Team:SJTU-BioX-Shanghai/Parts

From 2014.igem.org

(Difference between revisions)

Latest revision as of 23:41, 17 October 2014

Parts

We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool ready for potential scientific or engineering use.
      Those BioBricks are divided into four groups.
      1. BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.
      2. BioBricks in USB are our designed sequences. They can help us easily and quickly insert our target sequence and make a whole part.
      3. BioBricks in Application are our complete parts.
      4. BioBricks in New TAL are our newly designed TAL parts, which are robust and perform better in Golden Gate method.

Basic Parts

USB

Application

New TAL

<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts>

Basic Parts

Review previous parts

ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (BBa_K771002, SJTU-BioX-Shanghai)

Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (BBa_K771002, SJTU-BioX-Shanghai)

mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (BBa_E1010, Antiquity )

FL3-TALE(BBa_K1453300)

Figure 2.3.1 Diagram of FL3-TALE

This is a TALE protein with a flexible linker 3 before it.

Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.

Connector

We have four types of connector.

Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion,
pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy

pBluescript II KS(+) ScaI deletion (BBa_K1453901)

pBluescript II KS(+) EcoRV deletion (BBa_K1453001)

pBluescript II KS(+)_3_copy (BBa_K1453003)

pBluescript II KS(+)_5_copy (BBa_K1453004)

Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.

ssDsbA-mRFP-Lgt-TAL1-His Tag(BBa_K1453005)

Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag

The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.

TAL1-His Tag(BBa_K1453007)

Figure 2.3.4 Diagram of TAL1-His Tag

This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.

The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.

USB

We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.

TAL USB(BBa_K1453000)

Figure 2.3.5 Diagram of TAL USB

We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.

Enzyme USB(BBa_K1453400)(BBa_K1453401)

In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker.

Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI

The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site.

On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.

When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.

TAL_USB-His Tag(BBa_K1453006)

Figure 2.3.7 Diagram of TAL_USB-His Tag

In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.

When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)

ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag(BBa_K1453402)

Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag

This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.

ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag(BBa_K1453403)

Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag

This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.

Enzyme USB(BsmAI)-TAL_USB-His Tag(BBa_K1453406)

Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag

This part is the combination of BBa_K1453401 and BBa_K1453006.

Enzyme USB(AarI)-TAL_USB-His Tag(BBa_K1453407)

Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag

This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.

Application

We chose some functional enzymes and inserted them into connectees
We want to prove that our connectees and connectors system can successfully achieve our designed function in the end.

ssDsbA-Lgt-pykF-TAL1-His Tag(BBa_K1453404)

Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag

This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.

ssDsbA-Lgt-poxB-TAL1-His Tag(BBa_K1453405)

Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag

This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB

pykF-TAL1-His Tag(BBa_K1453408)

Figure 2.3.14 Diagram of pykF-TAL1-His Tag

This part is used in our application test free in the cytoplasm.

This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.

poxB-TAL1-His Tag(BBa_K1453409)

Figure 2.3.15 Diagram of poxB-TAL1-His Tag

This part is used in our application test free in the cytoplasm.

This part is based on the BBa_1453006 and BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB

New TAL

New TAL with better sticky ends(BBa_K1453500) (501) (502) (503) (504) (505) (506)

We design seven new sticky ends which get the least score when judging the similarity.
If you want to know how we design these ends, please go to see our project-Part3 TAL improve.

PART-left:
…CTGACCCCGGAGACG

PART1(150bp):
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG

PART2(219bp):
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG

PART3(262bp):
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG

PART4(224bp):
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA
GACG

PART5(194bp):
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA
TCGGCGGCAAACAGGCACTCGATGAGACG

PART6(249bp):
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG
TGCAACGCCTCTTGCCAGTTTTAGAGACG

PART-right:
CGTCTCATTTTGTGTCAGGCCCACGGA...

The recognition sequence of the TALE protein:

