Team:USyd-Australia/Notebook/Primers
From 2014.igem.org
Primers |
Name | Sequence (5'-3') | Theoretical Tm | Purpose |
---|---|---|---|
iGEM16 | GAGTGCCACCTGACGTCTAAGAAACC | 60.9C | For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM VF2 primer |
iGEM25 | CCCTGATTCTGTGGATAACCGTATTACCG | 60.0C | For BioBrick sequencing, amplification by PCR, or junction PCR. Alternative to iGEM VR primer |
iGEM1401 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1402 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1403 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1404 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1405 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1406 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1407 | CTATATCTATGATCTCGCAGTCTCC | 53.8C | PCR primers over the junction between aacC1 (G block) and pSB1C3 vector, for validation of successful G block insertion by PCR screening |
iGEM1408 | GCCTTTTGCTCACATGTTCTTTC | 55.2C | PCR primers over the junction between aacC1 (G block) and pSB1C3 vector, for validation of successful G block insertion by PCR screening |
iGEM1409 | GTTTTTTTGGATGGAGTGAAACGATGGCGATTG | 61.7C | Amplification of iGEM-IntI1 gBlock forward primer |
iGEM1410 | TGACACCTTGCCCTTTTTTGCCG | 60.9C | Amplification of iGEM-IntI1 gBlock reverse primer |
iGEM1411 | GTTTTTTTGGATGGAGTGAAACGATGGCGATTG | 61.7C | Gblock primers for IntI1 in pSAM-R |
iGEM1412 | TGACACCTTGCCCTTTTTTG | 53.9C | Gblock primers for IntI1 in pSAM-R |
iGEM1413 | GACATTGCCGTCACTGCGTC | 59.1C | Junction primers for IntI1 in pSAM-R |
iGEM1414 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | Junction primers for IntI1 in pSAM-R | |
iGEM1415 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | Junction primers for IntI1 in pSAM-R | |
iGEM1416 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | Junction primers for IntI1 in pSAM-R | |
iGEM1417 | AAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAG | 67.6C | Linearisation of pSB1C3, containing full BioBrick prefix and suffix |
iGEM1418 | AAACTCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGC | 66.9C | Linearisation of pSB1C3, containing full BioBrick prefix and suffix |
iGEM1419 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1420 | xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx | ||
iGEM1421 | GGGAATTCAAATCTAGAGACACCATCG | 57.1C | Amplification of LacI-Plac-AttI gBlock forward primer |
iGEM1422 | CCTGCAGTTTACTAGTTTTGCCTAACTTTGTTTTAG | 59.4C | Amplification of LacI-Plac-AttI gBlock forward primer |
iGEM1423 | CAGGCTTTACACTTTATGCTTCCG | 56.3C | lacI-Plac-attI RHJ-F right hand junction forward primer (use with iGEM25) |
iGEM1424 | AATGTAATTCAGCTCCGCCATC | 55.5C | lacI-Plac-attI LHJ-R left hand junction reverse primer (use with iGEM16) |
iGEM1425 | AAATCTAGATGGCGCGGCTTAACTCAGGTGTTAGGCTTAGGAGGCTCAAGTATGGGCAT | 70.7C | For making aacC1 gene cassettes from Tn1696. Use with iGEM1426. |
iGEM1426 | AAAACTAGTGGCGTCGGCTTGGACGAATTGTTAGGCTTAGGTGGCGGTACTTGGGTC | 71.4C | For making aacC1 gene cassettes from Tn1696. Use with iGEM1425. |
iGEM1427 | TTTTCTAGAGTTTGATGTTATGGAGCAGCAACG | 60.2C | For making aacC1 gene cassettes from Tn1696. Use with iGEM1428. Alternative to iGEM1424. |
iGEM1428 | TTTACTAGTGCAAAAAGGCAGCAATTATGAGCC | 60.9C | For making aacC1 gene cassettes from Tn1696. Use with iGEM1427. Alternative to iGEM1426. |
NVC71 | CTAAGAATCCATAGTCCAACTCC | 52.4C | aadB gene, rvs primer for junction screen |
NVC92b | CACGCAAGACCTCAACCTTTTCC | 58.6C | aadB gene, rvs primer for junction screen |
NVC158 | GATACCTTGTGCGGCTATGTCTG | 57.6C | pUS41/44, left of cloning site |
NVC159 | GCCGCCTTGGGCCGGGTGATGTC | 69.2C | pUS41/44, right of cloning site |