Team:Hong Kong HKUST/pneumosensor/results

From 2014.igem.org

(Difference between revisions)
Line 265: Line 265:
</table>
</table>
</div>
</div>
-
 
-
 
-
 
-
 
-
 
-
 
<!-- end of one row of content , two column one picture left-->
<!-- end of one row of content , two column one picture left-->
</div>
</div>
</div>
</div>
 +
<footer>
 +
<script>
 +
$(document).ready(function(){
 +
 +
//Check to see if the window is top if not then display button
 +
$(window).scroll(function(){
 +
if ($(this).scrollTop() > 100) {
 +
$('.scrollToTop').fadeIn();
 +
} else {
 +
$('.scrollToTop').fadeOut();
 +
}
 +
});
 +
 +
//Click event to scroll to top
 +
$('.scrollToTop').click(function(){
 +
$('html, body').animate({scrollTop : 0},800);
 +
return false;
 +
});
 +
 +
});
 +
</script>
 +
<a href="#" class="scrollToTop">
 +
<div style= "text-align:center" class="scrollToTop">
 +
<br>
 +
Back to top
 +
</div>
 +
</a>
 +
</footer>
</body></html>
</body></html>
}}
}}

Revision as of 07:44, 16 October 2014





Pneumosensor Results



Detection Module


Overview

The two-component regulatory system in S. pneumoniae, consisting of the receptor ComD and its response regulator ComE was to be used in detecting the autoinducer molecule, competence-stimulating peptide (CSP) and so detect S. pneumoniae populations correspondingly.

Construct

Tag protein

We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in comD extraction primer.

comD forward primer:
TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG
[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]

comD reverse primer with FLAG tag:
GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT
[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]



comE was extracted from pKHS-come kindly sent to us by Dr. Don Morrison (Université de Toulouse, UPS, Laboratoire de Microbiologie et Génétique Moléculaires). Extraction was done using the following primers:

comE forward primer:
TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG
[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]

comE reverse primer:
GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA
[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]



comE sequence contained an illegal SpeI site, so we designed a set of overlapping primers for site-directed mutagenesis:

comE mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC

comE mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG

However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) comE forward primer & mutagenesis reverse primer; (ii) comE reverse primer & mutagenesis forward primer. The two fragments were then ligated with the pSB1C3 backbone through Gibson Assembly.




S. pneumoniae σx Promoters Module


Overview

The activity of Com-Box promoter is turned on by a specific sigma factor that is produced by a regulatory gene comX. The σx will bind to the Com-Box promoter region and activate gene expression. σx serve as an inducer with high specificity as it binds to an area of several specific 8 base pairs (TACGAATA) on the Com-Box promoter. This σx-Com-Box system could be used as a highly specific reporting system in our S.pneumonia detection platform. However in nature, ComX protein will be degraded by ClpXP enzyme which exists in E. coli and some other bacteria. Hence, to ensure the induction of Com-Box promoter by σx, ComW protein is needed as it functions to protect σx from being degraded by ClpXP. ComW protein will be degraded instead, increasing the amount of σx produced.

Construct
The three main components of the construct are comX gene, comW gene, and Com-Box promoter. We assembled comX and Com-Box promoter in one vector plasmid, while comW in a different plasmid. The system will be fused with a tagging protein and a reporting protein. Tagging protein is essential for detecting the σx and ComW protein expression by means of western blot. Reporting protein which is fluorescence protein is needed for reporting purpose, hence σx-Com-Box system could serve as a specific reporting system that will be useful for many synthetic constructs. σx generator and Com-Box promoter construct will be assembled separately in different plasmid before being combined into one plasmid.

σx Generator construct (BBa_K1379006) and comW construct

Backbone pSB1C3 was used for σx generator construct and comW construct. comX gene / comW gene were fused with BBa_K880005 which contains a constitutive promoter (BBa_J23100) and strong RBS (BBa_B0034). The purpose of this strong constitutive promoter and strong RBS is to unsure the large production of σx and ComW protein throughout time. Then, a double terminator (BBa_B0015) is fused with the promoter, RBS, and comX. BBa_K880005 and BBa_B0015 were obtained from 2014 iGEM distribution kit.

Construct using pSB1C3 backbone consisting only σx CDS (BBa_K1379004), and σx followed by double terminator BBa_B0015(BBa_K1379045) was also built to facilitate assembly of σx to promoters and RBSs of choice.

Bacterial Strain
The bacterial strain of E. coli used is DH10B. Since this strain of E. coli has clpXP degradation enzyme which targets ComX for degradation, an excess amount of ComX protein is required to maintain enough amount of ComX for Com-Box promoter induction.

comX and comW gene
comX gene and comW gene were cloned from NCTC 7465 S.pneumoniae strain genomic DNA by PCR using Vent Polymerase.