TCGATATCAAGC

iGEM014 SJTU-BioX-Shanghai

@@ Line 3: / Line 3: @@
 {{Template:Team:SJTU-BioX-Shanghai/top-nav}}
 {{Template:Team:SJTU-BioX-Shanghai/article}}
+{{Template:Team:SJTU-BioX-Shanghai/preview}}
 <html>
 <style type="text/css">
-   .header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/7/7c/SJTU14_project.png");}
+#groupparts {
+    width: 100%;
+text-align: center; margin-left: auto; margin-right: auto;
+background:#FFF;}
+#groupparts table{visibility:visible;}
+   .header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}
+ .projtile {
+     margin-right:1.167%;
+     margin-left:1.167%;
+     width:31%;}
+#passage{
+     width:100%;}
+#passage p{
+     padding:4%;}
+#subtitleyjn2{
+     margin-left:40%;}
 </style>
 <div class="content">
-  <article class="post__article">
-			<div class="body" style="white-space:pre-wrap; line-break:strict;"><p class="s1"><span class="c1">四个改造质粒的</span>part<span class="c1">介绍：</span></p><p class="s2 s3"><span class="c2">1.</span><span class="c3">pBlue</span><span class="c3">script II KS(+) ScaI deletion</span><span class="c3">  </span></p><p class="s1"><span class="c3">2</span><span class="c4">、</span><span class="c3">pBlue</span><span class="c3">script II KS(+) EcoRV deletion</span></p><p class="s1"><span class="c3">3</span><span class="c4">、</span><span class="c3">pBlue</span><span class="c3">script II KS(+)  3 copy</span><span class="c3"> TTCGATATCAAGCT</span></p><p class="s1"><span class="c3">4</span><span class="c4">、</span><span class="c3">pBlue</span><span class="c3">script II KS(+)  5 copy</span><span class="c3"> TTCGATATCAAGCT</span></p><p class="s2"> </p><p class="s2 s4"><span class="c5">1.</span><span class="c6">Vector</span></p><p class="s2 s5">We used <span class="c3">pBlue</span><span class="c3">script II KS(+) </span>as our origin vector and then transformed it into the Connector of our desire.</p><p class="s6"><span class="c7"><span style="display:inline-block;text-indent:0px;vertical-align:baseline;width:34.583em;"><img src="images/image1.jpg" alt="C:\Users\FlyFreedom\Desktop\pBluescript_II_KS(+)_1x.png" style="width:34.583em;"/></span></span></p><p class="s7 s8"><span class="c8">Figure 1  Vector map of </span><span class="c9">pBluescript II KS(+)</span></p><p class="s7 s9"> </p><p class="s7 s10"><span class="c10">This is the sequence of </span><span class="c3">pBluescript II KS(+):</span></p><p class="s6"><span class="c11">CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAG</span><span class="c12">G^AA</span><span class="c13">T</span><span class="c14">T^C</span><span class="c15">GAT^ATC</span><span class="c16">AAGC</span><span class="c17">T</span><span class="c11">TATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGAT</span><span class="c17">T</span><span class="c18">TTGGTCATGAGA</span><span class="c17">T</span><span class="c11">TATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTC</span><span class="c17">T</span><span class="c18">GTGACTGGTG</span><span class="c19">AG</span><span class="c20">T</span><span class="c21">^ACT</span><span class="c11">CAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCAC</span></p><p class="s6"><span class="c22">(Restriction site for </span><span class="c23">EcoRI </span><span class="c22">is marked with blue, restriction site for </span><span class="c24">EcoRV</span><span class="c23"> </span><span class="c22">is marked with red, restriction site for </span><span class="c25">ScaI </span><span class="c22">is marked with green. The </span><span class="c26">TAL recognition sequences</span><span class="c22"> are highlighted with yellow while the start </span><span class="c27">T</span><span class="c22"> base and end </span><span class="c27">T</span><span class="c22"> base are grey.)  </span></p><p class="s11 s12"><span class="c28">●</span><span class="c7">List for possible TAL recognition sequences:</span></p><p class="s6"><span class="c22">'TAAAAAGGCCGCGT', 'TAAAAATGAAGTTT', 'TAAATCAAAAGAAT', 'TAAATCAGCTCATT', 'TAAATCGGAACCCT', 'TAAATTGTAAGCGT', 'TAACGCCAGGGTTT', 'TAACTCACATTAAT', 'TAAGATGCTTTTCT', 'TAAGCGTTAATATT', 'TAAGGGATTTTGGT', 'TAATACGACTCACT', 'TAATCAAGTTTTTT', 'TACCAATGCTTAAT', 'TACCCAGCTTTTGT', 'TACCGGATACCTGT', 'TACCTGTCCGCCTT', 'TACTCTTCCTTTTT', 'TACTGTCATGCCAT', 'TAGAACTAGTGGAT', 'TAGAAGGACAGTAT', 'TAGAGTAAGTAGTT', 'TAGATAACTACGAT', 'TAGCAGAGCGAGGT', 'TAGCGGTGGTTTTT', 'TAGCTGTTTCCTGT', 'TAGGGTTGAGTGTT', 'TAGGTATCTCAGTT', 'TAGTGAGGGTTAAT', 'TATATGAGTAAACT', 'TATCACTCATGGTT', 'TATCCGCTCACAAT', 'TATCCGGTAACTAT', 'TATCTCAGCGATCT', 'TATCTCAGTTCGGT', 'TATTATTGAAGCAT', 'TATTGGGCGCTCTT', 'TATTTGAATGTATT', 'TATTTTGTTAAAAT', 'TCAAAAAGGATCTT', 'TCAAAGGCGGTAAT', 'TCAACCAAGTCATT', 'TCAAGAAGATCCTT', 'TCAAGCTTATCGAT', 'TCAATCTAAAGTAT', 'TCACCAGCGTTTCT', 'TCACCTAGATCCTT', 'TCACGCTCGTCGTT', 'TCACGTTAAGGGAT', 'TCACTCATGGTTAT', 'TCACTGCCCGCTTT', 'TCAGCCCGACCGCT', 'TCAGCGATCTGTCT', 'TCAGCTCATTTTTT', 'TCAGTGAGGCACCT', 'TCATACTCTTCCTT', 'TCATAGCTCACGCT', 'TCATGGTCATAGCT', 'TCATTGGAAAACGT', 'TCCAGTCTATTAAT', 'TCCATCCAGTCTAT', 'TCCCATTCGCCATT', 'TCCCCCTGGAAGCT', 'TCCGCTTCCTCGCT', 'TCCGTAAGATGCTT', 'TCCTGCAACTTTAT', 'TCCTGTGTGAAATT', 'TCCTTTGATCTTTT', 'TCCTTTTTCAATAT', 'TCGATATCAAGCTT', 'TCGCCATTCAGGCT', 'TCGCGTTAAATTTT', 'TCGCTGCGCTCGGT', 'TCGGAAAAAGAGTT', 'TCGGCAAAATCCCT', 'TCGGGGCGAAAACT', 'TCGGTCGTTCGGCT', 'TCGGTGTAGGTCGT', 'TCGTCGTTTGGTAT', 'TCGTGCACCCAACT', 'TCGTGCGCTCTCCT', 'TCGTGTAGATAACT', 'TCGTTGTCAGAAGT', 'TCTAAAGTATATAT', 'TCTATCAGGGCGAT', 'TCTATTTCGTTCAT', 'TCTCAGCGATCTGT', 'TCTCAGTTCGGTGT', 'TCTCATGAGCGGAT', 'TCTCTTACTGTCAT', 'TCTGAGAATAGTGT', 'TCTGTCTATTTCGT', 'TCTTCAGCATCTTT', 'TGAACCATCACCCT', 'TGAAGTGGTGGCCT', 