master mix for BglII</li>
+
    </ul><li>Master mix for BglII</li>
-
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li>
+
    <ul class="ul_ul_notebook"><li>2 &mu;L BglII</li>
-
<li>10 &mu;L Orange buffer</li>
+
        <li>10 &mu;L Orange buffer</li>
-
<li>84 &mu;L H20</li>
+
        <li>84 &mu;L H20</li>
-
</ul><li>Master mix for EcoRV</li>
+
    </ul><li>Master mix for EcoRV</li>
-
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li>
+
    <ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li>
-
<li>7.5 &mu;L Red buffer</li>
+
        <li>7.5 &mu;L Red buffer</li>
-
<li>63 &mu;L H20</li>
+
        <li>63 &mu;L H20</li>
-
</ul></ul>
+
    </ul></ul>
-
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p>
+
    <p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/4/4c/20140725_Minipreps_piezas_y_construcciones.png>
+
    <img class="img_notebook" src=http://2014.igem.org/wiki/images/4/4c/20140725_Minipreps_piezas_y_construcciones.png>
-
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p>
+
    <p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p>
Line 1,609: Line 1,609:
<ul class="ul_notebook"><li>FAO1-PCR1</li>
<ul class="ul_notebook"><li>FAO1-PCR1</li>
-
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li>
+
    <ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li>
-
<li>Buffer HF (5X) 10.0 &mu;L</li>
+
        <li>Buffer HF (5X) 10.0 &mu;L</li>
-
<li>dNTPs 2.0 &mu;L</li>
+
        <li>dNTPs 2.0 &mu;L</li>
-
<li>Oligo R (JUL06) 2.5 &mu;L</li>
+
        <li>Oligo R (JUL06) 2.5 &mu;L</li>
-
<li>Oligo F (JUL05) 2.5 &mu;L</li>
+
        <li>Oligo F (JUL05) 2.5 &mu;L</li>
-
<li>Phusion polymerase 0.5 &mu;L</li>
+
        <li>Phusion polymerase 0.5 &mu;L</li>
-
<li>H2O 32.0 &mu;L</li>
+
        <li>H2O 32.0 &mu;L</li>
-
</ul><li>FAO1-PCR2</li>
+
    </ul><li>FAO1-PCR2</li>
-
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li>
+
    <ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li>
-
<li>Buffer HF (5X) 10.0 &mu;L</li>
+
        <li>Buffer HF (5X) 10.0 &mu;L</li>
-
<li>dNTPs 2.0 &mu;L</li>
+
        <li>dNTPs 2.0 &mu;L</li>
-
<li>Oligo R (JUL08) 2.5 &mu;L</li>
+
        <li>Oligo R (JUL08) 2.5 &mu;L</li>
-
<li>Oligo F (JUL07) 2.5 &mu;L</li>
+
        <li>Oligo F (JUL07) 2.5 &mu;L</li>
-
<li>Phusion polymerase 0.5 &mu;L</li>
+
        <li>Phusion polymerase 0.5 &mu;L</li>
-
<li>H2O 32.0 &mu;L</li>
+
        <li>H2O 32.0 &mu;L</li>
-
</ul></ul>
+
    </ul></ul>
-
<p class="p_notebook">Annealing temperatures</p>
+
    <p class="p_notebook">Annealing temperatures</p>
-
<ul class="ul_notebook"><li>FAO1-PCR1: 59 ºC</li>
+
    <ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li>
-
<li>FAO1-PCR2: 64 ºC</li>
+
        <li>FAO1-PCR2: 64 &deg;C</li>
-
</ul>
+
    </ul>
-
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p>
+
    <p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p>
-
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li>
+
    <ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li>
-
<li>FAO1-PCR2: 1015 bp</li>
+
        <li>FAO1-PCR2: 1015 bp</li>
-
</ul>
+
    </ul>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/8/81/20140728_CUP2yFAO1.png>
+
    <img class="img_notebook" src=http://2014.igem.org/wiki/images/8/81/20140728_CUP2yFAO1.png>
-
<p class="p_notebook">Both FAO1 PCR products were not correct.</p>
+
    <p class="p_notebook">Both FAO1 PCR products were not correct.</p>
-
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p>
+
    <p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p>
-
<table class="table_notebook">
+
    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr>
-
</table>
+
    </table>
Line 1,709: Line 1,709:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr>
</table>
</table>
Line 1,735: Line 1,735:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (ºC)</td><td class="td_notebook">Time </td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
</table>
</table>
Line 1,759: Line 1,759:
-
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37ºC with agitation. </p>
+
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p>
Line 1,767: Line 1,767:
-
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28ºC. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28ºC.</p>
+
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p>
Line 1,779: Line 1,779:
-
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28ºC. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p>
+
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p>
Line 1,801: Line 1,801:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr>
</table>
</table>
Line 1,817: Line 1,817:
<ul class="ul_notebook"><li>Master mix for EcoRV:</li>
<ul class="ul_notebook"><li>Master mix for EcoRV:</li>
-
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li>
+
    <ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li>
-
<li>15 &mu;L Red buffer</li>
+
        <li>15 &mu;L Red buffer</li>
-
<li>126 &mu;L H20</li>
+
        <li>126 &mu;L H20</li>
-
</ul><li>Master mix for NcoI:</li>
+
    </ul><li>Master mix for NcoI:</li>
-
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li>
+
    <ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li>
-
<li>7.5 &mu;L Tango buffer</li>
+
        <li>7.5 &mu;L Tango buffer</li>
-
<li>63 &mu;L H2O</li>
+
        <li>63 &mu;L H2O</li>
-
</ul></ul>
+
    </ul></ul>
-
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p>
+
    <p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p>
-
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p>
+
    <p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p>
Line 1,843: Line 1,843:
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png>
+
    <img class="img_notebook" src=http://2014.igem.org/wiki/images/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png>
-
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p>
+
    <p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p>
-
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p>
+
    <p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p>
-
<table class="table_notebook">
+
    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr>
-
</table>
+
    </table>
Line 1,869: Line 1,869:
-
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p>
+
    <p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p>
-
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li>
+
    <ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li>
-
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li>
+
        <li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li>
-
<li>1 &mu;L 2&alpha;1</li>
+
        <li>1 &mu;L 2&alpha;1</li>
-
<li>1 &mu;L BsaI</li>
+
        <li>1 &mu;L BsaI</li>
-
<li>1 &mu;L T4 ligase</li>
+
        <li>1 &mu;L T4 ligase</li>
-
<li>1 &mu;L ligase buffer</li>
+
        <li>1 &mu;L ligase buffer</li>
-
<li>4 &mu;L H20</li>
+
        <li>4 &mu;L H20</li>
-
</ul>
+
    </ul>
</br><h4 class="date_notebook">08/04/2014</h4>
</br><h4 class="date_notebook">08/04/2014</h4>
Line 1,903: Line 1,903:
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li>
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li>
-
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li>
+
    <li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li>
-
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li>
+
    <li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li>
-
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li>
+
    <li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li>
</ul>
</ul>
Line 1,923: Line 1,923:
-
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64ºC)</li>
+
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li>
-
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li>
+
    <ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li>
-
<li>35 &mu;L HF buffer (5x)</li>
+
        <li>35 &mu;L HF buffer (5x)</li>
-
<li>7 &mu;L dNTPs</li>
+
        <li>7 &mu;L dNTPs</li>
-
<li>8.75 &mu;L oligo forward (Jul07)</li>
+
        <li>8.75 &mu;L oligo forward (Jul07)</li>
-
<li>8.75 &mu;L oligo reverse (Jul08)</li>
+
        <li>8.75 &mu;L oligo reverse (Jul08)</li>
-
<li>1.05 &mu;L Phusion polymerase</li>
+
        <li>1.05 &mu;L Phusion polymerase</li>
-
<li>112.7 H20</li>
+
        <li>112.7 H20</li>
-
</ul></ul>
+
    </ul></ul>
-
<p class="p_notebook">PCR temperatures, 35 cycles:</p>
+
    <p class="p_notebook">PCR temperatures, 35 cycles:</p>
-
<table class="table_notebook">
+
    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (ºC)</td><td class="td_notebook">Time </td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
-
</table>
+
    </table>
-
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li>
+
    <ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li>
-
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
+
        <ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
-
<li>10 &mu;L HF buffer (5x)</li>
+
            <li>10 &mu;L HF buffer (5x)</li>
-
<li>2 &mu;L dNTPs</li>
+
            <li>2 &mu;L dNTPs</li>
-
<li>2.5 &mu;L oligo forward (Jul09)</li>
+
            <li>2.5 &mu;L oligo forward (Jul09)</li>
-
<li>2.5 &mu;L oligo reverse (Jul10)</li>
+
            <li>2.5 &mu;L oligo reverse (Jul10)</li>
-
<li>0.5 &mu;L Phusion polymerase</li>
+
            <li>0.5 &mu;L Phusion polymerase</li>
-
<li>32 &mu;L H20</li>
+
            <li>32 &mu;L H20</li>
-
</ul></ul>
+
        </ul></ul>
-
<p class="p_notebook">PCR temperatures, 35 cycles:</p>
+
        <p class="p_notebook">PCR temperatures, 35 cycles:</p>
-
<table class="table_notebook">
+
        <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (ºC)</td><td class="td_notebook">Time </td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
-
</table>
+
        </table>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/fa/20140805_PCR_FAO1.png>
+
        <img class="img_notebook" src=http://2014.igem.org/wiki/images/f/fa/20140805_PCR_FAO1.png>
-
<p class="p_notebook">It continues without working. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p>
+
        <p class="p_notebook">It continues without working. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p>
-
</br><h4 class="date_notebook">08/06/14</h4>
+
    </br><h4 class="date_notebook">08/06/14</h4>
-
<p class="p_notebook">Minipreps of yesterday's culture were made:</p>
+
    <p class="p_notebook">Minipreps of yesterday's culture were made:</p>
-
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li>
+
    <ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li>
-
</ul>
+
    </ul>
-
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p>
+
    <p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p>
-
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li>
+
    <ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li>
-
<li>P35S:EaDAcT:T35S in 2&Omega;2</li>
+
        <li>P35S:EaDAcT:T35S in 2&Omega;2</li>
-
</ul>
+
    </ul>
-
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p>
+
    <p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p>
-
<ul class="ul_notebook"><li>FAO1-PCR1: </li>
+
    <ul class="ul_notebook"><li>FAO1-PCR1: </li>
-
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
+
        <ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
-
<li>10 &mu;L HF buffer (5x)</li>
+
            <li>10 &mu;L HF buffer (5x)</li>
-
<li>2 &mu;L dNTPs</li>
+
            <li>2 &mu;L dNTPs</li>
-
<li>2.5 &mu;L oligo forward (Jul07)</li>
+
            <li>2.5 &mu;L oligo forward (Jul07)</li>
-
<li>2.5 &mu;L oligo reverse (Jul08)</li>
+
            <li>2.5 &mu;L oligo reverse (Jul08)</li>
-
<li>0.5 &mu;L Phusion polymerase</li>
+
            <li>0.5 &mu;L Phusion polymerase</li>
-
<li>32 &mu;L H20</li>
+
            <li>32 &mu;L H20</li>
-
</ul></ul>
+
        </ul></ul>
-
