Team:Valencia UPV/Notebook wetlab.html

From 2014.igem.org

(Difference between revisions)
 
(41 intermediate revisions not shown)
Line 3: Line 3:
<style>
<style>
 +
.normal-table
 +
{
 +
border: 1px solid black;
 +
margin: 0px;
 +
padding: 15px;
 +
white-space: normal;
 +
table-layout: normal;
 +
background: transparent;
 +
 +
}
 +
 +
.normal-table tr td
 +
{
 +
border: 1px solid black;
 +
margin: 0px;
 +
padding: 15px;
 +
white-space: normal;
 +
table-layout: normal;
 +
background: transparent;
 +
 +
}
 +
 +
.normal-table tr th
 +
{
 +
border: 1px solid black;
 +
margin: 0px;
 +
padding: 15px;
 +
white-space: normal;
 +
table-layout: normal;
 +
background: transparent;
 +
 +
}
.table_notebook{
.table_notebook{
Line 87: Line 119:
-
<div align="center"><div id="cn-box" align="justify">
+
<div align="center"><div id="cn-box" align="justify"><br/>
 +
 
 +
<div align="center"><img class="img-title" alt="Notebook" src="http://2014.igem.org/wiki/images/2/2a/VUPVNotebook.png"></img></div><br/>
 +
 
<div class="box_above_notebook">
<div class="box_above_notebook">
Contents:
Contents:
-
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis">Biosynthesis</a></li> <li> <a href="#Trichome_promoter">Trichome promoter</a></li> <li> <a href="#Switch">Switch</a></li> <li> <a href="#Biosafety">Biosafety</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks">Translator to BioBricks</a></li></ul>
+
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul>
-
</div><a name="Biosynthesis"></a></br></br><h3 class="section_notebook">Biosynthesis</h3></br><h4 class="date_notebook">06/09/2014</h4>
+
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4>
Line 2,566: Line 2,601:
-
<p class="p_notebook">Starting from an agar plate containing a Candida gene bank, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p>
+
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p>
-
<p class="p_notebook">The tube containing the gene bank was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p>
+
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p>
-
<img class="img_notebook" src= gel PCR FAO1>
+
<img class="img_notebook" src= "http://2014.igem.org/wiki/images/9/95/20140814_colony_pcr_y_BBSI_test.png>
Line 2,584: Line 2,619:
-
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000)and Rif (1:1000) during 2 days at 28&deg;C. </p>
+
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p>
-
</br><h4 class="date_notebook">08/17/2014</h4>
 
-
 
-
 
-
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p>
 
-
 
-
 
-
 
-
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p>
 
-
 
-
 
-
 
-
<p class="p_notebook">Ligation reagents:</p>
 
-
 
-
 
-
 
-
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
 
-
 
-
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 
-
 
-
<li>1 &mu;L T35S</li>
 
-
 
-
<li>1 ul Atr&Delta;11</li>
 
-
 
-
<li>1.5 &mu;L 2&alpha;1</li>
 
-
 
-
<li>1 &mu;L Buffer ligase 10X</li>
 
-
 
-
<li>1 &mu;L T4</li>
 
-
 
-
<li>1 &mu;L BsaI</li>
 
-
 
-
<li>2.5 &mu;L H2O</li>
 
-
 
-
</ul></ul>
 
-
 
-
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li>
 
-
 
-
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 
-
 
-
<li>1 &mu;L T35S</li>
 
-
 
-
<li>1 ul Atr&Delta;11/EaDAcT</li>
 
-
 
-
<li>1 &mu;L 2&alpha;2</li>
 
-
 
-
<li>1 &mu;L Buffer ligase 10X</li>
 
-
 
-
<li>1 &mu;L T4</li>
 
-
 
-
<li>1 &mu;L BsaI</li>
 
-
 
-
<li>3 &mu;L H2O</li>
 
-
 
-
</ul></ul>
 
</br><h4 class="date_notebook">08/18/2014</h4>
</br><h4 class="date_notebook">08/18/2014</h4>
Line 2,648: Line 2,629:
-
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the gene bank minipreps made on 08/14/2014).</p>
+
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p>
Line 2,692: Line 2,673:
</ul></ul>
</ul></ul>
-
<ul class="ul_notebook"><li>Gene bank PCR 3 (control):</li>
+
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis gene bank miniprep </li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li>
<li>1 &mu;L dNTPs</li>
<li>1 &mu;L dNTPs</li>
Line 2,710: Line 2,691:
</ul></ul>
</ul></ul>
-
<ul class="ul_notebook"><li>Gene bank PCR 4:</li>
+
<ul class="ul_notebook"><li>genomic library PCR 4:</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis gene bank miniprep </li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li>
<li>1 &mu;L dNTPs</li>
<li>1 &mu;L dNTPs</li>
Line 2,732: Line 2,713:
-
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p>
+
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png>
-
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
 
-
<li>PCPS2:HarFAR:T35S</li>
 
-
<li>PCPS2:EaDAcT:T35S</li>
+
</br><h4 class="date_notebook">08/20/2014</h4>
-
</ul>
 
-
</br><h4 class="date_notebook">08/19/2014</h4>
 
 +
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p>
-
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p>
 
 +
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p>
-
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li>
 
-
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li>
+
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p>
-
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li>
 
-
</ul>
 
-
</br><h4 class="date_notebook">08/20/2014</h4>
+
<table class="table_notebook">
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr>
-
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p>
+
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr>
-
<table class="table_notebook">
+
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
</table>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1e/20140820_PCR_colony.png>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/a7/20140820_FAO.png>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr>
 
-
</table>
+
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p>
-
<img class="img_notebook" src= gel digestiones>
 
-
<img class="img_notebook" src= hay dos geles porque Alba puso un gel con pocillos insuficientes (en el peque\F1o est\E1 la digesti\F3n de Ea con ecorv y hindIII).>
 
 +
</br><h4 class="date_notebook">08/22/2014</h4>
-
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p>
 
 +
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p>
-
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p>
 
 +
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li>
 +
<li>Incubate 15 min at 70&deg;C.</li>
-
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p>
+
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li>
-
<p class="p_notebook"> </p>
+
<li>Centrifuge 3 min at 15000 xg.</li>
-
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li>
+
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li>
+
<li>Centrifuge 1 min at 15000 xg. </li>
-
<li>1 &mu;L PCPS2:HarFAR:T35S</li>
+
<li>Recover 1 &mu;L of supernatant. </li>
-
<li>1 &mu;L 2&Omega;1</li>
+
</ul>
-
<li>1 &mu;L BsmBI</li>
+
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p>
-
<li>1 &mu;L T4 ligase</li>
 
-
<li>1 &mu;L Buffer ligase</li>
 
-
<li>4 &mu;L H2O miliQ</li>
+
<ul class="ul_notebook"><li>Control PCR:</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L template</li>
 +
 
 +
<li>1 &mu;L dNTPs</li>
 +
 
 +
<li>1 &mu;L HSR1 clone Fw+1 </li>
 +
 
 +
<li>1 &mu;L HSR1 Rtrv + 1149</li>
 +
 
 +
<li>&mu;L Taq polimerase </li>
 +
 
 +
<li>5 &mu;L Buffer 10X</li>
 +
 
 +
<li>40 &mu;L H2O</li>
</ul></ul>
</ul></ul>
-
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li>
+
<ul class="ul_notebook"><li>FAO1 PCR</li>
-
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li>
+
<li>1 &mu;L template</li>
-
<li>1 &mu;L PCPS2:EaDAcT:T35S</li>
+
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li>
-
<li>1 &mu;L 2&Omega;2</li>
+
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li>
-
<li>1 &mu;L BsmBI</li>
+
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li>
-
<li>1 &mu;L T4 ligase</li>
+
<li>&mu;L Taq polimerase </li>
-
<li>1 &mu;L Buffer ligase</li>
+
<li>5 &mu;L Buffer 10X</li>
-
<li>4 &mu;L H2O miliQ</li>
+
<li>40 &mu;L H2O</li>
</ul></ul>
</ul></ul>
-
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
+
<p class="p_notebook">PCR parameters (35 cycles):</p>
-
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p>
+
<table class="table_notebook">
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr>
-
<p class="p_notebook">On the other hand, we were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p>
+
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr>
-
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p>
+
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 +
</table>
-
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p>
+
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/c/ce/20140822_P35S_BB_FAO.png>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li>
 +
 
 +
<li>HSR1 RTRv+1149</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li>
 +
 
 +
<li>HSR1 RTRv+1149 </li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>iGEMJul07 </li>
 +
 
 +
<li>iGEMJul08</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>iGEMJul09 </li>
 +
 
 +
<li>iGEMJul10</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p>
Line 2,866: Line 2,903:
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr>
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
Line 2,880: Line 2,917:
-
<img class="img_notebook" src= gel con solo el control>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/ac/20140825_pcps2_ta29_atr.png>
-
<p class="p_notebook">We do not close the PCR tube properly so we found our PCR product evaporated. The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p>
+
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p>
-
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p>
+
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p>
-
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p>
+
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li>
 +
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li>
 +
<li>GB0486 2&alpha;2R </li>
-
</br><h4 class="date_notebook">08/21/2014</h4>
+
</ul>
 +
</br><h4 class="date_notebook">08/27/2014</h4>
-
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p>
 
 +
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p>
-
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p>
 
 +
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p>
-
</br><h4 class="date_notebook">08/22/2014</h4>
 
 +
</br><h4 class="date_notebook">08/28/2014</h4>
-
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 
 +
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p>
-
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 
-
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
+
<ul class="ul_notebook"><li>GB parts:</li>
-
</ul>
+
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li>
-
<p class="p_notebook">Digestions in silico made to check minipreps:</p>
+
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li>
 +
 
 +
<li>GB0486 2&alpha;2R</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
Line 2,928: Line 2,973:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr>
</table>
</table>
Line 2,942: Line 2,987:
-
<img class="img_notebook" src= gel digestiones TUs>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
-
<p class="p_notebook">All digestions were not correct. </p>
+
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p>
-
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p>
+
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p>
-
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li>
+
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p>
-
<li>Incubate 15 min at 70&deg;C.</li>
 
-
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li>
 
-
<li>Centrifuge 3 min at 15000 xg.</li>
+
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li>
-
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li>
+
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li>
-
<li>Centrifuge 1 min at 15000 xg. </li>
+
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li>
-
<li>Recover 1 &mu;L of supernatant. </li>
+
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li>
</ul>
</ul>
-
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p>
+
</br><h4 class="date_notebook">08/29/2014</h4>
-
<ul class="ul_notebook"><li>Control PCR:</li>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
-
<ul class="ul_ul_notebook"><li>1 &mu;L template</li>
 
-
<li>1 &mu;L dNTPs</li>
 
-
<li>1 &mu;L HSR1 clone Fw+1 </li>
+
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p>
-
<li>1 &mu;L HSR1 Rtrv + 1149</li>
 
-
<li>&mu;L Taq polimerase </li>
 
-
<li>5 &mu;L Buffer 10X</li>
+
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p>
-
<li>40 &mu;L H2O</li>
 
-
</ul></ul>
 
-
<ul class="ul_notebook"><li>FAO1 PCR</li>
+
</br><h4 class="date_notebook">08/30/2014</h4>
-
<li>1 &mu;L template</li>
 
-
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li>
 
-
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li>
+
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p>
-
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li>
 
-
<li>&mu;L Taq polimerase </li>
 
-
<li>5 &mu;L Buffer 10X</li>
+
</br><h4 class="date_notebook">09/01/2014</h4>
-
<li>40 &mu;L H2O</li>
 
-
</ul></ul>
 
-
<p class="p_notebook">PCR parameters (35 cycles):</p>
+
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li>
 +
 
 +
<li>Mix it well.</li>
 +
 
 +
<li>Store at -80&deg;C.</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
Line 3,016: Line 3,079:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr>
+
</table>
-
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
+
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4e/20140804_bb_bar_EaDAcT.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr>
</table>
</table>
Line 3,032: Line 3,117:
-
</br><h4 class="date_notebook">08/24/2014</h4>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b9/20140905_Barnase_Renilla_EaDAcT.png>
-
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p>
+
<p class="p_notebook">They were not correct. We will keep trying.</p>
-
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
+
</br><h4 class="date_notebook">09/08/2014</h4>
-
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li>
+
 