'TGAATACTCATACT', 'TGACAGTTACCAAT', 'TGACTCCCCGTCGT', 'TGACTCGCTGCGCT', 'TGAGAATAGTGTAT', 'TGAGCGCGCGTAAT', 'TGAGGCACCTATCT', 'TGAGTAAACTTGGT', 'TGAGTGAGCTAACT', 'TGATCCCCCATGTT', 'TGCAAAAAAGCGGT', 'TGCAAGCAGCAGAT', 'TGCACCCAACTGAT', 'TGCAGGAATTCGAT', 'TGCATAATTCTCTT', 'TGCCCGGCGTCAAT', 'TGCCGTAAAGCACT', 'TGCGCAACGTTGTT', 'TGCGCGCTTGGCGT', 'TGCGCTCGGTCGTT', 'TGCGCTCTCCTGTT', 'TGCGGCGACCGAGT', 'TGCTACAGAGTTCT', 'TGCTGAAGCCAGTT', 'TGCTGCAAGGCGAT', 'TGGAAAACGTTCTT', 'TGGCAGCACTGCAT', 'TGGCAGCAGCCACT', 'TGGCGCTTTCTCAT', 'TGGCGTTTTTCCAT', 'TGGTAGCGGTGGTT', 'TGGTAGCTCTTGAT', 'TGGTATGGCTTCAT', 'TGGTCATAGCTGTT', 'TGGTCCTGCAACTT', 'TGGTTTTTTTGTTT', 'TGTAACCCACTCGT', 'TGTCAGAAGTAAGT', 'TGTGAAATTGTTAT', 'TGTGACTGGTGAGT', 'TGTGTGAAATTGTT', 'TGTTGAATACTCAT', 'TGTTGAGATCCAGT', 'TGTTGTTCCAGTTT', 'TTAAAAATGAAGTT', 'TTAAAAGTGCTCAT', 'TTAAAATTCGCGTT', 'TTAAATCAGCTCAT', 'TTAATTGCGCGCTT', 'TTAGCTCCTTCGGT', 'TTATCAAAAAGGAT', 'TTATCACTCATGGT', 'TTATCAGGGTTATT', 'TTATCCGCCTCCAT', 'TTATTGAAGCATTT', 'TTCACCTAGATCCT', 'TTCCGCGCACATTT', 'TTCCTGTGTGAAAT', 'TTCGATATCAAGCT', 'TTCGCGTTAAATTT', 'TTCGGAAAAAGAGT', 'TTCGGTCCTCCGAT', 'TTGCGCAACGTTGT', 'TTGCTGGCGTTTTT', 'TTGGAAAACGTTCT', 'TTGGCCGCAGTGTT', 'TTGGGAAGGGCGAT', 'TTGGTATCTGCGCT', 'TTGGTCATGAGATT', 'TTGGTCTGACAGTT', 'TTGTAAGCGTTAAT', 'TTGTTAAATCAGCT', 'TTGTTCCCTTTAGT', 'TTGTTGCCATTGCT', 'TTTAAATTAAAAAT', 'TTTATCAGGGTTAT', 'TTTCACCAGCGTTT', 'TTTCCCCGAAAAGT', 'TTTCGTTCATCCAT', 'TTTCTACGGGGTCT', 'TTTCTGTGACTGGT', 'TTTGGAACAAGAGT', 'TTTGGGGTCGAGGT', 'TTTGGTCATGAGAT', 'TTTTAAATCAATCT', 'TTTTCAATATTATT', 	 'TTTTTCAATATTAT',    'TTTTTCCATAGGCT'</span></p><p class="s7 s13"> </p><p class="s11 s14"><span class="c29">2.</span><span class="c30">Connector</span></p><p class="s15"><span class="c7">The so-called Connector is plasmid designed to bind with several different Connectees(iGEM12_SJTU_BioX_Shanghai BBa_K771000). Connectees are </span></p><p class="s7 s10"><span class="c7">fusion proteins who carry out functional enzymes and have TAL(Transactivator-like effectors) at one end that can bind to certain DNA sequences and you can design your own Connectees with different enzymes. For </span><span class="c3">pBluescript II KS(+)</span><span class="c7">, we have selected three 14-nucleotide-long sequences called RS</span><span class="c7">Ⅰ</span><span class="c7">, RS</span><span class="c7">Ⅱ</span><span class="c7"> and RS</span><span class="c7">Ⅲ</span><span class="c7"> as the recognition sequences(RS).</span></p><p class="s7 s10"><span class="c7">The recognition sequences must start with a T and end with a T.</span></p><p class="s7 s16"><span class="c22">RS </span><span class="c22">Ⅰ</span><span class="c22">:   </span><span class="c23">TTC</span><span class="c31">GATATC</span><span class="c22">AAGCT </span></p><p class="s7 s16"><span class="c22">RS </span><span class="c22">Ⅱ</span><span class="c22">:  TGTGACTGGTG</span><span class="c25">AGT</span></p><p class="s7 s16"><span class="c22">RS </span><span class="c22">Ⅲ</span><span class="c22">:  TTTGGTCATGAGAT</span></p><p class="s7 s10"><span class="c22">( RS </span><span class="c22">Ⅰ </span><span class="c22">contains partial restriction enzyme cutting site of </span><span class="c23">EcoRI </span><span class="c22">and </span><span class="c24">EcoRV </span><span class="c22">)</span></p><p class="s7 s10"><span class="c22">( RS </span><span class="c22">Ⅱ </span><span class="c22">contains partial restriction enzyme cutting site of </span><span class="c25">ScaI </span><span class="c22">)</span></p><p class="s7 s17"><span class="c7">        <span style="display:inline-block;text-indent:0px;vertical-align:baseline;width:26.812em;"><img src="images/image2.jpg" alt="Macintosh HD:Users:chenming:Desktop:2)S$H4H`C{]S)M29%C6UJ}3.jpg" style="width:26.812em;"/></span></span></p><p class="s7 s18"><span class="c8">Figure 2  A Connector binds with three different Connectees</span></p><p class="s7 s19"> </p><p class="s7 s19"> </p><p class="s7 s19"> </p><p class="s11 s14"><span class="c29">3.</span><span class="c30">Combination</span></p><p class="s7 s10"><span class="c7">In order to prove that Connectors are able to bind with three kinds of Connectees. We designed the combination experiment. We selected a pathway: substrate becomes intermediate product through enzyme</span><span class="c7">Ⅰ</span><span class="c7">,then the intermediate product can either go to production A through enzyme</span><span class="c7">Ⅱ</span><span class="c7"> or production B through enzyme </span><span class="c7">Ⅲ</span><span class="c7">. </span></p><p class="s7 s20"><span class="c7">                       <span style="display:inline-block;text-indent:0px;vertical-align:baseline;width:34.566em;"><img src="images/image3.jpg" alt="Macintosh HD:Users:chenming:Desktop:6~2I1}LP1{6UJJW~100NIIL.jpg" style="width:34.566em;"/></span></span></p><p class="s7 s18"><span class="c8">Figure 3   Diagrams of our pathway design</span></p><p class="s7 s21"> </p><p class="s6"><span class="c7">	To achieve this, we need three kinds of Connectees fused with enzyme </span><span class="c7">Ⅰ</span><span class="c7">, </span><span class="c7">Ⅱ</span><span class="c7">and</span><span class="c7">Ⅲ</span><span class="c7"> independently and two kinds of Connectors. One has RS</span><span class="c7">Ⅰ</span><span class="c7">and RS</span><span class="c7">Ⅱ</span><span class="c7"> while the other has RS</span><span class="c7">Ⅰ</span><span class="c7">and RS</span><span class="c7">Ⅲ</span><span class="c7">. So in the end, Connectors with RS</span><span class="c7">Ⅰ</span><span class="c7"> and RS</span><span class="c7">Ⅱ</span><span class="c7"> get production A while Connectors with RS</span><span class="c7">Ⅰ</span><span class="c7"> and RS</span><span class="c7">Ⅲ</span><span class="c7"> production B.