<ul class="ul_notebook"><li>FAO2-PCR1: </li>
+
        <ul class="ul_notebook"><li>FAO2-PCR1: </li>
-
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
+
            <ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
-
<li>10 &mu;L HF buffer (5x)</li>
+
                <li>10 &mu;L HF buffer (5x)</li>
-
<li>2 &mu;L dNTPs</li>
+
                <li>2 &mu;L dNTPs</li>
-
<li>2.5 &mu;L oligo forward (Jul09)</li>
+
                <li>2.5 &mu;L oligo forward (Jul09)</li>
-
<li>2.5 &mu;L oligo reverse (Jul10)</li>
+
                <li>2.5 &mu;L oligo reverse (Jul10)</li>
-
<li>0.5 &mu;L Phusion polymerase</li>
+
                <li>0.5 &mu;L Phusion polymerase</li>
-
<li>32 &mu;L H20</li>
+
                <li>32 &mu;L H20</li>
-
</ul></ul>
+
            </ul></ul>
-
<p class="p_notebook">PCR temperatures, 35 cycles:</p>
+
            <p class="p_notebook">PCR temperatures, 35 cycles:</p>
-
<table class="table_notebook">
+
            <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (ºC)</td><td class="td_notebook">Time </td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
-
</table>
+
            </table>
-
<p class="p_notebook">Digestions made in silico to check minipreps:</p>
+
            <p class="p_notebook">Digestions made in silico to check minipreps:</p>
-
<p class="p_notebook"><i>E. coli</i></p>
+
            <p class="p_notebook"><i>E. coli</i></p>
-
<table class="table_notebook">
+
            <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr>
-
</table>
+
            </table>
-
<p class="p_notebook"><i>A. tumefaciens</i></p>
+
            <p class="p_notebook"><i>A. tumefaciens</i></p>
-
<table class="table_notebook">
+
            <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr>
-
</table>
+
            </table>
-
<p class="p_notebook">Digestion master mixes:</p>
+
            <p class="p_notebook">Digestion master mixes:</p>
-
<ul class="ul_notebook"><li>Master mix for NotI:</li>
+
            <ul class="ul_notebook"><li>Master mix for NotI:</li>
-
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li>
+
                <ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li>
-
<li>12.5 &mu;L Orange buffer</li>
+
                    <li>12.5 &mu;L Orange buffer</li>
-
<li>105 &mu;L H20</li>
+
                    <li>105 &mu;L H20</li>
-
</ul><li>Master mix for RsaI:</li>
+
                </ul><li>Master mix for RsaI:</li>
-
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li>
+
                <ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li>
-
<li>10 &mu;L Tango buffer</li>
+
                    <li>10 &mu;L Tango buffer</li>
-
<li>84 &mu;L H2O</li>
+
                    <li>84 &mu;L H2O</li>
-
</ul></ul>
+
                </ul></ul>
-
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p>
+
                <p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p>
-
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p>
+
                <p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p>
-
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li>
+
                <ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li>
-
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li>
+
                    <ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li>
-
<li>2.5 &mu;L Buffer</li>
+
                        <li>2.5 &mu;L Buffer</li>
-
<li>5 &mu;L Miniprep sample</li>
+
                        <li>5 &mu;L Miniprep sample</li>
-
<li>17 &mu;L H2O</li>
+
                        <li>17 &mu;L H2O</li>
-
</ul></ul>
+
                    </ul></ul>
-
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p>
+
                    <p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/7/72/20140806_agro_y_cup2.png>
+
                    <img class="img_notebook" src=http://2014.igem.org/wiki/images/7/72/20140806_agro_y_cup2.png>
-
<p class="p_notebook">FAO1 PCR product.</p>
+
                    <p class="p_notebook">FAO1 PCR product.</p>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png>
+
                    <img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png>
-
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p>
+
                    <p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p>
-
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p>
+
                    <p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p>
-
<table class="table_notebook">
+
                    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td><td class="td_notebook">Dilution</td></tr>
+
                        <tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr>
+
                        <tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr>
+
                        <tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr>
+
                        <tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr>
+
                        <tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr>
-
</table>
+
                    </table>
-
<p class="p_notebook">Recultured media was grown at 28 ºC overnight (around 16 h).</p>
+
                    <p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p>
-
</br><h4 class="date_notebook">08/07/2014</h4>
+
                </br><h4 class="date_notebook">08/07/2014</h4>
-
<p class="p_notebook">Agroinfiltrate in <i>Nicotiana benthamiana</i>.</p>
+
                <p class="p_notebook">Agroinfiltrate in <i>Nicotiana benthamiana</i>.</p>
-
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li>
+
                <ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li>
-
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li>
+
                    <li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li>
-
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li>
+
                    <li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li>
-
</ul>
+
                </ul>
-
<p class="p_notebook">Agroinfiltration protocol consist on:</p>
+
                <p class="p_notebook">Agroinfiltration protocol consist on:</p>
-
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li>
+
                <ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li>
-
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li>
+
                    <li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li>
-
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li>
+
                    <li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li>
-
<li>Mix the cultures, keeping all of them in the same proportions.</li>
+
                    <li>Mix the cultures, keeping all of them in the same proportions.</li>
-
<li>Proceed to agroinfiltration.</li>
+
                    <li>Proceed to agroinfiltration.</li>
-
</ul>
+
                </ul>
-
</br><h4 class="date_notebook">08/08/2014</h4>
+
            </br><h4 class="date_notebook">08/08/2014</h4>
-
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jes&uacute;s Mu&ntilde;oz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p>
+
            <p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jes&uacute;s Mu&ntilde;oz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p>
-
<table class="table_notebook">
+
            <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56ºC</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54ºC</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49ºC (annealing)</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51ºC</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr>
-
</table>
+
            </table>
-
<p class="p_notebook">Possibility of primer combinations </p>
+
            <p class="p_notebook">Possibility of primer combinations </p>
-
<table class="table_notebook">
+
            <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49ºC</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54ºC</td></tr>
+
                <tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr>
-
</table>
+
            </table>
Line 2,297: Line 2,297:
-
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52ºC). C primer combination was not used due to the length of the spected band. </p>
+
            <p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p>
-
<p class="p_notebook">PCR parameters</p>
+
            <p class="p_notebook">PCR parameters</p>
-
<ul class="ul_notebook"><li>94ºC, 3 min</li>
+
            <ul class="ul_notebook"><li>94&deg;C, 3 min</li>
-
<li>35 cycles</li>
+
                <li>35 cycles</li>
-
<ul class="ul_ul_notebook"><li>94ºC, 30 s</li>
+
                <ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li>
-
<li>49 or 52ºC, 15 s</li>
+
                    <li>49 or 52&deg;C, 15 s</li>
-
<li>72ºC, 90 s</li>
+
                    <li>72&deg;C, 90 s</li>
-
</ul><li>72ºC, 7 min</li>
+
                </ul><li>72&deg;C, 7 min</li>
-
</ul>
+
            </ul>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png>
+
            <img class="img_notebook" src=http://2014.igem.org/wiki/images/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png>
-
<p class="p_notebook"> </p>
+
            <p class="p_notebook"> </p>
-
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer.  </p>
+
            <p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer.  </p>
-
</br><h4 class="date_notebook">08/11/2014</h4>
+
        </br><h4 class="date_notebook">08/11/2014</h4>
-
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p>
+
        <p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p>
-
<p class="p_notebook">PCRs wih Taq polimerase:</p>
+
        <p class="p_notebook">PCRs wih Taq polimerase:</p>
-
<ul class="ul_notebook"><li>1 &mu;L Template </li>
+
        <ul class="ul_notebook"><li>1 &mu;L Template </li>
-
<li>1.5 &mu;L dNTPs</li>
+
            <li>1.5 &mu;L dNTPs</li>
-
<li>1 &mu;L Forward primer</li>
+
            <li>1 &mu;L Forward primer</li>
-
<li>1 &mu;L Reverse primer</li>
+
            <li>1 &mu;L Reverse primer</li>
-
<li>1 &mu;L Taq pol.</li>
+
            <li>1 &mu;L Taq pol.</li>
-
<li>5 Buffer 10X</li>
+
            <li>5 Buffer 10X</li>
-
<li>39.5 &mu;L H2O</li>
+
            <li>39.5 &mu;L H2O</li>
-
</ul>
+
        </ul>
-
<table class="table_notebook">
+
        <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 Rtrv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 Rtrv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 Rtrv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr>
+
            <tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 Rtrv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr>
-
</table>
+
        </table>
-
<p class="p_notebook">PCR conditions:</p>
+
        <p class="p_notebook">PCR conditions:</p>
-
<ul class="ul_notebook"><li>94ºC 3 min</li>
+
        <ul class="ul_notebook"><li>94&deg;C 3 min</li>
-
<li>35 cycles</li>
+
            <li>35 cycles</li>
-
<ul class="ul_ul_notebook"><li>94ºC 30 s</li>
+
            <ul class="ul_ul_notebook"><li>94&deg;C 30 s</li>
-
<li>49ºC 15 s</li>
+
                <li>49&deg;C 15 s</li>
-
<li>72ºC 90 s</li>
+
                <li>72&deg;C 90 s</li>
-
</ul><li>72ºC 7 min</li>
+
            </ul><li>72&deg;C 7 min</li>
-
</ul>
+
        </ul>
-
<a name="Trichome_promoter"></a></br></br><h3 class="section_notebook">Trichome promoter</h3></br><h4 class="date_notebook">07/03/2014</h4>
+
        <img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png>
-
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p>
+
        <p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong.</p>
-
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li>
+
        <a name="Trichome_promoter"></a></br></br><h3 class="section_notebook">Trichome promoter</h3></br><h4 class="date_notebook">07/03/2014</h4>
-
<li>Introduce the disks inside the tube.</li>
 
