Team:Valencia UPV/Notebook wetlab.html

From 2014.igem.org

(Difference between revisions)
 
(60 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:Valencia_UPV/header}}
{{:Team:Valencia_UPV/header}}
<html>
<html>
-
<head>
 
<style>
<style>
 +
.normal-table
 +
{
 +
border: 1px solid black;
 +
margin: 0px;
 +
padding: 15px;
 +
white-space: normal;
 +
table-layout: normal;
 +
background: transparent;
 +
 +
}
 +
 +
.normal-table tr td
 +
{
 +
border: 1px solid black;
 +
margin: 0px;
 +
padding: 15px;
 +
white-space: normal;
 +
table-layout: normal;
 +
background: transparent;
 +
 +
}
 +
 +
.normal-table tr th
 +
{
 +
border: 1px solid black;
 +
margin: 0px;
 +
padding: 15px;
 +
white-space: normal;
 +
table-layout: normal;
 +
background: transparent;
 +
 +
}
.table_notebook{
.table_notebook{
Line 63: Line 94:
   
   
.ul_notebook {
.ul_notebook {
-
     list-style-type: none;
+
     list-style: square;
-
    padding: 0px;
+
     list-style-position: inside;
-
    margin: 0px;
+
-
     list-style: initial;
+
}
}
 +
.ul_ul_notebook {
 +
    list-style: square;
 +
    list-style-position: inside;
 +
    margin-left: 1.5em;
 +
}
 +
 +
.ul_ul_ul_notebook {
 +
    list-style: square;
 +
    list-style-position: inside;
 +
    margin-left: 3.0em;
 +
}
 +
 +
.ul_ul_ul_ul_notebook {
 +
    list-style: square;
 +
    list-style-position: inside;
 +
    margin-left: 4.5em;
 +
}
</style>
</style>
-
</head>
 
-
<body>
 
-
<div align="center"><div class="c-box" id="cn-box" align="center"></br><div id="main" class="c-box" align="justify" style="border: 5px;">
+
<div align="center"><div id="cn-box" align="justify"><br/>
 +
 
 +
<div align="center"><img class="img-title" alt="Notebook" src="http://2014.igem.org/wiki/images/2/2a/VUPVNotebook.png"></img></div><br/>
 +
 