</span></p><p class="s6"><span class="c7"><span style="display:inline-block;text-indent:0px;vertical-align:baseline;width:36.228em;"><img src="images/image4.png" alt="image4.png" style="width:36.228em;"/></span></span></p><p class="s6"><span class="c8">Figure 4   Connector is originally designed with three recognition sequence(RS). Then we transformed it into two different Connector, one with RS </span><span class="c8">Ⅰ</span><span class="c8"> and RS </span><span class="c8">Ⅱ</span><span class="c8"> while the other one with RS </span><span class="c8">Ⅰ</span><span class="c8"> and RS </span><span class="c8">Ⅲ</span><span class="c8">. Connector with RS</span><span class="c8">Ⅰ</span><span class="c8">and RS</span><span class="c8">Ⅱ</span><span class="c8"> can bind with Connectee-enzyme </span><span class="c8">Ⅰ</span><span class="c8"> and Connectee-enzyme </span><span class="c8">Ⅱ</span><span class="c8"> and get  production A in the end, while Connector with RS </span><span class="c8">Ⅰ</span><span class="c8"> and RS </span><span class="c8">Ⅲ</span><span class="c8"> can bind with Connectee-enzyme </span><span class="c8">Ⅰ</span><span class="c8"> and Connectee-enzyme </span><span class="c8">Ⅲ</span><span class="c8"> and get production B.</span></p><p class="s7 s19"> </p><p class="s6"><span class="c7">	The corresponding Connectors are</span><span class="c32"> </span><span class="c3">pBluescript II KS(+) ScaI deletion</span><span class="c7"> and </span><span class="c3">pBluescript II KS(+) EcoRV deletion.</span></p><p class="s11 s22"><span class="c33">●</span><span class="c3">pBluescript II KS(+) ScaI deletion</span><span class="c4">：</span></p><p class="s7 s10"><span class="c7">We delete the RS</span><span class="c7">Ⅱ</span><span class="c7"> site so this transformed Connector can only bind to  Connectees with two kinds of enzyme. </span></p><p class="s7 s10"><span class="c7">In order to delete this site and surrounding sequence, we adopted the Inverse PCR to delete the following sequence: </span></p><p class="s7 s10"><span class="c7">CTGTGACTGGTGAGTACTCAACCAAGTCATTCTG</span></p><p class="s7 s21"> </p><p class="s7 s10"><span class="c7">Primers for Sac</span><span class="c7">Ⅰ</span><span class="c7">:</span></p><p class="s7 s10"><span class="c7">Forward: AGAATAGTGTATGCGGCGCGAC            Tm:57</span><span class="c7">℃</span></p><p class="s7 s10"><span class="c7">Reverse: AAAAGCATCTTACGGATGGCA              Tm:58</span><span class="c7">℃</span></p><p class="s11 s23"> </p><p class="s11 s24"><span class="c3">pBluescript II KS(+) ScaI deletion </span><span class="c7">can be used along with</span><span class="c3"> pBluescript II</span></p><p class="s11 s24"><span class="c3">KS(+) EcoRV deletion </span><span class="c7">and our Connectees(iGEM12_SJTU_BioX_Shanghai BBa_K771000) to achieve your certain pathway design.</span></p><p class="s11 s23"> </p><p class="s11 s22"><span class="c33">●</span><span class="c3">pBluescript II KS(+) EcoRV deletion</span><span class="c4">：</span></p><p class="s7 s10"><span class="c7">We delete the RS</span><span class="c7">Ⅲ</span><span class="c7"> site so this transformed Connector can only bind to  Connectees with two kinds of enzyme. </span></p><p class="s7 s10"><span class="c7">In order to delete this site and surrounding sequence, we adopted the Inverse PCR to delete the following sequence: </span></p><p class="s7 s10"><span class="c7">GGCTGCAGGAATTCGATATCAAGC</span></p><p class="s7 s19"> </p><p class="s7 s10"><span class="c7">Primers for EcoRV:</span></p><p class="s7 s10"><span class="c7">Forward: TTATCGATACCGTCGACCTCG             Tm:56</span><span class="c7">℃</span></p><p class="s15"><span class="c7">Reverse: CGGGGGATCCACTAGTTCTA               Tm:53</span><span class="c7">℃</span></p><p class="s7 s25"> </p><p class="s11 s24"><span class="c3">pBluescript II KS(+) EcoRV deletion </span><span class="c7">can be used along with</span><span class="c3"> pBluescript II</span></p><p class="s11 s24"><span class="c3">KS(+) ScaI deletion </span><span class="c7">and our Connectees(iGEM12_SJTU_BioX_Shanghai BBa_K771000) to achieve your certain pathway design.</span></p><p class="s7 s25"> </p><p class="s7 s26"> </p><p class="s11 s14"><span class="c29">4.</span><span class="c30">Maximization</span></p><p class="s6"><span class="c7">	We are trying to combine as many as enzymes as possible because more enzymes</span><span class="c7">’ </span><span class="c7">combination can produce more complicated reaction chains. So our purpose is to figure out the maximum number of Connectees that binding to a Connector.</span></p><p class="s6"><span class="c7">	So we intended to add more RS on the Connectors. On the one hand, more RSs mean we can bind more kinds of enzymes on one Connector. On the other hand ,we doubt the binding efficiency between Connectors and Connectees so more RSs can improve the possibility of Connectees binding to Connectors.</span></p><p class="s1">   The corresponding Connectors are<span class="c3"> pBlue</span><span class="c3">script II KS(+)_3_copy</span><span class="c3"> </span>and<span class="c3"> pBlue</span><span class="c3">script II KS(+)_5_copy</span>.</p><p class="s7 s19"> </p><p class="s11 s12"><span class="c28">●</span><span class="c3">pBluescript II KS(+)_3_copy </span></p><p class="s7 s10"><span class="c7">In order to add 3 copies of RS on Connectors, we firstly use restriction enzyme BstXI and BamHI to make a nick and replace the original sequence with one RS. Secondly, in the same way, we use restriction enzyme SalI and KpnI to add another RS.