 +
 
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p>
 +
 
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>P35S:EaDAcT:T35S in 2&alpha;2</li>
 +
 
 +
<li>P35S:P19:GFP:TNos</li>
</ul>
</ul>
-
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p>
+
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p>
-
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p>
+
</br><h4 class="date_notebook">09/10/2014</h4>
-
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li>
+
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p>
-
<li>PCPS2:GFP:TNos (Rif, Kan)</li>
 
-
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li>
 
-
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li>
+
</br><h4 class="date_notebook">09/11/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/12/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li>
</ul>
</ul>
-
</br><h4 class="date_notebook">08/25/2014</h4>
+
<p class="p_notebook">Note: Go to 09/16/2014</p>
-
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p>
+
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li>
 +
 
 +
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/13/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/15/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We stored in glycerol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p>
Line 3,074: Line 3,223:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr>
</table>
</table>
Line 3,084: Line 3,233:
-
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p>
+
<img class="img_notebook" src= gel digestions >
-
<ul class="ul_notebook"><li>T35S:P19:TNos </li>
+
</br><h4 class="date_notebook">09/18/2014</h4>
-
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li>
 
-
<li>T35S:P19:GFP:TNos</li>
 
-
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li>
+
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
</ul>
</ul>
-
<p class="p_notebook">Furthermore, we repeated the FAO1 colony PCR using a <i>C. tropicalis</i> gene bank in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p>
+
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p>
-
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li>
+
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li>
-
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li>
+
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li>
-
<li>HSR1 RTRv+1149</li>
+
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li>
-
</ul></ul>
+
</ul>
-
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li>
+
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p>
-
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li>
 
-
<li>HSR1 RTRv+1149 </li>
 
-
</ul></ul>
+
</br><h4 class="date_notebook">09/23/2014</h4>
-
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li>
 
-
<ul class="ul_ul_notebook"><li>iGEMJul07 </li>
 
-
<li>iGEMJul08</li>
+
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p>
-
</ul></ul>
 
-
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li>
 
-
<ul class="ul_ul_notebook"><li>iGEMJul09 </li>
+
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
-
<li>iGEMJul10</li>
+
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
-
</ul></ul>
+
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
-
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p>
+
</ul>
 +
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p>
-
<table class="table_notebook">
 
-
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
+
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p>
-
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr>
+
</br><h4 class="date_notebook">09/24/2014</h4>
-
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr>
 
-
</table>
+
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p>
-
<img class="img_notebook" src= gel PCR FAO1>
+
</br><h4 class="date_notebook">09/25/2014</h4>
-
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p>
+
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p>
-
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p>
+
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li>
-
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p>
+
</ul>
 +
</br><h4 class="date_notebook">09/26/2014</h4>
-
</br><h4 class="date_notebook">08/26/2014</h4>
 
 +
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p>
-
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p>
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
-
<p class="p_notebook">Digestions in silico the check the minipreps:</p>
+
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
</ul>
 +
 +
<p class="p_notebook">We obtained similar results.</p>
 +
 +
 +
 +
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p>
 +
 +
 +
 +
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We recultured in new media:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p>
 +
 +
 +
 +
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/02/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We collected agroinfiltred leaf samples. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/10/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p>
-
<table class="table_notebook">
 
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr>
 
-
</table>
 
-
<a name="Trichome_promoter"></a></br></br><h3 class="section_notebook">Trichome promoter</h3></br><h4 class="date_notebook">07/03/2014</h4>
+
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4>
Line 3,956: Line 4,197:
-
<img class="img_notebook" src= gel: digestions made 14/08 (wells 2 and 3)>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d5/20140814_CUP2_digestions.png>
Line 3,979: Line 4,220:
 +
 +
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p>
 +
 +
 +
 +
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p>
 +
 +
 +
 +
<p class="p_notebook">Ligation reagents:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 ul Atr&Delta;11</li>
 +
 +
<li>1.5 &mu;L 2&alpha;1</li>
 +
 +
<li>1 &mu;L Buffer ligase 10X</li>
 +
 +
<li>1 &mu;L T4</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>2.5 &mu;L H2O</li>
 +
 +
</ul></ul>
 +
 +
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 ul Atr&Delta;11/EaDAcT</li>
 +
 +
<li>1 &mu;L 2&alpha;2</li>
 +
 +
<li>1 &mu;L Buffer ligase 10X</li>
 +
 +
<li>1 &mu;L T4</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>3 &mu;L H2O</li>
 +
 +
</ul></ul>
 +
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li>
 +
 +
<li>PCPS2:HarFAR:T35S</li>
 +
 +
<li>PCPS2:EaDAcT:T35S</li>
 +
 +
</ul>
</br><h4 class="date_notebook">08/19/2014</h4>
</br><h4 class="date_notebook">08/19/2014</h4>
Line 3,984: Line 4,293:
-
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again. </p>
+
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li>
 +
 
 +
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li>
 +
 
 +
</ul>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1e/20140820_PCR_colony.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p>
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li>
 +
 
 +
<li>1 &mu;L PCPS2:HarFAR:T35S</li>
 +
 
 +
<li>1 &mu;L 2&Omega;1</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Buffer ligase</li>
 +
 
 +
<li>4 &mu;L H2O miliQ</li>
 +
 
 +
</ul></ul>
 +
 
 +
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li>
 +
 
 +
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li>
 +
 
 +
<li>1 &mu;L PCPS2:EaDAcT:T35S</li>
 +
 
 +
<li>1 &mu;L 2&Omega;2</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Buffer ligase</li>
 +
 
 +
<li>4 &mu;L H2O miliQ</li>
 +
 
 +
</ul></ul>
 +
 
 +
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p>
 +
 
 +
 
Line 4,002: Line 4,425:
 +
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p>
-
<p class="p_notebook">  </p>
 
-
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4>
+
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p>
-
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p>
+
</br><h4 class="date_notebook">08/22/2014</h4>
-
</br><h4 class="date_notebook">07/28/2014</h4>
+
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
-
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p>
+
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li>
-
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p>
+
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
-
<p class="p_notebook"> </p>
+
</ul>
-
<p class="p_notebook">PCR reaction reagents:</p>
+
<p class="p_notebook">Digestions in silico made to check minipreps:</p>
Line 4,030: Line 4,453:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
+
</table>
-
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr>
 
-
</table>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
-
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p>
+
<p class="p_notebook">All digestions were not correct. </p>
-
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p>
 
 +
</br><h4 class="date_notebook">08/24/2014</h4>
-
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li>
 
-
<li>CUP2-PCR2: 348 bp</li>
+
 
 +
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li>
</ul>
</ul>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/8/81/20140728_CUP2yFAO1.png>
+
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p>
-
<p class="p_notebook">Both PCR products were correct.</p>
+
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p>
 +
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li>
 +
<li>PCPS2:GFP:TNos (Rif, Kan)</li>
-
</br><h4 class="date_notebook">07/30/2014</h4>
+
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li>
 +
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li>
 +
</ul>
-
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p>
+
</br><h4 class="date_notebook">08/25/2014</h4>
-
<p class="p_notebook">Ligation of both parts of CUP2.</p>
+
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p>
-
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li>
 
-
<li>1 &mu;L CUP1-PCR1</li>
 
-
<li>1 &mu;L pUPD</li>
+
<table class="table_notebook">
-
<li>1 &mu;L BsmBI</li>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<li>1 &mu;L T4 ligase</li>
+
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr>
-
<li>1 &mu;L ligase buffer</li>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr>
-
<li>4 &mu;L H20</li>
+
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>T35S:P19:TNos </li>
 +
 
 +
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li>
 +
 
 +
<li>T35S:P19:GFP:TNos</li>
 +
 
 +
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li>
</ul>
</ul>
-
</br><h4 class="date_notebook">07/31/2014</h4>
+
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p>
-
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p>
+
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p>
-
</br><h4 class="date_notebook">08/04/2014</h4>
 
 +
</br><h4 class="date_notebook">08/26/2014</h4>
-
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p>
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p>
-
</br><h4 class="date_notebook">08/05/2014</h4>
 
 +
<p class="p_notebook">Digestions in silico the check the minipreps:</p>
-
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p>
 
 +
<table class="table_notebook">
-
</br><h4 class="date_notebook">08/06/14</h4>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr>
-
<p class="p_notebook">Minipreps of yesterday's culture were made:</p>
+
</table>
-
<ul class="ul_notebook"><li>Gal4AD</li>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/f/f1/20140826_Atr_%2B_Har.png>
 +
 
-
<li>CUP2</li>
+
 
 +
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li>
</ul>
</ul>
-
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p>
+
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p>
-
<table class="table_notebook">
+
</br><h4 class="date_notebook">08/27/2014</h4>
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr>
+
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p>
-
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr>
 
-
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr>
 
-
</table>
+
</br><h4 class="date_notebook">08/28/2014</h4>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/7/72/20140806_agro_y_cup2.png>
+
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p>
-
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p>
+
<ul class="ul_notebook"><li>TUs with trichome promoter:</li>
 +
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li>
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li>
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png>
+
</ul></ul>
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
-
<p class="p_notebook">Gal4AD piece is correct.</p>
 
 +
<table class="table_notebook">
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
</br><h4 class="date_notebook">08/11/2014</h4>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr>
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr>
-
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr>
 +
</table>
-
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p>
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
-
<p class="p_notebook">Quantification </p>
 
 +
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p>
-
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li>
 
-
<li>Gal4: 221.4 ng/&mu;L</li>
+
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p>
-
</ul>
 
-
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p>
 
 +
</br><h4 class="date_notebook">08/29/2014</h4>
-
<p class="p_notebook">The following ligations were made:</p>
 
 +
<p class="p_notebook">We made a ligation as follows:</p>
-
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li>
 
-
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li>
+
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li>
-
<li>1 &mu;L CUP2</li>
+
</ul>
-
<li>1 &mu;L Gal4AD</li>
+
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
-
<li>1 &mu;L T35S</li>
+
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
<li>1.5 &mu;L 2&alpha;1</li>
<li>1 &mu;L BsaI</li>
<li>1 &mu;L BsaI</li>
Line 4,220: Line 4,679:
<li>1 &mu;L Buffer ligase</li>
<li>1 &mu;L Buffer ligase</li>
-
<li>1 &mu;L 2&alpha;2 vector</li>
+
<li>3.5 &mu;L H2O</li>
-
 
+
-
<li>2 &mu;L H2O</li>
+
</ul></ul>
</ul></ul>
-
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li>
+
<p class="p_notebook">Protocol followed was the same as previously done.</p>
-
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 
-
<li>1 &mu;L CUP2</li>
 
-
<li>1 &mu;L Gal4AD</li>
+
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p>
-
<li>1 &mu;L T35S</li>
 
-
<li>1 &mu;L BsaI</li>
 
-
<li>1 &mu;L T4 ligase</li>
+
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p>
-
<li>1 &mu;L Buffer ligase</li>
 
-
<li>1 &mu;L 2&alpha;2 vector</li>
 
-
<li>2 &mu;L H2O </li>
+
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
-
</ul></ul>
+
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
-
</br><h4 class="date_notebook">08/12/2014</h4>
+
</ul>
 +
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p>
-
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p>
 
 +
</br><h4 class="date_notebook">08/30/2014</h4>
-
</br><h4 class="date_notebook">08/13/2014</h4>
 
 +
<p class="p_notebook">We picked colonies:</p>
-
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p>
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li>
 +
</ul>
-
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li>
+
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p>
-
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li>
+
 
 +
 
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b5/2014091_BB_y_Ruta_entera.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
<li>P35S:P19:GFP:TNos </li>
</ul>
</ul>
-
</br><h4 class="date_notebook">08/14/2014</h4>
+
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p>
-
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p>
+
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li>
 +
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li>
 +
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li>
-
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p>
+
<li>PCPS2:GFP:Tnos in 2&alpha;2</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li>
 +
 
