Team:Heidelberg/pages/Notebook/Materials

From 2014.igem.org

(Difference between revisions)
 
Line 1: Line 1:
<html>
<html>
-
<p>See below all the Materials we used. For the individual experiments visit our Notebook, the <a style="font-weight:bold" href="http://2014.igem.org/Team:Heidelberg/Notebook">MidnightDoc</a>, for a collection of our Methods please see <a href="http://2014.igem.org/Team:Heidelberg/pages/Notebook/Methods">Methods</a>.</p>
+
<p>See below all the Materials we used. For the individual experiments visit our Notebook, the <a style="font-weight:bold" href="http://2014.igem.org/Team:Heidelberg/Notebook">MidnightDoc</a>, for a collection of our Methods please see <a href="http://2014.igem.org/Team:Heidelberg/Notebook/Methods">Methods</a>.</p>
</html>
</html>

Latest revision as of 16:57, 8 December 2014

See below all the Materials we used. For the individual experiments visit our Notebook, the MidnightDoc, for a collection of our Methods please see Methods.

Contents

Kits

Kit Supplier Catalog Number
MinElute® PCR Purification Kit (250) QIAGEN 28006
Plasmid Plus Maxi Kit (25) QIAGEN 12963
Plasmid Plus Midi Kit (25) QIAGEN 12943
QIAEX II® Gel Extraction Kit (500) QIAGEN 20051
QIAGEN® Plasmid Plus Midi Kit (100) QIAGEN 12945
QIAquick® Gel Extraction Kit (250) QIAGEN 28706
QIAquick® PCR Purification Kit (250) QIAGEN 28106
QIAprep® Spin Miniprep Kit (250) QIAGEN 27106
QIAprep® Spin Miniprep Columns QIAGEN 27115
Protein Thermal Shift Starter Kit 4462263 Life Technologies
EnzChek® Ultra Xylanase Assay Kit Life Technologies E33650


Marker

Marker Supplier Catalog Number
Quick-Load® 2-Log DNA Ladder (0.1-10.0 kb) New England BioLabs N3200S
Quick-Load® 1 kb DNA Ladder New England BioLabs N0468S
50 bp DNA Ladder New England BioLabs N3236S
Gel loading solution Sigma-Aldrich Chemie GmbH G2526-5ML
MagicMark XP Western Protein Standard Life Technologies LC5602
Novex® Sharp Pre-stained Protein Standard Invitrogen LC5800
SERVA Triple Color Protein Standard SERVA Electrophoresis 39258.01


Enzymes

Enzyme Supplier Catalog Number
DreamTaq Green PCR Master Mix (2X) Thermo Fisher Scientific Biosciences GmbH K1081
DreamTaq PCR MM Fermentas Life Sciences K1071
Gibson Assembly® Master Mix New England Biolabs E2611 S
Lysozyme from Chicken Egg White Sigma-Aldrich Chemie GmbH L4919-500MG
Phusion® Flash High-Fidelity PCR Master Mix Biozym Scientific GmbH F-548L
Phusion® High-Fidelity PCR Master Mix New England Biolabs M0531 L
T4 DNA Ligase New England Biolabs GmbH M0202 S
2x PCR Master mix Solution (iTaq) HISS DIAGNOSTICS GmbH 25028
Sortase A (Staphylococcus aureus) roboklon E4400-01
TEV Protease Th. Geyer GmbH SA/T4455/000001
Xylanase, recombinant Sigma-Aldrich Chemie GmbH X2753-10G
Human DNA (cytosine-5) Methyltransferase NEB M0230 S


Antibodies

Antibody Supplier Catalog Number
Penta·His Antibody, BSA-free QIAGEN 34660
Anti-GFP Roche 11814460001
RFP antibody [5F8] Chromotec 5F8
Goat anti Mouse IgG HRPO Dianova GmbH 115-035-003
Rat IgG, HRP-linked whole antibody (from goat) GE Healthcare NA935


Restriction Enzymes

Enzyme Supplier Catalog Number
BamI New England Biolabs R3136 S
BgIII New England Biolabs R0144 S
BsaI-HF® NEB R3535 L
BsmBI NEB R0580 L
DpnI New England Biolabs R0176 S
EcoRI New England BioLabs R0101S
EcoRI-HF New England Biolabs R3101
HindIII-HF New England Biolabs R3104 S
HpaII NEB R0171 S
KpnI-HF New England Biolabs R3142 S
MfeI-HF New England Biolabs R3589 S
NheI-HF New England BioLabs R3131 S
NotI-HF New England BioLabs R3189 S
PacI New England Biolabs R0547 S
PstI-HF New England Biolabs R3140 S
PvuI-HF New England BioLabs R3150S
SalI-HF New England Biolabs R3138 S
Sau3AI NEB R0169 S
SpeI-HF New England BioLabs R3133 S
XbaI New England BioLabs R0145 S


Bacterial Strains

Strain Supplier Catalog Number
E. coli DH10ß New England Biolabs C3019
E. coli Top10 Invitrogen C404010
E. coli Turbos
E. coli MG1655
E. coli OneShot
E. coli Bl21 (DE3)
Bacillus subtilis
Micrococcus lysodeikticus


Antibiotics and Media Supplements

Antibiotic Supplier Catalog Number Concentration stock solution Dilution Solvent
Ampicillin Anhydrous Crystalline Sigma-Aldrich Chemie GmbH A9393-5G 100 mg/ml 1:1000 H2O
Ampicillin Sodium Crystalline Sigma-Aldrich Chemie GmbH A9518-5G 100 mg/ml 1:1000 H2O
Chloramphenicol Crystalline Sigma-Aldrich Chemie GmbH C0378-5G 30 mg/ml 1:3000 Ethanol
Kanamycinsulfat Mixture of Componenta Sigma-Aldrich Chemie GmbH 60615-5G 50 mg/ml 1:1000 H2O
Tetracycline Sigma-Aldrich Chemie GmbH T7660 10 mg/ml 1:1000 Ethanol
Propionic Acid Sodium Insect Cell*Culture Sigma-Aldrich Chemie GmbH P5436-100G 100mM 10mM H2O
Bacitracin Sigma-Aldrich Chemie GmbH B0125-50KU - -


Media

Medium Supplier Catalog Number
SOC Outgrowth Medium New England Biolabs GmbH B9020 S
LB BROTH BASE Th. Geyer GmbH & Co KG SA/L3022/001000
LB Broth Powder Sigma-Aldrich Chemie GmbH L3022-1KG
M9 Minimal Salts SERVA 48505.01


Buffers

Buffer Supplier Catalog Number
NEBuffer Pack #4 (green) New England Biolabs GmbH B7004 S
NEBuffer Pack #1 (yellow) New England Biolabs GmbH B7001 S
NEBuffer Pack for T4 DNA Ligase New England Biolabs GmbH B0202 S
NEBuffer Pack #2 (blue) New England Biolabs GmbH B7002 S
NEBuffer Pack #3 (red) New England Biolabs GmbH B7003 S
TAE - Buffer (50X) for Molecular Biology VWR International GmbH A4686.1000
Gel Loading Buffer Sigma-Aldrich G2526-5ML
Tris Acetate-EDTA Buffer Sigma-Aldrich T9650-1L