</span></p><p class="s7 s10"><span class="c7">The RS sequence is TTCGATATCAAGCT.</span></p><p class="s7 s10"><span class="c7">Here we have designed the new short sequence:</span></p><p class="s6"><span class="c7"><span style="display:inline-block;text-indent:0px;vertical-align:baseline;width:36.208em;"><img src="images/image5.png" alt="image5.png" style="width:36.208em;"/></span></span></p><p class="s11 s24"><span class="c7">and</span></p><p class="s6"><span style="display:inline-block;text-indent:0px;vertical-align:baseline;width:36.235em;"><img src="images/image6.png" alt="Macintosh HD:Users:chenming:Desktop:2.png" style="width:36.235em;"/></span></p><p class="s7 s10"><span class="c7">This is the what we get in the end:</span></p><p class="s6"><span class="c7">CT...CT</span><span class="c34">CCACCGCGGTGG</span><span class="c35">TTCGATATCAAGCT</span><span class="c36">GGATCC</span><span class="c7">CCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACC</span><span class="c37">GTCGAC</span><span class="c7">TTCGATATCAAGCT</span><span class="c38">GGTACC</span><span class="c7">CA</span><span class="c7">…</span><span class="c7">.AC</span></p><p class="s27"><span class="c3">pBluescript II KS(+)_3_copy</span><span class="c7"> can be used along with our Connectees(iGEM12_SJTU_BioX_Shanghai BBa_K771000) to achieve your certain pathway design.</span></p><p class="s2 s28"> </p><p class="s2 s29"><span class="c39">●</span><span class="c40">pBlue</span><span class="c40">script II KS(+)_5_copy</span></p><p class="s7 s10"><span class="c7">In order to add 4 more copies of RS on Connectors, we firstly use restriction enzyme BstXI and BamHI to make a nick and replace the original sequence with 4 consecutive repeats of RS. </span></p><p class="s7 s10"><span class="c7">The RS sequence is TTCGATATCAAGCT.</span></p><p class="s7 s10"><span class="c7">Here we have designed the new short sequence:</span></p><p class="s6"><span class="c7"><span style="display:inline-block;text-indent:0px;vertical-align:baseline;width:36.167em;"><img src="images/image7.png" alt="Macintosh HD:Users:chenming:Desktop:3.png" style="width:36.167em;"/></span></span></p><p class="s7 s10"><span class="c7">This is the what we get in the end:</span></p><p class="s6"><span class="c7">CT</span><span class="c7">…</span><span class="c7">CT</span><span class="c37">CCACCGCGGTGG<span id="b1"/></span><span class="c35">TTCGATATCAAGCT</span><span class="c41">TTCGATATCAAGCT</span><span class="c35">TTCGATATCAAGCT</span><span class="c41">TTCGATATCAAGCT</span><span class="c38">GGATCC</span><span class="c7">CC</span><span class="c7">…</span><span class="c7">AC</span></p><p class="s27"><span class="c3">pBluescript II KS(+)_5_copy</span><span class="c7"> can be used along with our Connectees(iGEM12_SJTU_BioX_Shanghai BBa_K771000) to achieve your certain pathway design.</span></p><p class="s11 s30"> </p><p class="s11 s14"><span class="c29">5.</span><span class="c42">Inverse PCR</span></p><p class="s2 s5"><span class="c43">We used Inverse PCR to transform our plasmid into two kinds of Connectors:</span><span class="c40"> pBlue</span><span class="c40">script II KS(+) ScaI deletion</span><span class="c40"> </span><span class="c43">and </span><span class="c40">pBlue</span><span class="c40">script II KS(+) EcoRV deletion</span><span class="c43">.</span></p><p class="s1"><span class="c43">Inverse PCR method is using cyclic DNA (such as a plasmid) as the template, with two primers designed in a reverse direction to achieve completed PCR. In this way, by designing primers,we can introduce a mutation, insertion or deletion.</span></p><p class="s7 s10"><span class="c7">We used KOD-Plus-Mutagenesis Kit by TOYOBO.CO.LTD. </span></p><p class="s7 s31 c7">More details please click http://www.bio-toyobo.cn.</p></div>
+<div class="jiao" >
-  </article>
+<div class="projtile_only">
+       <center><h2>Parts</h2></br></center>
+<center>
+<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool ready for potential scientific or engineering use.<br>
+&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Those BioBricks are divided into four groups.</br>
+&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1. BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br>
+&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2. BioBricks in USB are our designed sequences. They can help us easily and quickly insert our target sequence and make a whole part.</br>
+&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3. BioBricks in Application are our complete parts. </br>
+&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;4. BioBricks in New TAL are our newly designed TAL parts, which are robust and perform better in Golden Gate method.</br>
+</p>
+</center>
+</div>
+     <div class="projtile" >
+   <a href="#dingweidian2" title="Basic Parts">
+    <center><h2>Basic Parts</h2></center></a>
+    </div>
+     <div class="projtile">
+   <a href="#dianweidian9"  title="USB">
+    <center> <h2>USB</h2></center></a>
+    </div>
+     <div class="projtile">
+<a href="#dianweidian14" title="Application">
+    <center><h2>Application</h2></center></a>
+    </div>
+     <div class="projtile">
+<a href="#dianweidian10" title="New TAL">
+    <center><h2>New TAL</h2></center></a>
+    </div>
+</div>
+ <div style="clear:both;"></div></html>
+<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><p id="dingweidian2"></p>
+<html><div class="content"><article class="post__article">
+</br></br>
+<h2>Basic Parts</h2>