 +
<li>Mix it well using vortex.</li>
 +
 
 +
<li>Store at -80&deg;C.</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/03/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li>
 +
 
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
<li>TNos:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
Line 4,284: Line 4,829:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr>
</table>
</table>
Line 4,298: Line 4,843:
-
<img class="img_notebook" src= gel >
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/a2/2014093_agrobacterium_pathway.png>
-
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p>
+
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p>
-
<p class="p_notebook"> </p>
 
-
</br><h4 class="date_notebook">08/15/2014</h4>
 
 +
</br><h4 class="date_notebook">09/04/2014</h4>
-
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p>
+
 
 +
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p>
 +
 
 +
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li>
 +
 
 +
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li>
 +
 
 +
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies to store them in glycerol:</p>
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li>
 +
 
 +
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Result analysis:</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three  gens are placed in the same construction. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/08/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
Line 4,316: Line 4,923:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
</table>
</table>
Line 4,326: Line 4,933:
-
<img class="img_notebook" src=gel digestiones Cup2 con p35s repetidads por Alfredo>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d1/20140908_PCR_P35S_AtrHarEa.png>
-
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p>
+
<p class="p_notebook">Both digestions were correct. </p>
-
<p class="p_notebook"> </p>
 
-
</br><h4 class="date_notebook">08/17/2014</h4>
 
 +
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p>
-
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p>
 
 +
</br><h4 class="date_notebook">10/09/2014</h4>
-
<p class="p_notebook">Ligation reagents:</p>
 
 +
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p>
-
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li>
 
-
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
+
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li>
-
<li>1 &mu;L T35S</li>
+
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li>
-
<li>1 ul Gal4AD</li>
+
<li>P35S:P19:GFP:TNos </li>
-
<li>1 &mu;L 2&alpha;2</li>
+
</ul>
-
<li>1 &mu;L CUP2</li>
+
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p>
-
<li>1 &mu;L Buffer ligase 10X</li>
 
-
<li>1 &mu;L T4</li>
 
-
<li>1 &mu;L BsaI</li>
+
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p>
-
<li>2 &mu;L H2O</li>
 
-
</ul></ul>
 
-
</br><h4 class="date_notebook">08/18/2014</h4>
+
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li>
 +
</ul>
 +
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p>
-
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p>
 
 +
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p>
-
</br><h4 class="date_notebook">08/19/2014</h4>
 
 +
</br><h4 class="date_notebook">09/11/2014</h4>
-
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p>
 
 +
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p>
-
</br><h4 class="date_notebook">08/20/2014</h4>
+
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/12/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/68/20140912_Pathway_complete.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digetions were correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/15/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions that were still pending from 09/12.</p>
Line 4,390: Line 5,047:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
</table>
</table>
Line 4,400: Line 5,057:
-
<img class="img_notebook" src= gel digestiones cup con TUs con pCPS2>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/35/20140916_gb_pieces_pathway_enzymes.png>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/2/28/20140916_ge_pieces_AcPathway.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Minipreps of yesterday's culture were made:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico were the same as previouly done.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1f/20140917_gb253_pathway.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p>
 +
 
 +
<p class="p_notebook">  </p>
 +
 
 +
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/19/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/9/9f/20140919_PCPS2_omegaunder_Barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/21/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies to store them in glycerol:</p>
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We obtained similar results.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li>
 +
 
 +
<li>PCPS2:EaDAcT:T35S </li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src= gel digestiones 29/09/2014>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured in new media:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We agroinfiltred following the protocol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We collected agroinfiltred leaf samples. </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
-
<p class="p_notebook">Digestions were correct. </p>
 
-
<p class="p_notebook"> </p>
 
-
<a name="Biosafety"></a></br></br><h3 class="section_notebook">Biosafety</h3></br><h4 class="date_notebook">07/22/2014</h4>
+
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4>
Line 4,598: Line 5,547:
-
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
+
<img class="img_notebook" src=http://b2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
Line 4,609: Line 5,558:
-
 
-
<p class="p_notebook">?? --> Se puso una PCR o no?</p>
 
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p>
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png>
Line 4,646: Line 5,597:
-
<img class="img_notebook" src=gel digestiones Bar, CUP y TUs con promotor tricomas>
+
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png>
Line 4,691: Line 5,642:
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p>
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png>
Line 4,728: Line 5,683:
-
<img class="img_notebook" src= gel Barnasa (asumo que salio bien porque purificaste la banda)>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/ef/20140821_Barnase.png>
Line 4,760: Line 5,715:
-
<img class="img_notebook" src= gel digestiones >
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
Line 4,804: Line 5,759:
 +
</br><h4 class="date_notebook">08/26/2014</h4>
 +
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p>
-
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4>
 
-
<p class="p_notebook">We have transformed and cultured the following parts from the BioBrick collection:</p>
 
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
<li>1 &mu;L Barnase product</li>
-
<ul class="ul_notebook"><li>BBa_ J23101</li>
+
<li>1.2 &mu;L Buffer Ligase</li>
-
<li>BBa_E0240</li>
+
<li>1 &mu;L T4 ligase</li>
-
<li>BBa_J23115</li>
+
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>6.8 &mu;L H2O</li>
</ul>
</ul>
-
<p class="p_notebook">All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium with chloramphenicol. </p>
+
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/eb/20140817_Ta29_e040.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/2/27/20140827_ta29.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD.  </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made minipreps of yesterday's culture. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e5/2014092_Barnasaa_bb.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Master Mix (12 reactions)</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li>
 +
 
 +
<li>12 &mu;L primer R</li>
 +
 
 +
<li>12 &mu;L primer F</li>
 +
 
 +
<li>12 &mu;L Taq Polymerase</li>
 +
 
 +
<li>24 &mu;L Buffer 10X</li>
 +
 
 +
<li>48 &mu;L H2O</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Termocycler conditions (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/7/75/2014092_Barnasa_PCR_colony.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/04/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4e/20140804_bb_bar_EaDAcT.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">bands were not correct, so we picked another colony.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of barnase's culture.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b9/20140905_Barnase_Renilla_EaDAcT.png>
 +
 
 +
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did again Barnase minipreps. </p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4a/20140906_Barnase.png >
 +
 
 +
 
 +
 
 +
<p class="p_notebook">All digestions were not correct except one of them. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1 &mu;L pUPD</li>
 +
 
 +
<li>1 &mu;L Barnase</li>
 +
 
 +
<li>1.2 &mu;L Buffer ligase 10X</li>
 +
 
 +
<li>1 ul T4 ligase</li>
 +
 
 +
<li>1 &mu;L BsmBI</li>
 +
 
 +
<li>6.8 &mu;L H2O</li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/35/20140916_gb_pieces_pathway_enzymes.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">The gel shows that the PCR product is correct. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Barnase in pUPD</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/18/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/49/20140918_bar_colony_PCR.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/19/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/7/75/20140919_omega_undercover_Bar_Colony_PCR.png>
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/9/9f/20140919_PCPS2_omegaunder_Barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We made ligations of:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li>
 +
 
 +
<li>Barnase PCR product in pUPD</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We digested Barnase ligation with XbaI.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>MoFlippers constructions</li>
 +
 
 +
<li>Mutated Barnase in pUPD</li>
 +
 
 +
</ul>
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/b/bb/20140922_Omega_under_Bar.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Transformation into E.coli:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;1</li>
 +
 
 +
<li>Barnase (XbaI digested) in pUPD</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/21/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies:</p>
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li>
 +
 
 +
<li>P35S:Yellow:T35S in 2&alpha;1 </li>
 +
 
 +
</ul>
 +
 
 +
<ul class="ul_notebook"><li>Barnase digested with XbaI </li>
 +
 
 +
</ul>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/22/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
<ul class="ul_notebook"><li>Barnase in pUPD</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;1 </li>
 +
 
 +
</ul>
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated again chromoproteins ligation:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li>
 +
 
 +
<li>1 &mu;L P35S</li>
 +
 
 +
<li>1 &mu;L T35S</li>
 +
 
 +
<li>1 &mu;L Blue/Yellow</li>
 +
 
 +
<li>1 &mu;L T4 ligase</li>
 +
 
 +
<li>1 &mu;L Ligase buffer</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>3 &mu;L H2O</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions were run in two different gels</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/8/86/20140922_Ruta_KanRes_Omega_Barnase.png>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/69/20140922_Blue_Ruta_KanRes_Bar.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Barnase digestions were not correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Blue digestions were correct</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p>
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li>
 +
 
 +
<li>P35S:Yellow:T35S iin 2&alpha;2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/24/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/05/20140924_Barnase.png>
 +
 
 +
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies to store them in glycerol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li>
 +
 
 +
<li>1 &mu;L Barnase in pUPD (Mutated)</li>
 +
 
 +
<li>1 &mu;L TA29</li>
 +
 
 +
<li>1 &mu;L T35S</li>
 +
 
 +
<li>1 &mu;L ligase buffer</li>
 +
 
 +
<li>1 &mu;L BsaI</li>
 +
 
 +
<li>1 &mu;L T4 Ligase</li>
 +
 
 +
<li>2.5 &mu;L H2O</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li>
 +
 
 +
<li>P35S:Blue:T35S in 2&alpha;2</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4a/20140925_CUP_prom_chromoproteins.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture: </p>
 +
 
 +
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestion in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/f/ff/20140926_Barnase.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Digestions were correct.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/27/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/a/a4/20140927_Blue_Agro.png>
 +
 
 +
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We picked colonies (E.coli):</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li>
 +
 
 +
<li>P35S:Yellow:T35S (2&alpha;2)</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">09/28/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture. </p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b3/20140929_PCPS2_Blue.png>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">They were correct. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (2&alpha;2)</li>
 +
 
 +
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (2&alpha;2)</li>
 +
 
 +
</ul>
 +
 
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 
 +
 
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= gel digestions>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Both digestions were correct. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p>
 +
 
 +
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We send the Biosafety module to Norwich.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We agroinfiltred following the protocol:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:P19:TNos</li>
 +
 
 +
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">10/03/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/05/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li>
 +
 
 +
<li>P35S:Yellow:T35S (2&alpha;2)</li>
 +
 
 +
</ul>
 +
 
 +
<table class="table_notebook">
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr>
 +
 
 +
</table>
 +
 
 +
 
 +
 
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/2/27/20141005_Chromoprot_agro.png>
 +
 
 +
<p class="p_notebook">They were correct.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/07/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/08/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other chromoproteins that could be used in plece of Blue and Yellow chromoproteins. </p>
 +
 
 +
 
 +
 
 +
<ul class="ul_notebook"><li>P35S: Ant1:TNos_P35S:JFA13:TNos</li>
 +
 
 +
</ul>
 +
 
 +
</br><h4 class="date_notebook">10/09/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">Yesterday's culture did not grow. </p>
 +
 
 +
 
 +
 
 +
</br><h4 class="date_notebook">10/10/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p>
 +
 
 +
 
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<p class="p_notebook"> </p>
 +
 
