Team:LZU-China/Parts

From 2014.igem.org

(Difference between revisions)
Line 346: Line 346:
padding:0;
padding:0;
font-size: 14px;
font-size: 14px;
-
text-align: left;
+
text-align: center;
}
}
html{background-color:#e9ecec}
html{background-color:#e9ecec}
Line 519: Line 519:
position:absolute;
position:absolute;
left:575px;
left:575px;
-
top:2977px;
+
top:3977px;
width:220px;
width:220px;
height:221px;
height:221px;
Line 753: Line 753:
         </table>
         </table>
<p>&nbsp;</p>
<p>&nbsp;</p>
-
<p>&nbsp;</p>
+
<p>&nbsp;</p></td>
-
<p>&nbsp;</p>
+
-
        <p><br />
+
-
      </p></td>
+
       <td width="5%">&nbsp;</td>
       <td width="5%">&nbsp;</td>
     </tr>
     </tr>
Line 763: Line 760:
     <tr>
     <tr>
       <td>&nbsp;</td>
       <td>&nbsp;</td>
 +
    </tr>
 +
  </table>
 +
  <p><br />
 +
</p>
 +
<p>&nbsp;</p>
 +
<p>&nbsp;</p>
 +
    <p>&nbsp;</p>
 +
  <table width="100%" border="0">
 +
    <tr>
 +
      <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  height="65">  <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div></td>
 +
    </tr>
 +
  </table>
 +
  <table width="100%" border="0">
 +
    <tr>
 +
      <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  width="22%" height="408">&nbsp;</td>
 +
      <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  width="56%"><p>&nbsp;</p>
 +
        <p>&nbsp;</p>
 +
        <p>&nbsp;</p>
 +
        <p><img src="http://2014.igem.org/wiki/images/c/c0/Partpic1.png" width="560" height="378" /></p>
 +
        <p>&nbsp;</p>
 +
        <p><img src="http://2014.igem.org/wiki/images/e/e0/Partpic2.png" width="451" height="419" /></p>
 +
        <p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p>
 +
        <p></p>
 +
        <p><br />
 +
        </p></td>
 +
      <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  width="22%">&nbsp;</td>
     </tr>
     </tr>
   </table>
   </table>
Line 770: Line 793:
     </tr>
     </tr>
   </table>
   </table>
-
   <p><br />
+
   <p>&gt;nahR  naphthalene degradation LysR-family transcriptional activator  903bp<br />
   ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p>
   ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p>
   <p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase  1005bp<br />
   <p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase  1005bp<br />
Line 828: Line 851:
     TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br />
     TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br />
     GATCTAA</p>
     GATCTAA</p>
-
<p>&nbsp;</p>
+
  <p>&nbsp;</p>
-
<p>&nbsp;</p>
+
  <p>&nbsp;</p>
-
    <p>&nbsp;</p>
+
  <p>&nbsp;</p>
-
   <table width="100%" border="0">
+
   <p>&nbsp;</p>
-
    <tr>
+
  <p>&nbsp;</p>
-
      <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  height="65">  <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div></td>
+
  <p>&nbsp;</p>
-
    </tr>
+
  <p>&nbsp;</p>
-
  </table>
+
  <p>&nbsp;</p>
-
  <table width="100%" border="0">
+
  <p>&nbsp;</p>
-
    <tr>
+
  <p>&nbsp;</p>
-
      <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  width="22%" height="408">&nbsp;</td>
+
  <p>&nbsp;</p>
-
      <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  width="56%"><p>&nbsp;</p>
+
  <p>&nbsp;</p>
-
        <p>&nbsp;</p>
+
  <p>&nbsp;</p>
-
        <p>&nbsp;</p>
+
  <p>&nbsp;</p>
-
        <p><img src="http://2014.igem.org/wiki/images/c/c0/Partpic1.png" width="560" height="378" /></p>
+
  <p>&nbsp;</p>
-
        <p>&nbsp;</p>
+
  <p>&nbsp;</p>
-
        <p><img src="http://2014.igem.org/wiki/images/e/e0/Partpic2.png" width="451" height="419" /></p>
+
  <p>&nbsp;</p>
-
        <p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p>
+
  <p>&nbsp;</p>
-
        <p></p>
+
  <p>&nbsp;</p>
-
<p>&nbsp;</p>
+
  <p><script type="text/javascript">
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p>&nbsp;</p>
+
-
        <p><script type="text/javascript">
+
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));
</script></p>
</script></p>
-
        <p><br />
 
-
        </p></td>
 
-
      <td background="http://2014.igem.org/wiki/images/a/a6/Huils.jpg"  width="22%">&nbsp;</td>
 
-
    </tr>
 
-
  </table>
 
-
  <p>&nbsp;</p>
 
</div>
</div>
<p>&nbsp;</p>
<p>&nbsp;</p>

Revision as of 03:46, 18 October 2014

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> LZU-China 2014

 
 
          SUMMARY OF THE PARTS

 

 

 

          

No Part No. NCBI No. Resistance Vector Gene Name Gene function Length Website (NCBI)
1 BBa_K1523021 NC_004999.1 Chl pSB1C3 nahR nahE coding sequence,
encoding a LysR-type transcriptional regulator
903 bp http://www.ncbi.nlm.nih.gov/gene/1343208
2 BBa_K1523022 NC_007926.1
(37386..38381)
Chl pSB1C4 nahE nahE coding sequence 1005 bp http://www.ncbi.nlm.nih.gov/gene/3974214
3 BBa_K1523023 NC_007926.1
(44492..45796)
Chl pSB1C5 nahG nahG coding sequence 1305 bp http://www.ncbi.nlm.nih.gov/gene/3974216
4 BBa_K1523025 NC_017530.1 Chl pSB1C6 chrR chrR coding sequence 666 bp http://www.ncbi.nlm.nih.gov/gene/12519943
5 BBa_K1523101 N/A Chl pSB1C7 PyeaR PyeaR->Riboflavin synthase 3726 bp N/A
6 BBa_K1523008 NC_007779.1 Chl pSB1C8 Yief yieF coding sequence 560 bp http://www.ncbi.nlm.nih.gov/gene/12933177

 

 

 
 


 

 

 

          GEL PICTURE OF SOME PARTS
 

 

 

 

 

Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.


 
          PARTS SEQUENCES

>nahR naphthalene degradation LysR-family transcriptional activator 903bp
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA

>nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG

>nahG salicylate hydroxylase 1305bp
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA

>ChrR chromate reductas 666 bp
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA

>BBa_K1523101 Part-only sequence (3726 bp)
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC
TGCAACAGCTTGAACAACAGTTGTAA

>yieF chromate reductas 560 bp
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA
GATCTAA