-
<li>Introduce the two tubes in liquid nitrogen.</li>
 
-
<li>Remove them from the liquid nitrogen and store at -80ºC until use.</li>
+
        <p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p>
-
<li>Remove one tube from -80ºC and re-introduce them in liquid nitrogen. </li>
 
-
<li>Grind the disks.</li>
 
-
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65ºC.)</li>
+
        <ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li>
-
<li>Grind the mixture.</li>
+
            <li>Introduce the disks inside the tube.</li>
-
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li>
+
            <li>Introduce the two tubes in liquid nitrogen.</li>
-
<li>Vortex it and maintain at 65ºC for 45 min. Mix it by inversion 5-15 min.</li>
+
            <li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li>
-
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li>
+
            <li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li>
-
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li>
+
            <li>Grind the disks.</li>
-
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li>
+
            <li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li>
-
<li>Repeat the last three steps.</li>
+
            <li>Grind the mixture.</li>
-
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li>
+
            <li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li>
-
<li>To precipitate, maintain 20 min on ice or at -80ºC during 5 min.</li>
+
            <li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li>
-
<li>Centrifuge 10 min at 13000 rpm (4ºC).</li>
+
            <li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li>
-
<li>Discard the supernatant by decantation (be carefull with the pellet).</li>
+
            <li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li>
-
<li>Wash with 600 &mu;L ethanol (80%).</li>
+
            <li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li>
-
<li>Centrifuge 5 min at 13000 rpm. </li>
+
            <li>Repeat the last three steps.</li>
-
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li>
+
            <li>Add one volume o isopropanol and mix well by inversion (10 times). </li>
-
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li>
+
            <li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li>
-
<li>Store at -20ºC. </li>
+
            <li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li>
-
</ul>
+
            <li>Discard the supernatant by decantation (be carefull with the pellet).</li>
-
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p>
+
            <li>Wash with 600 &mu;L ethanol (80%).</li>
 +
            <li>Centrifuge 5 min at 13000 rpm. </li>
 +
            <li>Discard the ethanol by pipeting and let it dry a few minutes. </li>
-
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li>
+
            <li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li>
-
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20ºC)</li>
+
            <li>Store at -20&deg;C.  </li>
-
</ul>
+
        </ul>
-
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p>
+
        <p class="p_notebook">Measurement of genomic concentration with nanodrop.</p>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/5/5e/20140703_extraccion_genomico_tobacco.png>
+
        <ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li>
 +
            <li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li>
 +
        </ul>
-
<p class="p_notebook">It is correct.</p>
+
        <p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p>
-
</br><h4 class="date_notebook">07/10/2014</h4>
+
        <img class="img_notebook" src=http://2014.igem.org/wiki/images/5/5e/20140703_extraccion_genomico_tobacco.png>
-
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p>
+
        <p class="p_notebook">It is correct.</p>
-
<p class="p_notebook">Ordered primers</p>
+
    </br><h4 class="date_notebook">07/10/2014</h4>
-
<ul class="ul_notebook"><li>IGEMJULO1</li>
+
    <p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p>
-
<li>IGEMJULO2</li>
 
-
</ul>
 
-
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p>
+
    <p class="p_notebook">Ordered primers</p>
-
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li>
+
    <ul class="ul_notebook"><li>IGEMJULO1</li>
-
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li>
+
        <li>IGEMJULO2</li>
-
</ul>
+
    </ul>
-
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p>
+
    <p class="p_notebook">Ajust primers to a 100 uM concentration:</p>
-
<p class="p_notebook">Reagents needed for PCR:</p>
+
    <ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li>
 +
        <li>IGEMJUL02 + 691 &mu;L miliQ H2O</li>
 +
    </ul>
-
<ul class="ul_notebook"><li>0.5 &mu;L template</li>
+
    <p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p>
-
<li>10 &mu;L buffer HF 5x</li>
 
-
<li>2 &mu;L dNTPs</li>
 
-
<li>2.5 &mu;L oligo R</li>
+
    <p class="p_notebook">Reagents needed for PCR:</p>
-
<li>2.5 &mu;L oligo F</li>
 
-
<li>0.5 &mu;L Pfu</li>
 
-
<li>32 &mu;L miliQ H2O</li>
+
    <ul class="ul_notebook"><li>0.5 &mu;L template</li>
-
</ul>
+
        <li>10 &mu;L buffer HF 5x</li>
-
<p class="p_notebook">Final volume: 50 &mu;L</p>
+
        <li>2 &mu;L dNTPs</li>
 +
        <li>2.5 &mu;L oligo R</li>
 +
        <li>2.5 &mu;L oligo F</li>
-
<p class="p_notebook">Parameters:</p>
+
        <li>0.5 &mu;L Pfu</li>
 +
        <li>32 &mu;L miliQ H2O</li>
 +
    </ul>
-
<ul class="ul_notebook"><li>98 ºC (2 min)</li>
+
    <p class="p_notebook">Final volume: 50 &mu;L</p>
-
<li>35 cycles</li>
 
-
<ul class="ul_ul_notebook"><li>98 ºC (10 sec)</li>
 
-
<li>59 ºC (15 sec)</li>
+
    <p class="p_notebook">Parameters:</p>
-
<li>72 ºC (45 sec)</li>
 
-
</ul><li>72 ºC (7 min)</li>
 
-
</ul>
+
    <ul class="ul_notebook"><li>98 &deg;C (2 min)</li>
 +
 
 +
        <li>35 cycles</li>
 +
 
 +
        <ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li>
 +
 
 +
            <li>59 &deg;C (15 sec)</li>
 +
 
 +
            <li>72 &deg;C (45 sec)</li>
 +
 
 +
        </ul><li>72 &deg;C (7 min)</li>
 +
 
 +
    </ul>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/dd/20140710_productoPCR_tricomas.png>
+
    <img class="img_notebook" src=http://2014.igem.org/wiki/images/d/dd/20140710_productoPCR_tricomas.png>
-
<p class="p_notebook">We didn't get PCR product.</p>
+
    <p class="p_notebook">We didn't get PCR product.</p>
Line 2,557: Line 2,565:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr>
</table>
</table>
Line 2,585: Line 2,593:
-
<ul class="ul_notebook"><li>98 ºC (2 min)</li>
+
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li>
-
<li>35 cycles</li>
+
    <li>35 cycles</li>
-
<ul class="ul_ul_notebook"><li>98 ºC (10 sec)</li>
+
    <ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li>
-
<li>1, 3, 5 -> 59 ºC (15 sec). 2, 4 -> 55 ºC (15 sec)</li>
+
        <li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li>
-
<li>72 ºC (45 sec)</li>
+
        <li>72 &deg;C (45 sec)</li>
-
</ul><li>72 ºC (7 min)</li>
+
    </ul><li>72 &deg;C (7 min)</li>
</ul>
</ul>
Line 2,613: Line 2,621:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr>
</table>
</table>
Line 2,637: Line 2,645:
-
<ul class="ul_notebook"><li>98 ºC (2 min)</li>
+
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li>
-
<li>35 cycles</li>
+
    <li>35 cycles</li>
-
<ul class="ul_ul_notebook"><li>98 ºC (10 sec)</li>
+
    <ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li>
-
<li>49, 52, 55, 60 ºC (15 sec)</li>
+
        <li>49, 52, 55, 60 &deg;C (15 sec)</li>
-
<li>72 ºC (45 sec)</li>
+
        <li>72 &deg;C (45 sec)</li>
-
</ul><li>72 ºC (7 min)</li>
+
    </ul><li>72 &deg;C (7 min)</li>
</ul>
</ul>
Line 2,669: Line 2,677:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5</td><td class="td_notebook">5</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50</td><td class="td_notebook">50</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10</td><td class="td_notebook">10</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5</td><td class="td_notebook">12.5</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5</td><td class="td_notebook">12.5</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5</td><td class="td_notebook">2.5</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5</td><td class="td_notebook">107.5</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr>
</table>
</table>
Line 2,689: Line 2,697:
-
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59  ºC.</p>
+
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59  &deg;C.</p>
Line 2,711: Line 2,719:
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li>
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li>
-
<li>1.25 &mu;L forward primer 10 uM</li>
+
    <li>1.25 &mu;L forward primer 10 uM</li>
-
<li>1.25 &mu;L reverse primer 10 uM</li>
+
    <li>1.25 &mu;L reverse primer 10 uM</li>
-
<li>0.5 &mu;L template 620 ng/&mu;L</li>
+
    <li>0.5 &mu;L template 620 ng/&mu;L</li>
-
<li>9.5 &mu;L H2O</li>
+
    <li>9.5 &mu;L H2O</li>
</ul>
</ul>
-
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 ºC.</p>
+
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p>
-
<ul class="ul_notebook"><li>98 ºC (30 sec)</li>
+
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li>
-
<li>35 cycles</li>
+
    <li>35 cycles</li>
-
<ul class="ul_ul_notebook"><li>98 ºC (10 sec)</li>
+
    <ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li>
-
<li>50, 53, 55, 59 ºC (15 sec)</li>
+
        <li>50, 53, 55, 59 &deg;C (15 sec)</li>
-
<li>72 ºC (45 sec)</li>
+
        <li>72 &deg;C (45 sec)</li>
-
</ul><li>72 ºC (2 min)</li>
+
    </ul><li>72 &deg;C (2 min)</li>
</ul>
</ul>
Line 2,743: Line 2,751:
-
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 ºC reactions.</p>
+
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p>
Line 2,757: Line 2,765:
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
-
<li>1 &mu;L PCR product</li>
+
    <li>1 &mu;L PCR product</li>
-
<li>1 &mu;L BsmBI (5-10 ud)</li>
+
    <li>1 &mu;L BsmBI (5-10 ud)</li>
-
<li>1 &mu;L T4 ligase (5-10 ud)</li>
+
    <li>1 &mu;L T4 ligase (5-10 ud)</li>
-
<li>1.2 &mu;L buffer ligase (3 ud)</li>
+
    <li>1.2 &mu;L buffer ligase (3 ud)</li>
-
<li>6.8 &mu;L H20</li>
+
    <li>6.8 &mu;L H20</li>
</ul>
</ul>
-
<p class="p_notebook">Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).</p>
+
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
Line 2,803: Line 2,811:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr>
</table>
</table>
Line 2,823: Line 2,831:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr>
</table>
</table>
Line 2,843: Line 2,851:
<ul class="ul_notebook"><li>pTnos (GB0037)</li>
<ul class="ul_notebook"><li>pTnos (GB0037)</li>
-
<li>pGFP (GB0059)</li>
+
    <li>pGFP (GB0059)</li>
-
<li>pLuciferase (GB0096)</li>
+
    <li>pLuciferase (GB0096)</li>
</ul>
</ul>
Line 2,873: Line 2,881:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr>
</table>
</table>
Line 2,895: Line 2,903:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr>
</table>
</table>
Line 2,917: Line 2,925:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr>
</table>
</table>
Line 2,949: Line 2,957:
-
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 ºC with agitation. </p>
+
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p>
Line 2,981: Line 2,989:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr>
</table>
</table>
Line 2,997: Line 3,005:
<ul class="ul_notebook"><li>Master mix for EcoRV:</li>
<ul class="ul_notebook"><li>Master mix for EcoRV:</li>
-
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li>
+
    <ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li>
-
<li>15 &mu;L Red buffer</li>
+
        <li>15 &mu;L Red buffer</li>
-
<li>126 &mu;L H20</li>
+
        <li>126 &mu;L H20</li>
-
</ul><li>Master mix for HindIII:</li>
+
    </ul><li>Master mix for HindIII:</li>
-
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li>
+
    <ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li>
-
<li>10 &mu;L Red buffer</li>
+
        <li>10 &mu;L Red buffer</li>
-
<li>84 &mu;L H2O</li>
+
        <li>84 &mu;L H2O</li>
-
</ul></ul>
+
    </ul></ul>
-
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p>
+
    <p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p>
-
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p>
+
    <p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png>
+
    <img class="img_notebook" src=http://2014.igem.org/wiki/images/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png>
-
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p>
+
    <p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p>
Line 3,031: Line 3,039:
-
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p>
+
    <p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p>
-
<table class="table_notebook">
+
    <table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr>
+
        <tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr>
-
</table>
+
    </table>
Line 3,053: Line 3,061:
-
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28ºC).</p>
+
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p>
Line 3,075: Line 3,083:
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p>
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p>
-
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos) were made. </p>
+
 