 +
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4>
 +
 
 +
 
 +
 
 +
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p>
Line 4,884: Line 6,747:
-
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p>
+
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p>
Line 5,014: Line 6,877:
-
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p>
+
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p>
Line 5,146: Line 7,009:
-
<p class="p_notebook">The digestion was correct. We have scheduled the interlab study for next Wednesday.</p>
+
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p>
Line 5,154: Line 7,017:
-
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (Untransformed E.coli DH5-&alpha;)were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani  broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p>
+
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani  broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p>
Line 5,170: Line 7,033:
-
<p class="p_notebook">A GloMax-Multi Detection System form Pr&Omega; fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p>
+
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p>
-
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p>
+
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p>
Line 5,180: Line 7,043:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(1)</td><td class="td_notebook">3.10E+002</td><td class="td_notebook">1.085</td><td class="td_notebook">0.38</td><td class="td_notebook">2.854</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1)</td><td class="td_notebook">1.085</td><td class="td_notebook">0.38</td><td class="td_notebook">2.854</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(2)</td><td class="td_notebook">2.96E+002</td><td class="td_notebook">1.036</td><td class="td_notebook">0.35</td><td class="td_notebook">2.959</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.036</td><td class="td_notebook">0.35</td><td class="td_notebook">2.959</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">3.08E+002</td><td class="td_notebook">1.076</td><td class="td_notebook">0.39</td><td class="td_notebook">2.759</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.076</td><td class="td_notebook">0.39</td><td class="td_notebook">2.759</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(1)</td><td class="td_notebook">1.40E+003</td><td class="td_notebook">4.907</td><td class="td_notebook">0.36</td><td class="td_notebook">13.632</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1)</td><td class="td_notebook">4.907</td><td class="td_notebook">0.36</td><td class="td_notebook">13.632</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(2)</td><td class="td_notebook">1.36E+003</td><td class="td_notebook">4.754</td><td class="td_notebook">0.34</td><td class="td_notebook">13.981</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">4.754</td><td class="td_notebook">0.34</td><td class="td_notebook">13.981</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.00E+003</td><td class="td_notebook">3.494</td><td class="td_notebook">0.26</td><td class="td_notebook">13.439</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">3.494</td><td class="td_notebook">0.26</td><td class="td_notebook">13.439</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(1)</td><td class="td_notebook">1.64E+004</td><td class="td_notebook">57.393</td><td class="td_notebook">0.43</td><td class="td_notebook">133.471</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">57.393</td><td class="td_notebook">0.43</td><td class="td_notebook">133.471</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(2)</td><td class="td_notebook">1.76E+004</td><td class="td_notebook">61.622</td><td class="td_notebook">0.47</td><td class="td_notebook">131.110</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">61.622</td><td class="td_notebook">0.47</td><td class="td_notebook">131.110</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.83E+004</td><td class="td_notebook">63.999</td><td class="td_notebook">0.47</td><td class="td_notebook">136.167</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">63.999</td><td class="td_notebook">0.47</td><td class="td_notebook">136.167</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(1)</td><td class="td_notebook">3.97E+002</td><td class="td_notebook">1.389</td><td class="td_notebook">0.37</td><td class="td_notebook">3.754</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">1.389</td><td class="td_notebook">0.37</td><td class="td_notebook">3.754</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(2)</td><td class="td_notebook">3.87E+002</td><td class="td_notebook">1.353</td><td class="td_notebook">0.37</td><td class="td_notebook">3.656</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.353</td><td class="td_notebook">0.37</td><td class="td_notebook">3.656</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">3.92E+002</td><td class="td_notebook">1.370</td><td class="td_notebook">0.33</td><td class="td_notebook">4.151</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.370</td><td class="td_notebook">0.33</td><td class="td_notebook">4.151</td></tr>
</table>
</table>
Line 5,216: Line 7,079:
<table class="table_notebook">
<table class="table_notebook">
-
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr>
-
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr>
+
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr>
 +
 
 +
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr>
</table>
</table>
-
<a name="Translator_to_BioBricks"></a></br></br><h3 class="section_notebook">Translator to BioBricks</h3></br><h4 class="date_notebook">08/07/2014</h4>
+
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4>
Line 5,333: Line 7,198:
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png>
Line 5,362: Line 7,239:
-
<img class="img_notebook" src= gel traductor >
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/e/e0/20140819_p35s.png>
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/5/55/20140819_t35s2C_p35s.png>
-
<p class="p_notebook">We check the PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p>
+
 
 +
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p>
Line 5,418: Line 7,297:
-
<img class="img_notebook" src= gel digestiones + PCR P35>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
Line 5,462: Line 7,341:
-
<img class="img_notebook" src= gel digestiones de T35S>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png>
Line 5,503: Line 7,382:
-
 
-
<img class="img_notebook" src= gel producto PCR >
 
Line 5,536: Line 7,413:
-
<img class="img_notebook" src= gel producto PCR >
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/c/ce/20140822_P35S_BB_FAO.png>
Line 5,552: Line 7,429:
-
<img class="img_notebook" src= gel digestiones y PCR TUs>
+
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png>
 +
 
 +
 
Line 5,560: Line 7,439:
-
<p class="p_notebook">We repeated the FAO1 PCR</p>
+
</br><h4 class="date_notebook">09/06/2014</h4>
 +
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p>
 +
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p>
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/aa/20140906_PCR_P35S.png>
 +
 +
 +
 +
 +
<p class="p_notebook">We did not obtain any product.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/07/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b0/20140907_Barnase_PCR_35S.png>
 +
 +
 +
 +
<p class="p_notebook">We did not obtain any product.  </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/08/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d1/20140908_PCR_P35S_AtrHarEa.png>
 +
 +
 +
 +
<p class="p_notebook">We did not obtain any PCR product. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>250 ng E0040</li>
 +
 +
<li>2.5 &mu;L NEB2</li>
 +
 +
<li>0.5 &mu;L BSA</li>
 +
 +
<li>0.5 &mu;L XbaI</li>
 +
 +
<li>0.5 &mu;L PstI</li>
 +
 +
</ul>
 +
 +
 +
 +
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p>
 +
 +
 +
 +
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li>
 +
 +
<li>MoFlipper + Atr&Delta;11</li>
 +
 +
<li>MoFlipper + HarFAR</li>
 +
 +
<li>MoFlipper + EaDAcT</li>
 +
 +
<li>MoFlipper + TA29</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/19/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/7/75/20140919_omega_undercover_Bar_Colony_PCR.png>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/9/9f/20140919_PCPS2_omegaunder_Barnase.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p>
<p class="p_notebook"> </p>
<p class="p_notebook"> </p>
 +
 +
<p class="p_notebook">MoFlipper cultures did not grow.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
<ul class="ul_notebook"><li>Omega undercover</li>
 +
 +
</ul>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/8/86/20140922_Ruta_KanRes_Omega_Barnase.png>
 +
 +
 +
 +
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>Omega undercover with TA29</li>
 +
 +
<li>MoFlipper with Atr&Delta;11</li>
 +
 +
<li>MoFlipper with HarFAR</li>
 +
 +
<li>MoFlipper with EaDAcT</li>
 +
 +
</ul>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/7/7d/20140923_Ta29_Moflippers.png>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/26/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p>
 +
 +
 +
 +
 +
 +
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
<p class="p_notebook"> </p>
 +
 +
 +
 +
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">07/28/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p>
 +
 +
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
<p class="p_notebook">PCR reaction reagents:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p>
 +
 +
 +
 +
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li>
 +
 +
<li>CUP2-PCR2: 348 bp</li>
 +
 +
</ul>
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/8/81/20140728_CUP2yFAO1.png>
 +
 +
 +
 +
<p class="p_notebook">Both PCR products were correct.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">07/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p>
 +
 +
 +
 +
<p class="p_notebook">Ligation of both parts of CUP2.</p>
 +
 +
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li>
 +
 +
<li>1 &mu;L CUP1-PCR1</li>
 +
 +
<li>1 &mu;L pUPD</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L ligase buffer</li>
 +
 +
<li>4 &mu;L H20</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">07/31/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/04/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/05/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/06/14</h4>
 +
 +
 +
 +
<p class="p_notebook">Minipreps of yesterday's culture were made:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>Gal4AD</li>
 +
 +
<li>CUP2</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/7/72/20140806_agro_y_cup2.png>
 +
 +
 +
 +
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png>
 +
 +
 +
 +
<p class="p_notebook">Gal4AD piece is correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/11/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p>
 +
 +
 +
 +
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p>
 +
 +
 +
 +
<p class="p_notebook">Quantification </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li>
 +
 +
<li>Gal4: 221.4 ng/&mu;L</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p>
 +
 +
 +
 +
<p class="p_notebook">The following ligations were made:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li>
 +
 +
<li>1 &mu;L CUP2</li>
 +
 +
<li>1 &mu;L Gal4AD</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Buffer ligase</li>
 +
 +
<li>1 &mu;L 2&alpha;2 vector</li>
 +
 +
<li>2 &mu;L H2O</li>
 +
 +
</ul></ul>
 +
 +
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 +
<li>1 &mu;L CUP2</li>
 +
 +
<li>1 &mu;L Gal4AD</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Buffer ligase</li>
 +
 +
<li>1 &mu;L 2&alpha;2 vector</li>
 +
 +
<li>2 &mu;L H2O </li>
 +
 +
</ul></ul>
 +
 +
</br><h4 class="date_notebook">08/12/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/13/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li>
 +
 +
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">08/14/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p>
 +
 +
 +
 +
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/d/d5/20140814_CUP2_digestions.png>
 +
 +
 +
 +
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
</br><h4 class="date_notebook">08/15/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/1/18/20140815_CUP2_digestion.png>
 +
 +
 +
 +
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
</br><h4 class="date_notebook">08/17/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p>
 +
 +
 +
 +
<p class="p_notebook">Ligation reagents:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 ul Gal4AD</li>
 +
 +
<li>1 &mu;L 2&alpha;2</li>
 +
 +
<li>1 &mu;L CUP2</li>
 +
 +
<li>1 &mu;L Buffer ligase 10X</li>
 +
 +
<li>1 &mu;L T4</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>2 &mu;L H2O</li>
 +
 +
</ul></ul>
 +
 +
</br><h4 class="date_notebook">08/18/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/19/2014</h4>
 +
 +
 +
 +
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/20/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src=http://2014.igem.org/wiki/images/e/e0/20140820_digestions_barnase.png >
 +
 +
 +
 +
<p class="p_notebook">Digestions were correct. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/27/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made ligations as follows:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li>
 +
 +
<li>1 &mu;L SF in 1&alpha;1</li>
 +
 +
<li>1 &mu;L 2&Omega;1</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Buffer ligase</li>
 +
 +
<li>4 &mu;L H2O</li>
 +
 +
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li>
 +
 +
<li>1 &mu;L CUP2</li>
 +
 +
<li>1 &mu;L Gal4AD</li>
 +
 +
<li>1 &mu;L T35S</li>
 +
 +
<li>1 &mu;L 2&alpha;1</li>
 +
 +
<li>1 &mu;L BsaI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Buffer ligase</li>
 +
 +
<li>4 &mu;L H2O</li>
 +
 +
</ul></ul>
 +
 +
<p class="p_notebook">Protocol was the same as previously folowed. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/28/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
 +
 +
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/29/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">08/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked colonies:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/42/20140830_switch.png>
 +
 +
 +
 +
<p class="p_notebook">We have to repeat digestions.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/01/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/02/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/03/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p>
 +
 +
 +
 +
<p class="p_notebook">We repeated the following digestions:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions made in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/a/a2/2014093_agrobacterium_pathway.png>
 +
 +
 +
 +
<p class="p_notebook">We consider to use the miniprep number 2.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/05/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/b/b9/20140905_Barnase_Renilla_EaDAcT.png>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/09/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We digested minipreps made the previous days:</p>
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/2/24/20140909_Digestiones_fallidas_CUP2.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">10/09/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">To store our construction in glycerol, we picked some colonies  (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/6/66/20140910_CUP2_digestions.png>
 +
 +
 +
 +
<p class="p_notebook">CUP2 digestions were correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/11/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We obtained from GB collection the following piece:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We stored in glycerol:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/15/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/16/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>GB0253</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico to check the minipreps:</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/35/20140916_gb_pieces_pathway_enzymes.png >
 +
 +
 +
 +
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/17/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">Minipreps of yesterday's culture were made:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>GB0256</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico were the same as previouly done.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/1/1f/20140917_gb253_pathway.png>
 +
 +
 +
 +
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/22/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p>
 +
 +
 +
 +
<p class="p_notebook">We ligate it in pUPD vector:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>2 &mu;L GBlock</li>
 +
 +
<li>1 &mu;L pUPD</li>
 +
 +
<li>1 &mu;L BsmBI</li>
 +
 +
<li>1 &mu;L T4 ligase</li>
 +
 +
<li>1 &mu;L Ligase buffer</li>
 +
 +
<li>4 &mu;L H2O</li>
 +
 +
</ul>
 +
 +
</br><h4 class="date_notebook">09/23/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p>
 +
 +
<ul class="ul_notebook"><li>GBlock in pUPD</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">09/24/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/25/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p>
 +
 +
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr>
 +
 +
</table>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/0/06/20140925_CUP_promoter_gblock_fail.png>
 +
 +
 +
 +
<p class="p_notebook">Digestions have to be repeated.</p>
 +
 +
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/4/4a/20140925_CUP_prom_chromoproteins.png>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/f/fb/20140925_CUP_promoter_GBlock.png>
 +
 +
<p class="p_notebook">Minipreps were correct. </p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">09/29/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>1 &mu;L colony</li>
 +
 +
<li>1 &mu;L primer F</li>
 +
 +
<li>1 ul primer R</li>
 +
 +
<li>1 &mu;L dNTPs</li>
 +
 +
<li>1 &mu;L Taq Polymerase</li>
 +
 +
<li>5 &mu;L Buffer 10X</li>
 +
 +
<li>40 &mu;L H20</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">PCR conditions (35 cycles):</p>
 +
 +
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr>
 +
 +
</table>
 +
 +
 +
 +
<p class="p_notebook">We run a gel with PCR products:</p>
 +
 +
 +
 +
<img class="img_notebook" src= "http://2014.igem.org/wiki/images/3/3c/20140930_PCR_sreening_gblock.png">
 +
 +
 +
 +
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li>
 +
 +
<li>Incorrect possible band: 270 bp</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">09/30/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture.</p>
 +
 +
 +
 +
<img class="img_notebook" src= gel digestion mini35 GBlock>
 +
 +
 +
 +
<p class="p_notebook">They were correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/01/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li>
 +
 +
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li>
 +
 +
<li>0.75 ul Luciferase (75 ng/&mu;L</li>
 +
 +
<li>0.75 T35S (75 ng/&mu;L)</li>
 +
 +
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li>
 +
 +
<li>1 &mu;L Bsa1</li>
 +
 +
<li>1 &mu;L T4 Ligase </li>
 +
 +
<li>1 &mu;L Buffer ligase</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Tomorrow we will transform the result.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/02/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p>
 +
 +
 +
 +
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p>
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li>
 +
 +
</ul>
 +
 +
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li>
 +
 +
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li>
 +
 +
<li>1 µl pDGB2?2</li>
 +
 +
<li>1 µl BsaI</li>
 +
 +
<li>1 µl T4 ligasa</li>
 +
 +
<li>1.2 µl T10x</li>
 +
 +
<li>4.8 µl water</li>
 +
 +
</ul></ul>
 +
 +
 +
 +
</br><h4 class="date_notebook">10/03/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked two colonies of each construct: </p>
 +
 +
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li>
 +
 +
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li>
 +
 +
</br><h4 class="date_notebook">10/04/2014</h4>
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 +
 +
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li>
 +
 +
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li>
 +
 +
</ul>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr>
 +
 +
</table>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/2/2d/20141004_CBSmini35_UTR_Luc.png>
 +
 +
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p>
 +
 +
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p>
 +
 +
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation. </p>
 +
 +
</br><h4 class="date_notebook">10/06/2014</h4>
 +
 +
<p class="p_notebook">We made the following binary assembly.</p>
 +
 +
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li>
 +
 +
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li>
 +
 +
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li>
 +
 +
<li>1 µl 2&Omega;2</li>
 +
 +
<li>1 µl BsmBI</li>
 +
 +
<li>1 µl T4 ligasa</li>
 +
 +
<li>1.2 µl Buffer T10x</li>
 +
 +
<li>5.8 µl H2O</li>
 +
 +
</ul></ul>
 +
 +
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p>
 +
 +
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li>
 +
 +
</br><h4 class="date_notebook">10/07/2014</h4>
 +
 +
<p class="p_notebook">We picked two colonies of:</p>
 +
 +
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li>
 +
 +
</br><h4 class="date_notebook">10/08/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We made minipreps of yesterday's culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Restriction analysis:</p>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr>
 +
 +
</table>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/5/55/20141008_cbsmini35_2omega2.png>
 +
 +
 +
 +
 +
 +
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p>
 +
 +
<p class="p_notebook"> </p>
 +
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p>
 +
 +
 +
 +
 +
 +
</br><h4 class="date_notebook">10/10/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">11/10/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday' culture:</p>
 +
 +
 +
 +
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li>
 +
 +
</ul>
 +
 +
<p class="p_notebook">Digestions in silico:</p>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr>
 +
 +
</table>
 +
 +
<p class="p_notebook"> </p>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/3/31/20141011_Yellow_chromoprot_CUP_agro.png>
 +
 +
 +
 +
<p class="p_notebook">They were correct.</p>
 +
 +
 +
 +
</br><h4 class="date_notebook">13/10/2014</h4>
 +
 +
 +
 +
<p class="p_notebook">We did minipreps of yesterday's culture:</p>
 +
 +
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li>
 +
 +
</ul>
 +
 +
<table class="table_notebook">
 +
 +
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr>
 +
 +
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr>
 +
 +
</table>
 +
 +
<p class="p_notebook"> </p>
 +
 +
<img class="img_notebook" src= http://2014.igem.org/wiki/images/c/c8/20141013_luciferase_mini35.png>
 +
 +
<p class="p_notebook">They were correct.</p>
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
<p class="p_notebook"> </p>
 +
 +
 +
 +
</div>
</div>
 +
<div id="space-margin"></div>
</html>
</html>
{{:Team:Valencia_UPV/footer_img}}
{{:Team:Valencia_UPV/footer_img}}