Other Chemicals

Chemical Supplier Catalog Number
Isopropyl B-D-Thiogalactopyranoside 1 piece Sigma-Aldrich Chemie GmbH I5502-1G
Dimethyl Sulfoxide PCR Reagent Sigma-Aldrich Chemie GmbH D9170-1VL
Glycerol Sigma Grade Sigma-Aldrich Chemie GmbH G9012-100ML
5-Bromo-4-Chloro-3-Indolyl B-D-*Galactop Sigma-Aldrich Chemie GmbH B4252-100MG
Bacteriological Agar Sigma-Aldrich Chemie GmbH A5306-250G
L-Plus-Arabinose Crystalline Sigma-Aldrich Chemie GmbH A3256-25G
Calciumchlorid Dihydrat Th. Geyer GmbH & Co KG SA/00223506/000500
Malt Extract from Starch Digestion Sigma-Aldrich Chemie GmbH M0383-100G
D(+)-Saccharose, ACS, for Micro-Biology Sigma-Aldrich Chemie GmbH 84100-1KG
Dimethyl Sulfoxide Plant Cell Culture*TE D4540-100ML
Sodium Hydroxide Anhydrous Pellets Th. Geyer GmbH & Co.KG SA/S5881/000500
TRIZMA(R) Hydrochloride PH 3.5-5.0 Sigma-Aldrich Chemie GmbH T6666-50G
L-Glutamine 200 MM Sterile Sigma-Aldrich Chemie GmbH G7513-20ML
Ethanol 96% Denatured Carl Roth GmbH & Co.KG T171.3
Propanol-2 Sigma-Aldrich Chemie GmbH 59309-1L
Natriumdodecylsulfat,SDS,99%, Ultra Pure 13904
Gold(III)-Chloride Carl Roth GmbH & Co.KG 5624.1
Pro-Leu Sigma-Aldrich Chemie GmbH P1130-1G
Nitric Acid 65% p.a. Iso Carl Roth GmbH & Co.KG X943.1
Mops, Sodium Sigma-Aldrich Chemie GmbH M9024-25G
L-Glutamine Sigma-Aldrich Chemie GmbH G7513-100ML
Chelating Resin Sigma-Aldrich Chemie GmbH C7901-50G
Potassium Hydroxide in Platellets 6751.3
Hydrochloric Acid 37% 4625.1
Pyruvic Acid Sigma-Aldrich Chemie GmbH 107360-25G
Fmoc-Orn(BOC)-OH 96.0 % 47560-5G-F
Glycerol >99.5% Sigma-Aldrich Chemie GmbH G9012-1L
Water Molecular Biology Reagent Sigma-Aldrich Chemie GmbH W4502-1L
Acetonitrile Sigma-Aldrich Chemie GmbH 34967-1L
Ascorbic Acid 99% Sigma-Aldrich Chemie GmbH A92902-100G
Imidazol 99% Carl Roth GmbH 3899.4
1,4-Dithiothreit p.a. 25g Carl Roth GmbH 6908.2
Phenylmethylsulfonylfluorid Carl Roth GmbH 6367.1
S-Adenosyl-L-Methionine Chloride (SAM) Sigma-Aldrich Chemie GmbH A7007-5MG
Boric Acid Carl Roth GmbH & Co.KG 6943.1
Fluorecine Isothiocyanate Isomer Sigma-Aldrich Chemie Gmb F7250-50MG
Hydroxylammonium chloride Sigma-Aldrich Chemie GmbH 159417-100G
Rotiphorese® Gel 40 (19:1) 250 ml Carl Roth GmbH 3030.2
Rotiphorese® Gel 30 (37,5:1) 1 l Carl Roth GmbH 3029.1
Albumin Bovine Fraction V Powder Sigma-Aldrich Chemie GmbH A9647-50G
Peptidoglycan from Micrococcusluteus Sigma-Aldrich Chemie GmbH 53243-10MG-F
Adenosine 5´-Triphosphate (ATP) NEB P0756 S

Electrophoresis

Reagent Supplier Catalog Number Concentration Solvent
Agarose Molecular Biology Reagent Th. Geyer GmbH & Co KG SA/A9539/000050 0.5% H2O
Agarose for Routine Use Sigma-Aldrich Chemie GmbH A9539-100G - -
Gel Loading Dye Purple NEB B7024 S