 +
 
 +
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico performed to check the insertion:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
    <tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
    <tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr>
 +
 
 +
    <tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p>
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4>
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4>
Line 3,101: Line 3,135:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr>
</table>
</table>
Line 3,121: Line 3,155:
-
<p class="p_notebook">Annealing temperature: both 61 ºC</p>
+
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p>
Line 3,131: Line 3,165:
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li>
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li>
-
<li>CUP2-PCR2: 348 bp</li>
+
    <li>CUP2-PCR2: 348 bp</li>
</ul>
</ul>
Line 3,157: Line 3,191:
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li>
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li>
-
<li>1 &mu;L CUP1-PCR1</li>
+
    <li>1 &mu;L CUP1-PCR1</li>
-
<li>1 &mu;L pUPD</li>
+
    <li>1 &mu;L pUPD</li>
-
<li>1 &mu;L BsmBI</li>
+
    <li>1 &mu;L BsmBI</li>
-
<li>1 &mu;L T4 ligase</li>
+
    <li>1 &mu;L T4 ligase</li>
-
<li>1 &mu;L ligase buffer</li>
+
    <li>1 &mu;L ligase buffer</li>
-
<li>4 &mu;L H20</li>
+
    <li>4 &mu;L H20</li>
</ul>
</ul>
Line 3,175: Line 3,209:
-
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37ºC).</p>
+
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p>
Line 3,205: Line 3,239:
<ul class="ul_notebook"><li>Gal4AD</li>
<ul class="ul_notebook"><li>Gal4AD</li>
-
<li>CUP2</li>
+
    <li>CUP2</li>
</ul>
</ul>
Line 3,215: Line 3,249:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr>
</table>
</table>
Line 3,263: Line 3,297:
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li>
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li>
-
<li>Gal4: 221.4 ng/&mu;L</li>
+
    <li>Gal4: 221.4 ng/&mu;L</li>
</ul>
</ul>
Line 3,277: Line 3,311:
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li>
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li>
+
    <ul class="ul_ul_notebook"><li>1 &mu;L P35S</li>
-
<li>1 &mu;L CUP2</li>
+
        <li>1 &mu;L CUP2</li>
-
<li>1 &mu;L Gal4AD</li>
+
        <li>1 &mu;L Gal4AD</li>
-
<li>1 &mu;L T35S</li>
+
        <li>1 &mu;L T35S</li>
-
<li>1 &mu;L BsaI</li>
+
        <li>1 &mu;L BsaI</li>
-
<li>1 &mu;L T4 ligase</li>
+
        <li>1 &mu;L T4 ligase</li>
-
<li>1 &mu;L Buffer ligase</li>
+
        <li>1 &mu;L Buffer ligase</li>
-
<li>1 &mu;L 2&alpha;2</li>
+
        <li>1 &mu;L 2&alpha;2</li>
-
<li>2 &mu;L H2O</li>
+
        <li>2 &mu;L H2O</li>
-
</ul></ul>
+
    </ul></ul>
-
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li>
+
    <ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
+
        <ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
-
<li>1 &mu;L CUP2</li>
+
            <li>1 &mu;L CUP2</li>
-
<li>1 &mu;L Gal4AD</li>
+
            <li>1 &mu;L Gal4AD</li>
-
<li>1 &mu;L T35S</li>
+
            <li>1 &mu;L T35S</li>
-
<li>1 &mu;L BsaI</li>
+
            <li>1 &mu;L BsaI</li>
-
<li>1 &mu;L T4 ligase</li>
+
            <li>1 &mu;L T4 ligase</li>
-
<li>1 &mu;L Buffer ligase</li>
+
            <li>1 &mu;L Buffer ligase</li>
-
<li>1 &mu;L 2&alpha;2</li>
+
            <li>1 &mu;L 2&alpha;2</li>
-
<li>2 &mu;L H2O </li>
+
            <li>2 &mu;L H2O </li>
-
<a name="Biosafety"></a></br></br><h3 class="section_notebook">Biosafety</h3></br><h4 class="date_notebook">07/22/2014</h4>
+
            <a name="Biosafety"></a></br></br><h3 class="section_notebook">Biosafety</h3></br><h4 class="date_notebook">07/22/2014</h4>
-
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p>
+
            <p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p>
-
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li>
+
            <ul class="ul_notebook"><li>P35S:Rosea:TNos</li>
-
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li>
+
                <li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li>
-
</ul>
+
            </ul>
-
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p>
+
            <p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p>
-
</br><h4 class="date_notebook">07/23/2014</h4>
+
        </br><h4 class="date_notebook">07/23/2014</h4>
-
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
+
        <p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
Line 3,345: Line 3,379:
-
</br><h4 class="date_notebook">07/24/2014</h4>
+
    </br><h4 class="date_notebook">07/24/2014</h4>
-
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
+
    <p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
Line 3,365: Line 3,399:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr>
</table>
</table>
Line 3,407: Line 3,441:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr>
</table>
</table>
Line 3,431: Line 3,465:
<ul class="ul_notebook"><li>TA29 PCR parameters</li>
<ul class="ul_notebook"><li>TA29 PCR parameters</li>
-
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
+
    <ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
-
<li>35 cycles</li>
+
        <li>35 cycles</li>
-
<li>98&deg;C, 10 s</li>
+
        <li>98&deg;C, 10 s</li>
-
<li>60&deg;C, 18 s</li>
+
        <li>60&deg;C, 18 s</li>
-
<li>72&deg;C, 40 s</li>
+
        <li>72&deg;C, 40 s</li>
-
<li>72&deg;C, 7 min</li>
+
        <li>72&deg;C, 7 min</li>
-
</ul><li>Barnase PCR parameters</li>
+
    </ul><li>Barnase PCR parameters</li>
-
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
+
    <ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
-
<li>35 cycles</li>
+
        <li>35 cycles</li>
-
<li>98&deg;C, 10 s</li>
+
        <li>98&deg;C, 10 s</li>
-
<li>63&deg;C, 18 s</li>
+
        <li>63&deg;C, 18 s</li>
-
<li>72&deg;C, 40 s</li>
+
        <li>72&deg;C, 40 s</li>
-
<li>72&deg;C, 7 min</li>
+
        <li>72&deg;C, 7 min</li>
-
</ul></ul>
+
    </ul></ul>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
+
    <img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
-
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p>
+
    <p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p>
Line 3,487: Line 3,521:
-
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61ºC. </p>
+
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p>
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png>
 +
 +
 +
 +
<p class="p_notebook">We still do not get PCR product.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/12/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
Line 3,507: Line 3,559:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr>
+
    <tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr>
</table>
</table>
Line 3,517: Line 3,569:
-
<ul class="ul_notebook"><li>P35s PCR parameters</li>
+
<p class="p_notebook">P35s PCR parameters</p>
-
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
+
<ul class="ul_notebook"><li>98&deg;C, 2 min</li>
-
<li>35 cycles</li>
+
    <li>35 cycles</li>
-
<li>98, 10 s</li>
+
    <ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li>
-
<li>67&deg;C, 18 s</li>
+
        <li>67&deg;C, 18 s</li>
-
<li>72&deg;C, 40 s</li>
+
        <li>72&deg;C, 40 s</li>
-
<li>98&deg;C, 7 min</li>
+
    </ul><li>98&deg;C, 7 min</li>
-
</ul><li>T35s PCR parameters</li>
+
</ul>
-
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
+
<p class="p_notebook">T35s PCR parameters</p>
-
<li>35 cycles</li>
+
<ul class="ul_notebook"><li>98&deg;C, 2 min</li>
-
<li>98&deg;C, 10 s</li>
+
    <li>35 cycles</li>
-
<li>65&deg;C, 18 s</li>
+
    <ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li>
-
<li>72&deg;C, 40 s</li>
+
        <li>65&deg;C, 18 s</li>
-
<li>98&deg;C, 7 min</li>
+
        <li>72&deg;C, 40 s</li>
-
</ul></ul>
+
    </ul><li>98&deg;C, 7 min</li>
 +
 
 +
</ul>
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
Line 3,568: Line 3,622:
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p>
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/11/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png>
 +
 +
 +
 +
<p class="p_notebook">We still do not get PCR product.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">08/12/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
</div>
</div>

Revision as of 19:25, 16 August 2014




Biosynthesis


06/09/2014

The enzymes involved in the biosynthesis pathways are AtrΔ11, HarFAR, FAO1, EaDAcT.



The design of the GBlocks was performed taking into account the following considerations:

  • Codon optimization
  • Inner restriction sites eliminations by finding synonymous mutations
  • Addition of GB endings

06/10/2014

Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD

GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).


06/11/2014

We ordered the following gBlocks and primers.

  • EaDAcT: Eunymus alatus (adapted for GB) 1127 bp
  • HarFAR: Helicoverpa armigera (adapted for GB) 1400 bp
  • AtrΔ11: Amyelois transitella (order primers for GB) 1000 bp
    • I14Jun03 AtrΔ11 F1
    • I14Jun04 AtrΔ11 R1
  • FAO1: N. benthamiana primers
    • I14Jun01 FAO1 F1
    • I14Jun02 FAO1 R1
NameSequenceLenghtTm (NTI)Tm (Phusion)
I14Jun01_FAO1_F1cgccgtctcgctcgaatggagaaaaagagccatcc3549.962.4
I14Jun02_FAO1_R1cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc4654.563.7
I14Jun03Atr_D11_F1gcgccgtctcgctcgaatggttcctaataag3154.565.3
I14Jun04Atr_D11_R1gcgccgtctcgctcgaagctcaacgtttc295769.1

06/24/2014

We thought which parts of the GB collection could we use.

Strategy 1:

  • pP35S, pT35s (x2)
  • pAtUbq10, pTAtHSP18.2

Strategy 2:

  • pP35S, pT35s
  • pP35s, pTAtHSP18.2
  • pAtUbq10, pTAtHSP18.2

Strategy 3:

  • pP35S, pT35s
  • pP35s, pTTctp
  • pAtUbq10, pTAtHSP18.2

Pieces to take from GB2.0 colection:

pDGB2α1GB0483Kan
pDGB2α2GB0484Kan
pP35sGB0030Amp
pT35sGB0036Amp
pAtUbq10GB0223Amp
pTAtHSP18.2GB0035Amp
pTTctpGB0081Amp
pUPDGB0317Amp

Later we will need:

pDGB2Ω1GB0487Smp
pDGB2Ω2GB0488Smp

Prepare plaques with antibiotics Kan, Spm, Amp


06/25/2014

Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).


06/26/2014

Culture in agar Petri dish. 2 plaques: Amp and Kan.

Minipreps with EZNA Plasmid DNA MiniKit I.