Latest revision as of 19:17, 15 October 2014


Notebook



Biosynthesis under constitutive promoter


06/09/2014

The enzymes involved in the biosynthesis pathways are AtrΔ11, HarFAR, FAO1, EaDAcT.



The design of the GBlocks was performed taking into account the following considerations:

  • Codon optimization
  • Inner restriction sites eliminations by finding synonymous mutations
  • Addition of GB endings

06/10/2014

Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD

GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).


06/11/2014

We ordered the following gBlocks and primers.

  • EaDAcT: Eunymus alatus (adapted for GB) 1127 bp
  • HarFAR: Helicoverpa armigera (adapted for GB) 1400 bp
  • AtrΔ11: Amyelois transitella (order primers for GB) 1000 bp
    • I14Jun03 AtrΔ11 F1
    • I14Jun04 AtrΔ11 R1
  • FAO1: N. benthamiana primers
    • I14Jun01 FAO1 F1
    • I14Jun02 FAO1 R1
NameSequenceLenghtTm (NTI)Tm (Phusion)
I14Jun01_FAO1_F1cgccgtctcgctcgaatggagaaaaagagccatcc3549.962.4
I14Jun02_FAO1_R1cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc4654.563.7
I14Jun03Atr_D11_F1gcgccgtctcgctcgaatggttcctaataag3154.565.3
I14Jun04Atr_D11_R1gcgccgtctcgctcgaagctcaacgtttc295769.1

06/24/2014

We thought which parts of the GB collection could we use.

Strategy 1:

  • pP35S, pT35s (x2)
  • pAtUbq10, pTAtHSP18.2

Strategy 2:

  • pP35S, pT35s
  • pP35s, pTAtHSP18.2
  • pAtUbq10, pTAtHSP18.2

Strategy 3:

  • pP35S, pT35s
  • pP35s, pTTctp
  • pAtUbq10, pTAtHSP18.2

Pieces to take from GB2.0 colection:

pDGB2α1GB0483Kan
pDGB2α2GB0484Kan
pP35sGB0030Amp
pT35sGB0036Amp
pAtUbq10GB0223Amp
pTAtHSP18.2GB0035Amp
pTTctpGB0081Amp
pUPDGB0317Amp

Later we will need:

pDGB2Ω1GB0487Smp
pDGB2Ω2GB0488Smp

Prepare plaques with antibiotics Kan, Spm, Amp


06/25/2014

Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).


06/26/2014

Culture in agar Petri dish. 2 plaques: Amp and Kan.

Minipreps with EZNA Plasmid DNA MiniKit I.

Expected digestions:

pP35s GB0030NotIBuffer: Orange2981, 1105
pT35s GB0036NotIBuffer: Orange2981, 304
pAtUbq10 GB0223NotIBuffer: Orange2981, 714
pTAtHSP18.2 GB0035NotIBuffer: Orange2981, 328
pTTctp GB0081NotIBuffer: Orange2981, 487

Electrophoresis analysis.

We got the expected bands in all cases.


07/01/2014

AtrΔ11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence.

We made a PCR amplification using the AtrΔ11 gene as a template and the oligos: R +F

Reagents needed:

  • 32.5 μL of H2O miliQ
  • 10 μL HF buffer
  • 2 μL dNTPs
  • 2.5 μL Reverse primer
  • 2.5 μL Forward primer
  • 1 μL template (AtrΔ11 gene)
  • 0.5 μL phusion (polimerase)

PCR parameters: The annealing temperature was 60°C and the extension temperature was 65°C.

Electrophoresis performed to check the PCR product, which was expected to be around 1 kb.

pUPD ligation of EaDAcT, HarFar and AtrΔ11.

Reagents needed for the reaction of ligation:

  • 1 μL pUPD
  • 1 μL PCR product/gblock product
  • 1.2 μL buffer 10x
  • 1 μL BsmBI
  • 1 μL T4 ligase
  • 6.8 μL H2O miliQ

Vfinal= 12 μL

Termocycler parameters: The ligase temperature was 16°C and the BsmBI temperature was 37°C.

As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and AtrΔ11.


07/02/2014

E. coli transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent E. coli strain (DH5α) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.

Reagents needed:

  • E. coli aliquot
  • 1.5 μL of ligation in pUPD (for each gene: EaDAcT, HarFAR, AtrΔ11)

Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 μL of SOC are added to each vial. All of them were incubated at 37°C for 1 hour.

After incubation, culture in Petri plates (always in a LAF).

2 cell-culture dishes per transformation (with Ampicillin), one with 50 μL and the other with the remaining volume.

Petri plates are incubated at 37°C for 16 h.


07/03/2014

Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 μL Amp. This step is repeated three times:

  • 3x 1 colony of EaDAcT in pUPD + LB + Amp
  • 3x 1 colony of HarFAR in pUPD + LB + Amp
  • 3x 1 colony of AtrΔ11 in pUPD + LB + Amp

All tubes are incubated at 37°C overnight in agitation.


07/04/2014

Digestions in silico using Vector NTI to check after minipreps if ligations are correct.

EaDAcTNotI2981, 1167
RsaI1876, 1343, 532, 306, 91
HarFARNotI2981, 1440
PvuII2564, 1394, 463
AtrΔ11NotI2981, 1056
BanII2570, 803, 351, 314

Digestion reagents:

  • 0.5 μL restriction enzyme
  • 2.5 μL buffer
  • 21 μL H20 (miliQ)
  • 1 μL sample

Preparation of master mixes

  • Master mix for NotI
    • 5 μL NotI
    • 25 μL Orange
    • 210 μL H20
  • Master mix for RsaI
    • 1.5 μL RsaI
    • 7.5 μL Tango
    • 63 μL H20
  • Master mix for PvuII
    • 1.5 μL PvuII
    • 7.5 μL Green
    • 63 μL H20
  • Master mix for BanII
    • 1.5 μL BanII
    • 7.5 μL Tango
    • 63 μL H20

Perform electrophoresis to check if the size of the fragments from the digestions is correct.

Comments:

  • We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.
  • For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.

07/06/2014

We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:

  • 3.5 mL LB
  • 7 μL Amp
  • 7 μL X-Gal
  • 3.5 μL IPTG (turns the tube blue if the colonies picked were blue)

07/07/2014

We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and AtrΔ11 2, 3.

Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.

EaDAcTNotI2981, 1167
RsaI1876, 1343, 532, 306, 91
HarFARNotI2981, 1440
PvuII2564, 1394, 463
AtrΔ11NotI2981, 1056
RsaI1879, 1310, 467, 327, 54

Preparation of master mixes

  • Master mix for NotI
    • 3.5 μL NotI
    • 17.5 μL Orange
    • 147 μL H20
  • Master mix for RsaI
    • 2 μL RsaI
    • 10 μL Tango
    • 84 μL H20
  • Master mix for PvuII
    • 2 μL PvuII
    • 10 μL Green
    • 84 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK. We sent AtrΔ11 (3), HarFAR (3) and EaDAcT (3) to sequence.