Primers and Oligos

Name Sequence
VF2 tgccacctgacgtctaagaa
VR attaccgcctttgagtgagc
pSB1C3_F_SspDnaE-N-taataat GACGCAGGTACAATTAAATAATAATACTAGTAGCGGCCGCTGCAG
pSB1C3_R_Flag-SspDnaE_C CTTTAACCTTGTCATCATCGTCTTTGTAGTCCATCTAGTACTTTCCTGTGTGACTCTAGAAGCG
SspDnaE-C_F_pSB1C3-Flag TACTAGATGGACTACAAAGACGATGATGACAAGGTTAAAGTTATCGGTCGTCGATCCC
SspDnaE-C_R_BsaI-ccdB CTCCCTTATACACAGCCAGTGGTCTCGAATTGTTTGTTAAAACAGTTGGCGGCGATAG
ccdB_F_SspDnaE-C-BsaI TTAACAAACAATTCGAGACCACTGGCTGTGTATAAGGGAGCCTGAC
ccdB_R_BsaI-SspDnaE-N TTAAAATTTCGGTACCAAAACTGAGGCAGCTAGTGAGACCCGCGTGGATCCGGCTTAC
SspDnaE-N_F_ccdB-BsaI GGTCTCACTAGCTGCCTCAGTTTTGGTACCG
SspDnaE-N_R_taataat-pSB1C3 GCGGCCGCTACTAGTATTATTATTTAATTGTACCTGCGTCAAGTAATG
SspDnaE-C_R_6His-BsaI-ccdB GCCAGTGGTCTCGAATTGATGGTGATGGTGATGGTGTTTGTTAAAACAGTTGGCGGCGATAG
ccdB_F_SspDnaE-C-6His-BsaI CAAACACCATCACCATCACCATCAATTCGAGACCACTGGCTGTGTATAAGGGAGCCTGAC
pSB1C3_F_NpuDnaE-N CGGGTTGATAATTTGCCGAATTAATAATACTAGTAGCGGCCGCTG
pSB1C3_R_FLAG-NpuDnaE-C CTTGTCGTCATCGTCTTTGTAGTCCATCTAGTACTTTCCTGTGTGACTCTAGAAGC
NpuDnaE-C_F_pSB1C3-FLAG AGGAAAGTACTAGATGGACTACAAAGACGATGACGACAAGCATATGATCAAAATAGCCACACG
NpuDnaE-C_R_BsaI-ccdB GCTCCCTTATACACAGCCAGTGGTCTCGAATTGATTGAAACAATTAGAAGCTATGAAGCC
ccdB_F_NpuDnaE-C-BsaI TTTCAATCAATTCGAGACCACTGGCTGTGTATAAGGGAGCC
ccdB_R_BasI-NpuDnaE-N CTTAAACAGCTAGTGAGACCCGCGTGGATCCGGCTTAC
NpuDnaE-N_F_BsaI-ccdB TAGTAAGCCGGATCCACGCGGGTCTCACTAGCTGTTTAAGCTATGAAACGGAAATATTG
NpuDnaE-N_R_pSB1C3 CCGCTACTAGTATTATTAATTCGGCAAATTATCAACCC
NpuDnaE-C_R_6His-BsaI-ccdB TGGTCTCGAATTGATGATGGTGATGGTGATGATTGAAACAATTAGAAGCTATGAAGCC
ccdB_F_NpuDnaE-C-6His-BsaI TGTTTCAATCATCACCATCACCATCATCAATTCGAGACCACTGGCTGTGTATAAGGGAGCC
BBa_E0040_F_EcoR1 GAAAGGAATTCATGCGTAAAGGAGAAGAACTTTTCACTGGAG
BBa_E0040_R_Spe1 TAGTAACTAGTTTTGTATAGTTCATCCATGCCATGTGTAATCC
DNMT1_P1_R_deg.seq.731-1602 GCATCCAGRTTGCTSCC
DNMT1_P2_R_deg.seq.731-1602 CCACCACACAGCATYTC
DNMT1_P3_F_both_seq.731-1602 ATGTGGGACCCGGCAGC
DNMT1_P4_F_deg.seq.731-1602 CAGTAYACCTTTCATGATGTG
LOV-I539E_mut_F TTTTGGTCTCAGAGGCCGCCGCCAAGCGGGTGAAGCTGGAC
LOV-I539E_mut_R ttttggtctcacctcattttctgcagttttcttaatcagcatg
LOV-C450A_mut_F ttttggtctcagccaggtttctacaaggtcctgaaactgatc
LOV-C450A_mut_R aaaaggtctcttggcgtttcttcccaaaatttcttcac
T7RBS BioBrick_F AAACTACGCTTTAGTAGCTTAATAACTCTGATAGTGCTAGTGTAGATCTC
T7RBS BioBrick_R PLACEHOLDER
T7RBS-IGEMHD_F PLACEHOLDER
T7RBS-IGEMHD_R PLACEHOLDER
pSBX-T7fwd AATTTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCGAATTCGCGGCCGCTT
pSBX-T7rev CTAGAAGCGGCCGCGAATTCGGGGAATTGTTATCCGCTCACAATTCCCCTATAGTGAGTCGTATTA
T7RBS-IGEMHD_F_v2 PLACEHOLDER
T7RBS-IGEMHD_R_v2 PLACEHOLDER
T7RBS BioBrick_F_v2 AATTCGCGGCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATA
T7RBS BioBrick_R_v2 CTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTCTAGAAGCGGCCGCG
Bba_E0040_F_BsaI=EcoR1 GAAAGGGTCTCGAATTCATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTC
Bba_E0040_R_His6_BsaI=Spe1 TAGTAGGTCTCACTAGTGTGGTGATGGTGATGATGTTTGTATAGTTCATCCATGCCATGTG
BsaI=EcoRI_null_BsaI=Spe1 GCAGCAGGTCTCAAATTATGCGACTAGAGAGACCGCTGCT
BsaI=SpeI_null_BsaI=EcoRI AGCAGCGGTCTCTCTAGTCGCATAATTTGAGACCTGCTGC
1F-smt3_pSB1A3 AATTCGCGGCCGCTTCTAGATGTCGGACTCAGAAGTCAATCAAGAAGC
2R-smt3_Tev_BsaI_ccdb TCTCTACCCTGGAAGTACAGGTTTTCGGATCCACCAATCTGTTCTCTGTGAGC
2F-ccdb_F_smt3_Tev_BsaI AGATTGGTGGATCCGAAAACCTGTACTTCCAGGGTAGAGACCACTGGCTGTGTATAAGGGAGCC
3R-ccdb_R-sortase-his6 GCCGCTACTAGTATTATTAGTGATGGTGATGGTGATGACCACCGGTTTCCGGAAGTGAGACCCGCGTGGATCCGGCTTACTAAAAGCC
3F-pSB1A3_F_ccdb-sortase-his6 GGTCATCACCATCACCATCACTAATAATACTAGTAGCGGCCGCTGCAGTCCG
1R-pSB1A3_smt3 TTCTTGATTGACTTCTGAGTCCGACATCTAGAAGCGGCCGCGAATTCC
ccdB_F_BsmBI AGAGACGACTGGCTGTGTATAAGGGAGCCTGAC
ccdB_R_BsmBI TGAGACGCGCGTGGATCCGGCTTACTAAAAG
mRFP_F_BsaI AGAGACCCAATACGCAAACCGCCTCTC
mRFP_R_BsaI TGAGACCTATAAACGCAGAAAGGCCCACC
T7RBS-IGEMHDv3_F AATTCGCGGCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGATCGGTGAAATGCACGACTGATAGTA
T7RBS-IGEMHDv3_R CTAGTACTATCAGTCGTGCATTTCACCGATCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTCTAGAAGCGGCCGCG
NpuDnaEN_F GTGGGCCTTTCTGCGTTTATAGGTCTCATGCTTAAGCTATGAAACGGAAATATTGACAG
NpuDnaEN_R GCTCCCTTATACACAGCCAGTCGTCTCTACCACCATTCGGCAAATTATCAACCCGCATC
NpuDnaEC_F GCCGGATCCACGCGCGTCTCAGGTGGAATCAAAATAGCCACACGTAAATATTTAGGCAAAC
NpuDnaEC_R GAGAGGCGGTTTGCGTATTGGGTCTCTGTTGGAAGCTATGAAGCCATTTTTGAGTGC
SspDnaEN_F PLACEHOLDER
SspDnaEN_R PLACEHOLDER
SspDnaEC_F PLACEHOLDER
SspDnaEC_R PLACEHOLDER
AssemBIyIntN-linker_F TGGTTAGTAGGGTGGC
AssemBIyIntN-linker_R ATTAGCCACCCTACTA
AssemBIyIntC-linker_F GATGGGTGGCGGTGGC
AssemBIyIntC-linker_R CACCGCCACCGCCACC
SB-prep-3P-1 gccgctgcagtccggcaaaaaa
SB-prep-2Ea atgaattccagaaatcatccttagcg
pSBX_F_ccdB-BsmBI GCCGGATCCACGCGCGTCTCATAATAAATCGGTGAAATGCACGACTGATAG
pSBX_R_BsmBI-ccdB GCTCCCTTATACACAGCCAGTCGTCTCTCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTC
pSBX_F_mRFP-BsaI GTGGGCCTTTCTGCGTTTATAGGTCTCATAATAAATCGGTGAAATGCACGACTGATAG
pSBX_R_BsaI-mRFP GAGAGGCGGTTTGCGTATTGGGTCTCTCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTC
pSBX_F_taataa TAATAAATCGGTGAAATGCACGACTGATAG
pSBX_R_atg CATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTC
GFP_F_pSBX TCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGATGCGTAAAGGAGAAGAACTTTTC
GFP_R_pSBX CTAGTACTATCAGTCGTGCATTTCACCGATTTATTATTTGTATAGTTCATCCATGCCATG
Lambda-Lys_F_pSBX TCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGGTAGAAATCAATAATCAACGTAAGGC
Lambda-Lys_R_pSBX CTAGTACTATCAGTCGTGCATTTCACCGATTTATTATACATCAATCTCTCTGACCGTTCCG
1F-ccdb_F_pSB1A3-bsaI ATTTCTGGAATTCGCGGCCGCTTCTAGATGTGAGACCACTGGCTGTGTATAAGGGAGCC
1R-pSB1A3_R_bsaI-sortase-his-pSB1A3 TTATACACAGCCAGTGGTCTCACATCTAGAAGCGGCCGCGAATTCC
SspDnaX-S11C_F TTAGTAAGCCGGATCCACGCGCGTCTCAGGTGGTGGCCTGCTGGTACACAACAGAGACCCAATACGCAAACCGCCTCTCCCC
SspDnaX-S11C_R GGGGAGAGGCGGTTTGCGTATTGGGTCTCTGTTGTGTACCAGCAGGCCACCACCTGAGACGCGCGTGGATCCGGCTTACTAA
SspGyrB-S11C_F TTAGTAAGCCGGATCCACGCGCGTCTCAGGTGGTGGTGTTTTCGTTCACAACAGAGACCCAATACGCAAACCGCCTCTCCCC
SspGyrB-S11C_R GGGGAGAGGCGGTTTGCGTATTGGGTCTCTGTTGTGAACGAAAACACCACCACCTGAGACGCGCGTGGATCCGGCTTACTAA
TerDnaE3-S11C_F TTAGTAAGCCGGATCCACGCGCGTCTCAGGTGGTGGTCTGATCGCGAGCAACAGAGACCCAATACGCAAACCGCCTCTCCCC
TerDnaE3-S11C_R GGGGAGAGGCGGTTTGCGTATTGGGTCTCTGTTGCTCGCGATCAGACCACCACCTGAGACGCGCGTGGATCCGGCTTACTAA
NpuDnaEN_R_taataa-pSBX CTAGTACTATCAGTCGTGCATTTCACCGATTTATTAATTCGGCAAATTATCAACCCGCATC
NpuDnaEC_F_pSB-T7RBS TCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGATCAAAATAGCCACACGTAAATATTTAGGC
AssemBIyIntN-linker+H6_F TGGTGGTCATCATCACCATCACCATTAG
AssemBIyIntN-linker+H6_R ATTACTAATGGTGATGGTGATGATGACC
AssemBIyIntC-linker+H6_F GATGCATCATCACCATCACCACGGT
AssemBIyIntC-linker+H6_R CACCACCGTGGTGATGGTGATGATG
GFPn_1-157_R_KGG_TGCT_BsaI CGTAGGTCTCGAGCACTTACCTCCTTTGTCTGCCATGATGTATACATTG
GFPn_1-64_R_KGG_TGCT_BsaI CGTAGGTCTCAAGCACTTACCTCCGAAAGTAGTGACAAGTGTTGGCC
GFPn_1-64_1-157_F_H6_GATG_BsaI GCATGGTCTCAGATGCATCATCACCATCACCACCGTAAAGGAGAAGAACTTTTC
GFPc_158-238_F_NWC_CAAC_BsaI GCATGGTCTCACAACTGCTGGAACCAAAAGAATGGAATCAAAGTTAAC
GFPc_65-238_F_NWC_CAAC_BsaI GCATGGTCTCACAACTGCTGGAACGGTTATGGTGTTCAATGCTTTGC
GFPc_65-238_158-238_R_H6_TAAT_BsaI CGTAGGTCTCTATTAGTGGTGATGGTGATGATGTTTGTATAGTTCATCCATGCCATGTG
mCherryN_1-168_R_KGG_TGCT_BsaI CGTAGGTCTCAAGCACTTACCTCCCTGCTTGATCTCGCCCTTC
mCherryN_1-168_F_H6_GATG_BsaI GCATGGTCTCAGATGCATCATCACCATCACCACGTGAGCAAGGGCG
mCherryC_169-236_R_H6_TAAT_BsaI CGTAGGTCTCTATTAGTGGTGATGGTGATGATGCTTGTACAGCTCGTCCATGC
mCherryC_169-236_F_NWC_CAAC_BsaI GCATGGTCTCACAACTGCTGGAACAGGCTGAAGCTGAAGGACG
mRFPn_1-168_R_KGG_TGCT_BsaI CGTAGGTCTCAAGCACTTACCTCCTTTCAGTTTCAGACGCATTTTGATTTC
mRFPn_1-154_R_KGG_TGCT_BsaI CGTAGGTCTCAAGCACTTACCTCCGTCTTCCGGGTACATACGTTCG
mRFPn_1-154_1-168_F_H6_GATG_BsaI GCATGGTCTCAGATGCATCATCACCATCACCACGCTTCCTCCGAAGACG
mRFPc_169-225_F_NWC_CAAC_BsaI GCATGGTCTCACAACTGCTGGAACGACGGTGGTCACTACGACG
mRFPc_155-225_F_NWC_CAAC_BsaI GCATGGTCTCACAACTGCTGGAACGGTGCTCTGAAAGGTGAAATC
mRFPc_155-225_169-225_R_H6_TAAT_BsaI CGTAGGTCTCTATTAGTGGTGATGGTGATGATGAGCACCGGTGGAGTG
RenLucN_1-229_R_KGG_TGCT_BsaI CGTAGGTCTCAAGCACTTACCTCCCTTAACGAGAGG
RenLucN_1-229_F_H6_GATG_BsaI GCATGGTCTCAGATGCATCATCACCATCACCACGCTTCCAAGGTGTACG
RenLucC_230-311_R_H6_TAAT_BsaI CGTAGGTCTCTATTAGTGGTGATGGTGATGATGTTACTGCTCGTTCTTCAGCACG
RenLucC_230-311_F_NWC_CAAC_BsaI GCATGGTCTCACAACTGCTGGAACAAGCCCGACGTCGTCC
FireLucN_1-437_R_KGG_TGCT_BsaI CGTAGGTCTCAAGCACTTACCTCCGCGGTCAACGATGAAG
FireLucN_1-437_F_H6_GATG_BsaI GCATGGTCTCAGATGCATCATCACCATCACCACGAAGACGCCAAAAAC
FireLucC_438-550_R_H6_TAAT_BsaI CGTAGGTCTCTATTAGTGGTGATGGTGATGATGCACGGCGATCTTTCC
FireLucC_438-550_F_F_NWC_CAAC_BsaI GCATGGTCTCACAACTGCTGGAACCTGAAGTCTCTGATTAAGTACAAAGGC
PCA(t7rbs-npuc-mrfp-npun-igemhd)_F_prefix CCCCGAATTCGCGGCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATG
PCA(t7rbs-npuc-mrfp-npun-igemhd)_R_SpeI CGCTACTAGTACTATCAGTCGTGCATTTCACCG
LambdaLys_F_BsaI_c-ext CTGGTCTCACAACTGCTGGGAAGTAGAAATCAATAATCAACGTAAGGCGTTCC
LambdaLys_R_HISTAG_n-ext_BsaI CTGGTCTCTAGCATTTACCACGGCCGCTGTGATGATGATGATGATGGCTGCCTACATCAATCTCTCTGACCGTTCCG
LambdaLys_R_RIGIDLINKER_n-ext_BsaI CTGGTCTCTAGCATTTACCACGCGGTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCGCCACCTACATCAATCTCTCTGACCGTTCCG
LambdyLys_R_FLEXLINKER_n-ext_BsaI CTGGTCTCTAGCATTTACCACGTCCAGAACCACCACCAGAACCACCTACATCAATCTCTCTGACCGTTCCG
Xyla_BB_F_RBS34_X GCCGCTTCTAGAGAAAGAGGAGAAATACTAGATGGCTAGCACAGACTACTGGCAAAATTG
Xyla_BB_R_SP GGAAGCCTGCAGCGGCCGCTACTAGTATTATTACCACACTGTTACGTTAGAACTTCCAC
Xyla_F_BsaI_C-ext CTGGTCTCACAACTGCTGGGAAGCTAGCACAGACTACTGGCAAAATTG
Xyla_F_BsaI_Destroyed-C-ext_His CTGGTCTCACAACGGCTGGGAAGCTAGCACAGACTACTGGCAAAATTG
Xyla_R_BsaI_N-ext CTGGTCTCTAGCATTTACCACGCCACACTGTTACGTTAGAACTTCCAC
Xyla_R_BsaI_N-ext_His CTGGTCTCTAGCATTTACCACGATGATGGTGATGGTGATGCCACACTGTTACGTTAGAACTTCCAC
2GateNinsert_F_X-T7RBS CCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGAGAGACCCAATACGCAAACC
2GateNinsert_R_SP CCGGACTGCAGCGGCCGCTACTAGTATTTATTATGAGACGCGCGTGGATC
2GateCinsert_F_X-T7RBS CGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGAGAGACGACTGGCTGTGTATAAGG
2GateCinsert_R_SP CCGGACTGCAGCGGCCGCTACTAGTATTATTATGAGACCTATAAACGCAGAAAGG