Expected digestions:

pP35s GB0030NotIBuffer: Orange2981, 1105
pT35s GB0036NotIBuffer: Orange2981, 304
pAtUbq10 GB0223NotIBuffer: Orange2981, 714
pTAtHSP18.2 GB0035NotIBuffer: Orange2981, 328
pTTctp GB0081NotIBuffer: Orange2981, 487

Electrophoresis analysis.

We got the expected bands in all cases.


07/01/2014

AtrΔ11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence.

We made a PCR amplification using the AtrΔ11 gene as a template and the oligos: R +F

Reagents needed:

  • 32.5 μL of H2O miliQ
  • 10 μL HF buffer
  • 2 μL dNTPs
  • 2.5 μL Reverse primer
  • 2.5 μL Forward primer
  • 1 μL template (AtrΔ11 gene)
  • 0.5 μL phusion (polimerase)

PCR parameters: The annealing temperature was 60°C and the extension temperature was 65°C.

Electrophoresis performed to check the PCR product, which was expected to be around 1 kb.

pUPD ligation of EaDAcT, HarFar and AtrΔ11

Reagents needed for the reaction of ligation:

  • 1 μL pUPD
  • 1 μL PCR product/gblock product
  • 1.2 μL buffer 10x
  • 1 μL BsmBI
  • 1 μL T4 ligase
  • 6.8 μL H2O miliQ

Vfinal= 12 μL

Termocycler parameters: The ligase temperature was 16°C and the BsmBI temperature was 37°C.

As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and AtrΔ11.


07/02/2014

E. coli transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent E. coli strain (DH5α) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.

Reagents needed:

  • E. coli aliquot
  • 1.5 μL of ligation in pUPD (for each gene: EaDAcT, HarFAR, AtrΔ11)

Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 μL of SOC are added to each vial. All of them were incubated at 37°C for 1 hour.

After incubation, culture in Petri plates (always in a LAF).

2 cell-culture dishes per transformation (with Ampicillin), one with 50 μL and the other with the remaining volume.

Petri plates are incubated at 37°C for 16 h.


07/03/2014

Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 μL Amp. This step is repeated three times:

  • 3x 1 colony of EaDAcT in pUPD + LB + Amp
  • 3x 1 colony of HarFAR in pUPD + LB + Amp
  • 3x 1 colony of AtrΔ11 in pUPD + LB + Amp

All tubes are incubated at 37°C overnight in agitation.


07/04/2014

Digestions in silico using Vector NTI to check after minipreps if ligations are correct.

EaDAcTNotI2981, 1167
RsaI1876, 1343, 532, 306, 91
HarFARNotI2981, 1440
PvuII2564, 1394, 463
AtrΔ11NotI2981, 1056
BanII2570, 803, 351, 314

Digestion reagents:

  • 0.5 μL restriction enzyme
  • 2.5 μL buffer
  • 21 μL H20 (miliQ)
  • 1 μL sample

Preparation of master mixes

  • Master mix for NotI
    • 5 μL NotI
    • 25 μL Orange
    • 210 μL H20
  • Master mix for RsaI
    • 1.5 μL RsaI
    • 7.5 μL Tango
    • 63 μL H20
  • Master mix for PvuII
    • 1.5 μL PvuII
    • 7.5 μL Green
    • 63 μL H20
  • Master mix for BanII
    • 1.5 μL BanII
    • 7.5 μL Tango
    • 63 μL H20

Perform electrophoresis to check if the size of the fragments from the digestions is correct.

Comments:

  • We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.
  • For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.

07/06/2014

We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:

  • 3.5 mL LB
  • 7 μL Amp
  • 7 μL X-Gal
  • 3.5 μL IPTG (turns the tube blue if the colonies picked were blue)

07/07/2014

We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and AtrΔ11 2, 3.

Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.

EaDAcTNotI2981, 1167
RsaI1876, 1343, 532, 306, 91
HarFARNotI2981, 1440
PvuII2564, 1394, 463
AtrΔ11NotI2981, 1056
RsaI1879, 1310, 467, 327, 54

Preparation of master mixes

  • Master mix for NotI
    • 3.5 μL NotI
    • 17.5 μL Orange
    • 147 μL H20
  • Master mix for RsaI
    • 2 μL RsaI
    • 10 μL Tango
    • 84 μL H20
  • Master mix for PvuII
    • 2 μL PvuII
    • 10 μL Green
    • 84 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK. We sent AtrΔ11 (3), HarFAR (3) and EaDAcT (3) to sequence.


07/08/2014

Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.

The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an α or Ω vector.

Reagents needed for ligation:

  • 1 μL promoter 75 ng/μL
  • 1 μL terminator 75 ng/μL
  • 1 μL CDS 75 ng/μL
  • 1 μL vector α
  • 1.2 μL ligase buffer 10x
  • 1 μL T4
  • 1 μL BsaI
  • 4.2 μL H20

Total: 12 μL

Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different α vector.

Strategy Promoter-Terminator:

AtrΔ11P35sT35s40.41
HarFARP35sTatHSP39.68
EaDAcTPAtUbqTatHSP32.27

Adjust concentrations to 75 ng/μL for ligation reaction

Initial concentrations (nanodrop):

PieceConcentrationsVolumeVolume of H20 to add
PAtUpb442.6 ng/μL34 μL166.6 μL
pTatHSP235.4 ng/μL36 μL77 μL
T35s194.9 ng/μL37.5 μL60 μL
P35s454.7 ng/μL36 μL182 μL
2α157.1 ng/μL-We will need to put 1.5 μL of this one
2α2104.0 ng/μL38 μL14.7 μL
AtrΔ11359.3 ng/μL20 μL75.8 μL
HarFAR404.4 ng/μL15 μL65.9 μL
EaDAcT155.6 ng/μL10 μL10.7 μL

Ligation reaction

  • P35s:AtrΔ11:T35s in 2α1
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL AtrΔ11
    • 1.5 μL 2α1
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 3.7 μL H20
  • P35s:HarFAR:TatHSP in 2α2
    • 1 μL P35s
    • 1 μL TatHSP
    • 1 μL HarFAR
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20
  • PAtUbq:EaDAcT:TatHSP in 2α2
    • 1 μL PAtUbq
    • 1 μL TatHSP
    • 1 μL EaDAcT
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20

07/09/2014

Transformation of constructions in E. coli

We finally got the sequencing results from 07/07/2014.

  • Mutation in AtrΔ11 -> We threw away the colonies and transformed cells. We picked again white colonies.
  • HarFAR -> Sequencing correct
  • EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!

We took vectors 2Ω1 (GB0487) and 2Ω2 (GB0488) parts from the GB colection.

  • Worked in the LAF
  • Cultivated in a Petri dish with Spm
  • Let them grow for one day

Cultivate transformated cells in two Kan plaques (Kan matches vector α)

  • 50 mL transformation in one plaque
  • Rest of the culture in another (250 μL aprox)
  • Let them grow for one day

07/10/2014

Pick colonies and grow them in liquid medium.

  • 6 from AtrΔ11 (repetition because of mutation)
    • 3.5 mL LB
    • 7 μL Amp
    • 7 μL X-gal
    • 3.5 μL IPTG
  • 1 colony from 2Ω1
    • 3.5 mL LB
    • 7 μL Spm
  • 1 colony from 2Ω2
    • 3.5 mL LB
    • 7 μL Spm
  • 3 colonies from P35s:HarFAR:TatHSP
    • 3.5 mL LB
    • 7 μL Kan
  • 3 colonies from PAtUbq:EaDAcT:TatHSP
    • 3.5 mL LB
    • 7 μL Kan

Grow at 37°C in agitation overnight.

We have checked the promoters and terminators are both compatible with GB and BioBricks.

Only P35s and T35s work for both. pPnos could also work.

Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.


07/11/2014

We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes AtrΔ11 3 and 6; 2Ω1; 2Ω2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.

Additionally, we have cultured each of the colonies named above to store them.


07/14/2014

We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.

PartsRetriction enzymeExpected Bands
PAtUbq:EaDAcT:TatHSP in 2α2HindIII6322, 1722, 736, 221
P35s:HarFAR:TatHSP in 2 α2HindIII6322, 1794, 221
AtrΔ11NotI2961, 1056
2Ω1BamHI6652, 382, 239
2Ω2EcoRV6652, 621

Preparation of master mixes

  • Master mix for HindIII
    • 3.5 μL HindIII
    • 17.5 μL Red
    • 147 μL H20
  • Master mix for NotI
    • 1.5 μL NotI
    • 7.5 μL Orange
    • 63 μL H20
  • Mix for EcoRV
    • 0.5 μL EcoRV
    • 2.5 μL Red
    • 21 μL H20
  • Mix for BamHI
    • 0.5 μL PvuII
    • 2.5 μL Green
    • 21 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK except the AtrΔ11 (3), which had some partial digestion. It was the reason we sent AtrΔ11 (6) to sequence.


07/15/2014

We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation.

Reagents needed for the reaction of ligation (Total volume = 12 μL):

  • P35s:AtrΔ11:T35s in 2α1
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL AtrΔ11
    • 1.5 μL 2α1
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 3.7 μL H20
  • P35s:HarFAR:T35s in 2α2
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL HarFAR
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20
  • P35s:EaDAcT:T35s in 2α2
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL EaDAcT
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20

Note: Concentrations were previously adjusted to 75 ng/μL. Only the AtrΔ11 was adjusted from 250.2 ng/μL.

Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:

  • Amp
    • pAtrΔ11 (6)
    • pEaDAcT (3)
    • pHarFAR (3)
  • Kan
    • P35:HarFAR:TatHSP in 2α2 (3)
    • PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)

07/16/2014

Storage in glycerol of the HarFAR (GB1018), AtrΔ11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2α2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2α2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve.

The procedure is to mix 700 μL of culture with 300 μL of glycerol 50%, spin it and store it in the -80°C.


07/17/2014

Pick 3 colonies of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.

Digestions in silico.

Transcriptional unitsRestriction enzymesExpected bands
P35s:AtrΔ11:T35sEcoRI6323, 2269
NcoI390, 8202
P35s:HarFAR:T35sHindIII933, 6322, 1722
NcoI8587, 390
P35s:EaDAcT:T35sHindIII6322, 2366
EcoRV683, 8021

Preparation of reagents needed for genomic extraction of Candida tropicalis for FAO1.


07/18/2014

Mistake in P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.


07/19/2014

Minipreps of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.

Transcriptional unit DNA concentration
P35s:AtrΔ11:T35s (1)164 ng/μL
P35s:AtrΔ11:T35s (2)168 ng/μL
P35s:AtrΔ11:T35s (3)147.4 ng/μL
P35s:HarFAR:T35s (1)125.3 ng/μL
P35s:HarFAR:T35s (2)114.5 ng/μL
P35s:HarFAR:T35s (3)140.3 ng/μL
P35s:EaDAcT:T35s (1)144.2 ng/μL
P35s:EaDAcT:T35s (2)137.9 ng/μL
P35s:EaDAcT:T35s (3)128.5 ng/μL
Stuffer fragment135.5 ng/μL
2Ω1196.8 ng/μL
2Ω2175.4 ng/μL

Digestions of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.