07/08/2014

Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.

The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an α or Ω vector.

Reagents needed for ligation:

  • 1 μL promoter 75 ng/μL
  • 1 μL terminator 75 ng/μL
  • 1 μL CDS 75 ng/μL
  • 1 μL vector α
  • 1.2 μL ligase buffer 10x
  • 1 μL T4
  • 1 μL BsaI
  • 4.2 μL H20

Total: 12 μL

Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different α vector.

Strategy Promoter-Terminator:

AtrΔ11P35sT35s40.41
HarFARP35sTatHSP39.68
EaDAcTPAtUbqTatHSP32.27

Adjust concentrations to 75 ng/μL for ligation reaction

Initial concentrations (nanodrop):

PieceConcentrationsVolumeVolume of H20 to add
PAtUpb442.6 ng/μL34 μL166.6 μL
pTatHSP235.4 ng/μL36 μL77 μL
T35s194.9 ng/μL37.5 μL60 μL
P35s454.7 ng/μL36 μL182 μL
2α157.1 ng/μL-We will need to put 1.5 μL of this one
2α2104.0 ng/μL38 μL14.7 μL
AtrΔ11359.3 ng/μL20 μL75.8 μL
HarFAR404.4 ng/μL15 μL65.9 μL
EaDAcT155.6 ng/μL10 μL10.7 μL

Ligation reaction

  • P35s:AtrΔ11:T35s in 2α1
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL AtrΔ11
    • 1.5 μL 2α1
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 3.7 μL H20
  • P35s:HarFAR:TatHSP in 2α2
    • 1 μL P35s
    • 1 μL TatHSP
    • 1 μL HarFAR
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20
  • PAtUbq:EaDAcT:TatHSP in 2α2
    • 1 μL PAtUbq
    • 1 μL TatHSP
    • 1 μL EaDAcT
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20

07/09/2014

Transformation of constructions in E. coli

We finally got the sequencing results from 07/07/2014.

  • Mutation in AtrΔ11 -> We threw away the colonies and transformed cells. We picked again white colonies.
  • HarFAR -> Sequencing correct
  • EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!

We took vectors 2Ω1 (GB0487) and 2Ω2 (GB0488) parts from the GB colection.

  • Worked in the LAF
  • Cultivated in a Petri dish with Spm
  • Let them grow for one day

Cultivate transformated cells in two Kan plaques (Kan matches vector α)

  • 50 mL transformation in one plaque
  • Rest of the culture in another (250 μL aprox)
  • Let them grow for one day

07/10/2014

Pick colonies and grow them in liquid medium.

  • 6 from AtrΔ11 (repetition because of mutation)
    • 3.5 mL LB
    • 7 μL Amp
    • 7 μL X-gal
    • 3.5 μL IPTG
  • 1 colony from 2Ω1
    • 3.5 mL LB
    • 7 μL Spm
  • 1 colony from 2Ω2
    • 3.5 mL LB
    • 7 μL Spm
  • 3 colonies from P35s:HarFAR:TatHSP
    • 3.5 mL LB
    • 7 μL Kan
  • 3 colonies from PAtUbq:EaDAcT:TatHSP
    • 3.5 mL LB
    • 7 μL Kan

Grow at 37°C in agitation overnight.

We have checked the promoters and terminators are both compatible with GB and BioBricks.

Only P35s and T35s work for both. pPnos could also work.

Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.


07/11/2014

We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes AtrΔ11 3 and 6; 2Ω1; 2Ω2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.

Additionally, we have cultured each of the colonies named above to store them.


07/14/2014

We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.

PartsRetriction enzymeExpected Bands
PAtUbq:EaDAcT:TatHSP in 2α2HindIII6322, 1722, 736, 221
P35s:HarFAR:TatHSP in 2 α2HindIII6322, 1794, 221
AtrΔ11NotI2961, 1056
2Ω1BamHI6652, 382, 239
2Ω2EcoRV6652, 621

Preparation of master mixes

  • Master mix for HindIII
    • 3.5 μL HindIII
    • 17.5 μL Red
    • 147 μL H20
  • Master mix for NotI
    • 1.5 μL NotI
    • 7.5 μL Orange
    • 63 μL H20
  • Mix for EcoRV
    • 0.5 μL EcoRV
    • 2.5 μL Red
    • 21 μL H20
  • Mix for BamHI
    • 0.5 μL PvuII
    • 2.5 μL Green
    • 21 μL H20

We run the electrophoresis gel to check if this time we have done it correctly.

Everything was OK except the AtrΔ11 (3), which had some partial digestion. It was the reason we sent AtrΔ11 (6) to sequence.


07/15/2014

We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation.

Reagents needed for the reaction of ligation (Total volume = 12 μL):

  • P35s:AtrΔ11:T35s in 2α1
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL AtrΔ11
    • 1.5 μL 2α1
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 3.7 μL H20
  • P35s:HarFAR:T35s in 2α2
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL HarFAR
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20
  • P35s:EaDAcT:T35s in 2α2
    • 1 μL P35s
    • 1 μL T35s
    • 1 μL EaDAcT
    • 1 μL 2α2
    • 1.2 μL ligase buffer 10x
    • 1 μL T4
    • 1 μL BsaI
    • 4.2 μL H20

Note: Concentrations were previously adjusted to 75 ng/μL. Only the AtrΔ11 was adjusted from 250.2 ng/μL.

Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:

  • Amp
    • pAtrΔ11 (6)
    • pEaDAcT (3)
    • pHarFAR (3)
  • Kan
    • P35:HarFAR:TatHSP in 2α2 (3)
    • PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)

07/16/2014

Storage in glycerol of the HarFAR (GB1018), AtrΔ11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2α2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2α2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve.

The procedure is to mix 700 μL of culture with 300 μL of glycerol 50%, spin it and store it in the -80°C.


07/17/2014

Pick 3 colonies of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.

Digestions in silico.

Transcriptional unitsRestriction enzymesExpected bands
P35s:AtrΔ11:T35sEcoRI6323, 2269
NcoI390, 8202
P35s:HarFAR:T35sHindIII933, 6322, 1722
NcoI8587, 390
P35s:EaDAcT:T35sHindIII6322, 2366
EcoRV683, 8021

Preparation of reagents needed for genomic extraction of Candida tropicalis for FAO1.


07/18/2014

Mistake in P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.


07/19/2014

Minipreps of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.

Transcriptional unit DNA concentration
P35s:AtrΔ11:T35s (1)164 ng/μL
P35s:AtrΔ11:T35s (2)168 ng/μL
P35s:AtrΔ11:T35s (3)147.4 ng/μL
P35s:HarFAR:T35s (1)125.3 ng/μL
P35s:HarFAR:T35s (2)114.5 ng/μL
P35s:HarFAR:T35s (3)140.3 ng/μL
P35s:EaDAcT:T35s (1)144.2 ng/μL
P35s:EaDAcT:T35s (2)137.9 ng/μL
P35s:EaDAcT:T35s (3)128.5 ng/μL
Stuffer fragment135.5 ng/μL
2Ω1196.8 ng/μL
2Ω2175.4 ng/μL

Digestions of P35s:AtrΔ11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.

All digestions were correct except P35s:EaDAcT:T35s (2).

Ligation in Ω vectors.

  • P35s:AtrΔ11:T35s + P35s:HarFAR:T35s in 2Ω1
    • 1 μL P35s:AtrΔ11:T35s (75 ng/μL)
    • 1 μL P35s:HarFAR:T35s (75 ng/μL)
    • 1 μL 2Ω1 (75 ng/μL)
    • 1 μL BsmBI (5-10 ud)
    • 1 μL T4 ligase (5-10 ud)
    • 1 μL buffer ligase (3 ud)
    • 4 μL H20
  • P35s:EaDAcT:T35s in 2Ω2
    • 1 μL stuffer fragment (75 ng/μL)
    • 1 μL P35s:EaDAcT:T35s (75 ng/μL)
    • 1 μL 2Ω2 (75 ng/μL)
    • 1 μL BsmBI (5-10 ud)
    • 1 μL T4 ligase (5-10 ud)
    • 1 μL buffer ligase (3 ud)
    • 4 μL H20

Set the reaction: 25 cycles x (37°C 2 min, 16°C 5 min).

Omega vectors include a resistance to spectinomycin.


07/20/2014

Transform and grow in Petri dishes yesterday's ligations: P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 and P35S:EaDAcT:T35S in 2Ω2.


07/21/2014

Pick colonies of P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1 (3) and P35S:EaDAcT:T35S in 2Ω2 (2).


07/22/2014

We made minipreps of yesterday's liquid culture. Selected tubes:

  • P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω1(Tubes 1, 2 and 3)
  • P35S:EaDAcT:T35S in 2Ω2 (Tubes 1 and 2)

Digestions in silico made to check the transcriptional units:

Transcriptional unitsRestriction enzymeExpected bands
P35S:AtrΔ11:T35S+P35S:HarFAR:T35S in 2Ω1EcoRV9307, 2251
BamHI6652, 4906
P35S:EaDAcT:T35S in 2Ω2EcoRV6652, 1044, 817, 683
NcoI8806, 390

Digestion master mixes:

  • Master mix for NotI
    • 1.5 μL NotI
    • 7.5 μL Orange buffer
    • 63 μL H20
  • Master mix for NcoI
    • 1.5 μL NcoI
    • 7.5 μL Tango buffer
    • 63 μL H20
  • Master mix for BamHI
    • 2 μL BamHI
    • 10 μL Green buffer
    • 84 μL H20
  • Master mix for EcoRV
    • 4 μL EcoRV
    • 20 μL Red buffer
    • 168 μL H20

Note: Trichome promoter digestion preparation included.

All digestions were correct except the transcriptional unit of EaDAcT in 2Ω2 (P35s:EaDAcT:T35S).

Miniprep quantification:

PieceTubeConcentration (ng/μL)Volume (μL)
P35S:EaDAcT:T35S in 2Ω21350.733
P35S:EaDAcT:T35S in 2Ω22271.133
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω11306.331
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω12296.628
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω13246.033

All of the pieces named above were adjusted at 75 ng/μL.

Piece Tube numberFinal Volume (μL)Volume to be added (μL)
P35S:EaDAcT:T35S in 2Ω21154.30121.3
P35S:EaDAcT:T35S in 2Ω22119.3086.30
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω11126.6095.60
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω12110.7082.70
P35S:AtrΔ11:T35S + P35S:HarFAR:T35S in 2Ω13108.2475.20

As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step.

We transformed the same TU in a E. coli competent strain (DH5α). Then, the transformants were cultured in LB media and Spm and stored at 37°C overnight.

Finally, in order to obtain the FAO1 gene, we want to extract the Candida tropicalis genome, so we have picked a colony of C. tropicalis. To check the extraction protocol, we used a yeast previously tested, Saccharomyces cerevisiae. We have cultured C. tropicalis in YPD media and S. cerevisiae in YPDA media at 28 °C (5 mL).


07/23/2014

Candida genome extraction

Saccharomyces cerevisiae is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.

Cultures measured at 600 nm:

  • S. cerevisiae Abs = 1.07
  • C. tropicalis Abs = 0.39

S. cerevisiae is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of S. cerevisiae culture. The mix has to grow at 28 °C until the exponential phase is reached.

The absorbance was measured again:

  • S. cerevisiae Abs = 0.52
  • C. tropicalis Abs = 0.40

Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:

  • Grow yeast in 2 or 5 mL YPD to exponential phase.
  • Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).
  • Wash once with 1 mL sterile water.
  • Resuspend cells in 200 μL protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 μL beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37°C for 1-2 h and finally resuspend by turning the cups.
  • Add 200 μL of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).
  • Incubate at 65 °C for 20 min and cool inmediately on ice.
  • Add 200 μL of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice.
  • Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.
  • Add 2 μL RNase A (10 mg/mL) and incubate at 37 °C for 30 min.
  • Add 600 μL isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s).
  • Remove the supernatant and wash with 70% ethanol (10 min at room temperature).
  • Centrifuge (13,000 rpm, 30 s) and remove the supernatant.
  • Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 μL TE-buffer.
  • Store chromosomal DNA at 4 °C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).