+<h3>Review previous parts</h3>
+<p>
+ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><a name="#dianweidian2"></a>
+From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)
+</p>
+<p>
+Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br>
+From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)
+</p>
+<p>
+mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br>
+From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )
+<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center>
+</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br>
+<p>
+This is a TALE protein with a flexible linker 3 before it. <br>
+</p>
+<p>
+Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br>
+ </p>
+<h3>Connector</h3>
+<p>
+We have four types of connector.
+<br>
+<center><img src="https://static.igem.org/mediawiki/2014/f/fb/4plasmid.png" width= 800px></img></center>
+</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center>
+ </br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br>
+<p>
+pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453901" target="_blank">(BBa_K1453901)</a>
+</p>
+<p>
+pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453001" target="_blank">(BBa_K1453001)</a>
+</p>
+<p>
+pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453003" target="_blank">(BBa_K1453003)</a>
+</p>
+<p>
+pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453004" target="_blank">(BBa_K1453004)</a>
+</p>
+<p>
+Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br>
+<br>
+</p>
+<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center>
+</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br>
+<p>
+The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats
+protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.
+<br>
+</p>
+<br>
+<br>
+<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center>
+</br><center  id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br>
+<p>
+This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.
+</p>
+<p>
+The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.
+<br>
+</p>
+<br>
+<h2>USB</h2>
+<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target  TALE or Enzyme, respectively.</p>
+<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center>
+</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br>
+<p>
+We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.
+</p>
+<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3>
+<br>
+<p>
+In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p>
+<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center>
+<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center>
+</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br>
+<p>
+The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p>
+On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p>
+When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p>
+<br>
+<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center>
+</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br>
+<p>
+In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.
+<p>
+When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)
+<br>
+</p>
+<br>
+<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center>
+</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br>
+<p>
+This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.
+<br>
+</p>
+<br>
+<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center>
+</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br>
+<p>
+This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.
+<br>
+</p>
+<br>
+<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center>
+</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br>
+<p>
+This part is the combination of BBa_K1453401 and BBa_K1453006.
+<br>
+</p>
+<br>
+<h3 id="dianweidian14">Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center>
+</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br>
+<p>
+This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.
+<br>
+</p>
+<br>
+<h2>Application</h2>
+<p>
+We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong>
+<br>
+We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.
+<br>
+</p>
+<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center>
+</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br>
+<p>
+This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.
+<br>
+</p>
+<br>
+<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center>
+</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br>
+<p>
+This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB
+<br>
+</p>
+<br>
+<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center>
+</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br>
+<p>
+This part is used in our application test free in the cytoplasm.
+</p>
+<p>
+This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.
+<br>
+</p>
+<br>
+<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3>
+<center><img src="https://static.igem.org/mediawiki/2014/7/7e/3409.png" width=400px></img></br><p id="dianweidian10"></p></center>
+</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br>
+<p >
+This part is used in our application test free in the cytoplasm.
+</p>
+<p>
+This part is based on the BBa_1453006 and BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB
+</p>
+<br>
+<h2>New TAL</h2>
+<h3>New TAL with better sticky ends<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a>
+<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(501)</a>
+<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(502)</a>
+<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(503)</a>
+<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(504)</a>
+<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(505)</a>
+<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(506)</a></h3>
+<p>
+We design seven new sticky ends which get the least score when judging the similarity.<br>
+ If you want to know how we design these ends, please go to see our
+<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br>
+</p>
+<p>
+<br>
+</p>
+<p >
+	<b>PART-left:</b><br>
+	…CTGACCCCGGAGACG
+	</p>
+	<p>
+	<b>PART1(150bp):</b><br>
+	CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG
+	CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT
+	CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p>
+	<p>
+	<b>PART2(219bp):</b><br>
+	CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG
+	GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA
+	AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG
+	CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p>
+	<p>
+	<b>PART3(262bp):</b><br>
+	CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG
+	TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT
+	GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC
+	ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA
+	AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center>
+	<p>
+	<b>PART4(224bp):</b><br>
+	CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT
+	GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG
+	TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA
+	CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br>
+	GACG
+	</p>
+	<p>
+	<b>PART5(194bp):</b><br>
+	CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC
+	CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC
+	TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br>
+	TCGGCGGCAAACAGGCACTCGATGAGACG
+	</p>
+	<p>
+	<b>PART6(249bp):</b><br>
+	CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC
+	TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT
+	GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG
+	GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br>
+	TGCAACGCCTCTTGCCAGTTTTAGAGACG</p>
+	<p>
+	<b>PART-right:</b><br>
+	CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br>
+	<p>
+	The recognition sequence of the TALE protein:
+	<center><font size="5" color="red">TCGATATCAAGC</font></center></p>
+<div class="default" id="default">
+<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts>
+</div>
+</article>
    </div>
-<style type="text/css">
-p{
-	margin: 0px;
-}
-sub{
-	font-size: 67%;
-	vertical-align: -10%;
-}
-sup{
-	font-size: 67%;
-	vertical-align: 33%;
-}
-.s1{
-	-webkit-hyphens: none;
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 68.7500%;
-	font-style: normal;
-	font-variant: normal;
-	font-weight: normal;
-	hyphens: none;
-	letter-spacing: 0.0000em;
-	margin-bottom: 0.0000%;
-	margin-top: 0.0000%;
-	padding-left: 0.0000%;
-	padding-right: 0.0000%;
-	text-align: justify;
-	text-indent: 0.0000%;
-	text-transform: none;
-	white-space: normal;
-}
-.s2{
-	-webkit-hyphens: none;
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 68.7500%;
-	font-style: normal;
-	font-variant: normal;
-	font-weight: normal;
-	hyphens: none;
-	letter-spacing: 0.0000em;
-	margin-bottom: 0.0000%;
-	margin-top: 0.0000%;
-	padding-left: 4.1427%;
-	padding-right: 0.0000%;
-	text-align: justify;
-	text-decoration: none;
-	text-indent: -4.1427%;
-	text-transform: none;
-	white-space: normal;
-}
-.s3{
-	font-style: italic;
-	font-weight: bold;
-}
-.s4{
-	font-weight: bold;
-	padding-left: 3.2550%;
-	text-indent: -3.2550%;
-}
-.s5{
-	text-indent: 4.1427%;
-}
-.s6{
-	-webkit-hyphens: none;
-	color: #000000;
-	font-family: "Times New Roman";
-	font-size: 75.0000%;
-	font-style: normal;
-	font-variant: normal;
-	font-weight: normal;
-	hyphens: none;
-	letter-spacing: 0.0000em;
-	margin-bottom: 0.0000%;
-	margin-top: 0.0000%;
-	padding-left: 0.0000%;
-	padding-right: 0.0000%;
-	text-align: justify;
-	text-indent: 0.0000%;
-	text-transform: none;
-	white-space: normal;
-}
-.s7{
-	-webkit-hyphens: none;
-	color: #000000;
-	font-family: "Times New Roman";
-	font-size: 75.0000%;
-	font-style: normal;
-	font-variant: normal;
-	font-weight: normal;
-	hyphens: none;
-	letter-spacing: 0.0000em;
-	margin-bottom: 0.0000%;
-	margin-top: 0.0000%;
-	padding-left: 0.0000%;
-	padding-right: 0.0000%;
-	text-align: justify;
-	text-decoration: none;
-	text-indent: 0.0000%;
-	text-transform: none;
-	white-space: normal;
-}
-.s8{
-	text-align: center;
-	text-indent: 4.8331%;
-}
-.s9{
-	font-family: "Helvetica";
-	font-size: 56.2500%;
-	text-align: center;
-	text-indent: 4.8331%;
-}
-.s10{
-	text-indent: 4.8331%;
-}
-.s11{
-	-webkit-hyphens: none;
-	color: #000000;
-	font-family: "Times New Roman";
-	font-size: 75.0000%;
-	font-style: normal;
-	font-variant: normal;
-	font-weight: normal;
-	hyphens: none;
-	letter-spacing: 0.0000em;
-	margin-bottom: 0.0000%;
-	margin-top: 0.0000%;
-	padding-left: 5.5236%;
-	padding-right: 0.0000%;
-	text-align: justify;
-	text-decoration: none;
-	text-indent: -0.6904%;
-	text-transform: none;
-	white-space: normal;
-}
-.s12{
-	font-family: "Helvetica";
-	text-indent: -5.5236%;
-}
-.s13{
-	font-family: "Helvetica";
-	font-size: 62.5000%;
-}
-.s14{
-	font-family: "Helvetica";
-	font-weight: bold;
-	padding-left: 3.5509%;
-	text-indent: -3.5509%;
-}
-.s15{
-	-webkit-hyphens: none;
-	color: #000000;
-	font-family: "Times New Roman";
-	font-size: 75.0000%;
-	font-style: normal;
-	font-variant: normal;
-	font-weight: normal;
-	hyphens: none;
-	letter-spacing: 0.0000em;
-	margin-bottom: 0.0000%;
-	margin-top: 0.0000%;
-	padding-left: 0.0000%;
-	padding-right: 0.0000%;
-	text-align: justify;
-	text-decoration: none;
-	text-indent: 4.1427%;
-	text-transform: none;
-	white-space: normal;
-}
-.s16{
-	padding-left: 4.8331%;
-	text-indent: 4.8331%;
-}
-.s17{
-	text-indent: 6.9045%;
-}
-.s18{
-	text-align: center;
-	text-indent: 6.9045%;
-}
-.s19{
-	font-family: "Helvetica";
-}
-.s20{
-	padding-left: 4.8907%;
-	text-indent: 4.8331%;
-}
-.s21{
-	font-family: "Helvetica";
-	text-indent: 4.8331%;
-}
-.s22{
-	font-family: "Helvetica";
-	font-style: italic;
-	font-weight: bold;
-	text-indent: -5.5236%;
-}
-.s23{
-	font-family: "Helvetica";
-	text-indent: 0.0000%;
-}
-.s24{
-	text-indent: 0.0000%;
-}
-.s25{
-	font-family: "Helvetica";
-	text-indent: 4.1427%;
-}
-.s26{
-	font-family: "Helvetica";
-	font-style: italic;
-	font-weight: bold;
-}
-.s27{
-	-webkit-hyphens: none;
-	color: #000000;
-	font-family: "Times New Roman";
-	font-size: 75.0000%;
-	font-style: normal;
-	font-variant: normal;
-	font-weight: normal;
-	hyphens: none;
-	letter-spacing: 0.0000em;
-	margin-bottom: 0.0000%;
-	margin-top: 0.0000%;
-	padding-left: 0.0000%;
-	padding-right: 0.0000%;
-	text-align: justify;
-	text-indent: 4.8331%;
-	text-transform: none;
-	white-space: normal;
-}
-.s28{
-	font-size: 75.0000%;
-	font-style: italic;
-	font-weight: bold;
-	padding-left: 5.5236%;
-	text-indent: 0.0000%;
-}
-.s29{
-	font-style: italic;
-	font-weight: bold;
-	padding-left: 5.0633%;
-	text-indent: -5.0633%;
-}
-.s30{
-	font-family: "Helvetica";
-	font-size: 87.5000%;
-	font-weight: bold;
-	padding-left: 4.1427%;
-	text-indent: 3.4868%;
-}
-.s31{
-	font-family: "Times New Roman", "Helvetica";
-	text-indent: 4.8331%;
-}
-.c1{
-	font-family: "Hei Regular";
-}
-.c2{
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 100.0000%;
-	font-style: italic;
-	font-weight: bold;
-	padding-right: 2.1%;
-}
-.c3{
-	font-family: "Helvetica";
-	font-style: italic;
-	font-weight: bold;
-}
-.c4{
-	font-family: "Hei Regular";
-	font-style: italic;
-	font-weight: bold;
-}
-.c5{
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 100.0000%;
-	font-style: normal;
-	font-weight: bold;
-	padding-right: 1.2%;
-}
-.c6{
-	font-family: "Helvetica";
-	font-size: 127.2727%;
-	font-weight: bold;
-}
-.c7{
-	font-family: "Helvetica";
-}
-.c8{
-	font-family: "Helvetica";
-	font-size: 75.0000%;
-}
-.c9{
-	font-family: "Helvetica";
-	font-size: 75.0000%;
-	font-style: italic;
-	font-weight: bold;
-}
-.c10{
-	color: #000000;
-	font-family: "Helvetica";
-}
-.c11{
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-}
-.c12{
-	color: #3366FF;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-	text-decoration: underline;
-}
-.c13{
-	background: #D9D9D9;
-	color: #3366FF;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-	font-weight: bold;
-	text-decoration: underline;
-}
-.c14{
-	background: #FFFF00;
-	color: #3366FF;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-	text-decoration: underline;
-}
-.c15{
-	background: #FFFF00;
-	color: #FF0000;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-	text-decoration: underline;
-}
-.c16{
-	background: #FFFF00;
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-}
-.c17{
-	background: #D9D9D9;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-	font-weight: bold;
-}
-.c18{
-	background: #FFFF00;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-}
-.c19{
-	background: #FFFF00;
-	color: #00FF00;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-	text-decoration: underline;
-}
-.c20{
-	background: #D9D9D9;
-	color: #00FF00;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-	font-weight: bold;
-	text-decoration: underline;
-}
-.c21{
-	color: #00FF00;
-	font-family: "Helvetica";
-	font-size: 66.6667%;
-	text-decoration: underline;
-}
-.c22{
-	font-family: "Helvetica";
-	font-size: 83.3333%;
-}
-.c23{
-	color: #3366FF;
-	font-family: "Helvetica";
-	font-size: 83.3333%;
-}
-.c24{
-	color: #FF6600;
-	font-family: "Helvetica";
-	font-size: 83.3333%;
-}
-.c25{
-	color: #00FF00;
-	font-family: "Helvetica";
-	font-size: 83.3333%;
-}
-.c26{
-	background: #FFFF00;
-	font-family: "Helvetica";
-	font-size: 83.3333%;
-}
-.c27{
-	background: #C0C0C0;
-	font-family: "Helvetica";
-	font-size: 83.3333%;
-}
-.c28{
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 100.0000%;
-	font-style: normal;
-	font-weight: normal;
-	padding-right: 4.1%;
-}
-.c29{
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 100.0000%;
-	font-style: normal;
-	font-weight: bold;
-	padding-right: 1.3%;
-}
-.c30{
-	font-family: "Helvetica";
-	font-size: 116.6667%;
-	font-weight: bold;
-}
-.c31{
-	color: #FF0000;
-	font-family: "Helvetica";
-	font-size: 83.3333%;
-}
-.c32{
-	font-family: "Helvetica";
-	font-style: italic;
-}
-.c33{
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 100.0000%;
-	font-style: italic;
-	font-weight: bold;
-	padding-right: 4.2%;
-}
-.c34{
-	color: #C2D69B;
-	font-family: "Helvetica";
-}
-.c35{
-	color: #E36C0A;
-	font-family: "Helvetica";
-}
-.c36{
-	color: #92CDDC;
-	font-family: "Helvetica";
-}
-.c37{
-	color: #76923C;
-	font-family: "Helvetica";
-}
-.c38{
-	color: #31849B;
-	font-family: "Helvetica";
-}
-.c39{
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 100.0000%;
-	font-style: italic;
-	font-weight: bold;
-	padding-right: 3.8%;
-}
-.c40{
-	font-family: "Helvetica";
-	font-size: 109.0909%;
-	font-style: italic;
-	font-weight: bold;
-}
-.c41{
-	color: #FABF8F;
-	font-family: "Helvetica";
-}
-.c42{
-	color: #000000;
-	font-family: "Helvetica";
-	font-size: 116.6667%;
-	font-weight: bold;
-}
-.c43{
-	font-size: 109.0909%;
-}
-</style>
 </html>
 {{Team:SJTU-BioX-Shanghai/footer}}