All digestions were correct except P35s:EaDAcT:T35s (2).

Ligation in Ω vectors.

  • P35s:AtrΔ11:T35s + P35s:HarFAR:T35s in 2Ω1
    • 1 μL P35s:AtrΔ11:T35s (75 ng/μL)
    • 1 μL P35s:HarFAR:T35s (75 ng/μL)
    • 1 μL 2Ω1 (75 ng/μL)
    • 1 μL BsmBI (5-10 ud)
    • 1 μL T4 ligase (5-10 ud)
    • 1 μL buffer ligase (3 ud)
    • 4 μL H20
  • P35s:EaDAcT:T35s in 2Ω2
    • 1 μL stuffer fragment (75 ng/μL)
    • 1 μL P35s:EaDAcT:T35s (75 ng/μL)
    • 1 μL 2Ω2 (75 ng/μL)
    • 1 μL BsmBI (5-10 ud)
    • 1 μL T4 ligase (5-10 ud)
    • 1 μL buffer ligase (3 ud)
    • 4 μL H20

Set the reaction: 25 cycles x (37°C 2 min, 16°C 5 min).

Omega vectors include a resistance to spectinomycin.


07/20/2014

Transform and grow in Petri dishes yesterday's ligations: P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 and P35S:EaDAcT:T35S in 2Ω2.


07/21/2014

Pick colonies of P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 (3) and P35S:EaDAcT:T35S in 2Ω2 (2).


07/22/2014

We made minipreps of yesterday's liquid culture. Selected tubes:

  • P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1(Tubes 1, 2 and 3)
  • P35S:EaDAcT:T35S in 2Ω2 (Tubes 1 and 2)

Digestions in silico made to check the transcriptional units:

Transcriptional unitsRestriction enzymeExpected bands
P35S:AtrΔ11:T35S+P35S:HarFAR:T35S in 2Ω1EcoRV9307, 2251
BamHI6652, 4906
P35S:EaDAcT:T35S in 2Ω2EcoRV6652, 1044, 817, 683
NcoI8806, 390

Digestion master mixes:

  • Master mix for NotI
    • 1.5 μL NotI
    • 7.5 μL Orange buffer
    • 63 μL H20
  • Master mix for NcoI
    • 1.5 μL NcoI
    • 7.5 μL Tango buffer
    • 63 μL H20
  • Master mix for BamHI
    • 2 μL BamHI
    • 10 μL Green buffer
    • 84 μL H20
  • Master mix for EcoRV
    • 4 μL EcoRV
    • 20 μL Red buffer
    • 168 μL H20

Note: Trichome promoter digestion preparation included.

All digestions were correct except the transcriptional unit of EaDAcT in 2Ω2 (P35s:EaDAcT:T35S).

Miniprep quantification:

PieceTubeConcentration (ng/μL)Volume (μL)
P35S:EaDAcT:T35S in 2Ω21350.733
P35S:EaDAcT:T35S in 2Ω22271.133
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω11306.331
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω12296.628
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω13246.033

All of the pieces named above were adjusted at 75 ng/μL.

Piece Tube numberFinal Volume (μL)Volume to be added (μL)
P35S:EaDAcT:T35S in 2Ω21154.30121.3
P35S:EaDAcT:T35S in 2Ω22119.3086.30
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω11126.6095.60
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω12110.7082.70
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω13108.2475.20

As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step.

We transformed the same TU in a E. coli competent strain (DH5α). Then, the transformants were cultured in LB media and Spm and stored at 37°C overnight.

Finally, in order to obtain the FAO1 gene, we want to extract the Candida tropicalis genome, so we have picked a colony of C. tropicalis. To check the extraction protocol, we used a yeast previously tested, Saccharomyces cerevisiae. We have cultured C. tropicalis in YPD media and S. cerevisiae in YPDA media at 28 °C (5 mL).


07/23/2014

Candida genome extraction

Saccharomyces cerevisiae is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.

Cultures measured at 600 nm:

  • S. cerevisiae Abs = 1.07
  • C. tropicalis Abs = 0.39

S. cerevisiae is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of S. cerevisiae culture. The mix has to grow at 28 °C until the exponential phase is reached.

The absorbance was measured again:

  • S. cerevisiae Abs = 0.52
  • C. tropicalis Abs = 0.40

Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:

  • Grow yeast in 2 or 5 mL YPD to exponential phase.
  • Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).
  • Wash once with 1 mL sterile water.
  • Resuspend cells in 200 μL protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 μL beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37°C for 1-2 h and finally resuspend by turning the cups.
  • Add 200 μL of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).
  • Incubate at 65 °C for 20 min and cool inmediately on ice.
  • Add 200 μL of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice.
  • Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.
  • Add 2 μL RNase A (10 mg/mL) and incubate at 37 °C for 30 min.
  • Add 600 μL isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s).
  • Remove the supernatant and wash with 70% ethanol (10 min at room temperature).
  • Centrifuge (13,000 rpm, 30 s) and remove the supernatant.
  • Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 μL TE-buffer.
  • Store chromosomal DNA at 4 °C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).

Genomic quantification:

OrganismConcentration
S. cerevisiae72.2 ng/μL
C. tropicalis1397.1 ng/μL

Electrophoresis made to check the extraction quality was correct.

We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.

We picked EaDAcT colonies.


07/24/2014

The genomic quality of both organisms (C. tropicalis and S. cerevisiae) was checked in an agarose gel again.

We got the Candida genome band, however, the Saccharomyces genome band was not present.

Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate.

Miniprep digestions are going to be done tomorrow.


07/25/2014

Digestions in silico made for checking yesterday's minipreps:

Pieces/TURestriction enzymeExpected bands
P35S:EaDAcT:T35S in 2Ω2EcoRV6652, 1044, 817, 683
NcoI8806, 390

Digestion master mixes:

  • Master mix for NotI
    • 2 μL NotI
    • 10 μL Orange buffer
    • 84 μL H20
  • Master mix for NcoI
    • 2 μL NcoI
    • 10 μL Tango buffer
    • 84 μL H20
  • Master mix for BglII
    • 2 μL BglII
    • 10 μL Orange buffer
    • 84 μL H20
  • Master mix for EcoRV
    • 1.5 μL EcoRV
    • 7.5 μL Red buffer
    • 63 μL H20

An agarose gel was made to check the transcriptional unit and the other pieces:

All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.


07/28/2014

Once the Candida tropicalis genome DNA is obtained, the FAO1 gene can be amplified by PCR.

PCR reaction reagents:

  • FAO1-PCR1
    • Genomic 0.5 μL
    • Buffer HF (5X) 10.0 μL
    • dNTPs 2.0 μL
    • Oligo R (JUL06) 2.5 μL
    • Oligo F (JUL05) 2.5 μL
    • Phusion polymerase 0.5 μL
    • H2O 32.0 μL
  • FAO1-PCR2
    • Genomic 0.5 μL
    • Buffer HF (5X) 10.0 μL
    • dNTPs 2.0 μL
    • Oligo R (JUL08) 2.5 μL
    • Oligo F (JUL07) 2.5 μL
    • Phusion polymerase 0.5 μL
    • H2O 32.0 μL

Annealing temperatures

  • FAO1-PCR1: 59 °C
  • FAO1-PCR2: 64 °C

PCR products were checked using an electrophoresis. Expected bands:

  • FAO1-PCR1: 1157 bp
  • FAO1-PCR2: 1015 bp

Both FAO1 PCR products were not correct.

As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:

ReagentVolume
Trichome promoter1 μL
GFP1 μL
TNos1 μL
BsaI1 μL
p2α21 μL
T4 ligase1 μL
Ligase buffer1 μL
H2O3 μL
Total Volume10 μL

07/29/2014

As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:

ReagentFAO1-PCR1FAO1-PCR2
C. tropicalis genome2.5 μL2.5 μL
HF Buffer30 μL30 μL
dNTPs10 μL10 μL
Oligo R12.5 μL12.5 μL
Oligo F12.5 μL12.5 μL
Phusion polymerase1.5 μL1.5 μL
H2O181 μL181 μL

PCR temperatures, 25 cycles:

StepTemperature (°C)Time
Initialization982 min
Denaturation9820 s
Annealing50, 55, 60, 65??
Extension7245 s
Final elongation727 min

We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product.

EaDAcT Transcriptional Unit (TU) transformation

Using an electrocompetent E. coli strain (DH5α) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2Ω2), the mix is electroporated at 1500 V. Then, 300 μL of SOC are added and stored at 37°C with agitation.


07/30/2014

Transform P35s:AtrΔ11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2α2) in Agrobacterium tumefaciens strain C58. Introduce 1 μL of construction in a C58 aliquot. Electroporate at 1440V. Add 500 μL of LB in the LAF. Keep 2 hours in agitation at 28°C. Grow 20 μL and 200 μL in solid medium containing kanamicin and rifampicin. Incubate overnight at 28°C.

Pick colonies of P35s:EaDAcT:T35s in 2Ω2.


08/01/2014

Pick colonies from Agrobacterium tumefaciens and grow them in liquid medium for two days at 28°C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for α vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for Ω vectors.


07/31/2014

Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2Ω2

Additionally, we recultured in petri dish with its respective antibiotic (Spm).

Digestions in silico made for checking minipreps:

Pieces/TURestriction enzymeExpected bands
P35S:EaDAcT:T35S in 2Ω2NcoI8806, 390
EcoRV6652, 1044, 817, 683

Digestion mixes:

  • Master mix for EcoRV:
    • 3 μL EcoRV
    • 15 μL Red buffer
    • 126 μL H20
  • Master mix for NcoI:
    • 1.5 μL NcoI
    • 7.5 μL Tango buffer
    • 63 μL H2O

Note: We made master mixes because digestions were made simultaneously with the trichome promoter part.

An agarose gel was made to check the transcriptional unit.

Minipreps of P35s:EaDAcT:T35s in 2Ω2 (1) went correctly.

Miniprep results were quantified and then adjusted at 75 ng/μL:

Pieces/TUTubeConcentration (ug/μL)Initial volume (μL)Final Volume (μL)
P35S:EaDAcT:T35S in 2Ω2(1)141.43531
P35S:EaDAcT:T35S in 2Ω22)3.933(Discarded)

Ligation of P35s:EaDAcT:T35s in 2Ω2 with P35s:AtrΔ11:T35+P35s:HarFAR:T35 in 2Ω1.

  • 1 μL P35s:AtrΔ11:T35+P35s:HarFAR:T35 in 2Ω1
  • 1 μL P35s:EaDAcT:T35s in 2Ω2
  • 1 μL 2α1
  • 1 μL BsaI
  • 1 μL T4 ligase
  • 1 μL ligase buffer
  • 4 μL H20

08/04/2014

Transformation of P35s:EaDAcT:T35s in 2Ω2 P35s:AtrΔ11:T35+P35s:HarFAR:T35 in E. coli.