ComX Tag Protein
We engineered a C-myc protein tag in the 3’ ends of comX by including the sequence in comX extraction primer.

3’ primer to extract comX with engineered C-myc tag gene sequence:

GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CAGATCCTCTTCTGAGATGAGTTTTTGTTC GTGGGTACGGATAGTAAACTCCTTAAACAC

[6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [30’ C-myc protein] [30' reverse complementary of 3’ comX]

ComW Tag Protein
We engineered a FLAG protein tag in the 3’ ends of comW by including the sequence in comW extraction primer.

3’ primer to extract comW with engineered FLAG tag gene sequence:

GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CTTGTCGTCATCGTCTTTGTAGTC ACAAGAAATAAAACCCCGATTCATTACCAATT

[6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [24’ FLAG protein] [32' reverse complementary of 3’ comW]

PcelA (BBa_ K1379002) and PcomFA (BBa_ K1379003) construct

Backbone pSB1C3 was used for PcelA and PcomFA construct. PcelA / PcomFA gene was fused with BBa_E0240, which contains a medium RBS (BBa_B0034), GFP (BBa_E0040) and double terminator (BBa_B0015). The purpose of this GFP generator is to indicate the functionality of PcelA and PcomFA in the presence and absence of σx. BBa_E0240 was obtained from 2014 iGEM distribution kit. The bacterial strain of E. coli used is DH10B.

PCelA / PcomFA gene

Identifying the Possible Promoter Regions
To date (12 Oct 2014), the core/minimal promoter region of PcelA has not yet been experimentally defined. In locating the promoter region required to initiate transcription, iGEM 2014 Hong_Kong_HKUST team attempted in making educated guesses based on relevant information available from the literature. The Com-Box promoter consensus sequence “TACGAATA” was BLASTed for targets in the Streptococcus pneumoniae genomes of strains R6, D39, ATCC7699 and NCTC7465 in the NCBI database. Genome of strain NCTC7465 was particularly given attention because its gDNA was available for manipulation. A list of loci with annotated genes returned. σx was known to turn on late competence gene and therefore loci containing any of those genes documented were favored and filtered for. Those loci were then manually checked for consensus among the 4 genomes mentioned above. A sequence of 67 base pairs stood out as a promising target because it was 1) upstream of a late competence genes celA (encodes competence protein CelA), and 2) was identical across the 4 genomes. This 67 bp region has varying upstream sequences and the potential promoter region can reach as far as 200bp. Different truncations (67, 100, 150, 180, 249, 300 bp) were planned for deciding the minimal promoter region, but in the course of construction, only the 100bp version could be finished in time. It was tested to be functional and therefore submitted as PcelA.

PcelA and PcomFA gene were both cloned from the genomic DNA of S. pneumoniae strain NCTC7465 by PCR using Vent Polymerase. The difference between these two promoters is the whole sequence of PcomFA was obtained from Wellcome Trust Sanger Institute, a British genomics and genetics research institute. (https://www.sanger.ac.uk/)

PcelA Forward primer: TTTCTGTCTAGAGTTGACCAAGGAAGACTATTTTGC

PcelA Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAATTTTCTCCTCTCTTAGATTATTCGTAAGAGG

PcomFA Forward primer: TTTCTGTCTAGAGTGGACTTGGCCGTCCTCT

PcomFA Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAGACGTTCTTCTTCTGTTAATTCATTCTCAG

Assembly and Characterization

Assembly
comX and comW construct contain 3 parts that need to be assembled: BBa_K880005 which contains constitutive promoter and RBS, comX engineered with C-myc tag / comW engineered with FLAG tag, and a double terminator in pSB1C3 backbone. Promoter, RBS, comX engineered with C-myc tag, and double terminator were combined using traditional digestion and ligation method. The ligation product was confirmed by digestion check and sequencing.

Com-Box construct also contains 3 parts that need to be assembled: PcelA/PcomFA promoter, BBa_E0240 which contains RBS, GFP and double terminator, and pSB1C3 backbone. All three parts were combined using traditional digestion and ligation method. The final ligation product was confirmed by digestion check and sequencing.

Characterization
RPU (Relative promoter unit) and leakage will be measured as a characterization of 100 base pairs Com-Box promoter (PcelA), and 160 base pairs Com-Box promoter (PcomFA). For Com-Box promoter characterization, σx generator construct which contains BBa_K880005, comX gene, and BBa_B0015, is ligated with PcelA / PcomFA construct containing Com-Box promoter and GFP generator. In order to characterize the two Com-Box promoters, σx generator-Com-Box construct was migrated from pSB1C3 to pSB3K3. RPU are measured with BBa_J23101 Andersen family promoter as a reference promoter.


Back to top

Home

Pneumosensor

Riboregulator

Human Practice

Team

WetLab

Achievement