Genomic quantification:

OrganismConcentration
S. cerevisiae72.2 ng/μL
C. tropicalis1397.1 ng/μL

Electrophoresis made to check the extraction quality was correct.

We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.

We picked EaDAcT colonies.


07/24/2014

The genomic quality of both organisms (C. tropicalis and S. cerevisiae) was checked in an agarose gel again.

We got the Candida genome band, however, the Saccharomyces genome band was not present.

Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate.

Miniprep digestions are going to be done tomorrow.


07/25/2014

Digestions in silico made for checking yesterday's minipreps:

Pieces/TURestriction enzymeExpected bands
P35S:EaDAcT:T35S in 2Ω2EcoRV6652, 1044, 817, 683
NcoI8806, 390

Digestion master mixes:

  • Master mix for NotI
    • 2 μL NotI
    • 10 μL Orange buffer
    • 84 μL H20
  • Master mix for NcoI
    • 2 μL NcoI
    • 10 μL Tango buffer
    • 84 μL H20
  • Master mix for BglII
    • 2 μL BglII
    • 10 μL Orange buffer
    • 84 μL H20
  • Master mix for EcoRV
    • 1.5 μL EcoRV
    • 7.5 μL Red buffer
    • 63 μL H20

An agarose gel was made to check the transcriptional unit and the other pieces:

All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.


07/28/2014

Once the Candida tropicalis genome DNA is obtained, the FAO1 gene can be amplified by PCR.

PCR reaction reagents:

  • FAO1-PCR1
    • Genomic 0.5 μL
    • Buffer HF (5X) 10.0 μL
    • dNTPs 2.0 μL
    • Oligo R (JUL06) 2.5 μL
    • Oligo F (JUL05) 2.5 μL
    • Phusion polymerase 0.5 μL
    • H2O 32.0 μL
  • FAO1-PCR2
    • Genomic 0.5 μL
    • Buffer HF (5X) 10.0 μL
    • dNTPs 2.0 μL
    • Oligo R (JUL08) 2.5 μL
    • Oligo F (JUL07) 2.5 μL
    • Phusion polymerase 0.5 μL
    • H2O 32.0 μL

Annealing temperatures

  • FAO1-PCR1: 59 °C
  • FAO1-PCR2: 64 °C

PCR products were checked using an electrophoresis. Expected bands:

  • FAO1-PCR1: 1157 bp
  • FAO1-PCR2: 1015 bp

Both FAO1 PCR products were not correct.

As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:

ReagentVolume
Trichome promoter1 μL
GFP1 μL
TNos1 μL
BsaI1 μL
p2α21 μL
T4 ligase1 μL
Ligase buffer1 μL
H2O3 μL
Total Volume10 μL

07/29/2014

As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:

ReagentFAO1-PCR1FAO1-PCR2
C. tropicalis genome2.5 μL2.5 μL
HF Buffer30 μL30 μL
dNTPs10 μL10 μL
Oligo R12.5 μL12.5 μL
Oligo F12.5 μL12.5 μL
Phusion polymerase1.5 μL1.5 μL
H2O181 μL181 μL

PCR temperatures, 25 cycles:

StepTemperature (°C)Time
Initialization982 min
Denaturation9820 s
Annealing50, 55, 60, 65??
Extension7245 s
Final elongation727 min

We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product.

EaDAcT Transcriptional Unit (TU) transformation

Using an electrocompetent E. coli strain (DH5α) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2Ω2), the mix is electroporated at 1500 V. Then, 300 μL of SOC are added and stored at 37°C with agitation.


07/30/2014

Transform P35s:AtrΔ11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2α2) in Agrobacterium tumefaciens strain C58. Introduce 1 μL of construction in a C58 aliquot. Electroporate at 1440V. Add 500 μL of LB in the LAF. Keep 2 hours in agitation at 28°C. Grow 20 μL and 200 μL in solid medium containing kanamicin and rifampicin. Incubate overnight at 28°C.

Pick colonies of P35s:EaDAcT:T35s in 2Ω2.


08/01/2014

Pick colonies from Agrobacterium tumefaciens and grow them in liquid medium for two days at 28°C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for α vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for Ω vectors.


07/31/2014

Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2Ω2

Additionally, we recultured in petri dish with its respective antibiotic (Spm).

Digestions in silico made for checking minipreps:

Pieces/TURestriction enzymeExpected bands
P35S:EaDAcT:T35S in 2Ω2NcoI8806, 390
EcoRV6652, 1044, 817, 683

Digestion mixes:

  • Master mix for EcoRV:
    • 3 μL EcoRV
    • 15 μL Red buffer
    • 126 μL H20
  • Master mix for NcoI:
    • 1.5 μL NcoI
    • 7.5 μL Tango buffer
    • 63 μL H2O

Note: We made master mixes because digestions were made simultaneously with the trichome promoter part.

An agarose gel was made to check the transcriptional unit.

Minipreps of P35s:EaDAcT:T35s in 2Ω2 (1) went correctly.

Miniprep results were quantified and then adjusted at 75 ng/μL:

Pieces/TUTubeConcentration (ug/μL)Initial volume (μL)Final Volume (μL)
P35S:EaDAcT:T35S in 2Ω2(1)141.43531
P35S:EaDAcT:T35S in 2Ω22)3.933(Discarded)

Ligation of P35s:EaDAcT:T35s in 2Ω2 with P35s:AtrΔ11:T35+P35s:HarFAR:T35 in 2Ω1.

  • 1 μL P35s:AtrΔ11:T35+P35s:HarFAR:T35 in 2Ω1
  • 1 μL P35s:EaDAcT:T35s in 2Ω2
  • 1 μL 2α1
  • 1 μL BsaI
  • 1 μL T4 ligase
  • 1 μL ligase buffer
  • 4 μL H20

08/04/2014

Transformation of P35s:EaDAcT:T35s in 2Ω2 P35s:AtrΔ11:T35+P35s:HarFAR:T35 in E. coli.

Agrobacterium liquid cultures (5 mL LB)

  • P35s:GFP:p19:Tnos (Spm, Tet, Rif)
  • Empty C58 Agrobacterium tumefaciens (Rif)
  • 2x P35s:EaDAcT:T35s in 2α2 (Rif, Kan)
  • 2x P35s:AtrΔ11:T35+P35s:HarFAR:T35 in 2Ω1 (Rif, Spm)

08/05/2014

Pick colonies from P35s:AtrΔ11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2α1.

Repeat PCR of FAO1.

  • FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64°C)
    • 1.75 μL Candida tropicalis genomic
    • 35 μL HF buffer (5x)
    • 7 μL dNTPs
    • 8.75 μL oligo forward (Jul07)
    • 8.75 μL oligo reverse (Jul08)
    • 1.05 μL Phusion polymerase
    • 112.7 H20

PCR temperatures, 35 cycles:

StepTemperature (°C)Time
Initialization982 min
Denaturation9810 s
Annealing54, 59, 6455 s
Extension7255 s
Final elongation727 min
  • FAO1-PCR2: touchdown PCR
    • 0.5 μL Candida tropicalis genomic
    • 10 μL HF buffer (5x)
    • 2 μL dNTPs
    • 2.5 μL oligo forward (Jul09)
    • 2.5 μL oligo reverse (Jul10)
    • 0.5 μL Phusion polymerase
    • 32 μL H20

PCR temperatures, 35 cycles:

StepTemperature (°C)Time
Initialization985 min
Denaturation9810 s
Annealing69.5 (descending 0.5 per cycle) 20 s
Extension7255 s
Final elongation727 min

It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.


08/06/14

Minipreps of yesterday's culture were made:

  • TU AtrΔ11 + TU HarFAR + TU EaDAcT

Additionally, we made Agrobacterium' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)

  • TU AtrΔ11 + TU HarFAR in 2Ω1
  • P35S:EaDAcT:T35S in 2Ω2

FAO1 PCR was repeated (this time using a different primers aliquot).

  • FAO1-PCR1:
    • 0.5 μL Candida tropicalis genomic
    • 10 μL HF buffer (5x)
    • 2 μL dNTPs
    • 2.5 μL oligo forward (Jul07)
    • 2.5 μL oligo reverse (Jul08)
    • 0.5 μL Phusion polymerase
    • 32 μL H20
  • FAO2-PCR1:
    • 0.5 μL Candida tropicalis genomic
    • 10 μL HF buffer (5x)
    • 2 μL dNTPs
    • 2.5 μL oligo forward (Jul09)
    • 2.5 μL oligo reverse (Jul10)
    • 0.5 μL Phusion polymerase
    • 32 μL H20

PCR temperatures, 35 cycles:

StepTemperature (°C)Time
Initialization982 min
Denaturation9810 s
Annealing59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) 20 s
Extension7255 s
Final elongation727 min

Digestions made in silico to check minipreps:

E. coli

Pieces/TUResriction enzymesBufferExpected Bands
TU AtrΔ11+ TU HarFAR + TU EaDAcT in 2α1EcoRIOrange7428, 6323
TU AtrΔ11+ TU HarFAR + TU EaDAcT in 2α1BglIIOrange11175, 2576

A. tumefaciens

Pieces/TUResriction enzymesBufferExpected Bands
TU AtrΔ11 + TU HarFAR in 2Ω1EcoRVRed9307, 2251
TU AtrΔ11 + TU HarFAR in 2Ω1BamHIGreen6652, 4906
TU EaDAcT in 2α2EcoRVRed8021, 683
TU EaDAcT in 2α2HindIIIRed6322, 2382

Digestion master mixes:

  • Master mix for NotI:
    • 2.5 μL NotI
    • 12.5 μL Orange buffer
    • 105 μL H20
  • Master mix for RsaI:
    • 2 μL NcoI
    • 10 μL Tango buffer
    • 84 μL H2O

Note: We made master mixes because digestions were made simultaneously with the switch part.

We made different mixes for Agrobacterium samples because we think that minipreps are not as good as it is expected.

  • Agrobacterium sample mix:
    • 0.5 μL Restriction enzyme
    • 2.5 μL Buffer
    • 5 μL Miniprep sample
    • 17 μL H2O

Digestions in A. tumefaciens.

FAO1 PCR product.

All digestions and TU AtrΔ11+ TU HarFAR + TU EaDAcT in 2α1 were correct. PCR products were not correct or absent again.

As digestions were correct, we recultured Agrobacterium in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 μL of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000).

CultureAntibiotic
P35:GFP:P19:TNosSpm, Tet, Rif
Agrobacterium (as a control)Rif
P35S:EaDAcT:T35S Rif, Kan
P35S:AtrΔ11:T35S + P35S:HarFAR:T35SRif, Spm

Recultured media was grown at 28 °C overnight (around 16 h).


08/07/2014

Agroinfiltration in Nicotiana benthamiana.

  • Agrobacterium control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)
  • TU AtrΔ11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)
  • TU AtrΔ11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)

Agroinfiltration protocol consists of:

  • Centrifuge the cultures 15 min 3000 rpm and discard supernatant.
  • 5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 μL acetosyringone solution 200 mM (19.62 mg, DMSO 500 μL; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.
  • Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.
  • Mix the cultures, keeping all of them in the same proportions.
  • Proceed to agroinfiltration.

08/08/2014

In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of Candida tropicalis (C981 ng/μL and pYEP C98 28.2 ng/μL). These primers amplify for the gene HSR1.

