Team:LZU-China/Parts

From 2014.igem.org

(Difference between revisions)
 
Line 769: Line 769:
   <table width="100%" border="0">
   <table width="100%" border="0">
     <tr>
     <tr>
-
       <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  height="65"> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURES OF SOME PARTS</div></td>
+
       <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  height="65">
 +
<p>&nbsp;</p><p>&nbsp;</p>
 +
  <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURES OF SOME PARTS</div></td>
     </tr>
     </tr>
   </table>
   </table>

Latest revision as of 03:58, 18 October 2014

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> LZU-China 2014

 
 
          SUMMARY OF THE PARTS

 

 

 

          

No Part No. NCBI No. Resistance Vector Gene Name Gene function Length Website (NCBI)
1 BBa_K1523021 NC_004999.1 Chl pSB1C3 nahR nahE coding sequence,
encoding a LysR-type transcriptional regulator
903 bp http://www.ncbi.nlm.nih.gov/gene/1343208
2 BBa_K1523022 NC_007926.1
(37386..38381)
Chl pSB1C4 nahE nahE coding sequence 1005 bp http://www.ncbi.nlm.nih.gov/gene/3974214
3 BBa_K1523023 NC_007926.1
(44492..45796)
Chl pSB1C5 nahG nahG coding sequence 1305 bp http://www.ncbi.nlm.nih.gov/gene/3974216
4 BBa_K1523025 NC_017530.1 Chl pSB1C6 chrR chrR coding sequence 666 bp http://www.ncbi.nlm.nih.gov/gene/12519943
5 BBa_K1523101 N/A Chl pSB1C7 PyeaR PyeaR->Riboflavin synthase 3726 bp N/A
6 BBa_K1523008 NC_007779.1 Chl pSB1C8 Yief yieF coding sequence 560 bp http://www.ncbi.nlm.nih.gov/gene/12933177

 

 

 
 


 

 

 

 

 

          GEL PICTURES OF SOME PARTS
 

 

 

 

 

Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.

 

 

 


 

 

 

          PARTS SEQUENCES

 

 

>nahR naphthalene degradation LysR-family transcriptional activator 903bp
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA

>nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG

>nahG salicylate hydroxylase 1305bp
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA

>ChrR chromate reductas 666 bp
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA

>BBa_K1523101 Part-only sequence (3726 bp)
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC
TGCAACAGCTTGAACAACAGTTGTAA

>yieF chromate reductas 560 bp
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA
GATCTAA