<div class="box_above_notebook">
<div class="box_above_notebook">
Contents:
Contents:
-
<ul> <li> <a href="#Biosynthesis">Biosynthesis</a></li> <li> <a href="#Trichome_promoter">Trichome promoter</a></li> <li> <a href="#Switch">Switch</a></li> <li> <a href="#Biosafety">Biosafety</a></li> <li> <a href="#Translator_to_BioBricks">Translator to BioBricks</a></li></ul>
+
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul>
-
</div><a name="Biosynthesis"></a></br></br><h3 class="section_notebook">Biosynthesis</h3></br><h4 class="date_notebook">06/09/2014</h4>
+
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4>
Line 136: Line 183:
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li>
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li>
-
<ul class="ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li>
+
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li>
<li>I14Jun04 Atr&Delta;11 R1</li>
<li>I14Jun04 Atr&Delta;11 R1</li>
Line 142: Line 189:
</ul><li>FAO1: <i>N. benthamiana</i> primers</li>
</ul><li>FAO1: <i>N. benthamiana</i> primers</li>
-
<ul class="ul_notebook"><li>I14Jun01 FAO1 F1</li>
+
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li>
<li>I14Jun02 FAO1 R1</li>
<li>I14Jun02 FAO1 R1</li>
Line 340: Line 387:
</ul>
</ul>
-
<p class="p_notebook">PCR parameters: The annealing temperature was 60ºC and the extension temperature was 65ºC. </p>
+
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p>
Line 352: Line 399:
-
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11</p>
+
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p>
Line 378: Line 425:
-
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16ºC and the BsmBI temperature was 37ºC. </p>
+
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p>
Line 406: Line 453:
</ul>
</ul>
-
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37ºC for 1 hour.</p>
+
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p>
Line 414: Line 461:
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p>
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p>
-
<p class="p_notebook">Petri plates are incubated at 37ºC for 16 h.</p>
+
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p>
Line 434: Line 481:
</ul>
</ul>
-
<p class="p_notebook">All tubes are incubated at 37ºC overnight in agitation.</p>
+
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p>
Line 486: Line 533:
<ul class="ul_notebook"><li>Master mix for NotI</li>
<ul class="ul_notebook"><li>Master mix for NotI</li>
-
<ul class="ul_notebook"><li>5 &mu;L NotI</li>
+
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li>
<li>25 &mu;L Orange</li>
<li>25 &mu;L Orange</li>
Line 494: Line 541:
</ul><li>Master mix for RsaI</li>
</ul><li>Master mix for RsaI</li>
-
<ul class="ul_notebook"><li>1.5 &mu;L RsaI</li>
+
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li>
<li>7.5 &mu;L Tango</li>
<li>7.5 &mu;L Tango</li>
Line 502: Line 549:
</ul><li>Master mix for PvuII</li>
</ul><li>Master mix for PvuII</li>
-
<ul class="ul_notebook"><li>1.5 &mu;L PvuII</li>
+
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li>
<li>7.5 &mu;L Green</li>
<li>7.5 &mu;L Green</li>
Line 510: Line 557:
</ul><li>Master mix for BanII</li>
</ul><li>Master mix for BanII</li>
-
<ul class="ul_notebook"><li>1.5 &mu;L BanII</li>
+
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li>
<li>7.5 &mu;L Tango</li>
<li>7.5 &mu;L Tango</li>
Line 588: Line 635:
<ul class="ul_notebook"><li>Master mix for NotI</li>
<ul class="ul_notebook"><li>Master mix for NotI</li>
-
<ul class="ul_notebook"><li>3.5 &mu;L NotI</li>
+
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li>
<li>17.5 &mu;L Orange</li>
<li>17.5 &mu;L Orange</li>
Line 596: Line 643:
</ul><li>Master mix for RsaI</li>
</ul><li>Master mix for RsaI</li>
-
<ul class="ul_notebook"><li>2 &mu;L RsaI</li>
+
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li>
<li>10 &mu;L Tango</li>
<li>10 &mu;L Tango</li>
Line 604: Line 651:
</ul><li>Master mix for PvuII</li>
</ul><li>Master mix for PvuII</li>
-
<ul class="ul_notebook"><li>2 &mu;L PvuII</li>
+
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li>
<li>10 &mu;L Green</li>
<li>10 &mu;L Green</li>
Line 722: Line 769:
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
-
<ul class="ul_notebook"><li>1 &mu;L P35s</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
<li>1 &mu;L T35s</li>
<li>1 &mu;L T35s</li>
Line 742: Line 789:
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li>
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li>
-
<ul class="ul_notebook"><li>1 &mu;L P35s</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
<li>1 &mu;L TatHSP</li>
<li>1 &mu;L TatHSP</li>
Line 762: Line 809:
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li>
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li>
-
<ul class="ul_notebook"><li>1 &mu;L PAtUbq</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li>
<li>1 &mu;L TatHSP</li>
<li>1 &mu;L TatHSP</li>
Line 834: Line 881:
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li>
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li>
-
<ul class="ul_notebook"><li>3.5 mL LB</li>
+
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
<li>7 &mu;L Amp</li>
<li>7 &mu;L Amp</li>
Line 844: Line 891:
</ul><li>1 colony from 2&Omega;1</li>
</ul><li>1 colony from 2&Omega;1</li>
-
<ul class="ul_notebook"><li>3.5 mL LB</li>
+
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
<li>7 &mu;L Spm</li>
<li>7 &mu;L Spm</li>
Line 852: Line 899:
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li>
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li>
-
<ul class="ul_notebook"><li>3.5 mL LB</li>
+
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
<li>7 &mu;L Spm</li>
<li>7 &mu;L Spm</li>
Line 858: Line 905:
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li>
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li>
-
<ul class="ul_notebook"><li>3.5 mL LB</li>
+
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
<li>7 &mu;L Kan</li>
<li>7 &mu;L Kan</li>
Line 864: Line 911:
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li>
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li>
-
<ul class="ul_notebook"><li>3.5 mL LB</li>
+
<ul class="ul_ul_notebook"><li>3.5 mL LB</li>
<li>7 &mu;L Kan</li>
<li>7 &mu;L Kan</li>
Line 870: Line 917:
</ul></ul>
</ul></ul>
-
<p class="p_notebook">Grow at 37ºC in agitation overnight.</p>
+
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p>
Line 928: Line 975:
<ul class="ul_notebook"><li>Master mix for HindIII</li>
<ul class="ul_notebook"><li>Master mix for HindIII</li>
-
<ul class="ul_notebook"><li>3.5 &mu;L HindIII</li>
+
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li>
<li>17.5 &mu;L Red</li>
<li>17.5 &mu;L Red</li>
Line 936: Line 983:
</ul><li>Master mix for NotI</li>
</ul><li>Master mix for NotI</li>
-
<ul class="ul_notebook"><li>1.5 &mu;L NotI</li>
+
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li>
<li>7.5 &mu;L Orange</li>
<li>7.5 &mu;L Orange</li>
Line 944: Line 991:
</ul><li>Mix for EcoRV</li>
</ul><li>Mix for EcoRV</li>
-
<ul class="ul_notebook"><li>0.5 &mu;L EcoRV</li>
+
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li>
<li>2.5 &mu;L Red</li>
<li>2.5 &mu;L Red</li>
Line 952: Line 999:
</ul><li>Mix for BamHI</li>
</ul><li>Mix for BamHI</li>
-
<ul class="ul_notebook"><li>0.5 &mu;L PvuII</li>
+
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li>
<li>2.5 &mu;L Green</li>
<li>2.5 &mu;L Green</li>
Line 988: Line 1,035:
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li>
-
<ul class="ul_notebook"><li>1 &mu;L P35s</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
<li>1 &mu;L T35s</li>
<li>1 &mu;L T35s</li>
Line 1,006: Line 1,053:
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li>
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li>
-
<ul class="ul_notebook"><li>1 &mu;L P35s</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
<li>1 &mu;L T35s</li>
<li>1 &mu;L T35s</li>
Line 1,024: Line 1,071:
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li>
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li>
-
<ul class="ul_notebook"><li>1 &mu;L P35s</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li>
<li>1 &mu;L T35s</li>
<li>1 &mu;L T35s</li>
Line 1,052: Line 1,099:
<ul class="ul_notebook"><li>Amp</li>
<ul class="ul_notebook"><li>Amp</li>
-
<ul class="ul_notebook"><li>pAtr&Delta;11 (6)</li>
+
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li>
<li>pEaDAcT (3)</li>
<li>pEaDAcT (3)</li>
Line 1,060: Line 1,107:
</ul><li>Kan</li>
</ul><li>Kan</li>
-
<ul class="ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li>
+
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li>
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li>
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li>
Line 1,074: Line 1,121:
-
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80ºC.</p>
+
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p>
Line 1,182: Line 1,229:
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li>
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li>
-
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li>
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li>
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li>
Line 1,198: Line 1,245:
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li>
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li>
-
<ul class="ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li>
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li>
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li>
Line 1,214: Line 1,261:
</ul></ul>
</ul></ul>
-
<p class="p_notebook">Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).</p>
+
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
Line 1,278: Line 1,325:
<ul class="ul_notebook"><li>Master mix for NotI</li>
<ul class="ul_notebook"><li>Master mix for NotI</li>
-
<ul class="ul_notebook"><li>1.5 &mu;L NotI</li>
+
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li>
<li>7.5 &mu;L Orange buffer</li>
<li>7.5 &mu;L Orange buffer</li>
Line 1,286: Line 1,333:
</ul><li>Master mix for NcoI</li>
</ul><li>Master mix for NcoI</li>
-
<ul class="ul_notebook"><li>1.5 &mu;L NcoI</li>
+
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li>
<li>7.5 &mu;L Tango buffer</li>
<li>7.5 &mu;L Tango buffer</li>
Line 1,294: Line 1,341:
</ul><li>Master mix for BamHI</li>
</ul><li>Master mix for BamHI</li>
-
<ul class="ul_notebook"><li>2 &mu;L BamHI</li>
+
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li>
<li>10 &mu;L Green buffer</li>
<li>10 &mu;L Green buffer</li>
Line 1,302: Line 1,349:
</ul><li>Master mix for EcoRV</li>
</ul><li>Master mix for EcoRV</li>
-
<ul class="ul_notebook"><li>4 &mu;L EcoRV</li>
+
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li>
<li>20 &mu;L Red buffer</li>
<li>20 &mu;L Red buffer</li>
Line 1,378: Line 1,425:
-
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37ºC overnight. </p>
+
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p>
-
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 ºC (5 mL).</p>
+
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p>
Line 1,406: Line 1,453:
</ul>
</ul>
-
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 ºC until the exponential phase is reached. </p>
+
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p>
Line 1,428: Line 1,475:
<li>Wash once with 1 mL sterile water.</li>
<li>Wash once with 1 mL sterile water.</li>
-
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37ºC for 1-2 h and finally resuspend by turning the cups. </li>
+
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li>
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li>
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li>
-
<li>Incubate at 65 ºC for 20 min and cool inmediately on ice.</li>
+
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li>
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li>
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li>
Line 1,438: Line 1,485:
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li>
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li>
-
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 ºC for 30 min.</li>
+
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li>
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li>
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li>
Line 1,448: Line 1,495:
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li>
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li>
-
<li>Store chromosomal DNA at 4 ºC (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li>
+
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li>
</ul>
</ul>
Line 1,536: Line 1,583:
<ul class="ul_notebook"><li>Master mix for NotI</li>
<ul class="ul_notebook"><li>Master mix for NotI</li>
-
<ul class="ul_notebook"><li>2 &mu;L NotI</li>
+
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li>
<li>10 &mu;L Orange buffer</li>
<li>10 &mu;L Orange buffer</li>
Line 1,544: Line 1,591:
</ul><li>Master mix for NcoI</li>
</ul><li>Master mix for NcoI</li>
-
<ul class="ul_notebook"><li>2 &mu;L NcoI</li>
+
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li>
<li>10 &mu;L Tango buffer</li>
<li>10 &mu;L Tango buffer</li>
Line 1,552: Line 1,599:
</ul><li>Master mix for BglII</li>
</ul><li>Master mix for BglII</li>
-
<ul class="ul_notebook"><li>2 &mu;L BglII</li>
+
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li>
<li>10 &mu;L Orange buffer</li>
<li>10 &mu;L Orange buffer</li>
Line 1,560: Line 1,607:
</ul><li>Master mix for EcoRV</li>
</ul><li>Master mix for EcoRV</li>
-
<ul class="ul_notebook"><li>1.5 &mu;L EcoRV</li>
+
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li>
<li>7.5 &mu;L Red buffer</li>
<li>7.5 &mu;L Red buffer</li>
Line 1,594: Line 1,641:
<ul class="ul_notebook"><li>FAO1-PCR1</li>
<ul class="ul_notebook"><li>FAO1-PCR1</li>
-
<ul class="ul_notebook"><li>Genomic 0.5 &mu;L</li>
+
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li>
<li>Buffer HF (5X) 10.0 &mu;L</li>
<li>Buffer HF (5X) 10.0 &mu;L</li>
Line 1,610: Line 1,657:
</ul><li>FAO1-PCR2</li>
</ul><li>FAO1-PCR2</li>
-
<ul class="ul_notebook"><li>Genomic 0.5 &mu;L</li>
+
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li>
<li>Buffer HF (5X) 10.0 &mu;L</li>
<li>Buffer HF (5X) 10.0 &mu;L</li>
Line 1,630: Line 1,677:
<p class="p_notebook">Annealing temperatures</p>
<p class="p_notebook">Annealing temperatures</p>
-
<ul class="ul_notebook"><li>FAO1-PCR1: 59 ºC</li>
+
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li>
-
<li>FAO1-PCR2: 64 ºC</li>
+
<li>FAO1-PCR2: 64 &deg;C</li>
</ul>
</ul>
Line 1,720: Line 1,767:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (ºC)</td><td class="td_notebook">Time </td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
Line 1,744: Line 1,791:
-
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37ºC with agitation. </p>
+
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p>
Line 1,752: Line 1,799:
-
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28ºC. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28ºC.</p>
+
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p>
Line 1,764: Line 1,811:
-
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28ºC. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p>
+
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p>
Line 1,802: Line 1,849:
<ul class="ul_notebook"><li>Master mix for EcoRV:</li>
<ul class="ul_notebook"><li>Master mix for EcoRV:</li>
-
<ul class="ul_notebook"><li>3 &mu;L EcoRV</li>
+
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li>
<li>15 &mu;L Red buffer</li>
<li>15 &mu;L Red buffer</li>
Line 1,810: Line 1,857:
</ul><li>Master mix for NcoI:</li>
</ul><li>Master mix for NcoI:</li>
-
<ul class="ul_notebook"><li>1.5 &mu;L NcoI</li>
+
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li>
<li>7.5 &mu;L Tango buffer</li>
<li>7.5 &mu;L Tango buffer</li>
Line 1,844: Line 1,891:
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr>
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr>
</table>
</table>
Line 1,908: Line 1,955:
-
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64ºC)</li>
+
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li>
-
<ul class="ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li>
+
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li>
<li>35 &mu;L HF buffer (5x)</li>
<li>35 &mu;L HF buffer (5x)</li>
Line 1,934: Line 1,981:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (ºC)</td><td class="td_notebook">Time </td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
Line 1,952: Line 1,999:
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li>
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li>
-
<ul class="ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
+
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
<li>10 &mu;L HF buffer (5x)</li>
<li>10 &mu;L HF buffer (5x)</li>
Line 1,976: Line 2,023:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (ºC)</td><td class="td_notebook">Time </td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr>
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr>
Line 1,996: Line 2,043:
-
<p class="p_notebook">It continues without working. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p>
+
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p>
Line 2,028: Line 2,075:
<ul class="ul_notebook"><li>FAO1-PCR1: </li>
<ul class="ul_notebook"><li>FAO1-PCR1: </li>
-
<ul class="ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
+
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
<li>10 &mu;L HF buffer (5x)</li>
<li>10 &mu;L HF buffer (5x)</li>
Line 2,046: Line 2,093:
<ul class="ul_notebook"><li>FAO2-PCR1: </li>
<ul class="ul_notebook"><li>FAO2-PCR1: </li>
-
<ul class="ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
+
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li>
<li>10 &mu;L HF buffer (5x)</li>
<li>10 &mu;L HF buffer (5x)</li>
Line 2,068: Line 2,115:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (ºC)</td><td class="td_notebook">Time </td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
Line 2,130: Line 2,177:
<ul class="ul_notebook"><li>Master mix for NotI:</li>
<ul class="ul_notebook"><li>Master mix for NotI:</li>
-
<ul class="ul_notebook"><li>2.5 &mu;L NotI</li>
+
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li>
<li>12.5 &mu;L Orange buffer</li>
<li>12.5 &mu;L Orange buffer</li>
Line 2,138: Line 2,185:
</ul><li>Master mix for RsaI:</li>
</ul><li>Master mix for RsaI:</li>
-
<ul class="ul_notebook"><li>2 &mu;L NcoI</li>
+
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li>
<li>10 &mu;L Tango buffer</li>
<li>10 &mu;L Tango buffer</li>
Line 2,156: Line 2,203:
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li>
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li>
-
<ul class="ul_notebook"><li>0.5 &mu;L Restriction enzyme</li>
+
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li>
<li>2.5 &mu;L Buffer</li>
<li>2.5 &mu;L Buffer</li>
Line 2,192: Line 2,239:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td><td class="td_notebook">Dilution</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr>
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr>
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr>
Line 2,206: Line 2,253:
-
<p class="p_notebook">Recultured media was grown at 28 ºC overnight (around 16 h).</p>
+
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p>
Line 2,214: Line 2,261:
-
<p class="p_notebook">Agroinfiltrate in <i>Nicotiana benthamiana</i>.</p>
+
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p>
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li>
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li>
Line 2,226: Line 2,273:
-
<p class="p_notebook">Agroinfiltration protocol consist on:</p>
+
<p class="p_notebook">Agroinfiltration protocol consists of:</p>
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li>
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li>
Line 2,244: Line 2,291:
-
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jes&uacute;s Mu&ntilde;oz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p>
+
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p>
Line 2,252: Line 2,299:
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr>
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56ºC</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54ºC</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49ºC (annealing)</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51ºC</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr>
</table>
</table>
Line 2,264: Line 2,311:
-
<p class="p_notebook">Possibility of primer combinations </p>
+
<p class="p_notebook">Possibility of primer combinations: </p>
Line 2,270: Line 2,317:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49ºC</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr>
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr>
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54ºC</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr>
</table>
</table>
Line 2,282: Line 2,329:
-
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52ºC). C primer combination was not used due to the length of the spected band. </p>
+
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p>
Line 2,288: Line 2,335:
<p class="p_notebook">PCR parameters</p>
<p class="p_notebook">PCR parameters</p>
-
<ul class="ul_notebook"><li>94ºC, 3 min</li>
+
<ul class="ul_notebook"><li>94&deg;C, 3 min</li>
<li>35 cycles</li>
<li>35 cycles</li>
-
<ul class="ul_notebook"><li>94ºC, 30 s</li>
+
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li>
-
<li>49 or 52ºC, 15 s</li>
+
<li>49 or 52&deg;C, 15 s</li>
-
<li>72ºC, 90 s</li>
+
<li>72&deg;C, 90 s</li>
-
</ul><li>72ºC, 7 min</li>
+
</ul><li>72&deg;C, 7 min</li>
</ul>
</ul>
-
<img class="img_notebook" src= gel  >
+
<img class="img_notebook" src=http://2014.igem.org/wiki/images/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png>
<p class="p_notebook"> </p>
<p class="p_notebook"> </p>
Line 2,342: Line 2,389:
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr>
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 Rtrv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr>
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr>
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 Rtrv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr>
</table>
</table>
Line 2,358: Line 2,405:
-
<ul class="ul_notebook"><li>94ºC 3 min</li>
+
<ul class="ul_notebook"><li>94&deg;C 3 min</li>
<li>35 cycles</li>
<li>35 cycles</li>
-
<ul class="ul_notebook"><li>94ºC 30 s</li>
+
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li>
-
<li>49ºC 15 s</li>
+
<li>49&deg;C 15 s</li>
-
<li>72ºC 90 s</li>
+
<li>72&deg;C 90 s</li>
-
</ul><li>72ºC 7 min</li>
+
</ul><li>72&deg;C 7 min</li>
</ul>
</ul>
-
<a name="Trichome_promoter"></a></br></br><h3 class="section_notebook">Trichome promoter</h3></br><h4 class="date_notebook">07/03/2014</h4>
+
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/12/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">PHEROMONE ANALYSIS</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p>
 +
 
 +
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li>
 +
 
 +
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li>
 +
 
 +
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li>
 +
 
 +
<li>1 leaf from a wild type plant</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p>
 +
 
 +
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li>
 +
 
 +
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li>
 +
 
 +
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li>
 +
 
 +
<li>100,0 mg of wild type leaf</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Then  150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">EDTA 500mM preparation:</p>
 +
 
 +
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p>
 +
 
 +
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4>
 +
 
 +
<p class="p_notebook">Analysis was performed overnight.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/13/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">First results of the analysis were obtained. The analysis proved that our plant was successfuly producing the desired pheromones in high concentration. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=IMAGEN cromatogramas(12/8) 1>
 +
 
 +
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=IMAGEN cromatogramas 2>
 +
 
 +
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=IMAgen cromatogramas 7>
 +
 
 +
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone,  which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p>
 +
 
 +
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li>
 +
 
 +
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li>
 +
 
 +
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Results of the replicae analysis are shown below:</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=IMAGEN CORMATOGRAMA 13/08 1>
 +
 
 +
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=IMAGEN CROMATOGRAMA 13/08 3>
 +
 
 +
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/14/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p>
 +
 
 +
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li>
 +
 
 +
<li>1.5 &mu;L dNTPs</li>
 +
 
 +
<li>1 &mu;L Forward Primer </li>
 +
 
 +
<li>1 &mu;L Reverse Primer</li>
 +
 
 +
<li>1 &mu;L Taq Polimerase</li>
 +
 
 +
<li>5 &mu;L Buffer 10X</li>
 +
 
 +
<li>39.5 &mu;L H2O miliQ</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p>
 +
 
 +
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p>
 +
 
 +
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= "http://2014.igem.org/wiki/images/9/95/20140814_colony_pcr_y_BBSI_test.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/15/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">PCR conditions:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li>
 +
 
 +
<li>1 &mu;L dNTPs</li>
 +
 
 +
<li>1 &mu;L HSR1 BamHI + 480 </li>
 +
 
 +
<li>1 &mu;L HSR1 RTRv + 1149  </li>
 +
 
 +
<li>1 &mu;L Tap pol.</li>
 +
 
 +
<li>5 &mu;L Buffer 10x</li>
 +
 
 +
<li>39 &mu;L H2O miliQ</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>Colony PCR 2:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li>
 +
 
 +
<li>1 &mu;L dNTPs</li>
 +
 
 +
<li>1 &mu;L iGEMJul09 </li>
 +
 
 +
<li>1 &mu;L iGEMJul10  </li>
 +
 
 +
<li>1 &mu;L Tap pol.</li>
 +
 
 +
<li>5 &mu;L Buffer 10x</li>
 +
 
 +
<li>39 &mu;L H2O miliQ</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li>
 +
 
 +
<li>1 &mu;L dNTPs</li>
 +
 
 +
<li>1 &mu;L HSR1 BamHI + 480 </li>
 +
 
 +
<li>1 &mu;L HSR1 RTRv + 1149  </li>
 +
 
 +
<li>1 &mu;L Tap pol.</li>
 +
 
 +
<li>5 &mu;L Buffer 10x</li>
 +
 
 +
<li>39 &mu;L H2O miliQ</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>genomic library PCR 4:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li>
 +
 
 +
<li>1 &mu;L dNTPs</li>
 +
 
 +
<li>1 &mu;L iGEMJul09 </li>
 +
 
 +
<li>1 &mu;L iGEMJul10  </li>
 +
 
 +
<li>1 &mu;L Tap pol.</li>
 +
 
 +
<li>5 &mu;L Buffer 10x</li>
 +
 
 +
<li>39 &mu;L H2O miliQ</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1e/20140820_PCR_colony.png>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/a7/20140820_FAO.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li>
 +
 
 +
<li>Incubate 15 min at 70&deg;C.</li>
 +
 
 +
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li>
 +
 
 +
<li>Centrifuge 3 min at 15000 xg.</li>
 +
 
 +
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li>
 +
 
 +
<li>Centrifuge 1 min at 15000 xg. </li>
 +
 
 +
<li>Recover 1 &mu;L of supernatant. </li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Control PCR:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L template</li>
 +
 
 +
<li>1 &mu;L dNTPs</li>
 +
 
 +
<li>1 &mu;L HSR1 clone Fw+1 </li>
 +
 
 +
<li>1 &mu;L HSR1 Rtrv + 1149</li>
 +
 
 +
<li>&mu;L Taq polimerase </li>
 +
 
 +
<li>5 &mu;L Buffer 10X</li>
 +
 
 +
<li>40 &mu;L H2O</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>FAO1 PCR</li>
 +
 
 +
<li>1 &mu;L template</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li>
 +
 
 +
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li>
 +
 
 +
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li>
 +
 
 +
<li>&mu;L Taq polimerase </li>
 +
 
 +
<li>5 &mu;L Buffer 10X</li>
 +
 
 +
<li>40 &mu;L H2O</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">PCR parameters (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/c/ce/20140822_P35S_BB_FAO.png>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li>
 +
 
 +
<li>HSR1 RTRv+1149</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li>
 +
 
 +
<li>HSR1 RTRv+1149 </li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>iGEMJul07 </li>
 +
 
 +
<li>iGEMJul08</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>iGEMJul09 </li>
 +
 
 +
<li>iGEMJul10</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/ac/20140825_pcps2_ta29_atr.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li>
 +
 
 +
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li>
 +
 
 +
<li>GB0486 2&alpha;2R </li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>GB parts:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li>
 +
 
 +
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li>
 +
 
 +
<li>GB0486 2&alpha;2R</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li>
 +
 
 +
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">08/29/2014</h4>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li>
 +
 
 +
<li>Mix it well.</li>
 +
 
 +
<li>Store at -80&deg;C.</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4e/20140804_bb_bar_EaDAcT.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b9/20140905_Barnase_Renilla_EaDAcT.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">They were not correct. We will keep trying.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/08/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p>
 +
 
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>P35S:EaDAcT:T35S in 2&alpha;2</li>
 +
 
 +
<li>P35S:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/10/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/11/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/12/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Note: Go to 09/16/2014</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li>
 +
 
 +
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/13/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/15/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We stored in glycerol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= gel digestions >
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/24/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We obtained similar results.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured in new media:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We collected agroinfiltred leaf samples. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/10/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4>
Line 2,386: Line 3,449:
<li>Introduce the two tubes in liquid nitrogen.</li>
<li>Introduce the two tubes in liquid nitrogen.</li>
-
<li>Remove them from the liquid nitrogen and store at -80ºC until use.</li>
+
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li>
-
<li>Remove one tube from -80ºC and re-introduce them in liquid nitrogen. </li>
+
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li>
<li>Grind the disks.</li>
<li>Grind the disks.</li>
-
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65ºC.)</li>
+
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li>
<li>Grind the mixture.</li>
<li>Grind the mixture.</li>
Line 2,398: Line 3,461:
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li>
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li>
-
<li>Vortex it and maintain at 65ºC for 45 min. Mix it by inversion 5-15 min.</li>
+
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li>
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li>
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li>
Line 2,410: Line 3,473:
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li>
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li>
-
<li>To precipitate, maintain 20 min on ice or at -80ºC during 5 min.</li>
+
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li>
-
<li>Centrifuge 10 min at 13000 rpm (4ºC).</li>
+
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li>
<li>Discard the supernatant by decantation (be carefull with the pellet).</li>
<li>Discard the supernatant by decantation (be carefull with the pellet).</li>
Line 2,424: Line 3,487:
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li>
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li>
-
<li>Store at -20ºC.  </li>
+
<li>Store at -20&deg;C.  </li>
</ul>
</ul>
Line 2,434: Line 3,497:
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li>
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li>
-
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20ºC)</li>
+
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li>
</ul>
</ul>
Line 2,510: Line 3,573:
-
<ul class="ul_notebook"><li>98 ºC (2 min)</li>
+
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li>
<li>35 cycles</li>
<li>35 cycles</li>
-
<ul class="ul_notebook"><li>98 ºC (10 sec)</li>
+
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li>
-
<li>59 ºC (15 sec)</li>
+
<li>59 &deg;C (15 sec)</li>
-
<li>72 ºC (45 sec)</li>
+
<li>72 &deg;C (45 sec)</li>
-
</ul><li>72 ºC (7 min)</li>
+
</ul><li>72 &deg;C (7 min)</li>
</ul>
</ul>
Line 2,570: Line 3,633:
-
<ul class="ul_notebook"><li>98 ºC (2 min)</li>
+
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li>
<li>35 cycles</li>
<li>35 cycles</li>
-
<ul class="ul_notebook"><li>98 ºC (10 sec)</li>
+
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li>
-
<li>1, 3, 5 -> 59 ºC (15 sec). 2, 4 -> 55 ºC (15 sec)</li>
+
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li>
-
<li>72 ºC (45 sec)</li>
+
<li>72 &deg;C (45 sec)</li>
-
</ul><li>72 ºC (7 min)</li>
+
</ul><li>72 &deg;C (7 min)</li>
</ul>
</ul>
Line 2,622: Line 3,685:
-
<ul class="ul_notebook"><li>98 ºC (2 min)</li>
+
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li>
<li>35 cycles</li>
<li>35 cycles</li>
-
<ul class="ul_notebook"><li>98 ºC (10 sec)</li>
+
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li>
-
<li>49, 52, 55, 60 ºC (15 sec)</li>
+
<li>49, 52, 55, 60 &deg;C (15 sec)</li>
-
<li>72 ºC (45 sec)</li>
+
<li>72 &deg;C (45 sec)</li>
-
</ul><li>72 ºC (7 min)</li>
+
</ul><li>72 &deg;C (7 min)</li>
</ul>
</ul>
Line 2,654: Line 3,717:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5</td><td class="td_notebook">5</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50</td><td class="td_notebook">50</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10</td><td class="td_notebook">10</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5</td><td class="td_notebook">12.5</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5</td><td class="td_notebook">12.5</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5</td><td class="td_notebook">2.5</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5</td><td class="td_notebook">107.5</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr>
</table>
</table>
Line 2,674: Line 3,737:
-
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59  ºC.</p>
+
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59  &deg;C.</p>
Line 2,706: Line 3,769:
</ul>
</ul>
-
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 ºC.</p>
+
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p>
-
<ul class="ul_notebook"><li>98 ºC (30 sec)</li>
+
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li>
<li>35 cycles</li>
<li>35 cycles</li>
-
<ul class="ul_notebook"><li>98 ºC (10 sec)</li>
+
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li>
-
<li>50, 53, 55, 59 ºC (15 sec)</li>
+
<li>50, 53, 55, 59 &deg;C (15 sec)</li>
-
<li>72 ºC (45 sec)</li>
+
<li>72 &deg;C (45 sec)</li>
-
</ul><li>72 ºC (2 min)</li>
+
</ul><li>72 &deg;C (2 min)</li>
</ul>
</ul>
Line 2,728: Line 3,791:
-
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 ºC reactions.</p>
+
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p>
Line 2,754: Line 3,817:
</ul>
</ul>
-
<p class="p_notebook">Set the reaction: 25 cycles x (37ºC 2 min, 16ºC 5 min).</p>
+
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
Line 2,934: Line 3,997:
-
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 ºC with agitation. </p>
+
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p>
Line 2,982: Line 4,045:
<ul class="ul_notebook"><li>Master mix for EcoRV:</li>
<ul class="ul_notebook"><li>Master mix for EcoRV:</li>
-
<ul class="ul_notebook"><li>3 &mu;L EcoRV</li>
+
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li>
<li>15 &mu;L Red buffer</li>
<li>15 &mu;L Red buffer</li>
Line 2,990: Line 4,053:
</ul><li>Master mix for HindIII:</li>
</ul><li>Master mix for HindIII:</li>
-
<ul class="ul_notebook"><li>2 &mu;L HindIII</li>
+
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li>
<li>10 &mu;L Red buffer</li>
<li>10 &mu;L Red buffer</li>
Line 3,038: Line 4,101:
-
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28ºC).</p>
+
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p>
Line 3,060: Line 4,123:
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p>
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p>
-
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos) were made. </p>
+
 
 +
 
 +
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico performed to check the insertion:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/12/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/13/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/14/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d5/20140814_CUP2_digestions.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/15/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/17/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Ligation reagents:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 
 +
<li>1 &mu;L T35S</li>
 +
 
 +
<li>1 ul Atr&Delta;11</li>
 +
 
 +
<li>1.5 &mu;L 2&alpha;1</li>
 +
 
 +
<li>1 &mu;L Buffer ligase 10X</li>
 +
 
 +
<li>1 &mu;L T4</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>2.5 &mu;L H2O</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 
 +
<li>1 &mu;L T35S</li>
 +
 
 +
<li>1 ul Atr&Delta;11/EaDAcT</li>
 +
 
 +
<li>1 &mu;L 2&alpha;2</li>
 +
 
 +
<li>1 &mu;L Buffer ligase 10X</li>
 +
 
 +
<li>1 &mu;L T4</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>3 &mu;L H2O</li>
 +
 
 +
</ul></ul>
 +
 
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
 +
 
 +
<li>PCPS2:HarFAR:T35S</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">08/19/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li>
 +
 
 +
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li>
 +
 
 +
</ul>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1e/20140820_PCR_colony.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p>
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li>
 +
 
 +
<li>1 &mu;L PCPS2:HarFAR:T35S</li>
 +
 
 +
<li>1 &mu;L 2&Omega;1</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Buffer ligase</li>
 +
 
 +
<li>4 &mu;L H2O miliQ</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li>
 +
 
 +
<li>1 &mu;L PCPS2:EaDAcT:T35S</li>
 +
 
 +
<li>1 &mu;L 2&Omega;2</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Buffer ligase</li>
 +
 
 +
<li>4 &mu;L H2O miliQ</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/21/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico made to check minipreps:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">All digestions were not correct. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/24/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li>
 +
 
 +
<li>PCPS2:GFP:TNos (Rif, Kan)</li>
 +
 
 +
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li>
 +
 
 +
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>T35S:P19:TNos </li>
 +
 
 +
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li>
 +
 
 +
<li>T35S:P19:GFP:TNos</li>
 +
 
 +
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/26/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico the check the minipreps:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/f/f1/20140826_Atr_%2B_Har.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>TUs with trichome promoter:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/29/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made a ligation as follows:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li>
 +
 
 +
</ul>
 +
 
 +
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
<li>1.5 &mu;L 2&alpha;1</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Buffer ligase</li>
 +
 
 +
<li>3.5 &mu;L H2O</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">Protocol followed was the same as previously done.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b5/2014091_BB_y_Ruta_entera.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
<li>P35S:P19:GFP:TNos </li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li>
 +
 
 +
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li>
 +
 
 +
<li>PCPS2:GFP:Tnos in 2&alpha;2</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li>
 +
 
 +
<li>Mix it well using vortex.</li>
 +
 
 +
<li>Store at -80&deg;C.</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/03/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
<li>TNos:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/a2/2014093_agrobacterium_pathway.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p>
 +
 
 +
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li>
 +
 
 +
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li>
 +
 
 +
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies to store them in glycerol:</p>
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li>
 +
 
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Result analysis:</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three  gens are placed in the same construction. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/08/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d1/20140908_PCR_P35S_AtrHarEa.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Both digestions were correct. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/09/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li>
 +
 
 +
<li>P35S:P19:GFP:TNos </li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/11/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/12/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/68/20140912_Pathway_complete.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digetions were correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/15/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions that were still pending from 09/12.</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/35/20140916_gb_pieces_pathway_enzymes.png>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/2/28/20140916_ge_pieces_AcPathway.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Minipreps of yesterday's culture were made:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico were the same as previouly done.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1f/20140917_gb253_pathway.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p>
 +
 
 +
<p class="p_notebook">  </p>
 +
 
 +
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/19/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/9/9f/20140919_PCPS2_omegaunder_Barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/21/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies to store them in glycerol:</p>
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We obtained similar results.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S </li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src= gel digestiones 29/09/2014>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured in new media:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We agroinfiltred following the protocol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We collected agroinfiltred leaf samples. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li>
 +
 
 +
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">07/23/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">07/24/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">07/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">07/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">07/31/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Order primers for TA29 and barnase:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/07/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>TA29 PCR parameters</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
 +
 
 +
<li>35 cycles</li>
 +
 
 +
<li>98&deg;C, 10 s</li>
 +
 
 +
<li>60&deg;C, 18 s</li>
 +
 
 +
<li>72&deg;C, 40 s</li>
 +
 
 +
<li>72&deg;C, 7 min</li>
 +
 
 +
</ul><li>Barnase PCR parameters</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
 +
 
 +
<li>35 cycles</li>
 +
 
 +
<li>98&deg;C, 10 s</li>
 +
 
 +
<li>63&deg;C, 18 s</li>
 +
 
 +
<li>72&deg;C, 40 s</li>
 +
 
 +
<li>72&deg;C, 7 min</li>
 +
 
 +
</ul></ul>
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/08/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/11/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We still do not get PCR product.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/12/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://b2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/19/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
 
 +
<li>1 &mu;L TA29</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>1.2 &mu;L Buffer ligase</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>6.8 &mu;L H2O miliQ</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/21/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">PCR conditions (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/ef/20140821_Barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture. </p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/24/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of TA29 culture.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= gel digestiones y PCR TUs>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/26/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
 
 +
<li>1 &mu;L Barnase product</li>
 +
 
 +
<li>1.2 &mu;L Buffer Ligase</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>6.8 &mu;L H2O</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/eb/20140817_Ta29_e040.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/2/27/20140827_ta29.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD.  </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e5/2014092_Barnasaa_bb.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Master Mix (12 reactions)</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li>
 +
 
 +
<li>12 &mu;L primer R</li>
 +
 
 +
<li>12 &mu;L primer F</li>
 +
 
 +
<li>12 &mu;L Taq Polymerase</li>
 +
 
 +
<li>24 &mu;L Buffer 10X</li>
 +
 
 +
<li>48 &mu;L H2O</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Termocycler conditions (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/7/75/2014092_Barnasa_PCR_colony.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4e/20140804_bb_bar_EaDAcT.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">bands were not correct, so we picked another colony.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of barnase's culture.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b9/20140905_Barnase_Renilla_EaDAcT.png>
 +
 
 +
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did again Barnase minipreps. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4a/20140906_Barnase.png >
 +
 
 +
 
 +
 
 +
<p class="p_notebook">All digestions were not correct except one of them. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
 
 +
<li>1 &mu;L Barnase</li>
 +
 
 +
<li>1.2 &mu;L Buffer ligase 10X</li>
 +
 
 +
<li>1 ul T4 ligase</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>6.8 &mu;L H2O</li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/35/20140916_gb_pieces_pathway_enzymes.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The gel shows that the PCR product is correct. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Barnase in pUPD</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/49/20140918_bar_colony_PCR.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/19/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/7/75/20140919_omega_undercover_Bar_Colony_PCR.png>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/9/9f/20140919_PCPS2_omegaunder_Barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made ligations of:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li>
 +
 
 +
<li>Barnase PCR product in pUPD</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We digested Barnase ligation with XbaI.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>MoFlippers constructions</li>
 +
 
 +
<li>Mutated Barnase in pUPD</li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/b/bb/20140922_Omega_under_Bar.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Transformation into E.coli:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;1</li>
 +
 
 +
<li>Barnase (XbaI digested) in pUPD</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/21/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies:</p>
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li>
 +
 
 +
<li>P35S:Yellow:T35S in 2&alpha;1 </li>
 +
 
 +
</ul>
 +
 
 +
<ul class="ul_notebook"><li>Barnase digested with XbaI </li>
 +
 
 +
</ul>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
<ul class="ul_notebook"><li>Barnase in pUPD</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;1 </li>
 +
 
 +
</ul>
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated again chromoproteins ligation:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li>
 +
 
 +
<li>1 &mu;L P35S</li>
 +
 
 +
<li>1 &mu;L T35S</li>
 +
 
 +
<li>1 &mu;L Blue/Yellow</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Ligase buffer</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>3 &mu;L H2O</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions were run in two different gels</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/8/86/20140922_Ruta_KanRes_Omega_Barnase.png>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/69/20140922_Blue_Ruta_KanRes_Bar.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Barnase digestions were not correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Blue digestions were correct</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p>
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li>
 +
 
 +
<li>P35S:Yellow:T35S iin 2&alpha;2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/24/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/05/20140924_Barnase.png>
 +
 
 +
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies to store them in glycerol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li>
 +
 
 +
<li>1 &mu;L Barnase in pUPD (Mutated)</li>
 +
 
 +
<li>1 &mu;L TA29</li>
 +
 
 +
<li>1 &mu;L T35S</li>
 +
 
 +
<li>1 &mu;L ligase buffer</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>1 &mu;L T4 Ligase</li>
 +
 
 +
<li>2.5 &mu;L H2O</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4a/20140925_CUP_prom_chromoproteins.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture: </p>
 +
 
 +
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestion in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/f/ff/20140926_Barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/27/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/a/a4/20140927_Blue_Agro.png>
 +
 
 +
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies (E.coli):</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li>
 +
 
 +
<li>P35S:Yellow:T35S (2&alpha;2)</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture. </p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b3/20140929_PCPS2_Blue.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">They were correct. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (2&alpha;2)</li>
 +
 
 +
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (2&alpha;2)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= gel digestions>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Both digestions were correct. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p>
 +
 
 +
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We send the Biosafety module to Norwich.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We agroinfiltred following the protocol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">10/03/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li>
 +
 
 +
<li>P35S:Yellow:T35S (2&alpha;2)</li>
 +
 
 +
</ul>
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/2/27/20141005_Chromoprot_agro.png>
 +
 
 +
<p class="p_notebook">They were correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/07/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/08/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other chromoproteins that could be used in plece of Blue and Yellow chromoproteins. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S: Ant1:TNos_P35S:JFA13:TNos</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">10/09/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Yesterday's culture did not grow. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/10/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/21/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p>
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/9/9f/20140822_bb.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/24/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/26/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/a/a8/20140827_bb_e0240.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Double digestions</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li>
 +
 
 +
<li>2.5 &mu;L NEBuffer</li>
 +
 
 +
<li>0.5 &mu;L BSA</li>
 +
 
 +
<li>0.5 &mu;L enzyme 1</li>
 +
 
 +
<li>0.5 &mu;L enzyme 2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Final volume: 20 &mu;L</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">BioBricks ligations</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li>
 +
 
 +
<li>2 &mu;L part 2 (25 ng)</li>
 +
 
 +
<li>1 &mu;L T4 buffer 10X</li>
 +
 
 +
<li>0.5 &mu;L T4</li>
 +
 
 +
<li>4 &mu;L H20</li>
 +
 
 +
</ul>
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726,  943</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/29/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046,  943</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991,  998</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046,  943</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991,  998</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/thumb/2/26/20140830_bb.png/800px-20140830_bb.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/31/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/a/a6/20140901_bb.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/b/b7/20140902_bb.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/03/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/0/07/20140904_bb.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/09/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani  broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/10/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1)</td><td class="td_notebook">1.085</td><td class="td_notebook">0.38</td><td class="td_notebook">2.854</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.036</td><td class="td_notebook">0.35</td><td class="td_notebook">2.959</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.076</td><td class="td_notebook">0.39</td><td class="td_notebook">2.759</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1)</td><td class="td_notebook">4.907</td><td class="td_notebook">0.36</td><td class="td_notebook">13.632</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">4.754</td><td class="td_notebook">0.34</td><td class="td_notebook">13.981</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">3.494</td><td class="td_notebook">0.26</td><td class="td_notebook">13.439</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">57.393</td><td class="td_notebook">0.43</td><td class="td_notebook">133.471</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">61.622</td><td class="td_notebook">0.47</td><td class="td_notebook">131.110</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">63.999</td><td class="td_notebook">0.47</td><td class="td_notebook">136.167</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">1.389</td><td class="td_notebook">0.37</td><td class="td_notebook">3.754</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.353</td><td class="td_notebook">0.37</td><td class="td_notebook">3.656</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.370</td><td class="td_notebook">0.33</td><td class="td_notebook">4.151</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr>
 +
 
 +
</table>
 +
 
 +
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Run PCR with the following templates and primers:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">P35s PCR parameters</p>
 +
 
 +
<ul class="ul_notebook"><li>98&deg;C, 2 min</li>
 +
 
 +
<li>35 cycles</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li>
 +
 
 +
<li>67&deg;C, 18 s</li>
 +
 
 +
<li>72&deg;C, 40 s</li>
 +
 
 +
</ul><li>98&deg;C, 7 min</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">T35s PCR parameters</p>
 +
 
 +
<ul class="ul_notebook"><li>98&deg;C, 2 min</li>
 +
 
 +
<li>35 cycles</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li>
 +
 
 +
<li>65&deg;C, 18 s</li>
 +
 
 +
<li>72&deg;C, 40 s</li>
 +
 
 +
</ul><li>98&deg;C, 7 min</li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We didn't obtain PCR product.</p>
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
</br><h4 class="date_notebook">08/08/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/11/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We still do not get PCR product.</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/12/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/19/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li>
 +
 
 +
<li>PCR2: P35S:Atr&Delta;11:T35S template</li>
 +
 
 +
</ul>
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e0/20140819_p35s.png>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/5/55/20140819_t35s2C_p35s.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
 
 +
<li>1 &mu;L T35S_BB</li>
 +
 
 +
<li>1.2 &mu;L Buffer ligase</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>6.8 &mu;L H20 miliQ</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/21/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">In silico digestions:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct. </p>
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li>
 +
 
 +
<li>HarFAR (2&alpha;2)</li>
 +
 
 +
<li>Atr&Delta;11 (2&alpha;1)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Conditions for 35 cycles:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Conditions for 35 cycles:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/c/ce/20140822_P35S_BB_FAO.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The gel shows that the template is not there.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The gel showed that the PCR products were correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/aa/20140906_PCR_P35S.png>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not obtain any product.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/07/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b0/20140907_Barnase_PCR_35S.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not obtain any product.  </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/08/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d1/20140908_PCR_P35S_AtrHarEa.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not obtain any PCR product. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>250 ng E0040</li>
 +
 
 +
<li>2.5 &mu;L NEB2</li>
 +
 
 +
<li>0.5 &mu;L BSA</li>
 +
 
 +
<li>0.5 &mu;L XbaI</li>
 +
 
 +
<li>0.5 &mu;L PstI</li>
 +
 
 +
</ul>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li>
 +
 
 +
<li>MoFlipper + Atr&Delta;11</li>
 +
 
 +
<li>MoFlipper + HarFAR</li>
 +
 
 +
<li>MoFlipper + EaDAcT</li>
 +
 
 +
<li>MoFlipper + TA29</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/19/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/7/75/20140919_omega_undercover_Bar_Colony_PCR.png>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/9/9f/20140919_PCPS2_omegaunder_Barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p>
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
<p class="p_notebook">MoFlipper cultures did not grow.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
<ul class="ul_notebook"><li>Omega undercover</li>
 +
 
 +
</ul>
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/8/86/20140922_Ruta_KanRes_Omega_Barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Omega undercover with TA29</li>
 +
 
 +
<li>MoFlipper with Atr&Delta;11</li>
 +
 
 +
<li>MoFlipper with HarFAR</li>
 +
 
 +
<li>MoFlipper with EaDAcT</li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/7/7d/20140923_Ta29_Moflippers.png>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p>
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
 
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4>
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4>
Line 3,106: Line 7,699:
-
<p class="p_notebook">Annealing temperature: both 61 ºC</p>
+
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p>
Line 3,160: Line 7,753:
-
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37ºC).</p>
+
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p>
Line 3,256: Line 7,849:
-
<p class="p_notebook">Ligations made:</p>
+
<p class="p_notebook">The following ligations were made:</p>
Line 3,262: Line 7,855:
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li>
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li>
-
<ul class="ul_notebook"><li>1 &mu;L P35S</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li>
<li>1 &mu;L CUP2</li>
<li>1 &mu;L CUP2</li>
Line 3,276: Line 7,869:
<li>1 &mu;L Buffer ligase</li>
<li>1 &mu;L Buffer ligase</li>
-
<li>1 &mu;L 2&alpha;2</li>
+
<li>1 &mu;L 2&alpha;2 vector</li>
<li>2 &mu;L H2O</li>
<li>2 &mu;L H2O</li>
Line 3,284: Line 7,877:
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li>
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li>
-
<ul class="ul_notebook"><li>1 &mu;L PCPS2</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
<li>1 &mu;L CUP2</li>
<li>1 &mu;L CUP2</li>
Line 3,298: Line 7,891:
<li>1 &mu;L Buffer ligase</li>
<li>1 &mu;L Buffer ligase</li>
-
<li>1 &mu;L 2&alpha;2</li>
+
<li>1 &mu;L 2&alpha;2 vector</li>
<li>2 &mu;L H2O </li>
<li>2 &mu;L H2O </li>
-
<a name="Biosafety"></a></br></br><h3 class="section_notebook">Biosafety</h3></br><h4 class="date_notebook">07/22/2014</h4>
+
</ul></ul>
 +
</br><h4 class="date_notebook">08/12/2014</h4>
-
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p>
 
 +
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p>
-
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li>
 
-
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li>
+
</br><h4 class="date_notebook">08/13/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li>
 +
 
 +
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li>
</ul>
</ul>
-
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p>
+
</br><h4 class="date_notebook">08/14/2014</h4>
-
</br><h4 class="date_notebook">07/23/2014</h4>
+
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p>
-
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
+
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p>
 +
<table class="table_notebook">
 +
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
-
</br><h4 class="date_notebook">07/24/2014</h4>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr>
-
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr>
 +
</table>
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d5/20140814_CUP2_digestions.png>
-
</br><h4 class="date_notebook">07/25/2014</h4>
 
 +
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p>
-
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p>
+
<p class="p_notebook"> </p>
 +
 
 +
</br><h4 class="date_notebook">08/15/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p>
Line 3,350: Line 7,965:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr>
+
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/1/18/20140815_CUP2_digestion.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p>
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
</br><h4 class="date_notebook">08/17/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Ligation reagents:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 
 +
<li>1 &mu;L T35S</li>
 +
 
 +
<li>1 ul Gal4AD</li>
 +
 
 +
<li>1 &mu;L 2&alpha;2</li>
 +
 
 +
<li>1 &mu;L CUP2</li>
 +
 
 +
<li>1 &mu;L Buffer ligase 10X</li>
 +
 
 +
<li>1 &mu;L T4</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>2 &mu;L H2O</li>
 +
 
 +
</ul></ul>
 +
 
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/19/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr>
</table>
</table>
Line 3,362: Line 8,053:
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png >
-
</br><h4 class="date_notebook">07/28/2014</h4>
 
 +
<p class="p_notebook">Digestions were correct. </p>
-
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p>
 
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
<p class="p_notebook">We made ligations as follows:</p>
-
</br><h4 class="date_notebook">07/31/2014</h4>
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li>
-
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p>
+
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li>
 +
<li>1 &mu;L SF in 1&alpha;1</li>
 +
<li>1 &mu;L 2&Omega;1</li>
-
</br><h4 class="date_notebook">08/05/2014</h4>
+
<li>1 &mu;L BsmBI</li>
 +
<li>1 &mu;L T4 ligase</li>
 +
<li>1 &mu;L Buffer ligase</li>
-
<p class="p_notebook">Order primers for TA29 and barnase:</p>
+
<li>4 &mu;L H2O</li>
 +
 
 +
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 
 +
<li>1 &mu;L CUP2</li>
 +
 
 +
<li>1 &mu;L Gal4AD</li>
 +
 
 +
<li>1 &mu;L T35S</li>
 +
 
 +
<li>1 &mu;L 2&alpha;1</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Buffer ligase</li>
 +
 
 +
<li>4 &mu;L H2O</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">Protocol was the same as previously folowed. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
 +
 
 +
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/29/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
Line 3,392: Line 8,171:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr>
+
</table>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr>
+
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/42/20140830_switch.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We have to repeat digestions.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/03/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the following digestions:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr>
</table>
</table>
Line 3,406: Line 8,237:
-
</br><h4 class="date_notebook">08/07/2014</h4>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/a2/2014093_agrobacterium_pathway.png>