Agrobacterium liquid cultures (5 mL LB)

  • P35s:GFP:p19:Tnos (Spm, Tet, Rif)
  • Empty C58 Agrobacterium tumefaciens (Rif)
  • 2x P35s:EaDAcT:T35s in 2α2 (Rif, Kan)
  • 2x P35s:AtrΔ11:T35+P35s:HarFAR:T35 in 2Ω1 (Rif, Spm)

08/05/2014

Pick colonies from P35s:AtrΔ11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2α1.

Repeat PCR of FAO1.

  • FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64°C)
    • 1.75 μL Candida tropicalis genomic
    • 35 μL HF buffer (5x)
    • 7 μL dNTPs
    • 8.75 μL oligo forward (Jul07)
    • 8.75 μL oligo reverse (Jul08)
    • 1.05 μL Phusion polymerase
    • 112.7 H20

PCR temperatures, 35 cycles:

StepTemperature (°C)Time
Initialization982 min
Denaturation9810 s
Annealing54, 59, 6455 s
Extension7255 s
Final elongation727 min
  • FAO1-PCR2: touchdown PCR
    • 0.5 μL Candida tropicalis genomic
    • 10 μL HF buffer (5x)
    • 2 μL dNTPs
    • 2.5 μL oligo forward (Jul09)
    • 2.5 μL oligo reverse (Jul10)
    • 0.5 μL Phusion polymerase
    • 32 μL H20

PCR temperatures, 35 cycles:

StepTemperature (°C)Time
Initialization985 min
Denaturation9810 s
Annealing69.5 (descending 0.5 per cycle) 20 s
Extension7255 s
Final elongation727 min

It continues without working. For the next time we are going to repeat the dilutions in case they weren't correctly done.


08/06/14

Minipreps of yesterday's culture were made:

  • TU AtrΔ11 + TU HarFAR + TU EaDAcT

Additionally, we made Agrobacterium' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)

  • TU AtrΔ11 + TU HarFAR in 2Ω1
  • P35S:EaDAcT:T35S in 2Ω2

FAO1 PCR was repeated (this time using a different primers aliquot).

  • FAO1-PCR1:
    • 0.5 μL Candida tropicalis genomic
    • 10 μL HF buffer (5x)
    • 2 μL dNTPs
    • 2.5 μL oligo forward (Jul07)
    • 2.5 μL oligo reverse (Jul08)
    • 0.5 μL Phusion polymerase
    • 32 μL H20
  • FAO2-PCR1:
    • 0.5 μL Candida tropicalis genomic
    • 10 μL HF buffer (5x)
    • 2 μL dNTPs
    • 2.5 μL oligo forward (Jul09)
    • 2.5 μL oligo reverse (Jul10)
    • 0.5 μL Phusion polymerase
    • 32 μL H20

PCR temperatures, 35 cycles:

StepTemperature (°C)Time
Initialization982 min
Denaturation9810 s
Annealing59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) 20 s
Extension7255 s
Final elongation727 min

Digestions made in silico to check minipreps:

E. coli

Pieces/TUResriction enzymesBufferExpected Bands
TU AtrΔ11+ TU HarFAR + TU EaDAcT in 2α1EcoRIOrange7428, 6323
TU AtrΔ11+ TU HarFAR + TU EaDAcT in 2α1BglIIOrange11175, 2576

A. tumefaciens

Pieces/TUResriction enzymesBufferExpected Bands
TU AtrΔ11 + TU HarFAR in 2Ω1EcoRVRed9307, 2251
TU AtrΔ11 + TU HarFAR in 2Ω1BamHIGreen6652, 4906
TU EaDAcT in 2α2EcoRVRed8021, 683
TU EaDAcT in 2α2HindIIIRed6322, 2382

Digestion master mixes:

  • Master mix for NotI:
    • 2.5 μL NotI
    • 12.5 μL Orange buffer
    • 105 μL H20
  • Master mix for RsaI:
    • 2 μL NcoI
    • 10 μL Tango buffer
    • 84 μL H2O

Note: We made master mixes because digestions were made simultaneously with the switch part.

We made different mixes for Agrobacterium samples because we think that minipreps are not as good as it is expected.

  • Agrobacterium sample mix:
    • 0.5 μL Restriction enzyme
    • 2.5 μL Buffer
    • 5 μL Miniprep sample
    • 17 μL H2O

Digestions in A. tumefaciens.

FAO1 PCR product.

All digestions and TU AtrΔ11+ TU HarFAR + TU EaDAcT in 2α1 were correct. PCR products were not correct or absent again.

As digestions were correct, we recultured Agrobacterium in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 μL of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000).

CultureAntibiotic
P35:GFP:P19:TNosSpm, Tet, Rif
Agrobacterium (as a control)Rif
P35S:EaDAcT:T35S Rif, Kan
P35S:AtrΔ11:T35S + P35S:HarFAR:T35SRif, Spm

Recultured media was grown at 28 °C overnight (around 16 h).


08/07/2014

Agroinfiltrate in Nicotiana benthamiana.

  • Agrobacterium control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)
  • TU AtrΔ11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)
  • TU AtrΔ11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)

Agroinfiltration protocol consist on:

  • Centrifuge the cultures 15 min 3000 rpm and discard supernatant.
  • 5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 μL acetosyringone solution 200 mM (19.62 mg, DMSO 500 μL; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.
  • Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.
  • Mix the cultures, keeping all of them in the same proportions.
  • Proceed to agroinfiltration.

08/08/2014

In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesús Muñoz provided us with 4 primers and 2 clones of Candida tropicalis (C981 ng/μL and pYEP C98 28.2 ng/μL). These primers amplify for the gene HSR1.

Name Sequence Tm
HSR1 RTRv+1149TTTGTCTTGCAACAGGTCCA56°C
HSR1 clone Fw+1 ATGAGTAAGAAAAGCAACAGTACC54°C
HSR1 fw-BamHI+480GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT49°C (annealing)
HSR1 clone RV+stopCTAATTTTCTTCTTTTTCAATAGTAACTATCC51°C

Possibility of primer combinations

AHSR1 fw-BamHI+480HSR1 RTRv+114968749°C
CHSR1 clone Fw+1HSR1 clone RV+stop2187-
BHSR1 RTRv+1149HSR1 clone Fw+1 116854°C

We amplified the genomic of C. tropicalis and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52°C). C primer combination was not used due to the length of the spected band.

PCR parameters

  • 94°C, 3 min
  • 35 cycles
    • 94°C, 30 s
    • 49 or 52°C, 15 s
    • 72°C, 90 s
  • 72°C, 7 min

PCR products were not present. It probably did not work because we added to much buffer.


08/11/2014

We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/μL.

PCRs wih Taq polimerase:

  • 1 μL Template
  • 1.5 μL dNTPs
  • 1 μL Forward primer
  • 1 μL Reverse primer
  • 1 μL Taq pol.
  • 5 Buffer 10X
  • 39.5 μL H2O
PCRTemplateF primerR primer
1pUbiquitina HSRI-CDS col.6HSR1 BamHI + 480HSR1 Rtrev + 1149
2pUbiquitina HSRI-CDS col.6HSR1 Rtrv + 1149HSR1 Fw + 1
3C. tropicalis genomeHSRI-CDS col.6HSR1 BamHI + 480HSR1 Rtrev + 1149
4C. tropicalis genomeHSR1 Rtrv + 1149HSR1 Fw + 1

PCR conditions:

  • 94°C 3 min
  • 35 cycles
    • 94°C 30 s
    • 49°C 15 s
    • 72°C 90 s
  • 72°C 7 min

We had amplification in our positive controls. Our C. tropicalis genome may be wrong.



Trichome promoter


07/03/2014

Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.

  • Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.
  • Introduce the disks inside the tube.
  • Introduce the two tubes in liquid nitrogen.
  • Remove them from the liquid nitrogen and store at -80°C until use.
  • Remove one tube from -80°C and re-introduce them in liquid nitrogen.
  • Grind the disks.
  • Add 600 μL of CTAB (2%) buffer (pre-heat at 65°C.)
  • Grind the mixture.
  • Add RNAse (1.6 μL at M = 100 ug/μL for each mL of CTAB buffer).
  • Vortex it and maintain at 65°C for 45 min. Mix it by inversion 5-15 min.
  • Add 600 μL cloroform:isoamilic alcohol. Vortex it.
  • Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.
  • Recover the supernatant by aspiration (with a 200 μL pipet).
  • Repeat the last three steps.
  • Add one volume o isopropanol and mix well by inversion (10 times).
  • To precipitate, maintain 20 min on ice or at -80°C during 5 min.
  • Centrifuge 10 min at 13000 rpm (4°C).
  • Discard the supernatant by decantation (be carefull with the pellet).
  • Wash with 600 μL ethanol (80%).
  • Centrifuge 5 min at 13000 rpm.
  • Discard the ethanol by pipeting and let it dry a few minutes.
  • Resuspend it in 50-100 μL H2O miliQ or with TE buffer.
  • Store at -20°C.

Measurement of genomic concentration with nanodrop.

  • Tabacco 1: 182 ng/μL (Thrown away)
  • Tabacco 2: 620 ng/μL (Stored at -20°C)

Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).

It is correct.


07/10/2014

PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.

Ordered primers

  • IGEMJULO1
  • IGEMJULO2

Ajust primers to a 100 uM concentration:

  • IGEMJUL01 + 566 μL miliQ H2O
  • IGEMJUL02 + 691 μL miliQ H2O

Use a 1:10 alicuot for PCR (10 uM).

Reagents needed for PCR:

  • 0.5 μL template
  • 10 μL buffer HF 5x
  • 2 μL dNTPs
  • 2.5 μL oligo R
  • 2.5 μL oligo F
  • 0.5 μL Pfu
  • 32 μL miliQ H2O

Final volume: 50 μL

Parameters:

  • 98 °C (2 min)
  • 35 cycles
    • 98 °C (10 sec)
    • 59 °C (15 sec)
    • 72 °C (45 sec)
  • 72 °C (7 min)

We didn't get PCR product.


07/11/2014

Repeat PCR with different parameters.

1 2 3 4 5
Template0.5 μL0.5 μL0.5 μL0.5 μL0.5 μL
Buffer (5x)0.5 μL0.5 μL0.5 μL0.5 μL0.5 μL
dNTPs2 μL2 μL2 μL2 μL2 μL
Oligo R2.5 μL2.5 μL2.5 μL2.5 μL2.5 μL
Oligo F2.5 μL2.5 μL2.5 μL2.5 μL2.5 μL
Phu0.5 μL0.5 μL0.5 μL0.5 μL0.5 μL
Buffer32 μL32 μL32 μL32 μL32 μL

1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.

PCR parameters

  • 98 °C (2 min)
  • 35 cycles
    • 98 °C (10 sec)
    • 1, 3, 5 -> 59 °C (15 sec). 2, 4 -> 55 °C (15 sec)
    • 72 °C (45 sec)
  • 72 °C (7 min)

No PCR products again.

Repeat PCR again with other parameters.

Buffer HF Buffer GC
Template2 μL2 μL
Buffer (5x)40 μL40 μL
dNTPs8 μL8 μL
Oligo R10 μL10 μL
Oligo F10 μL10 μL
Phu22 μL μL
Buffer128 μL128 μL

Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.

  • 98 °C (2 min)
  • 35 cycles
    • 98 °C (10 sec)
    • 49, 52, 55, 60 °C (15 sec)
    • 72 °C (45 sec)
  • 72 °C (7 min)

No PCR products again.


07/14/2014

Repeat PCR again with more genomic.

Buffer HF Buffer GC
Template5 μL5 μL
Buffer (5x)50 μL50 μL
dNTPs10 μL10 μL
Oligo R12.5 μL12.5 μL
Oligo F12.5 μL12.5 μL
Phu2.5 μL2.5 μL
Buffer107.5 μL107.5 μL

Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 °C.

We still without having any amplification.


07/18/2014

Repeat the PCR with other enzyme.

  • 12.5 μL Q5 Master mix (2x).
  • 1.25 μL forward primer 10 uM
  • 1.25 μL reverse primer 10 uM
  • 0.5 μL template 620 ng/μL
  • 9.5 μL H2O

Set 4 reactions at 50, 53, 55, 59 °C.

  • 98 °C (30 sec)
  • 35 cycles
    • 98 °C (10 sec)
    • 50, 53, 55, 59 °C (15 sec)
    • 72 °C (45 sec)
  • 72 °C (2 min)

The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 °C reactions.


07/19/2014

Trichome promoter PCR product ligation in pUPD.

  • 1 μL pUPD
  • 1 μL PCR product
  • 1 μL BsmBI (5-10 ud)
  • 1 μL T4 ligase (5-10 ud)
  • 1.2 μL buffer ligase (3 ud)
  • 6.8 μL H20

Set the reaction: 25 cycles x (37°C 2 min, 16°C 5 min).


07/20/2014

Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.


07/21/2014

We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.


07/22/2014

We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media.

Miniprep quantification:

PieceTubeConcentration (ng/μL)Volume (μL)
Trichome promoter in pUPD1317.126
Trichome promoter in pUPD3354.832

Both minipreps were adjusted to 75 ng/μL.

Digestions in silico performed to check the insertion:

PieceRestriction enzymeExpected bands
Trichome Promoter in pUPDNotI2981, 1523
EcoRV3942, 562

Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.

Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:

  • pTnos (GB0037)
  • pGFP (GB0059)
  • pLuciferase (GB0096)

07/23/2014

Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.

We picked colonies from pTnos, pGFP and pLuciferase.


07/24/2014

Results of sequencing the promoter were obtained:

MutationPosition
T insertion??
T insertion??

Minipreps of pTnos, pGFP and pLuciferase.


07/28/2014

PieceConcentration (ng/μL)Initial Volume (μL)Final Volume (μL)
GFP318.835148.8
Tnos400.835186.5
pLuciferaseNotI2981, 1731

See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/μL.

The following table shows ligation details of the trichome promoter:

ReagentVolume
CPS21 μL
GFP1 μL
TNos1 μL
BsaI1 μL
p2α21 μL
T4 ligase1 μL
Ligase buffer1 μL
H2O3 μL
Total Volume10 μL

07/29/2014

Trichome Promoter transformation in E. coli.

Using an electrocompetent E. coli strain (DH5α) and 1.5 ul ligation (CPS2:GFP:TNos in 2α2), the mix is electroporated at 1500 V. Then, 300 μL of SOC are added and stored at 37 °C with agitation.


07/30/2014

Pick colonies of CPS2:GFP:TNos in 2α2.


07/31/2014

Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 α2

Additionally, we recultured in petri dish with its respective antibiotic (Kan).

Digestions in silico made for checking minipreps:

Pieces/TURestriction enzymeExpected bands
CPS2:GFP:TNos in 2α2HindIII6322, 2694
EcoRV8454, 562

Digestion mixes:

  • Master mix for EcoRV:
    • 3 μL EcoRV
    • 15 μL Red buffer
    • 126 μL H20
  • Master mix for HindIII:
    • 2 μL HindIII
    • 10 μL Red buffer
    • 84 μL H2O

Note: We made master mixes because digestions were made simultaneously with the biosynthesis part.

An agarose gel was made to check the transcriptional unit:

Minipreps of CPS2:GFP:TNos in 2α2 (1) went correctly.

Miniprep results were quantified and then adjusted at 75 ng/μL:

Pieces/TUTubeConcentration (ug/μL)Initial volume (μL)Final Volume (μL)
PCPS2:GFP:TNos in 2α21128.53356.5
PCPS2:GFP:TNos in 2α22135.93461.6
PCPS2:GFP:TNos in 2α23126.23558.9

08/05/2014

Transcriptional Unit (TU) PCPS2:GFP:TNos in 2α2 was transformed in Agrobacterium tumefaciens (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28°C).

Note: The scientific name has been updated to Rhizobium radiobacter.


08/08/2014

The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.


08/11/2014

Agrobacterium cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.

Minipreps of the TU PCPS2:GFP:TNos in Agrobacterium were made. and digestions were performed to check they were correct.

Digestions in silico performed to check the insertion:

Restriction enzymeExpected bands
HindIII6322, 2694
EcoRV8454, 562

PCPS2:GFP:TNos (1) digestion was correct.



Switch


07/04/2014

Adquisition of S. cerevisiae genomic DNA. (5 μL, stored in the fridge)


07/28/2014

We had the genome of S. cerevisiae, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).

Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast.

PCR reaction reagents:

ReagentCUP1-PCR1CUP2-PCR2
Template0.5 μL0.5 μL
Buffer HF (5X)10.0 μL10.0 μL
dNTPs2.0 μL2.0 μL
Oligo R (JUL06)2.5 μL2.5 μL
Oligo F (JUL05)2.5 μL2.5 μL
Phusion polymerase0.5 μL0.5 μL
H2O32.0 μL32.0 μL

Annealing temperature: both 61 °C

PCR products were checked using an electrophoresis. Expected bands:

  • CUP1-PCR1: 386 bp
  • CUP2-PCR2: 348 bp

Both PCR products were correct.


07/30/2014

We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".

Ligation of both parts of CUP2.

  • 1 μL CUP1-PCR1
  • 1 μL CUP1-PCR1
  • 1 μL pUPD
  • 1 μL BsmBI
  • 1 μL T4 ligase
  • 1 μL ligase buffer
  • 4 μL H20

07/31/2014

CUP2 was transformed in pUPD and cultured in solid media (37°C).


08/04/2014

Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.


08/05/2014

Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).


08/06/14

Minipreps of yesterday's culture were made:

  • Gal4AD
  • CUP2

Digestions made in silico in order to check transcriptional units:

Pieces/TUResriction enzymesBufferExpected Bands
CUP2 in pUPDNot1Orange2981, 752
CUP2 in pUPDRsaITango2457, 1276
Gal4AD in pUPDNot1Orange2981, 330
Gal4ADPuuIRed2215, 1096

CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.

Gal4AD piece is correct.


08/11/2014

Sequencing results of CUP2 piece were finally received and they were correct.

As the sequence was correct, we could continue with ligations.

Quantification

  • CUP2: 110.3 ng/μL
  • Gal4: 221.4 ng/μL

Samples were diluted to 75 ng/μL.

Ligations made:

  • P35S:CUP2:Gal4AD:T35S
    • 1 μL P35S
    • 1 μL CUP2
    • 1 μL Gal4AD
    • 1 μL T35S
    • 1 μL BsaI
    • 1 μL T4 ligase
    • 1 μL Buffer ligase
    • 1 μL 2α2
    • 2 μL H2O
  • PCPS2:CUP2:Gal4AD:T35S
    • 1 μL PCPS2
    • 1 μL CUP2
    • 1 μL Gal4AD
    • 1 μL T35S
    • 1 μL BsaI
    • 1 μL T4 ligase
    • 1 μL Buffer ligase
    • 1 μL 2α2
    • 2 μL H2O


    • Biosafety


      07/22/2014

      Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:

      • P35S:Rosea:TNos
      • TA29:Barnase:TNos (from GoldenBraid 1.0 collection)

      We were told by our advisor that Rosea produces necrosis in N. benthamiana, so we must think of an alternative.


      07/23/2014

      We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.


      07/24/2014

      Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.


      07/25/2014

      Digestions in silico made for checking yesterday's minipreps:

      PiecesRestriction enzymeExpected bands
      P35S:Rosea:TnosBglII2495, 2302
      NcoI4407, 390
      TA29:Barnase:TnosBglII2825, 2245

      07/28/2014

      See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/μL.


      07/31/2014

      We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.


      08/05/2014

      Order primers for TA29 and barnase:

      NameSequenceT annealing
      I14Ago01_TA29_F1CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT61.8°C
      I14Ago02_TA29_R1CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG60.8°C
      I14Ago03_barnase_F1CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG65.0°C
      I14Ago04_barnase_R1CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG63.4°C

      08/07/2014

      Primers received. PCR for barnase and TA29 performed.

      • TA29 PCR parameters
        • 98°C, 2 min
        • 35 cycles
        • 98°C, 10 s
        • 60°C, 18 s
        • 72°C, 40 s
        • 72°C, 7 min
      • Barnase PCR parameters
        • 98°C, 2 min
        • 35 cycles
        • 98°C, 10 s
        • 63°C, 18 s
        • 72°C, 40 s
        • 72°C, 7 min

      We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.


      08/08/2014

      We repeat yesterday's PCR with 2 degrees less in the annealing step.

      Results obtained are the same of yesterday's. We should think about charging something else.


      08/11/2014

      The previous PCR was repeated changing the annealing temperature to 61°C.

      We still do not get PCR product.


      08/12/2014

      We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/μL. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60°C for TA29 and 63°C for barnase), but it still doesn't work!



      Translator to BioBricks


      08/07/2014

      Ale's primers labeled A11Dic32 and M11Nov12 found.

      Run PCR with the following templates and primers:

      TemplateForwardReverseExpected lenght
      P35siGEMJul11 A11Dic321086 bp
      T35sM11Nov12iGEM12Jul284 bp

      P35s PCR parameters

      • 98°C, 2 min
      • 35 cycles
        • 98°C, 10 s
        • 67°C, 18 s
        • 72°C, 40 s
      • 98°C, 7 min

      T35s PCR parameters

      • 98°C, 2 min
      • 35 cycles
        • 98°C, 10 s
        • 65°C, 18 s
        • 72°C, 40 s
      • 98°C, 7 min

      We didn't obtain PCR product.


      08/08/2014

      We repeat yesterday's PCR with 2 degrees less in the annealing step.

      Now there is a band for P35s but it should not be there.


      08/11/2014

      The previous PCR was repeated changing the annealing temperature to 61°C.

      We still do not get PCR product.


      08/12/2014

      We repeated the PCR once more, this time setting the annealing temperatures at (59°C for T35s and 61°C for P35s).