Name Sequence Tm
HSR1 RTRv+1149TTTGTCTTGCAACAGGTCCA56°C
HSR1 clone Fw+1 ATGAGTAAGAAAAGCAACAGTACC54°C
HSR1 fw-BamHI+480GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT49°C (annealing)
HSR1 clone RV+stopCTAATTTTCTTCTTTTTCAATAGTAACTATCC51°C

Possibility of primer combinations:

AHSR1 fw-BamHI+480HSR1 RTRv+114968749°C
CHSR1 clone Fw+1HSR1 clone RV+stop2187-
BHSR1 RTRv+1149HSR1 clone Fw+1 116854°C

We amplified the genomic of C. tropicalis and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52°C). C primer combination was not used due to the length of the spected band.

PCR parameters

  • 94°C, 3 min
  • 35 cycles
    • 94°C, 30 s
    • 49 or 52°C, 15 s
    • 72°C, 90 s
  • 72°C, 7 min

PCR products were not present. It probably did not work because we added to much buffer.


08/11/2014

We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/μL.

PCRs wih Taq polimerase:

  • 1 μL Template
  • 1.5 μL dNTPs
  • 1 μL Forward primer
  • 1 μL Reverse primer
  • 1 μL Taq pol.
  • 5 Buffer 10X
  • 39.5 μL H2O
PCRTemplateF primerR primer
1pUbiquitina HSRI-CDS col.6HSR1 BamHI + 480HSR1 RTRev + 1149
2pUbiquitina HSRI-CDS col.6HSR1 RTRv + 1149HSR1 Fw + 1
3C. tropicalis genomeHSRI-CDS col.6HSR1 BamHI + 480HSR1 Rtrev + 1149
4C. tropicalis genomeHSR1 RTRv + 1149HSR1 Fw + 1

PCR conditions:

  • 94°C 3 min
  • 35 cycles
    • 94°C 30 s
    • 49°C 15 s
    • 72°C 90 s
  • 72°C 7 min

We had amplification in our positive controls. Our C. tropicalis genome may be wrong. Therefore Jesús Muñoz provided us with a new Candida tropicalis (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in E. coli.


08/12/2014

PHEROMONE ANALYSIS


PONER ENLACE DE LA WIKI

To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:

  • 2 leaves from P35s:GFP:P19:Tnos
  • 2 leaves from TU AtrΔ11+TU HarFAR and P35s:GFP:P19:Tnos
  • 2 leaves from TU AtrΔ11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos
  • 1 leaf from a wild type plant

Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80°C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.

  • 94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)
  • 97,0 mg of TU AtrΔ11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)
  • 118,7 mg of TU AtrΔ11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)
  • 100,0 mg of wild type leaf

Then 150 μL of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.

EDTA 500mM preparation:

Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.

After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.


PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol

Analysis was performed overnight.


08/13/2014

First results of the analysis were obtained. The analysis proved that our plant was successfuly producing the desired pheromones in high concentration. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal.

As shown in the figure, the leaf agroinfiltrated with TU AtrΔ11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression.

In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU AtrΔ11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.

In this figure, an unexprected peak present in the leaf infiltrated with TU AtrΔ11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of C. tropicalis search is still in progress.

The rest of the samples were prepared for the GC-MS analysis.

The samples were weighted, introduced in the vial and added with EDTA and CaCl2.

  • 94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)
  • 102,4 mg of TU AtrΔ11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)
  • 92,0 mg of TU AtrΔ11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)

Results of the replicae analysis are shown below:

In this replica, the sample with the TU AtrΔ11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.

In this replica, the sample with the TU AtrΔ11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.

In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.


08/14/2014

We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample.

We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.

Colony PCR protocol (Taq Polimerase):

  • 1 colony (C. tropicalis)
  • 1.5 μL dNTPs
  • 1 μL Forward Primer
  • 1 μL Reverse Primer
  • 1 μL Taq Polimerase
  • 5 μL Buffer 10X
  • 39.5 μL H2O miliQ

Primers used as a control: HSR1 + 480 and RTRv + 1149.

Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R.

Thermocycler conditions, 35 cycles:

StepTemperature (°C)Time
Initialization943 min
Denaturation9430 s
Annealing4915 s
Extension721 min
Final elongation727 min

Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 μL) was mixed with 5 mL of LB media and Amp (2:1000).

The tube containing the genomic library was grown at 28°C for 1 hour. Then, we made minipreps.

The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well.


08/15/2014

We transformed the whole pathway (P35S:AtrΔ11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2α1) into Agrobacterium tumefaciens (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28°C.


08/18/2014

We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).

PCR conditions:

  • Colony PCR 1 (control):
    • 1 colony (C. tropicalis)
    • 1 μL dNTPs
    • 1 μL HSR1 BamHI + 480
    • 1 μL HSR1 RTRv + 1149
    • 1 μL Tap pol.
    • 5 μL Buffer 10x
    • 39 μL H2O miliQ
  • Colony PCR 2:
    • 1 colony (C. tropicalis)
    • 1 μL dNTPs
    • 1 μL iGEMJul09
    • 1 μL iGEMJul10
    • 1 μL Tap pol.
    • 5 μL Buffer 10x
    • 39 μL H2O miliQ
  • genomic library PCR 3 (control):
    • 1 μL C. tropicallis genomic library miniprep
    • 1 μL dNTPs
    • 1 μL HSR1 BamHI + 480
    • 1 μL HSR1 RTRv + 1149
    • 1 μL Tap pol.
    • 5 μL Buffer 10x
    • 39 μL H2O miliQ
  • genomic library PCR 4:
    • 1 μL C. tropicallis genomic library miniprep
    • 1 μL dNTPs
    • 1 μL iGEMJul09
    • 1 μL iGEMJul10
    • 1 μL Tap pol.
    • 5 μL Buffer 10x
    • 39 μL H2O miliQ

PCR conditions were the same as those used on 08/14/2014


08/20/2014

We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one C. tropicalis colony and we introduced them into a vial containing 30 μL SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90°C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 μL vial. That was our PCR template.

We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).

PCR conditions using Phusion polimerase (35 cycles):

StepTemperature (°C)Time
Initialization983 min
Denaturation985 s
Annealing4910 s
Extension7220 s
Final elongation727 min

We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work.


08/22/2014

We did again a yeast genomic extraction (C. tropicalis), but this time we changed the protocol:

  • Pick 8 colonies of C. tropicalis growth in YPD media and resuspend them with 100 μL of solution (200 mM LiOAc and SDS 1%).
  • Incubate 15 min at 70°C.
  • Add 300 μL of ethanol 96%. Then, vortex the solution.
  • Centrifuge 3 min at 15000 xg.
  • Discard the superatant and resuspend the pellet (precipitated DNA) with 100 μL TE.
  • Centrifuge 1 min at 15000 xg.
  • Recover 1 μL of supernatant.

Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control.

  • Control PCR:
    • 1 μL template
    • 1 μL dNTPs
    • 1 μL HSR1 clone Fw+1
    • 1 μL HSR1 Rtrv + 1149
    • μL Taq polimerase
    • 5 μL Buffer 10X
    • 40 μL H2O
  • FAO1 PCR
  • 1 μL template
    • 1 μL dNTPs
    • 1 μL iGEMJul09_FAO1_PCR2F
    • 1 μL iGEMJul10_FAO1_PCR2R
    • μL Taq polimerase
    • 5 μL Buffer 10X
    • 40 μL H2O

PCR parameters (35 cycles):

StepTemperature (°C)Time
Initialization943 min
Denaturation9430 s
Annealing4915 s
Extension7290 s
Final elongation727 min

08/25/2014

We repeated the FAO1 colony PCR using a C. tropicalis genomic library in E. coli. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:

  • PCR 1 (Annealing temperature 49°C)
    • HSR1 Fw_BamHI+480
    • HSR1 RTRv+1149
  • PCR 2 and 3 (Annealing temperature 54°C)
    • HSR1 clone Fw+1
    • HSR1 RTRv+1149
  • PCR 4 and 5 (Annealing temperature 50°C)
    • iGEMJul07
    • iGEMJul08
  • PCR 6 (Annealing temperature 56°C)
    • iGEMJul09
    • iGEMJul10

PCR conditions with Taq polimerase (35 cycles):

StepTemperature (°C)Time
Initialization943 min
Denaturation9430 s
Annealing491:30 min
Extension721:30 min
Final elongation727 min

The electrophoresis gel shows that PCRs have not yielded any product.

We grown pieces from the GB collection in liquid medium:

  • GB0490 2Ω2R
  • GB0160 P35S:Renilla:TNos_P35S:P19:TNos
  • GB0486 2α2R

08/27/2014

We picked colonies of GB parts and we recultured them in liquid media.

We cultured C. tropicalis in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.


08/28/2014

We made minipreps of yesterday's liquid culture:

  • GB parts:
    • GB0490 2Ω2R
    • GB0160 P35S:Renilla:TNos_P35S:P19:TNos
    • GB0486 2α2R

Digestions in silico to check the minipreps:

PieceRestriction enzymeExpected bands
GB0490 NotI4453, 1532, 1290
GB0160HindIII4090, 2579, 788
EcoRV4601, 2475, 381
GB0486NotI4124, 1532, 1290

GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration.

We repeated again a genomic extraction (C. tropicalis) following the same protocols.

We picked colonies and recultured them in liquid media in order to preservate them with glycerol.

  • P35S:AtrΔ11:T35S in 2α1
  • SF_P35S:EaDAcT:T35S in 2Ω2
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S in 2Ω1
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2α1

08/29/2014

We repeated GB0160 digestions and we found that the piece is correct.

We observed agroinfiltered leaves and we took samples of them.


08/30/2014

We stored liquid media cultured on 08/28/2014 in glycerol.


09/01/2014

We picked colonies in order to store them in glycerol:

  • SF_P35S:EaDAcT:T35S in 2Ω2

09/02/2014

We stored in glycerol at -80°C cultures grown yesterday.

  • Add 300 μL glycerol (50%) and 700 μL of liquid culture.
  • Mix it well.
  • Store at -80°C.

09/04/2014

We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2Ω2) agar plates and we want to store it in glycerol correctly.

Digestions in silico:

PieceRestriction enzymeExpected bands
SF_P35S:EaDAcT:T35EcoRV6652, 1044, 817 683
NotI8806, 390

We did not obtain the expected bands, we will try again picking another colony.


09/05/2014

We did minipreps and the expected digestion's result was:

PieceRestriction enzymeExpected bands
P35:EaDacT:T35SEcoRV6600, 1000, 800, 700
NcoI8800, 400

They were not correct. We will keep trying.


09/08/2014

We picked A. tumefaciens colonies containing the following TU:

  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2α1
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S in 2Ω1
  • P35S:EaDAcT:T35S in 2α2
  • P35S:P19:GFP:TNos

Cultures were grown at 28°C during 2 days.


09/10/2014

To store our construction SF_P35S:EaDAcT:T35S in 2Ω2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly.


09/11/2014

We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.


09/12/2014

We made minipreps of yesterday's culture:

  • SF_P35S:EaDAcT:T35S (2Ω2)

Note: Go to 09/16/2014

Additionally, we agroinfiltrated the following constructions:

  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos
  • P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)

The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.


09/13/2014

We recultured A. tumefacies with P35S:AtrΔ11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media.


09/15/2014

We stored in glycerol:

  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2α1

09/16/2014

Additional digestions that were still pending from 09/12:

PieceRestriction enzymeExpected bands
SF_P35SEaDAcTEcoRV6600, 1000, 800, 700
NcoI8800, 400

09/18/2014

Following the protocol we agroinfiltrated the following mixtures:

  • P35S:P19:GFP:TNos (control)
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos

We collected agroinfiltered N. benthamiana leaf samples.

  • P35S:P19:GFP:TNos (as a control)
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct)
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)

They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.


09/23/2014

We collected agroinfiltered N. benthamiana leaf samples.

  • P35S:P19:GFP:TNos (control)
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos
  • PCPS2:AtrΔ11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos

Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80°C. Some of the samples were analyzed by CEQA.

We picked A. tumefaciens colonies containing the TU to agroinfilter.


09/24/2014

We refreshed A. tumefaciens cultures to agroinfilter N. benthamiana leaves.


09/25/2014

Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:

  • P35S:P19:TNos
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S
  • P35S:AtrΔ11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S

09/26/2014

We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):

  • P35S:P19:TNos
  • P35S:AtrΔ11: