Team:Valencia UPV/Notebook wetlab.html

From 2014.igem.org

(Difference between revisions)
 
(46 intermediate revisions not shown)
Line 3: Line 3:
<style>
<style>
 +
.normal-table
 +
{
 +
border: 1px solid black;
 +
margin: 0px;
 +
padding: 15px;
 +
white-space: normal;
 +
table-layout: normal;
 +
background: transparent;
 +
 +
}
 +
 +
.normal-table tr td
 +
{
 +
border: 1px solid black;
 +
margin: 0px;
 +
padding: 15px;
 +
white-space: normal;
 +
table-layout: normal;
 +
background: transparent;
 +
 +
}
 +
 +
.normal-table tr th
 +
{
 +
border: 1px solid black;
 +
margin: 0px;
 +
padding: 15px;
 +
white-space: normal;
 +
table-layout: normal;
 +
background: transparent;
 +
 +
}
.table_notebook{
.table_notebook{
Line 87: Line 119:
-
<div align="center"><div id="cn-box" align="justify">
+
<div align="center"><div id="cn-box" align="justify"><br/>
 +
 
 +
<div align="center"><img class="img-title" alt="Notebook" src="http://2014.igem.org/wiki/images/2/2a/VUPVNotebook.png"></img></div><br/>
 +
<div class="box_above_notebook">
Contents:
Contents:
-
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis">Biosynthesis</a></li> <li> <a href="#Trichome_promoter">Trichome promoter</a></li> <li> <a href="#Switch">Switch</a></li> <li> <a href="#Biosafety">Biosafety</a></li> <li> <a href="#Translator_to_BioBricks">Translator to BioBricks</a></li></ul>
+
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul>
-
</div><a name="Biosynthesis"></a></br></br><h3 class="section_notebook">Biosynthesis</h3></br><h4 class="date_notebook">06/09/2014</h4>
+
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4>
Line 364: Line 399:
-
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11</p>
+
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p>
Line 2,256: Line 2,291:
-
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jes&uacute;s Mu&ntilde;oz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p>
+
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p>
Line 2,276: Line 2,311:
-
<p class="p_notebook">Possibility of primer combinations </p>
+
<p class="p_notebook">Possibility of primer combinations: </p>
Line 2,438: Line 2,473:
-
</br><h4 class="date_notebook">PONER NOMBRE DEL PARATO</h4>
+
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p>
-
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE</h4>
+
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4>
-
<p class="p_notebook">Analysis was performed overnight</p>
+
<p class="p_notebook">Analysis was performed overnight.</p>
Line 2,470: Line 2,505:
<img class="img_notebook" src=IMAgen cromatogramas 7>
<img class="img_notebook" src=IMAgen cromatogramas 7>
-
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecena, a desired pheromone,  which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p>
+
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone,  which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p>
Line 2,566: Line 2,601:
-
<p class="p_notebook">Starting from an agar plate containing a Candida gene bank, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored in glycerine part of the culture and 200 &mu;L were mixed with 5 mL of LB media and Amp (2:1000). </p>
+
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p>
-
<p class="p_notebook">The tube containing the gene bank was grown at 28ºC for 1 hour. Then, we made minipreps. </p>
+
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p>
-
<img class="img_notebook" src= gel PCR FAO1>
+
<img class="img_notebook" src= "http://2014.igem.org/wiki/images/9/95/20140814_colony_pcr_y_BBSI_test.png>
Line 2,584: Line 2,619:
-
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000)and Rif (1:1000) during 2 days at 28º C. </p>
+
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p>
-
</br><h4 class="date_notebook">08/17/2014</h4>
 
 +
</br><h4 class="date_notebook">08/18/2014</h4>
-
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p>
 
 +
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p>
-
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p>
 
 +
<p class="p_notebook">PCR conditions:</p>
-
<p class="p_notebook">Ligation reagents:</p>
 
 +
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li>
-
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
+
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
+
<li>1 &mu;L dNTPs</li>
-
<li>1 &mu;L T35S</li>
+
<li>1 &mu;L HSR1 BamHI + 480 </li>
-
<li>1 ul Atr&Delta;11</li>
+
<li>1 &mu;L HSR1 RTRv + 1149  </li>
-
<li>1.5 &mu;L 2&alpha;1</li>
+
<li>1 &mu;L Tap pol.</li>
-
<li>1 &mu;L Buffer ligase 10X</li>
+
<li>5 &mu;L Buffer 10x</li>
-
<li>1 &mu;L T4</li>
+
<li>39 &mu;L H2O miliQ</li>
-
 
+
-
<li>1 &mu;L BsaI</li>
+
-
 
+
-
<li>2.5 &mu;L H2O</li>
+
</ul></ul>
</ul></ul>
-
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li>
+
<ul class="ul_notebook"><li>Colony PCR 2:</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
+
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li>
-
<li>1 &mu;L T35S</li>
+
<li>1 &mu;L dNTPs</li>
-
<li>1 ul Atr&Delta;11/EaDAcT</li>
+
<li>1 &mu;L iGEMJul09 </li>
-
<li>1 &mu;L 2&alpha;2</li>
+
<li>1 &mu;L iGEMJul10  </li>
-
<li>1 &mu;L Buffer ligase 10X</li>
+
<li>1 &mu;L Tap pol.</li>
-
<li>1 &mu;L T4</li>
+
<li>5 &mu;L Buffer 10x</li>
-
<li>1 &mu;L BsaI</li>
+
<li>39 &mu;L H2O miliQ</li>
-
 
+
-
<li>3 &mu;L H2O</li>
+
</ul></ul>
</ul></ul>
-
</br><h4 class="date_notebook">08/18/2014</h4>
+
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li>
 +
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li>
 +
<li>1 &mu;L dNTPs</li>
-
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the gene bank minipreps made on 08/14/2014).</p>
+
<li>1 &mu;L HSR1 BamHI + 480 </li>
 +
<li>1 &mu;L HSR1 RTRv + 1149  </li>
 +
<li>1 &mu;L Tap pol.</li>
-
<p class="p_notebook">PCR conditions:</p>
+
<li>5 &mu;L Buffer 10x</li>
 +
<li>39 &mu;L H2O miliQ</li>
 +
</ul></ul>
-
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li>
+
<ul class="ul_notebook"><li>genomic library PCR 4:</li>
-
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li>
<li>1 &mu;L dNTPs</li>
<li>1 &mu;L dNTPs</li>
-
<li>1 &mu;L HSR1 BamHI + 480 </li>
+
<li>1 &mu;L iGEMJul09 </li>
-
<li>1 &mu;L HSR1 RTRv + 1149  </li>
+
<li>1 &mu;L iGEMJul10  </li>
<li>1 &mu;L Tap pol.</li>
<li>1 &mu;L Tap pol.</li>
Line 2,674: Line 2,709:
</ul></ul>
</ul></ul>
-
<ul class="ul_notebook"><li>Colony PCR 2:</li>
+
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p>
-
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li>
+
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1e/20140820_PCR_colony.png>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/a7/20140820_FAO.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li>
 +
 
 +
<li>Incubate 15 min at 70&deg;C.</li>
 +
 
 +
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li>
 +
 
 +
<li>Centrifuge 3 min at 15000 xg.</li>
 +
 
 +
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li>
 +
 
 +
<li>Centrifuge 1 min at 15000 xg. </li>
 +
 
 +
<li>Recover 1 &mu;L of supernatant. </li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Control PCR:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L template</li>
<li>1 &mu;L dNTPs</li>
<li>1 &mu;L dNTPs</li>
-
<li>1 &mu;L iGEMJul09 </li>
+
<li>1 &mu;L HSR1 clone Fw+1 </li>
-
<li>1 &mu;L iGEMJul10  </li>
+
<li>1 &mu;L HSR1 Rtrv + 1149</li>
-
<li>1 &mu;L Tap pol.</li>
+
<li>&mu;L Taq polimerase </li>
-
<li>5 &mu;L Buffer 10x</li>
+
<li>5 &mu;L Buffer 10X</li>
-
<li>39 &mu;L H2O miliQ</li>
+
<li>40 &mu;L H2O</li>
</ul></ul>
</ul></ul>
-
<ul class="ul_notebook"><li>Gene bank PCR 3 (control):</li>
+
<ul class="ul_notebook"><li>FAO1 PCR</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis gene bank miniprep </li>
+
<li>1 &mu;L template</li>
-
<li>1 &mu;L dNTPs</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li>
-
<li>1 &mu;L HSR1 BamHI + 480 </li>
+
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li>
-
<li>1 &mu;L HSR1 RTRv + 1149  </li>
+
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li>
-
<li>1 &mu;L Tap pol.</li>
+
<li>&mu;L Taq polimerase </li>
-
<li>5 &mu;L Buffer 10x</li>
+
<li>5 &mu;L Buffer 10X</li>
-
<li>39 &mu;L H2O miliQ</li>
+
<li>40 &mu;L H2O</li>
</ul></ul>
</ul></ul>
-
<ul class="ul_notebook"><li>Gene bank PCR 4:</li>
+
<p class="p_notebook">PCR parameters (35 cycles):</p>
-
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis gene bank miniprep </li>
 
-
<li>1 &mu;L dNTPs</li>
 
-
<li>1 &mu;L iGEMJul09 </li>
+
<table class="table_notebook">
-
<li>1 &mu;L iGEMJul10  </li>
+
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
-
<li>1 &mu;L Tap pol.</li>
+
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr>
-
<li>5 &mu;L Buffer 10x</li>
+
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr>
-
<li>39 &mu;L H2O miliQ</li>
+
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/c/ce/20140822_P35S_BB_FAO.png>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li>
 +
 
 +
<li>HSR1 RTRv+1149</li>
</ul></ul>
</ul></ul>
-
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p>
+
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li>
 +
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li>
 +
<li>HSR1 RTRv+1149 </li>
-
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p>
+
</ul></ul>
 +
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li>
 +
<ul class="ul_ul_notebook"><li>iGEMJul07 </li>
-
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
+
<li>iGEMJul08</li>
-
<li>PCPS2:HarFAR:T35S</li>
+
</ul></ul>
-
<li>PCPS2:EaDAcT:T35S</li>
+
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>iGEMJul09 </li>
 +
 
 +
<li>iGEMJul10</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/ac/20140825_pcps2_ta29_atr.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li>
 +
 
 +
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li>
 +
 
 +
<li>GB0486 2&alpha;2R </li>
</ul>
</ul>
-
</br><h4 class="date_notebook">08/19/2014</h4>
+
</br><h4 class="date_notebook">08/27/2014</h4>
-
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p>
+
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p>
-
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li>
+
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p>
-
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li>
 
-
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li>
+
 
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>GB parts:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li>
 +
 
 +
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li>
 +
 
 +
<li>GB0486 2&alpha;2R</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li>
 +
 
 +
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li>
</ul>
</ul>
-
</br><h4 class="date_notebook">08/20/2014</h4>
+
</br><h4 class="date_notebook">08/29/2014</h4>
-
<p class="p_notebook">We made minipreps of yesterda's culture and to check them we made digestions in silico:</p>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li>
 +
 
 +
<li>Mix it well.</li>
 +
 
 +
<li>Store at -80&deg;C.</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
Line 2,770: Line 3,079:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr>
+
</table>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4e/20140804_bb_bar_EaDAcT.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr>
</table>
</table>
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b9/20140905_Barnase_Renilla_EaDAcT.png>
 +
 +
 +
 +
<p class="p_notebook">They were not correct. We will keep trying.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/08/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p>
 +
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li>
 +
 +
<li>P35S:EaDAcT:T35S in 2&alpha;2</li>
 +
 +
<li>P35S:P19:GFP:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/10/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/11/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/12/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Note: Go to 09/16/2014</p>
 +
 +
 +
 +
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li>
 +
 +
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/13/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/15/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We stored in glycerol:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= gel digestions >
 +
 +
 +
 +
</br><h4 class="date_notebook">09/18/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p>
 +
 +
 +
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/24/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We obtained similar results.</p>
 +
 +
 +
 +
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p>
 +
 +
 +
 +
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We recultured in new media:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p>
 +
 +
 +
 +
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/02/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We collected agroinfiltred leaf samples. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/10/2014</h4>
 +
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p>
Line 2,796: Line 3,435:
-
<a name="Trichome_promoter"></a></br></br><h3 class="section_notebook">Trichome promoter</h3></br><h4 class="date_notebook">07/03/2014</h4>
+
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4>
Line 3,558: Line 4,197:
-
<img class="img_notebook" src= gel: digestions made 14/08 (wells 2 and 3)>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d5/20140814_CUP2_digestions.png>
Line 3,570: Line 4,209:
-
<p class="p_notebook">We transformed the piece(P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28º C during 2 days. </p>
+
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p>
Line 3,581: Line 4,220:
 +
 +
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p>
 +
 +
 +
 +
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p>
 +
 +
 +
 +
<p class="p_notebook">Ligation reagents:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 ul Atr&Delta;11</li>
 +
 +
<li>1.5 &mu;L 2&alpha;1</li>
 +
 +
<li>1 &mu;L Buffer ligase 10X</li>
 +
 +
<li>1 &mu;L T4</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>2.5 &mu;L H2O</li>
 +
 +
</ul></ul>
 +
 +
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 ul Atr&Delta;11/EaDAcT</li>
 +
 +
<li>1 &mu;L 2&alpha;2</li>
 +
 +
<li>1 &mu;L Buffer ligase 10X</li>
 +
 +
<li>1 &mu;L T4</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>3 &mu;L H2O</li>
 +
 +
</ul></ul>
 +
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
 +
 +
<li>PCPS2:HarFAR:T35S</li>
 +
 +
<li>PCPS2:EaDAcT:T35S</li>
 +
 +
</ul>
</br><h4 class="date_notebook">08/19/2014</h4>
</br><h4 class="date_notebook">08/19/2014</h4>
Line 3,586: Line 4,293:
-
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again. </p>
+
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p>
 +
 +
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li>
 +
 +
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li>
 +
 +
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li>
 +
 +
</ul>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1e/20140820_PCR_colony.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p>
 +
 +
 +
 +
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p>
 +
 +
 +
 +
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li>
 +
 +
<li>1 &mu;L PCPS2:HarFAR:T35S</li>
 +
 +
<li>1 &mu;L 2&Omega;1</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Buffer ligase</li>
 +
 +
<li>4 &mu;L H2O miliQ</li>
 +
 +
</ul></ul>
 +
 +
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li>
 +
 +
<li>1 &mu;L PCPS2:EaDAcT:T35S</li>
 +
 +
<li>1 &mu;L 2&Omega;2</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Buffer ligase</li>
 +
 +
<li>4 &mu;L H2O miliQ</li>
 +
 +
</ul></ul>
 +
 +
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
 +
 +
 +
 +
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p>
 +
 +
 +
 +
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p>
 +
 +
 +
 +
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">08/21/2014</h4>
 +
 +
 +
 +
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p>
 +
 +
 +
 +
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p>
 +
 +
 +
 +
 +
 +
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p>
 +
 +
 +
 +
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico made to check minipreps:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
 +
 +
 +
 +
<p class="p_notebook">All digestions were not correct. </p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">08/24/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 +
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p>
 +
 +
 +
 +
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li>
 +
 +
<li>PCPS2:GFP:TNos (Rif, Kan)</li>
 +
 +
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li>
 +
 +
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png>
 +
 +
 +
 +
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>T35S:P19:TNos </li>
 +
 +
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li>
 +
 +
<li>T35S:P19:GFP:TNos</li>
 +
 +
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p>
 +
 +
 +
 +
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">08/26/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico the check the minipreps:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/f/f1/20140826_Atr_%2B_Har.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li>
 +
 +
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>TUs with trichome promoter:</li>
 +
 +
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li>
 +
 +
</ul></ul>
 +
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
 +
 +
 +
 +
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p>
 +
 +
 +
 +
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/29/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made a ligation as follows:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li>
 +
 +
</ul>
 +
 +
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 +
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 +
<li>1.5 &mu;L 2&alpha;1</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Buffer ligase</li>
 +
 +
<li>3.5 &mu;L H2O</li>
 +
 +
</ul></ul>
 +
 +
<p class="p_notebook">Protocol followed was the same as previously done.</p>
 +
 +
 +
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p>
 +
 +
 +
 +
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b5/2014091_BB_y_Ruta_entera.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p>
 +
 +
 +
 +
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p>
 +
 +
 +
 +
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 +
<li>P35S:P19:GFP:TNos </li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li>
 +
 +
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li>
 +
 +
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li>
 +
 +
<li>PCPS2:GFP:Tnos in 2&alpha;2</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li>
 +
 +
<li>Mix it well using vortex.</li>
 +
 +
<li>Store at -80&deg;C.</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/03/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 +
<li>TNos:P19:GFP:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/a2/2014093_agrobacterium_pathway.png>
 +
 +
 +
 +
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p>
 +
 +
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li>
 +
 +
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li>
 +
 +
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies to store them in glycerol:</p>
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li>
 +
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Result analysis:</p>
 +
 +
 +
 +
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p>
 +
 +
 +
 +
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three  gens are placed in the same construction. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/06/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/08/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d1/20140908_PCR_P35S_AtrHarEa.png>
 +
 +
 +
 +
<p class="p_notebook">Both digestions were correct. </p>
 +
 +
 +
 +
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/09/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li>
 +
 +
<li>P35S:P19:GFP:TNos </li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p>
 +
 +
 +
 +
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/11/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/12/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p>
 +
 +
 +
 +
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li>
 +
 +
</ul>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/68/20140912_Pathway_complete.png>
 +
 +
 +
 +
<p class="p_notebook">Digetions were correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/15/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Digestions that were still pending from 09/12.</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/35/20140916_gb_pieces_pathway_enzymes.png>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/2/28/20140916_ge_pieces_AcPathway.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Minipreps of yesterday's culture were made:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico were the same as previouly done.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1f/20140917_gb253_pathway.png>
 +
 +
 +
 +
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p>
 +
 +
 +
 +
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p>
 +
 +
<p class="p_notebook">  </p>
 +
 +
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p>
 +
 +
 +
 +
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/18/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/19/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/9/9f/20140919_PCPS2_omegaunder_Barnase.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 +
 +
 +
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/21/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies to store them in glycerol:</p>
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p>
 +
 +
 +
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p>
 +
 +
 +
 +
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We obtained similar results.</p>
 +
 +
 +
 +
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p>
 +
 +
 +
 +
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li>
 +
 +
<li>PCPS2:EaDAcT:T35S </li>
 +
 +
</ul>
 +
 +
<img class="img_notebook" src= gel digestiones 29/09/2014>
 +
 +
 +
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We recultured in new media:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We agroinfiltred following the protocol:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p>
 +
 +
 +
 +
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/02/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We collected agroinfiltred leaf samples. </p>
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li>
 +
 +
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">07/23/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">07/24/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">07/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr>
 +
 +
</table>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">07/28/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">07/31/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/05/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Order primers for TA29 and barnase:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr>
 +
 +
</table>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/07/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>TA29 PCR parameters</li>
 +
 +
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
 +
 +
<li>35 cycles</li>
 +
 +
<li>98&deg;C, 10 s</li>
 +
 +
<li>60&deg;C, 18 s</li>
 +
 +
<li>72&deg;C, 40 s</li>
 +
 +
<li>72&deg;C, 7 min</li>
 +
 +
</ul><li>Barnase PCR parameters</li>
 +
 +
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li>
 +
 +
<li>35 cycles</li>
 +
 +
<li>98&deg;C, 10 s</li>
 +
 +
<li>63&deg;C, 18 s</li>
 +
 +
<li>72&deg;C, 40 s</li>
 +
 +
<li>72&deg;C, 7 min</li>
 +
 +
</ul></ul>
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 +
 +
 +
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/08/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 +
 +
 +
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/11/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png>
 +
 +
 +
 +
<p class="p_notebook">We still do not get PCR product.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/12/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://b2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p>
 +
 +
 +
 +
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/19/2014</h4>
 +
 +
 +
 +
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p>
 +
 +
 +
 +
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
 +
<li>1 &mu;L TA29</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>1.2 &mu;L Buffer ligase</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>6.8 &mu;L H2O miliQ</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
 +
 +
 +
 +
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png>
 +
 +
 +
 +
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/21/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p>
 +
 +
 +
 +
<p class="p_notebook">PCR conditions (35 cycles):</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/ef/20140821_Barnase.png>
 +
 +
 +
 +
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p>
 +
 +
 +
 +
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture. </p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/24/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of TA29 culture.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= gel digestiones y PCR TUs>
 +
 +
 +
 +
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/26/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
 +
<li>1 &mu;L Barnase product</li>
 +
 +
<li>1.2 &mu;L Buffer Ligase</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>6.8 &mu;L H2O</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p>
 +
 +
 +
 +
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p>
 +
 +
 +
 +
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture.</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 +
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/eb/20140817_Ta29_e040.png>
 +
 +
 +
 +
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/2/27/20140827_ta29.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 +
 +
 +
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD.  </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
 +
 +
 +
 +
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture. </p>
 +
 +
 +
 +
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e5/2014092_Barnasaa_bb.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p>
 +
 +
 +
 +
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p>
 +
 +
 +
 +
<p class="p_notebook">Master Mix (12 reactions)</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li>
 +
 +
<li>12 &mu;L primer R</li>
 +
 +
<li>12 &mu;L primer F</li>
 +
 +
<li>12 &mu;L Taq Polymerase</li>
 +
 +
<li>24 &mu;L Buffer 10X</li>
 +
 +
<li>48 &mu;L H2O</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Termocycler conditions (35 cycles):</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/7/75/2014092_Barnasa_PCR_colony.png>
 +
 +
 +
 +
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4e/20140804_bb_bar_EaDAcT.png>
 +
 +
 +
 +
<p class="p_notebook">bands were not correct, so we picked another colony.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of barnase's culture.</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b9/20140905_Barnase_Renilla_EaDAcT.png>
 +
 +
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/06/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did again Barnase minipreps. </p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4a/20140906_Barnase.png >
 +
 +
 +
 +
<p class="p_notebook">All digestions were not correct except one of them. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p>
 +
 +
 +
 +
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
 +
<li>1 &mu;L Barnase</li>
 +
 +
<li>1.2 &mu;L Buffer ligase 10X</li>
 +
 +
<li>1 ul T4 ligase</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>6.8 &mu;L H2O</li>
 +
 +
</ul>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/35/20140916_gb_pieces_pathway_enzymes.png>
 +
 +
 +
 +
<p class="p_notebook">The gel shows that the PCR product is correct. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>Barnase in pUPD</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/18/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/49/20140918_bar_colony_PCR.png>
 +
 +
 +
 +
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p>
 +
 +
 +
 +
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/19/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/7/75/20140919_omega_undercover_Bar_Colony_PCR.png>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/9/9f/20140919_PCPS2_omegaunder_Barnase.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p>
 +
 +
 +
 +
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p>
 +
 +
 +
 +
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p>
 +
 +
 +
 +
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p>
 +
 +
 +
 +
<p class="p_notebook">We made ligations of:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li>
 +
 +
<li>Barnase PCR product in pUPD</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/20/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We digested Barnase ligation with XbaI.</p>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>MoFlippers constructions</li>
 +
 +
<li>Mutated Barnase in pUPD</li>
 +
 +
</ul>
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/b/bb/20140922_Omega_under_Bar.png>
 +
 +
 +
 +
<p class="p_notebook">Transformation into E.coli:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li>
 +
 +
<li>P35S:Blue:T35S in 2&alpha;1</li>
 +
 +
<li>Barnase (XbaI digested) in pUPD</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/21/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies:</p>
 +
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li>
 +
 +
<li>P35S:Yellow:T35S in 2&alpha;1 </li>
 +
 +
</ul>
 +
 +
<ul class="ul_notebook"><li>Barnase digested with XbaI </li>
 +
 +
</ul>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
<ul class="ul_notebook"><li>Barnase in pUPD</li>
 +
 +
<li>P35S:Blue:T35S in 2&alpha;1 </li>
 +
 +
</ul>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<p class="p_notebook">We repeated again chromoproteins ligation:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li>
 +
 +
<li>1 &mu;L P35S</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 &mu;L Blue/Yellow</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Ligase buffer</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>3 &mu;L H2O</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions were run in two different gels</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/8/86/20140922_Ruta_KanRes_Omega_Barnase.png>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/69/20140922_Blue_Ruta_KanRes_Bar.png>
 +
 +
 +
 +
<p class="p_notebook">Barnase digestions were not correct.</p>
 +
 +
 +
 +
<p class="p_notebook">Blue digestions were correct</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p>
 +
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li>
 +
 +
<li>P35S:Yellow:T35S iin 2&alpha;2</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/24/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/05/20140924_Barnase.png>
 +
 +
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies to store them in glycerol:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li>
 +
 +
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li>
 +
 +
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li>
 +
 +
<li>1 &mu;L Barnase in pUPD (Mutated)</li>
 +
 +
<li>1 &mu;L TA29</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 &mu;L ligase buffer</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>1 &mu;L T4 Ligase</li>
 +
 +
<li>2.5 &mu;L H2O</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p>
 +
 +
 +
 +
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li>
 +
 +
<li>P35S:Blue:T35S in 2&alpha;2</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4a/20140925_CUP_prom_chromoproteins.png>
 +
 +
 +
 +
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture: </p>
 +
 +
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestion in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/f/ff/20140926_Barnase.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/27/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/a/a4/20140927_Blue_Agro.png>
 +
 +
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies (E.coli):</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li>
 +
 +
<li>P35S:Yellow:T35S (2&alpha;2)</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/28/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture. </p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b3/20140929_PCPS2_Blue.png>
 +
 +
 +
 +
<p class="p_notebook">They were correct. </p>
 +
 +
 +
 +
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (2&alpha;2)</li>
 +
 +
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (2&alpha;2)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= gel digestions>
 +
 +
 +
 +
<p class="p_notebook">Both digestions were correct. </p>
 +
 +
 +
 +
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p>
 +
 +
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p>
 +
 +
 +
 +
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p>
 +
 +
 +
 +
<p class="p_notebook">We send the Biosafety module to Norwich.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We agroinfiltred following the protocol:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">10/03/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p>
 +
 +
 +
 +
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/05/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li>
 +
 +
<li>P35S:Yellow:T35S (2&alpha;2)</li>
 +
 +
</ul>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/2/27/20141005_Chromoprot_agro.png>
 +
 +
<p class="p_notebook">They were correct.</p>
 +
 +
 +
 +
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/07/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p>
 +
 +
 +
 +
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/08/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p>
 +
 +
 +
 +
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other chromoproteins that could be used in plece of Blue and Yellow chromoproteins. </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S: Ant1:TNos_P35S:JFA13:TNos</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">10/09/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Yesterday's culture did not grow. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/10/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p>
 +
 +
 +
 +
<p class="p_notebook"> </p>
 +
 +
 +
 +
 +
 +
 +
 +
<p class="p_notebook"> </p>
 +
 +
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/21/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/9/9f/20140822_bb.png>
 +
 +
 +
 +
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/24/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/26/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p>
 +
 +
 +
 +
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p>
 +
 +
 +
 +
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/a/a8/20140827_bb_e0240.png>
 +
 +
 +
 +
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p>
 +
 +
 +
 +
<p class="p_notebook">Double digestions</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li>
 +
 +
<li>2.5 &mu;L NEBuffer</li>
 +
 +
<li>0.5 &mu;L BSA</li>
 +
 +
<li>0.5 &mu;L enzyme 1</li>
 +
 +
<li>0.5 &mu;L enzyme 2</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Final volume: 20 &mu;L</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p>
 +
 +
 +
 +
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p>
 +
 +
 +
 +
<p class="p_notebook">BioBricks ligations</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li>
 +
 +
<li>2 &mu;L part 2 (25 ng)</li>
 +
 +
<li>1 &mu;L T4 buffer 10X</li>
 +
 +
<li>0.5 &mu;L T4</li>
 +
 +
<li>4 &mu;L H20</li>
 +
 +
</ul>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p>
 +
 +
 +
 +
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p>
 +
 +
 +
 +
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726,  943</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/29/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046,  943</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991,  998</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046,  943</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991,  998</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/thumb/2/26/20140830_bb.png/800px-20140830_bb.png>
 +
 +
 +
 +
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/31/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/a/a6/20140901_bb.png>
 +
 +
 +
 +
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p>
 +
 +
 +
 +
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/b/b7/20140902_bb.png>
 +
 +
 +
 +
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p>
 +
 +
 +
 +
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/03/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/0/07/20140904_bb.png>
 +
 +
 +
 +
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/09/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani  broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/10/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p>
 +
 +
 +
 +
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p>
 +
 +
 +
 +
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p>
 +
 +
 +
 +
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1)</td><td class="td_notebook">1.085</td><td class="td_notebook">0.38</td><td class="td_notebook">2.854</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.036</td><td class="td_notebook">0.35</td><td class="td_notebook">2.959</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.076</td><td class="td_notebook">0.39</td><td class="td_notebook">2.759</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1)</td><td class="td_notebook">4.907</td><td class="td_notebook">0.36</td><td class="td_notebook">13.632</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">4.754</td><td class="td_notebook">0.34</td><td class="td_notebook">13.981</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">3.494</td><td class="td_notebook">0.26</td><td class="td_notebook">13.439</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">57.393</td><td class="td_notebook">0.43</td><td class="td_notebook">133.471</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">61.622</td><td class="td_notebook">0.47</td><td class="td_notebook">131.110</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">63.999</td><td class="td_notebook">0.47</td><td class="td_notebook">136.167</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">1.389</td><td class="td_notebook">0.37</td><td class="td_notebook">3.754</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.353</td><td class="td_notebook">0.37</td><td class="td_notebook">3.656</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.370</td><td class="td_notebook">0.33</td><td class="td_notebook">4.151</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr>
 +
 +
</table>
 +
 +
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p>
 +
 +
 +
 +
<p class="p_notebook">Run PCR with the following templates and primers:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<p class="p_notebook">P35s PCR parameters</p>
 +
 +
<ul class="ul_notebook"><li>98&deg;C, 2 min</li>
 +
 +
<li>35 cycles</li>
 +
 +
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li>
 +
 +
<li>67&deg;C, 18 s</li>
 +
 +
<li>72&deg;C, 40 s</li>
 +
 +
</ul><li>98&deg;C, 7 min</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">T35s PCR parameters</p>
 +
 +
<ul class="ul_notebook"><li>98&deg;C, 2 min</li>
 +
 +
<li>35 cycles</li>
 +
 +
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li>
 +
 +
<li>65&deg;C, 18 s</li>
 +
 +
<li>72&deg;C, 40 s</li>
 +
 +
</ul><li>98&deg;C, 7 min</li>
 +
 +
</ul>
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 +
 +
 +
<p class="p_notebook">We didn't obtain PCR product.</p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
</br><h4 class="date_notebook">08/08/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 +
 +
 +
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/11/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png>
 +
 +
 +
 +
<p class="p_notebook">We still do not get PCR product.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">08/12/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/19/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li>
 +
 +
<li>PCR2: P35S:Atr&Delta;11:T35S template</li>
 +
 +
</ul>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e0/20140819_p35s.png>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/5/55/20140819_t35s2C_p35s.png>
 +
 +
 +
 +
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
 +
<li>1 &mu;L T35S_BB</li>
 +
 +
<li>1.2 &mu;L Buffer ligase</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>6.8 &mu;L H20 miliQ</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
 +
 +
 +
 +
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
 +
 +
 +
 +
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p>
 +
 +
 +
 +
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/21/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p>
 +
 +
 +
 +
<p class="p_notebook">In silico digestions:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were correct. </p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li>
 +
 +
<li>HarFAR (2&alpha;2)</li>
 +
 +
<li>Atr&Delta;11 (2&alpha;1)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Conditions for 35 cycles:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 +
</table>
 +
 +
 +
 +
 +
 +
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p>
 +
 +
 +
 +
<p class="p_notebook">Conditions for 35 cycles:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
 +
</table>
 +
 +
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/c/ce/20140822_P35S_BB_FAO.png>
 +
 +
 +
 +
<p class="p_notebook">The gel shows that the template is not there.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png>
 +
 +
 +
 +
 +
 +
<p class="p_notebook">The gel showed that the PCR products were correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/06/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p>
 +
 +
 +
 +
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/aa/20140906_PCR_P35S.png>
 +
 +
 +
 +
 +
 +
<p class="p_notebook">We did not obtain any product.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/07/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b0/20140907_Barnase_PCR_35S.png>
 +
 +
 +
 +
<p class="p_notebook">We did not obtain any product.  </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/08/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d1/20140908_PCR_P35S_AtrHarEa.png>
 +
 +
 +
 +
<p class="p_notebook">We did not obtain any PCR product. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>250 ng E0040</li>
 +
 +
<li>2.5 &mu;L NEB2</li>
 +
 +
<li>0.5 &mu;L BSA</li>
 +
 +
<li>0.5 &mu;L XbaI</li>
 +
 +
<li>0.5 &mu;L PstI</li>
 +
 +
</ul>
 +
 +
 +
 +
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p>
 +
 +
 +
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li>
 +
 +
<li>MoFlipper + Atr&Delta;11</li>
 +
 +
<li>MoFlipper + HarFAR</li>
 +
 +
<li>MoFlipper + EaDAcT</li>
 +
 +
<li>MoFlipper + TA29</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/19/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/7/75/20140919_omega_undercover_Bar_Colony_PCR.png>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/9/9f/20140919_PCPS2_omegaunder_Barnase.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
<p class="p_notebook">MoFlipper cultures did not grow.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
<ul class="ul_notebook"><li>Omega undercover</li>
 +
 +
</ul>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/8/86/20140922_Ruta_KanRes_Omega_Barnase.png>
 +
 +
 +
 +
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>Omega undercover with TA29</li>
 +
 +
<li>MoFlipper with Atr&Delta;11</li>
 +
 +
<li>MoFlipper with HarFAR</li>
 +
 +
<li>MoFlipper with EaDAcT</li>
 +
 +
</ul>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/7/7d/20140923_Ta29_Moflippers.png>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p>
 +
 +
 +
 +
 +
 +
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
<p class="p_notebook"> </p>
Line 3,884: Line 7,947:
-
<img class="img_notebook" src= gel >
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d5/20140814_CUP2_digestions.png>
Line 3,912: Line 7,975:
-
<img class="img_notebook" src=gel digestiones Cup2 con p35s repetidads por Alfredo>
+
<img class="img_notebook" src=http://2014.igem.org/wiki/images/1/18/20140815_CUP2_digestion.png>
Line 3,971: Line 8,034:
</br><h4 class="date_notebook">08/20/2014</h4>
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
Line 3,986: Line 8,053:
-
<p class="p_notebook"> </p>
+
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png >
-
<a name="Biosafety"></a></br></br><h3 class="section_notebook">Biosafety</h3></br><h4 class="date_notebook">07/22/2014</h4>
 
 +
<p class="p_notebook">Digestions were correct. </p>
-
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p>
 
 +
</br><h4 class="date_notebook">08/27/2014</h4>
-
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li>
 
-
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li>
+
 
 +
<p class="p_notebook">We made ligations as follows:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li>
 +
 
 +
<li>1 &mu;L SF in 1&alpha;1</li>
 +
 
 +
<li>1 &mu;L 2&Omega;1</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Buffer ligase</li>
 +
 
 +
<li>4 &mu;L H2O</li>
 +
 
 +
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 
 +
<li>1 &mu;L CUP2</li>
 +
 
 +
<li>1 &mu;L Gal4AD</li>
 +
 
 +
<li>1 &mu;L T35S</li>
 +
 
 +
<li>1 &mu;L 2&alpha;1</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Buffer ligase</li>
 +
 
 +
<li>4 &mu;L H2O</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">Protocol was the same as previously folowed. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
 +
 
 +
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li>
</ul>
</ul>
-
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p>
+
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p>
-
</br><h4 class="date_notebook">07/23/2014</h4>
+
</br><h4 class="date_notebook">08/29/2014</h4>
-
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
+
<p class="p_notebook">We picked colonies:</p>
 +
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li>
 +
</ul>
-
</br><h4 class="date_notebook">07/24/2014</h4>
+
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p>
-
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p>
+
</br><h4 class="date_notebook">08/30/2014</h4>
 +
<p class="p_notebook">We picked colonies:</p>
-
</br><h4 class="date_notebook">07/25/2014</h4>
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
 +
</ul>
-
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p>
+
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
Line 4,036: Line 8,171:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr>
-
 
+
-
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr>
+
</table>
</table>
Line 4,048: Line 8,181:
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/42/20140830_switch.png>
-
</br><h4 class="date_notebook">07/28/2014</h4>
 
 +
<p class="p_notebook">We have to repeat digestions.</p>
-
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p>
 
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p>
-
</br><h4 class="date_notebook">07/31/2014</h4>
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
-
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p>
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p>
-
</br><h4 class="date_notebook">08/05/2014</h4>
 
 +
</br><h4 class="date_notebook">09/03/2014</h4>
-
<p class="p_notebook">Order primers for TA29 and barnase:</p>
+
 
 +
 
 +
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the following digestions:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions made in silico:</p>
Line 4,078: Line 8,227:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8º C</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8º C</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0º C</td></tr>
+
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/a2/2014093_agrobacterium_pathway.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We consider to use the miniprep number 2.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4º C</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr>
</table>
</table>
Line 4,092: Line 8,271:
-
</br><h4 class="date_notebook">08/07/2014</h4>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b9/20140905_Barnase_Renilla_EaDAcT.png>
-
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p>
+
</br><h4 class="date_notebook">09/09/2014</h4>
-
<ul class="ul_notebook"><li>TA29 PCR parameters</li>
+
<p class="p_notebook">We digested minipreps made the previous days:</p>
-
<ul class="ul_ul_notebook"><li>98º C, 2 min</li>
+
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
-
<li>35 cycles</li>
+
</ul>
-
<li>98º C, 10 s</li>
+
<p class="p_notebook">Digestions in silico:</p>
-
<li>60º C, 18 s</li>
 
-
<li>72º C, 40 s</li>
 
-
<li>72º C, 7 min</li>
+
<table class="table_notebook">
-
</ul><li>Barnase PCR parameters</li>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<ul class="ul_ul_notebook"><li>98º C, 2 min</li>
+
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr>
-
<li>35 cycles</li>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr>
-
<li>98º C, 10 s</li>
+
</table>
-
<li>63º C, 18 s</li>
 
-
<li>72º C, 40 s</li>
 
-
<li>72º C, 7 min</li>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/2/24/20140909_Digestiones_fallidas_CUP2.png>
-
</ul></ul>
 
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 
 +
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p>
-
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p>
 
-
</br><h4 class="date_notebook">08/08/2014</h4>
+
</br><h4 class="date_notebook">10/09/2014</h4>
-
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p>
+
<p class="p_notebook">To store our construction in glycerol, we picked some colonies  (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
+
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p>
-
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/66/20140910_CUP2_digestions.png>
-
</br><h4 class="date_notebook">08/11/2014</h4>
+
<p class="p_notebook">CUP2 digestions were correct.</p>
-
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61º C. </p>
+
</br><h4 class="date_notebook">09/11/2014</h4>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png>
+
<p class="p_notebook">We obtained from GB collection the following piece:</p>
-
<p class="p_notebook">We still do not get PCR product.</p>
+
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li>
 +
</ul>
 +
<p class="p_notebook">We stored in glycerol:</p>
-
</br><h4 class="date_notebook">08/12/2014</h4>
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li>
-
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60º C for TA29 and 63º C for barnase), but it still doesn't work!</p>
+
</ul>
 +
</br><h4 class="date_notebook">09/15/2014</h4>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 
 +
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p>
-
</br><h4 class="date_notebook">08/18/2014</h4>
 
 +
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li>
 +
</ul>
-
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p>
+
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p>
-
<p class="p_notebook">?? --> Se puso una PCR o no?</p>
+
</br><h4 class="date_notebook">09/16/2014</h4>
-
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p>
 
 +
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p>
-
</br><h4 class="date_notebook">08/19/2014</h4>
 
 +
<ul class="ul_notebook"><li>GB0253</li>
-
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part were recultured in liquid media.</p>
+
</ul>
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
-
</br><h4 class="date_notebook">08/20/2014</h4>
 
 +
<table class="table_notebook">
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p>
+
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr>
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/35/20140916_gb_pieces_pathway_enzymes.png >
 +
 +
 +
 +
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Minipreps of yesterday's culture were made:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>GB0256</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico were the same as previouly done.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1f/20140917_gb253_pathway.png>
 +
 +
 +
 +
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p>
 +
 +
 +
 +
<p class="p_notebook">We ligate it in pUPD vector:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>2 &mu;L GBlock</li>
 +
 +
<li>1 &mu;L pUPD</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Ligase buffer</li>
 +
 +
<li>4 &mu;L H2O</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p>
 +
 +
<ul class="ul_notebook"><li>GBlock in pUPD</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">09/24/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico:</p>
<table class="table_notebook">
<table class="table_notebook">
Line 4,216: Line 8,491:
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr>
-
 
+
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr>
+
</table>
</table>
Line 4,224: Line 8,497:
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/06/20140925_CUP_promoter_gblock_fail.png>
 +
<p class="p_notebook">Digestions have to be repeated.</p>
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4a/20140925_CUP_prom_chromoproteins.png>
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/f/fb/20140925_CUP_promoter_GBlock.png>
 +
<p class="p_notebook">Minipreps were correct. </p>
-
<a name="Translator_to_BioBricks"></a></br></br><h3 class="section_notebook">Translator to BioBricks</h3></br><h4 class="date_notebook">08/07/2014</h4>
 
-
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p>
+
</br><h4 class="date_notebook">09/29/2014</h4>
-
<p class="p_notebook">Run PCR with the following templates and primers:</p>
+
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1 &mu;L colony</li>
 +
 
 +
<li>1 &mu;L primer F</li>
 +
 
 +
<li>1 ul primer R</li>
 +
 
 +
<li>1 &mu;L dNTPs</li>
 +
 
 +
<li>1 &mu;L Taq Polymerase</li>
 +
 
 +
<li>5 &mu;L Buffer 10X</li>
 +
 
 +
<li>40 &mu;L H20</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">PCR conditions (35 cycles):</p>
Line 4,248: Line 8,545:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr>
</table>
</table>
Line 4,258: Line 8,561:
-
<p class="p_notebook">P35s PCR parameters</p>
+
<p class="p_notebook">We run a gel with PCR products:</p>
-
<ul class="ul_notebook"><li>98&deg;C, 2 min</li>
 
-
<li>35 cycles</li>
 
-
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li>
+
<img class="img_notebook" src= "http://2014.igem.org/wiki/images/3/3c/20140930_PCR_sreening_gblock.png">
-
<li>67&deg;C, 18 s</li>
 
-
<li>72&deg;C, 40 s</li>
 
-
</ul><li>98&deg;C, 7 min</li>
+
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li>
 +
 
 +
<li>Incorrect possible band: 270 bp</li>
</ul>
</ul>
-
<p class="p_notebook">T35s PCR parameters</p>
+
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p>
-
<ul class="ul_notebook"><li>98&deg;C, 2 min</li>
 
-
<li>35 cycles</li>
 
-
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li>
+
</br><h4 class="date_notebook">09/30/2014</h4>
-
<li>65&deg;C, 18 s</li>
 
-
<li>72&deg;C, 40 s</li>
 
-
</ul><li>98&deg;C, 7 min</li>
+
<p class="p_notebook">We did minipreps of yesterday's culture.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= gel digestion mini35 GBlock>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">They were correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/01/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li>
 +
 
 +
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li>
 +
 
 +
<li>0.75 ul Luciferase (75 ng/&mu;L</li>
 +
 
 +
<li>0.75 T35S (75 ng/&mu;L)</li>
 +
 
 +
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li>
 +
 
 +
<li>1 &mu;L Bsa1</li>
 +
 
 +
<li>1 &mu;L T4 Ligase </li>
 +
 
 +
<li>1 &mu;L Buffer ligase</li>
</ul>
</ul>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
+
<p class="p_notebook">Tomorrow we will transform the result.</p>
-
<p class="p_notebook">We didn't obtain PCR product.</p>
+
</br><h4 class="date_notebook">10/02/2014</h4>
-
<p class="p_notebook"> </p>
 
-
</br><h4 class="date_notebook">08/08/2014</h4>
 
 +
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p>
-
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p>
 
 +
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p>
 +
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
+
</ul>
 +
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li>
 +
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li>
-
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p>
+
<li>1 µl pDGB2?2</li>
 +
<li>1 µl BsaI</li>
 +
<li>1 µl T4 ligasa</li>
-
</br><h4 class="date_notebook">08/11/2014</h4>
+
<li>1.2 µl T10x</li>
 +
<li>4.8 µl water</li>
 +
</ul></ul>
-
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p>
 
 +
</br><h4 class="date_notebook">10/03/2014</h4>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png>
 
 +
<p class="p_notebook">We picked two colonies of each construct: </p>
-
<p class="p_notebook">We still do not get PCR product.</p>
+
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li>
 +
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li>
 +
</br><h4 class="date_notebook">10/04/2014</h4>
 +
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 +
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li>
-
</br><h4 class="date_notebook">08/12/2014</h4>
+
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li>
 +
</ul>
 +
<table class="table_notebook">
-
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr>
 +
</table>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/2/2d/20141004_CBSmini35_UTR_Luc.png>
 +
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p>
 +
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p>
-
</br><h4 class="date_notebook">08/19/2014</h4>
+
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation. </p>
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
<p class="p_notebook">We made the following binary assembly.</p>
-
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p>
+
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li>
 +
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li>
 +
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li>
-
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li>
+
<li>1 µl 2&Omega;2</li>
-
<li>PCR2: P35S:Atr&Delta;11:T35S template</li>
+
<li>1 µl BsmBI</li>
 +
 
 +
<li>1 µl T4 ligasa</li>
 +
 
 +
<li>1.2 µl Buffer T10x</li>
 +
 
 +
<li>5.8 µl H2O</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p>
 +
 
 +
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li>
 +
 
 +
</br><h4 class="date_notebook">10/07/2014</h4>
 +
 
 +
<p class="p_notebook">We picked two colonies of:</p>
 +
 
 +
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li>
 +
 
 +
</br><h4 class="date_notebook">10/08/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li>
</ul>
</ul>
 +
 +
<p class="p_notebook">Restriction analysis:</p>
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (º C)</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr>
</table>
</table>
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/5/55/20141008_cbsmini35_2omega2.png>
-
<img class="img_notebook" src= gel traductor >
 
-
<p class="p_notebook">We check the PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p>
+
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p>
 +
<p class="p_notebook"> </p>
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p>
-
<p class="p_notebook">Additionally, we prepared LB agar. </p>
 
 +
</br><h4 class="date_notebook">10/10/2014</h4>
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p>
-
</div></div>
 
-
<div id="space-margin"></div>
+
</br><h4 class="date_notebook">11/10/2014</h4>
-
</html>
 
 +
 +
<p class="p_notebook">We did minipreps of yesterday' culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr>
 +
 +
</table>
 +
 +
<p class="p_notebook"> </p>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/31/20141011_Yellow_chromoprot_CUP_agro.png>
 +
 +
 +
 +
<p class="p_notebook">They were correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">13/10/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li>
 +
 +
</ul>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr>
 +
 +
</table>
 +
 +
<p class="p_notebook"> </p>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/c/c8/20141013_luciferase_mini35.png>
 +
 +
<p class="p_notebook">They were correct.</p>
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
<p class="p_notebook"> </p>
 +
 +
 +
 +
 +
 +
 +
 +
</div>
 +
<div id="space-margin"></div>
 +
</html>
{{:Team:Valencia_UPV/footer_img}}
{{:Team:Valencia_UPV/footer_img}}

Latest revision as of 19:17, 15 October 2014


Notebook



Biosynthesis under constitutive promoter


06/09/2014

The enzymes involved in the biosynthesis pathways are AtrΔ11, HarFAR, FAO1, EaDAcT.



The design of the GBlocks was performed taking into account the following considerations:

  • Codon optimization
  • Inner restriction sites eliminations by finding synonymous mutations
  • Addition of GB endings

06/10/2014

Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD

GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).


06/11/2014

We ordered the following gBlocks and primers.

  • EaDAcT: Eunymus alatus (adapted for GB) 1127 bp
  • HarFAR: Helicoverpa armigera (adapted for GB) 1400 bp
  • AtrΔ11: Amyelois transitella (order primers for GB) 1000 bp
    • I14Jun03 AtrΔ11 F1
    • I14Jun04 AtrΔ11 R1
  • FAO1: N. benthamiana primers
    • I14Jun01 FAO1 F1
    • I14Jun02 FAO1 R1
NameSequenceLenghtTm (NTI)Tm (Phusion)
I14Jun01_FAO1_F1cgccgtctcgctcgaatggagaaaaagagccatcc3549.962.4
I14Jun02_FAO1_R1cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc4654.563.7
I14Jun03Atr_D11_F1gcgccgtctcgctcgaatggttcctaataag3154.565.3
I14Jun04Atr_D11_R1gcgccgtctcgctcgaagctcaacgtttc295769.1

06/24/2014

We thought which parts of the GB collection could we use.

Strategy 1:

  • pP35S, pT35s (x2)
  • pAtUbq10, pTAtHSP18.2

Strategy 2:

  • pP35S, pT35s
  • pP35s, pTAtHSP18.2
  • pAtUbq10, pTAtHSP18.2

Strategy 3:

  • pP35S, pT35s
  • pP35s, pTTctp
  • pAtUbq10, pTAtHSP18.2

Pieces to take from GB2.0 colection:

pDGB2α1GB0483Kan
pDGB2α2GB0484Kan
pP35sGB0030Amp
pT35sGB0036Amp
pAtUbq10GB0223Amp
pTAtHSP18.2GB0035Amp
pTTctpGB0081Amp
pUPDGB0317Amp

Later we will need:

pDGB2Ω1GB0487Smp
pDGB2Ω2GB0488Smp

Prepare plaques with antibiotics Kan, Spm, Amp


06/25/2014

Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).


06/26/2014

Culture in agar Petri dish. 2 plaques: Amp and Kan.

Minipreps with EZNA Plasmid DNA MiniKit I.

Expected digestions:

pP35s GB0030NotIBuffer: Orange2981, 1105
pT35s GB0036NotIBuffer: Orange2981, 304
pAtUbq10 GB0223NotIBuffer: Orange2981, 714
pTAtHSP18.2 GB0035NotIBuffer: Orange2981, 328
pTTctp GB0081NotIBuffer: Orange2981, 487

Electrophoresis analysis.

We got the expected bands in all cases.


07/01/2014

AtrΔ11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence.

We made a PCR amplification using the AtrΔ11 gene as a template and the oligos: R +F

Reagents needed:

  • 32.5 μL of H2O miliQ
  • 10 μL HF buffer
  • 2 μL dNTPs
  • 2.5 μL Reverse primer
  • 2.5 μL Forward primer
  • 1 μL template (AtrΔ11 gene)
  • 0.5 μL phusion (polimerase)

PCR parameters: The annealing temperature was 60°C and the extension temperature was 65°C.

Electrophoresis performed to check the PCR product, which was expected to be around 1 kb.

pUPD ligation of EaDAcT, HarFar and AtrΔ11.

Reagents needed for the reaction of ligation:

  • 1 μL pUPD
  • 1 μL PCR product/gblock product
  • 1.2 μL buffer 10x
  • 1 μL BsmBI
  • 1 μL T4 ligase
  • 6.8 μL H2O miliQ

Vfinal= 12 μL

Termocycler parameters: The ligase temperature was 16°C and the BsmBI temperature was 37°C.

As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and AtrΔ11.


07/02/2014

E. coli transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent E. coli strain (DH5α) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.

Reagents needed:

  • E. coli aliquot
  • 1.5 μL of ligation in pUPD (for each gene: EaDAcT, HarFAR, AtrΔ11)

Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 μL of SOC are added to each vial. All of them were incubated at 37°C for 1 hour.

After incubation, culture in Petri plates (always in a LAF).

2 cell-culture dishes per transformation (with Ampicillin), one with 50 μL and the other with the remaining volume.

Petri plates are incubated at 37°C for 16 h.


07/03/2014

Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 μL Amp. This step is repeated three times:

  • 3x 1 colony of EaDAcT in pUPD + LB + Amp
  • 3x 1 colony of HarFAR in pUPD + LB + Amp
  • 3x 1 colony of AtrΔ11 in pUPD + LB + Amp

All tubes are incubated at 37°C overnight in agitation.


07/04/2014

Digestions in silico using Vector NTI to check after minipreps if ligations are correct.

EaDAcTNotI2981, 1167
RsaI1876, 1343, 532, 306, 91
HarFARNotI2981, 1440
PvuII2564, 1394, 463
AtrΔ11NotI2981, 1056
BanII2570, 803, 351, 314

Digestion reagents:

  • 0.5 μL restriction enzyme
  • 2.5 μL buffer
  • 21 μL H20 (miliQ)
  • 1 μL sample

Preparation of master mixes

  • Master mix for NotI
    • 5 μL NotI
    • 25 μL Orange
    • 210 μL H20
  • Master mix for RsaI
    • 1.5 μL RsaI
    • 7.5 μL Tango
    • 63 μL H20
  • Master mix for PvuII
    • 1.5 μL PvuII
    • 7.5 μL Green
    • 63 μL H20
  • Master mix for BanII
    • 1.5 μL BanII
    • 7.5 μL Tango
    • 63 μL H20

Perform electrophoresis to check if the size of the fragments from the digestions is correct.

Comments:

  • We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.
  • For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.

07/06/2014

We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:

  • 3.5 mL LB
  • 7 μL Amp
  • 7 μL X-Gal
  • 3.5 μL IPTG (turns the tube blue if the colonies picked were blue)

07/07/2014

We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and AtrΔ11 2, 3.

Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.

EaDAcTNotI2981, 1167
RsaI1876, 1343, 532, 306, 91
HarFARNotI2981, 1440
PvuII2564, 1394, 463
AtrΔ11NotI2981, 1056
RsaI1879, 1310, 467, 327, 54

Preparation of master mixes

  • Master mix for NotI
    • 3.5 μL NotI
    • 17.5 μL Orange
    • 147 μL H20
  • Master mix for RsaI
    • 2 μL RsaI
    • 10 μL Tango
    • 84 μL H20
  • Master mix for PvuII
    • 2 μL PvuII
    • 10 μL Green
    • 84 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK. We sent AtrΔ11 (3), HarFAR (3) and EaDAcT (3) to sequence.


07/08/2014

Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.

The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an α or Ω vector.

Reagents needed for ligation:

  • 1 μL promoter 75 ng/μL
  • 1 μL terminator 75 ng/μL
  • 1 μL CDS 75 ng/μL
  • 1 μL vector α
  • 1.2 μL ligase buffer 10x
  • 1 μL T4
  • 1 μL BsaI
  • 4.2 μL H20

Total: 12 μL

Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different α vector.

Strategy Promoter-Terminator:

AtrΔ11P35sT35s40.41
HarFARP35sTatHSP39.68
EaDAcTPAtUbqTatHSP32.27

Adjust concentrations to 75 ng/μL for ligation reaction

Initial concentrations (nanodrop):

PieceConcentrationsVolumeVolume of H20 to add
PAtUpb442.6 ng/μL34 μL166.6 μL
pTatHSP235.4 ng/μL36 μL77 μL
T35s194.9 ng/μL37.5 μL60 μL
P35s454.7 ng/μL36 μL182 μL
2α157.1 ng/μL-We will need to put 1.5 μL of this one
2α2104.0 ng/μL38 μL14.7 μL
AtrΔ11359.3 ng/μL20 μL75.8 μL
HarFAR404.4 ng/μL15 μL65.9 μL
EaDAcT155.6 ng/μL10 μL10.7 μL

Ligation reaction

  • P35s:AtrΔ11:T35s in 2α1
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL AtrΔ11
    • 1.5 μL 2α1
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 3.7 μL H20
  • P35s:HarFAR:TatHSP in 2α2
    • 1 μL P35s
    • 1 μL TatHSP
    • 1 μL HarFAR
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20
  • PAtUbq:EaDAcT:TatHSP in 2α2
    • 1 μL PAtUbq
    • 1 μL TatHSP
    • 1 μL EaDAcT
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20

07/09/2014

Transformation of constructions in E. coli

We finally got the sequencing results from 07/07/2014.

  • Mutation in AtrΔ11 -> We threw away the colonies and transformed cells. We picked again white colonies.
  • HarFAR -> Sequencing correct
  • EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!

We took vectors 2Ω1 (GB0487) and 2Ω2 (GB0488) parts from the GB colection.

  • Worked in the LAF
  • Cultivated in a Petri dish with Spm
  • Let them grow for one day

Cultivate transformated cells in two Kan plaques (Kan matches vector α)

  • 50 mL transformation in one plaque
  • Rest of the culture in another (250 μL aprox)
  • Let them grow for one day

07/10/2014

Pick colonies and grow them in liquid medium.

  • 6 from AtrΔ11 (repetition because of mutation)
    • 3.5 mL LB
    • 7 μL Amp
    • 7 μL X-gal
    • 3.5 μL IPTG
  • 1 colony from 2Ω1
    • 3.5 mL LB
    • 7 μL Spm
  • 1 colony from 2Ω2
    • 3.5 mL LB
    • 7 μL Spm
  • 3 colonies from P35s:HarFAR:TatHSP
    • 3.5 mL LB
    • 7 μL Kan
  • 3 colonies from PAtUbq:EaDAcT:TatHSP
    • 3.5 mL LB
    • 7 μL Kan

Grow at 37°C in agitation overnight.

We have checked the promoters and terminators are both compatible with GB and BioBricks.

Only P35s and T35s work for both. pPnos could also work.

Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.


07/11/2014

We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes AtrΔ11 3 and 6; 2Ω1; 2Ω2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.

Additionally, we have cultured each of the colonies named above to store them.


07/14/2014

We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.

Parts