GFP^C_F_ TATGGTGTTCAATGCTTTGCGAG
GFP^C_R_H6 GTGGTGATGGTGATGATGTTTGTATAGTTCATCCATGCCATGTG
NpuDnaE^C_F_T7RBS-H6 GGAGATACTAGATGCATCATCACCATCACCACATCAAAATAGCCACACGTAAATATTTAGGC
NpuDnaE^C_R_GFP^C CTCGCAAAGCATTGAACACCATAACAATTAGAAGCTATGAAGCCATTTTTGAGTG
pSB_F_GFP^C-H6 AACTATACAAACATCATCACCATCACCACTAATAATACTAGTAGCGGCCGCTGC
pSB-T7RBS_R_H6 GATGGTGATGATGCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTC
GFP^N_F_T7RBS-H6 GGAGATACTAGATGCATCATCACCATCACCACCGTAAAGGAGAAGAACTTTTCACTGGA
GFP^N_R_NpuDnaE^N CAAAGTAGTGACAAGTGTTGGCCATG
NpuDnaE^N_F_GFP^N TGGCCAACACTTGTCACTACTTTGTGTTTAAGCTATGAAACGGAAATATTGAC
NpuDnaE^N_R_H6 GGTGATGATGATTCGGCAAATTATCAACCCGCATC
pSB_F_NpuDnaE^N-H6 GATAATTTGCCGAATCATCATCACCATCACCACTAATAATACTAGTAGCGGCCGCTGC
NpuDnaE^C_R_SN->AG-sfGFP^C GCAAAGCACTGAACACCATAGCAACCAGCAGCTATGAAGCCATTTTTGAGTGC
NpuDnaE^C_F_H6 CATCATCATATCAAAATAGCCACACGTAAATATTTAGGC
NpuDnaE^C_R_sfGFP GCAAAGCACTGAACACCATAGCAATTAGAAGCTATGAAGCCATTTTTGAGTG
sfGFP^C_F_NpuDnaE^C GCTATGGTGTTCAGTGCTTTGCTC
sfGFP^C_R_H6 GTGGTGGTGGTGGTGTTTGTACAGTTCATCCATACCATGC
pSB_F_H6-sfGFP^C GTACAAACACCACCACCACCACCACTAATAATACTAGTAGCGGCCGCTGC
pSB-T7RBS_R_NpuDnaE^C-H6 CGTGTGGCTATTTTGATATGATGATGATGATGATGCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTC
NpuDnaE^N_F_sfGFP^N GACGCTGTGTTTAAGCTATGAAACGGAAATATTGACAGTAG
NpuDnaE^N_R_H6 GATGATTCGGCAAATTATCAACCCGCATC
sfGFP^N_F_T7RBS-H6 GAGATACTAGATGCACCACCACCACCACCACCGTAAAGGCGAAGAGCTGTTC
sfGFP^N_R_NpuDnaE^N CGTTTCATAGCTTAAACACAGCGTCGTTACCAGAGTCG
pSB_F_NpuDnaE^N-H6 GGGTTGATAATTTGCCGAATCATCATCATCATCATCATTAATAATACTAGTAGCGGCCGCTGCAG
pSB-T7RBS_R_H6 GTGGTGGTGGTGCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTC
sfGFP^N_R_C->G-NpuDnaE^N CATAGCTTAAACCCAGCGTCGTTACCAGAGTCG
NpuDnaE^N_F_sfGFP-C>-G CGACGCTGGGTTTAAGCTATGAAACGGAAATATTGACAGTAG
pSBX1C3-Ter_F_KpnI CTAGGGTCTACGTGATCGAGGTACCTACTAGAGCCAGGCATCAAATAAAA
pSBX1C3-GFP_R_Ext_IntN_BamHI GATCGAGGATCCCGCCAGAGAGATCAGAGAGTCACCAGAGATGCAACCAGATTCACGCAGTTTGTATAGTTCATCCATGCCATG
BamHI-MTS_bs_minD-KpnI-**_F GATCCCCTTTACAGGTGCTTGAAGAGCAAAACAAAGGAATGATGGCTAAGATTAAGTCATTTTTCGGAGTAAGATCTTAATAAGGTAC
BamHI-MTS_bs_minD-KpnI-**_R CTTATTAAGATCTTACTCCGAAAAATGACTTAATCTTAGCCATCATTCCTTTGTTTTGCTCTTCAAGCACCTGTAAAGGG
SspDnaBC_F_M+H6 GCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGCATCATCACCATCACCACAGCACAGGAAAAAGAGTTTCTATTAAAGATT
SspDnaBC_R_N->A+SGG GCCGGACTGCAGCGGCCGCTACTAGTATTATTACCCGCCTGAGGCATGGACAATGATGTCATTGGC
SspDnaBC_F_M-noH6 GCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGAGCACAGGAAAAAGAGTTTCTATTAAAGATT
CPEC-GFP_F_MTS GCAAAACAAAGGAATGATGGCTAAGATTAAGTCATTTTTCGGAGTAAGATCTAATACTAGAGCCAGGCATCAAATAAAACGAAAG
CPEC-GFP_R_Next_Nint GCCAGAGAGATCAGAGAGTCACCAGAGATGCAACCAGATTCACGCAGTTATTATTTGTATAGTTCATCCATGCCATGTGTAATC
CPEC_GFP_Insert_oligo_F CTCTGGTGACTCTCTGATCTCTCTGGCGCCTTTACAGGTGCTTGAAGAGCAAAACAAAGGAATGATGGCTAAGATTAAGT
dnmt1insert_F_BsaI ATGTTCGGTCTCAGGGTGGCGGTGGCAAAGATCGCATTAGCTGGCTGGGTCAG
dnmt1insert_G_BsaI ATGTTCGGTCTCATGCGCTGCTCAGCAGACACAGTTTAATTTC
mRFP_F_BsmBIBsaI ACTTACGGTCTCACGCAAGAGACGCAATACGCAAACCGCCTCTC
mRFP_R_BsmBIBsaI GCTTACGGTCTCAGAAGAGAGACGTATAAACGCAGAAAGGCCCACC
LambdaLys_R_BsaI CTGGTCTCTTACATCAATCTCTCTGACCGTTCCG
ccdB_F_BsmBI-BsaI CTCGTCTCATGTAAGAGACCACTGGCTGTGTATAAGGGAGCCTGAC
ccdB_R_BsaI-BsmBI CTCGTCTCAAGCAAGAGACCCGCGTGGATCCGGCTTACTAAAAG
CPEC_GFP_Insert_oligo_R ACTTAATCTTAGCCATCATTCCTTTGTTTTGCTCTTCAAGCACCTGTAAAGGCGCCAGAGAGATCAGAGAGTCACCAGAG
Smt3_F_p2Zv2Npu_flag GATGGACTACAAAGACGATGACGACAAGTCGGACTCAGAAGTCAATCAAGAAGC
Smt3_R_p2Zv2Npu GGCTATTTTGATGGATCCACCAATCTGTTCTCTGTGAG
p2Zv2Npu_F_Smt3 GGTGGATCCATCAAAATAGCCACACGTAAATATTTAGGC
p2Zv2Npu_R_flag_Smt3 CTTGTCGTCATCGTCTTTGTAGTCCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTC
h6-linker_F TGTAGGCAGCCATCATCATCATCATCACAGCGGCCGTGGTAAA
h6-linker_R AGCATTTACCACGGCCGCTGTGATGATGATGATGATGGCTGCC
flex-linker_F TGTAGGTGGTTCTGGTGGTGGTTCTGGACGTGGTAAA
flex-linker_R AGCATTTACCACGTCCAGAACCACCACCAGAACCACC
rigid-linker_F TGTAGGTGGCGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCACCGCGTGGTAAA
rigid-linker_R AGCATTTACCACGCGGTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCGCCACC
ccdB-pSBX4C5-mRFP(N)_F AGAGACGACTGGCTGTGTATAAGGG
ccdB-pSBX4C5-mRFP-(N)_R TGAGACCTATAAACGCAGAAAGGC
mRFP-pSBX4C5-ccdB-(C)_F AGAGACCCAATACGCAAACCG
mRFP-pSBX4C5-ccdB-(C)_R TGAGACGCGCGTGGATC
NpuDnaEN_F_C->G-BsaI-mRFP GGCCTTTCTGCGTTTATAGGTCTCAGGCTTAAGCTATGAAACGGAAATATTGACA
NpuDnaEN_R BsmBI_ccdB CCCTTATACACAGCCAGTCGTCTCTACCACCATTCGGCAAATTATCAACCCG
Npu DnaEC_F_BsmBI_ccdB GATCCACGCGCGTCTCAGGTGGAATCAAAATAGCCACACGTAAATATTTAGG
NpuDnaEC_R SN->AG-BsaI-mRFP CGGTTTGCGTATTGGGTCTCTGCCTGCAGCTATGAAGCCATTTTTGAGTG
Universal-S11N_F_BsaI_mRFP GGCCTTTCTGCGTTTATAGGTCTC
Universal-S11N_R BsmBI_ccdB CCCTTATACACAGCCAGTCGTC
Ssp DnaX-S11N_F_C->G_BsaI_mRFP GGCCTTTCTGCGTTTATAGGTCTCAGGCTTAACCGGCGACAGCC
Ssp DnaX-S11C_F_BsmBI_ccdB GATCCACGCGCGTCTCAGGTGGTGGCCTGCTGGTA
Ssp DnaX-S11C_R_BsaI_mRFP CGGTTTGCGTATTGGGTCTCTGTTGTGTACCAGCAGGCCACCACC
Ssp DnaX-S11C_R CGGTTTGCGTATTGGGTCTCTGCCTGCTACCAGCAGGCCACCACC
Ssp GyrB-S11N_F_C->G_BsaI_mRFP GGCCTTTCTGCGTTTATAGGTCTCAGGCTTCAGCGGTGACACCCTG
Ssp GyrB-S11C_F_BsmBI_ccdB GATCCACGCGCGTCTCAGGTGGTGGTGTTTTCGTT
Ssp GyrB-S11C_R_BsaI_mRFP CGGTTTGCGTATTGGGTCTCTGTTGTGAACGAAAACACCACCACCTGAG
Ssp GyrB-S11C_R_BsaI_mRFP CGGTTTGCGTATTGGGTCTCTGCCTGCAACGAAAACACCACCACCTGAG
Ter DnaE3-S11N_F_C->G_BsaI_mRFP GGCCTTTCTGCGTTTATAGGTCTCAGGCTTAACTTACGAAACTGAGATCATGACC
Ter DnaE3-S11C_F_BsmBI_ccdB GATCCACGCGCGTCTCAGGTGGTGGTCTGATCGCG
Ter DnaE3-S11C_R_BsaI_mRFP CGGTTTGCGTATTGGGTCTCTGTTGCTCGCGATCAGACCACCACC
Ter DnaE3-S11C_R CGGTTTGCGTATTGGGTCTCTGCCTGCCGCGATCAGACCACCACC
dnmt1insert_R_Flag_BsaI GGTCTCAGAAGCTTGTCGTCATCGTCTTTGTAGTCTGCGCTGCTCAGCAGACACAG
DNMT1_Substrate_R_1stMedC GAAGCTGGGACTTCCGGGAGCTTC[5MedC]GATCTGAGAGTGCAA
DNMT1_Substrate_F_1stMedC TTGCACTCTCAGAT[5MedC]GGAAGCTCCCGGGAAGTCCCAGCTTC
DNMT1_Substrate_F_2MedC TTGCACTCTCAGAT[5MedC]GGAAGCTCC[5MedC]GGGAAGTCCCAGCTTC
DNMT1_Substrate_F TTGCACTCTCAGATCGGAAGCTCCCGGGAAGTCCCAGCTTC
DNMT1_Substrate_R GAAGCTGGGACTTCCGGGAGCTTCCGATCTGAGAGTGCAA
DNMT1_Substrate_R_2MedC GAAGCTGGGACTTC[5MedC]GGGAGCTTC[5MedC]GATCTGAGAGTGCAA
VF2-C7T TGCCACTTGACGTCTAAGAA
sfGFP_T65C_F CGACGCTGTGTTATGGTGTTCAGTGCTTTGCTC
sfGFP_T65C_R GAACACCATAACACAGCGTCGTTACCAGAGTCG
rfp_F_BsaI ACTTAACGCAAGAGACCCAATACGCAAACCGCCTCTCC
rfp_R_BsaI ACTTTCGAAGTGAGACCTATAAACGCAGAAAGGCCCACCC
LiLaLy_F_BsaI CTGGTCTCATAATAAATCGGTGAAATGCACGACTG
LiLaLy_R_IasB CTGGTCTCTTACATCAATCTCTCTGACCGTTCCG
H6+exteins-insert_F TGTAGGCAGCCATCATCATCATCATCACAGCGGCCGTGGTAAATGCTGGGAA
H6+exteins-insert_R ATTATTCCCAGCATTTACCACGGCCGCTGTGATGATGATGATGATGGCTGCC
XylaLin_F_BsmBI CTCGTCTCATAATAATACTAGTAGCGGCCGCTG
XylaLin_R_IBmsB CTCGTCTCTCCACACTGTTACGTTAGAACTTCCAC
H6insert(Xyla)_F GTGGGGCAGCCATCACCATCACCATCATAGTGGT
H6insert(Xyla)_R ATTAACCACTATGATGGTGATGGTGATGGCTGCC
H6insert+exteins(Xyla)_F GTGGCATCACCATCACCATCATCGTGGTAAATGCTGGGAA
H6insert+exteins(Xyla)_R ATTATTCCCAGCATTTACCACGATGATGGTGATGGTGATG
H6Smt3_F_BBprefix CGCTTCTAGATGGGCAGCAGCCATCATC
mRFPexp_F_H6-TEVc CACAGCAGCGGCGAAAACCTGTACTTCCAGGGTAGAGACCAATACGCAAACCGCCTCTC
mRFPexp_F_Smt3-TEVc-BsaI GTGGATCCGAAAACCTGTACTTCCAGGGTAGAGACCAATACGCAAACCGCCTCTC
mRFPexp_R_BBsuffix-mockSortAc GCTACTAGTATTATTAGGTTTCCGGAAGTGAGACCTATAAACGCAGAAAGGCCCACC
pSB**3_F_mockSortAc GGTCTCACTTCCGGAAACCTAATAATACTAGTAGCGGCCGCTGCAGTCC
pSB**3_R_Smt3 GCTGCTGCCCATCTAGAAGCGGCCGCGAATTC
pSB**3_R_TEVc-H6 GGTTTTCGCCGCTGCTGTGATGATGATGATGATGACTACTGCCCATCTAGAAGCGGCCGCGAATTC
Smt3_R_TEVc-BsaI CTGGAAGTACAGGTTTTCGGATCCACCAATCTGTTCTCTGTGAG
mRFPexp_F_TEVc-BsaI CAGTAGTGAGAATCTTTACTTCCAGGGTTGAGACCAATACGCAAACCGCCTCTCC
mRFPexp_R_BBsuffix-H6-SortAc CTAGTATTATTAGTGATGGTGATGGTGATGACCACCAGTTTCAGGAAGTGAGACCTATAAACGCAGAAAGGCCCACC
pSB**3_R_TEVc-BsaI CAACCCTGGAAGTAAAGATTCTCACTACTGCCCATCTAGAAGCGGCCGCGAATTCC
eGFP_F_BsaI-G5RM CAGAACGGTCTCAGGGTGGAGGAGGAGGAAGAATGGTGAGCAAGGGCGAGGAGC
eGFP_R_BsaI CAGAACGGTCTCAGAAGCTTGTACAGCTCGTCCATGCC
ccdB_F_BsaI-BsmBI CAGAACGGTCTCACGCATGAGACGACTGGCTGTGTATAAGGGAGCCTGAC
ccdB_R_BsaI-BsmBI CAGAACGGTCTCAGAAGTGAGACGCGCGTGGATCCGGCTTAC
DNMT1lnk_0901/1f-FLAG_F CGCAGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTGATTATAAAGATGATGATGATAAA
DNMT1lnk_0901/1f-FLAG_R CCAGTTTATCATCATCATCTTTATAATCACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC
DNMT1lnk_0825/1r-FLAG-p1F CGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAA
DNMT1lnk_0825/1r-FLAG-p1R TTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGC
DNMT1lnk_0825/1r-FLAG-p2F AAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCAGCAAGCGGAGCAGCAGCAGAAGCAGCAGCAAAAGATTATAAAGATGATGATGATAAA
DNMT1lnk_0825/1r-FLAG-p2R CCAGTTTATCATCATCATCTTTATAATCTTTTGCTGCTGCTTCTGCTGCTGCTCCGCTTGCTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGC
EX-BsaI-A-NN-IasB-S_F AATTCGCGGCCGCTTCTAGAGGTCTCCGATGCCTGCCTGCTAGAGACCTGTCTA
EX-BsaI-A-NN-IasB-S_R CTAGTAGACAGGTCTCTAGCAGGCAGGCATCGGAGACCTCTAGAAGCGGCCGCG
EX-BsaI-CC-O-IasB-S_F AATTCGCGGCCGCTTCTAGAGGTCTCCCAACCCTGCCTAATAGAGACCTGTCTA
EX-BsaI-CC-O-IasB-S_R CTAGTAGACAGGTCTCTATTAGGCAGGGTTGGGAGACCTCTAGAAGCGGCCGCG
SsrA-Ctag-BsaI-Cext_BsaI_F CAACTGCTGGGAAGGAGGAGGTGCTGCTAACGACGAAAACTACGCTCTGGCTGCT
SsrA-Ctag-BsaI-Cext_BsaI_R ATTAAGCAGCCAGAGCGTAGTTTTCGTCGTTAGCAGCACCTCCTCCTTCCCAGCA
MTS_bs_minD_C_term_F CAACTGCTGGGAAGGAGGAGGTCCTTTACAGGTGCTTGAAGAGCAAAACAAAGGAATGATGGCTAAGATTAAGTCATTTTTCGGAGTAAGATCT
MTS_bs_minD_C_term_R ATTAAGATCTTACTCCGAAAAATGACTTAATCTTAGCCATCATTCCTTTGTTTTGCTCTTCAAGCACCTGTAAAGGACCTCCTCCTTCCCAGCA
myristoilation-Ntag_F GATGGGCATCGGCAAGTCCAAGGGCGGAGGCAGGGGCAAG
myristoilation-Ntag_R AGCACTTGCCCCTGCCTCCGCCCTTGGACTTGCCGATGCC
NLS-Ntag_F GATGCCCAAGAAAAAGCGCAAGGTAGGCGGAGGCAGGGGCAAG
NLS-Ntag_R AGCACTTGCCCCTGCCTCCGCCTACCTTGCGCTTTTTCTTGGG
OmpA_linker-BsaI_F GGCCTTGGTCTCAGATGCATATGAAAGCTACTAAACTGGTACTGG
OmpA_linker-BsaI_R GGCCTTGGTCTCGAGCACTTGCCCCTAGAGCTCCCTCCTCCAGAAC
pel_B-Ntag_F GATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCGGCGGAGGCAGGGGCAAG
pel_B-Ntag_R AGCACTTGCCCCTGCCTCCGCCGGCCATCGCCGGCTGGGCAGCGAGGAGCAGCAGACCAGCAGCAGCGGTCGGCAGCAGGTATTT
PKI_NES-Ntag_F GATGTTGGCTTTGAAATTGGCTGGTTTGGATATTGGCGGAGGCAGGGGCAAG
PKI_NES-Ntag_R AGCACTTGCCCCTGCCTCCGCCAATATCCAAACCAGCCAATTTCAAAGCCAA
DNMT1_F_BsaI=CAAC-CWE ATGTTCGGTCTCACAACTGCTGGGAAAAAGATCGCATTAGCTGGCTGGGTCAG
ccdB_R_BsmBI=ATCA-H5SGRGK-TGCT=BsaI CAGAACGGTCTCAAGCATTTACCACGGCCGCTGTGATGATGATGATGATTGAGACGCGCGTGGATCCGGCTTAC
DMMT1_R_H6SGRGT-TGCT=BsaI CAGAACGGTCTCAAGCAGGTACCACGGCCGCTGTGATGATGATGATGATGTGCGCTGCTCAGCAGACACAG
SSpDnaBC_F_ccdB-CN ATCCACGCGCGTCTCAGGTGGTAGCACAGGAAAAAGAGTTTCTATTAAAG
SSpDnaBC_R_CC-mRFP CGGTTTGCGTATTGGGTCTCTGTTGTGGACAATGATGTCATTGGC
SSpDnaBC_R_CC*-mRFP CGGTTTGCGTATTGGGTCTCTGCCTGCGACAATGATGTCATTGGC
SspDnaBN_F_mRFP-NN GCCTTTCTGCGTTTATAGGTCTCATGCTTATCTGGTGACTCTCTGATCTCTCTGG
SspDnaBN_F_mRFP-NN* GCCTTTCTGCGTTTATAGGTCTCAGGCTTATCTGGTGACTCTCTGATCTCTCTGG
SspDnaBN_R_NC-ccdB CCTTATACACAGCCAGTCGTCTCTACCACCACGGGACGCCAGAGAGATCAGAGAGTCACCAG
CBD_His_BsaI_f ATGTATGGTCTCAGATGCATCATCACCATCACCACGGTGGAGGTACCACAAATCCTGGTGTATC
CBD_Nextein_BsaI_r AAGTTCGGTCTCGAGCCACCAGATTCACGCAGTTGAAGCTGCCACAAGGC
DNMT1_F_BsaI=GGGT-G ATGTTCGGTCTCAGGGTGGTAAAGATCGCATTAGCTGGCTGGGTCAG
AsLOV2-mutagenesis_middle_PstI_F GAAACTGTAGGTTTCTACAAGGTCCTGAAAC
AsLOV2_mutagenesis_middle_PstI_R AGGACCTTGTAGAAACCTACAGTTTCTTCC
ccdB_R_BsmBI=ATCA-H5SGRGT-TGCT=BsaI CAGAACGGTCTCAAGCAGGTACCACGGCCGCTGTGATGATGATGATGATTGAGACGCGCGTGGATCCGGCTTAC
DNMT1lnk_0901/1f-FLAG_R_v2 GAAGTTTATCATCATCATCTTTATAATCACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC
DNMT1lnk_0915/4r-FLAG_p2F AAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCAAAAACCGCAGCAGCAGAAGCAGCAGCAAAAGATTATAAAGATGATGATGATAAA
DNMT1lnk_0915/3f_p1F CGCAGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGT
DNMT1lnk_0915/3f_p1R GCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC
DNMT1lnk_0915/3f_p2F GGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCC
DNMT1lnk_0915/3f_p2R TGATGGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC
rigid+exteins-insert_F TGTAGGTGGCGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCACCGCGTGGTAAATGCTGGGAA
rigid+exteins-insert_R ATTATTCCCAGCATTTACCACGCGGTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCGCCACC
DNMT1lnk_0915/4r-FLAG_p2R GAAGTTTATCATCATCATCTTTATAATCTTTTGCTGCTGCTTCTGCTGCTGCGGTTTTTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGC
DNMT1lnk_0915/2r_p1F CGCAGCGGAAGCGGCGGCGAAAAACGTGCTGGCGGAAGCGGCGGCGAAAGAAGCGGCGGCGAAAGAAGCGGCGGCGA
DNMT1lnk_0915/2r_p1R TTCTTTCGCCGCCGCTTCTTTCGCCGCCGCTTCTTTCGCCGCCGCTTCCGCCAGCACGTTTTTCGCCGCCGCTTCCGC
DNMT1lnk_0915/2r_p2F AAGAAGCGGCGGCGAAAGAAGCGGCGGCGAAAGCGAACGTGCTGGCGGAAGCGGCGGCGAAAGAAGCGGCGGCGAAAC
DNMT1lnk_0915/2r_p2R TGATGTTTCGCCGCCGCTTCTTTCGCCGCCGCTTCCGCCAGCACGTTCGCTTTCGCCGCCGCTTCTTTCGCCGCCGC
DNMT1lnk_0915/6f_p1F CGCAGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGG
DNMT1lnk_0915/6f_p1R GCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC
DNMT1lnk_0915/6f_p2F TAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGATTATAAAGATGATGATGATAAA
DNMT1lnk_0915/6f_p2R GAAGTTTATCATCATCATCTTTATAATCGCTACCACCACCGCTACCACCACCGCTACCACCACC
DNMT1lnk_0915/1r_p1F CGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAAAC
DNMT1lnk_0915/1r_p1R GCACGTTTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGC
DNMT1lnk_0915/1r_p2F GTGCTGGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAA
DNMT1lnk_0915/1r_p2R TTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCCA
DNMT1lnk_0915/1r_p3F AAGAAGCAGCAGCAAAAGCTAACGTGCTGGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAA
DNMT1lnk_0915/1r_p3R GAAGTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCCAGCACGTTAGCTTTTGCTGCTGC
Backbone-H6_R GATCCGTGGTGGTGGTGGTGG
H6-Backbone_F GGTGGTCATCATCATCATCATCATTAATAATACTAGTAG
LOV-6_R_SspDnaXC GCAGTTGTGTACCAGCAGGCCTTCTTTCGCCGCTTCATCAATATTTTGTGCAGTTTTCTTAATCAGCATGAC
LOV-12_R_BsaIIasB CGAGACCACCTTATTGGTCTCCAATATTTTGTGCAGTTTTCTTAATCAGCATGAC
LOV-12_R_SspDnaXC GCAGTTGTGTACCAGCAGGCCAATATTTTGTGCAGTTTTCTTAATCAGCATGAC
sfGFPC_F_BsaIIasB GGAGACCAATAAGGTGGTCTCGTGCTATGGTGTTCAGTGCTTTGC
sfGFPC_F_SspDnaXC GCCTGCTGGTACACAACTGCTATGGTGTTCAGTGCTTTGC
sfGFPC_R_H6 ATGATGATGATGATGATGACCACCTTTGTACAGTTCATCCATACCATGCG
sfGFPN_F_H6 CACCACCACCACGGATCACGTAAAGGCGAAGAGCTGTTC
sfGFPN_R_SspDnaXN CTGGCTGTCGCCGGTTAAGCACAGCGTCGTTACCAGAG
sfGFPN_R_SspDnaXN* CTGGCTGTCGCCGGTTAAACCCAGCGTCGTTACCAG
SspDnaXN_F TTAACCGGCGACAGCC
SspDnaXC*-sfGFP_F_H6 CACCACCACCACGGATCAGGCCTGCTGGTAGCTGGTTGCTATGGTGTTCAGTGCTTTGC
SspDnaXC-sfGFP_F_H6 CACCACCACCACGGATCAGGCCTGCTGGTACACAACTGCTATGGTGTTCAGTGCTTTGC
SspDnaXN_R_H6 ATGATGATGATGATGATGACCACCGTTTGCAACGAAG
mRFP2-168_F_H6 CACCACCACCACGGATCAGCTTCCTCCGAAGACGTTATC
mRFP2-168_R_SspDnaXN CTGGCTGTCGCCGGTTAAGCATTCGTCGATACCAGATCCTTTCAGTTTCAGACGCATTTTG
mRFP2-168_R_SspDnaXN* CTGGCTGTCGCCGGTTAAACCTTCGTCGATACCAGATCCTTTCAGTTTCAGACGCATTTTG
mRFP169-225_F_-6-SspDnaXC-Ext GCCTGCTGGTACACAACTGCCACACCGACGGTGGTCACTACGACGC
mRFP169-225_F_-12-SspDnaXC-Ext-Jalpha GCCTGCTGGTACACAACTGCCACACCGCGAACCTGGACGGTGGTCACTACGACGC
mRFP169-225_F_BsaIIasB GGAGACCAATAAGGTGGTCTCGGGTGGTCACTACGACGCTGAAG
mRFP169-225_F_H6-SspDnaXC CACCACCACCACGGATCAGGCCTGCTGGTACACAACTGCCACACCGACGGTGGTCACTACGACGC
mRFP169-255_F_H6-SspDnaXC* CACCACCACCACGGATCAGGCCTGCTGGTAGCTGGTTGCCACACCGACGGTGGTCACTACGACGC
mRFP169-255_R_H6 ATGATGATGATGATGATGACCACCAGCACCGGTGGAGTGACG
LOV_F_H6 CACCACCACCACGGATCATTGGCTACTACACTTGAACGTATTG
GFPc*158-238_F_NWC_CAAC_BsaI GCATGGTCTCAAGGCTGCTGGAACCAAAAGAATGGAATCAAAGTTAACTTC
GFPc*_R_H6_TAAT=IasB CGTAGGTCTCTATTAGTGGTGATGGTGATGATGTTTGTATAGTTCATCCATGCCATG
GFPn*1-157_R_KGG_GGCT=IasB CGTAGGTCTCGAGCCCTTACCTCCTTTGTCTGCCATGATGTATACATTG
GFPn*_F_H6_GATG_BsaI GCATGGTCTCAGATGCATCATCACCATCACCACCGTAAAGGAGAAGAACTTTTCACTG
mCherryC*169-236_F_BsaI=AGGC-NWC GCATGGTCTCAAGGCTGCTGGAACAGGCTGAAGCTGAAGGACG
mCherryC*_R_H6-TAAT=IasB CGTAGGTCTCTATTAGTGGTGATGGTGATGATGCTTGTACAGCTCGTCCATGC
mCherryN*1-168_R_KGG-GGCT=IasB CGTAGGTCTCAAGCCCTTACCTCCCTGCTTGATCTCGCCCTT
mCherryN*_F_BsaI=GATG-H6 GCATGGTCTCAGATGCATCATCACCATCACCACGTGAGCAAGGGCGAGG
mRFPc*155-225_F_BsaI=AGGC-NWC GCATGGTCTCAAGGCTGCTGGAACGGTGCTCTGAAAGGTGAAATC
mRFPc*169-225_F_BsaI=AGGC-NWC GCATGGTCTCAAGGCTGCTGGAACGACGGTGGTCACTACGACG
mRFPc*_R_H6_TAAT=IasB CGTAGGTCTCTATTAGTGGTGATGGTGATGATGAGCACCGGTGGAGTG
mRFPn*1-154_R_KGG-GGCT=IasB CGTAGGTCTCAAGCCCTTACCTCCGTCTTCCGGGTACATACGTTC
mRFPn*1-168_R_KGG-GGCT=IasB CGTAGGTCTCAAGCCCTTACCTCCTTTCAGTTTCAGACGCATTTTG
mRFPn*_F_H6_BsaI=GATG GCATGGTCTCAGATGCATCATCACCATCACCACGCTTCCTCCGAAGACGTTATC
mRFP_F_BsmBI=GATG=IasB AATTATCGTCTCAGATGAGAGACCCAATACGCA
mRFP_R_BsaI=GGTG=IBmsB TAATATCGTCTCACACCTGAGACCTATAAACGCAG
mRFP_F_BsmBI=TGGT=IasB AATTATCGTCTCATGGTAGAGACCCAATACGCAA
mRFP_R_BsaI=TAAT=IBmsB TAATATCGTCTCAATTATGAGACCTATAAACGCAGAAAGG
bad1_F1 TGTAGGTGGTGCAGAAGCAGCTGCTAAAGAAGCAGCAGCTAAAGTTAACCTGACCGCTGCTGAAGCT
bad1_R1 TGCTGCAGCTTCAGCAGCGGTCAGGTTAACTTTAGCTGCTGCTTCTTTAGCAGCTGCTTCTGCACCACC
bad1_F2 GCAGCAAAAGAAGCTGCAGCTAAAGTGAACCTGACCGCAGCAGAAGCTGCTGCAAAACGCGGTACC
bad1_R2 AGCAGGTACCGCGTTTTGCAGCAGCTTCTGCTGCGGTCAGGTTCACTTTAGCTGCAGCTTCTTT
may1_F1 TGTAGGTGGTGCAGAAGCTGCTGCTAAAGAAGCTGCTGCAAAAGCAGCAGCTGCACATCCGGAAGCTGCAGAAGCTGC
may1_R1 TTTGCTGCAGCTTCTGCAGCTTCCGGATGTGCAGCTGCTGCTTTTGCAGCAGCTTCTTTAGCAGCAGCTTCTGCACCACC
may1_F2 AGCAAAAGAAGCTGCAGCTAAAGCTAAAACCGCTGCTGAAGCTGCAGCAAAAGAAGCTGCAGCGAAAGCACGCGGTACC
may1_R2 AGCAGGTACCGCGTGCTTTCGCTGCAGCTTCTTTTGCTGCAGCTTCAGCAGCGGTTTTAGCTTTAGCTGCAGCTTCT
sgt1_F TGTAGGTGGTGCAGAAGCAGCTGCTAAAGAAGCTGCTGCAAAACGCGGTACC
sgt1_R AGCAGGTACCGCGTTTTGCAGCAGCTTCTTTAGCAGCTGCTTCTGCACCACC
sgt2_F TGTAGGTGGTGCTGAAGCTGCAGCAAAAGCTGCAGCACATCCGGAAGCTGCAGAAGCTGCAGCTAAACGCGGTACC
sgt2_R AGCAGGTACCGCGTTTAGCTGCAGCTTCTGCAGCTTCCGGATGTGCTGCAGCTTTTGCTGCAGCTTCAGCACCACC
sho1_F TGTAGGTGGTCGCGGTACC
sho1_R AGCAGGTACCGCGACCACC
sho2_F TGTAGGTGGTGCAGAAGCAGCTGCTAAACGCGGTACC
sho2_R AGCAGGTACCGCGTTTAGCAGCTGCTTCTGCACCACC
LacI_F_VR CAGCTCACTCAAAGGCGGTAATACTTTACGGCTAGCTCAGTCCTAGG
LacI_R_pSB*C3 GTTATCCCCTGATTCTGTGGATAACCTTATTACTGCCCGCTTTCCAGTC
pSB*C3_F GGTTATCCACAGAATCAGGGG
pSB*C3_R GTATTACCGCCTTTGAGTGAGC
mRFP169-225_F_GSGIDECHT GATCTGGTATCGACGAATGCCACACCGACGGTGGTCACTACGACGC
mRFP169-225_F_GSGIDECHT-Jalpha GATCTGGTATCGACGAATGCCACACCGCGAACCTGGACGGTGGTCACTACGACGC
mRFP2-168_R_GSGIDECHT GGTGTGGCATTCGTCGATACCAGATCCTTTCAGTTTCAGACGCATTTTG
DNMT1lnk_0917/1r_p1F CGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGTAAATC
DNMT1lnk_0917/1r_p1R GTAAGATTTACTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGC
DNMT1lnk_0917/1r_p2F TTACAGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAA
DNMT1lnk_0917/1r_p2R TTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCTGCT
DNMT1lnk_0917/1r_p3F AAGAAGCAGCAGCAAAAGCTGTAAATCTTACAGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAA
DNMT1lnk_0917/1r_p3R GAAGTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCTGCTGTAAGATTTACAGCTTTTGCTGCTGC
DNMT1lnk_0917/2r_p1F CGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGTAAATCTTACAGCAGCAGAAG
DNMT1lnk_0917/2r_p1R GCTGCTTCTGCTGCTGTAAGATTTACTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGC
DNMT1lnk_0917/2r_p2F CAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAA
DNMT1lnk_0917/2r_p2R TTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCT
DNMT1lnk_0917/2r_p3F AGAAGCAGCAGCAAAAGCAGTAAATCTTACAGCAGCAGAAGCAGCAGCAAAAGCAC
DNMT1lnk_0917/2r_p3R TGATGTGCTTTTGCTGCTGCTTCTGCTGCTGTAAGATTTACTGCTTTTGCTGCTGC
mRFPexp_R_BsmBI=ATCA-H5SGRGT-TGCT=BsaI CAGAACGGTCTCAAGCAGGTACCACGGCCGCTGTGATGATGATGATGATGGAGACGTATAAACGCAGAAAGGCCCACC
mut-noPstIT-3A-GateNpuDnaE(C)SN->AG_F GGCTTCATAGCAGCAGGCAGAGACCCAATAC
mut-noPstIT-3A-GateNpuDnaE(C)SN->AG_R CTGCCTGCTGCTATGAAGCCATTTTTGAGTG
SspDnaE(N)_F_mRFP-NN GCCTTTCTGCGTTTATAGGTCTCATGCTTAAGTTTTGGTACCGAAATTTTAACC
SspDnaE(N)_R_NC-ccdB CCTTATACACAGCCAGTCGTCTCTACCACCACGGGATTTAATTGTACCTGCGTCAAGTAATG
SSpDnaE(C)_F_ccdB-CN ATCCACGCGCGTCTCAGGTGGTGTTAAAGTTATCGGTCGTCGATC
SSpDnaE(C)_R_CC-mRFP CGGTTTGCGTATTGGGTCTCTGTTGGCGGCGATAGC
univ#1long_F TGTAGGTGGTGCAGAAGCAGCAGCTAAAGAAGCT
univ#1long_R AGCTGCAGCTTCTTTAGCTGCTGCTTCTGCACCACC
univ#1short_F TGTAGGTGGTGCAGAAGCTGCT
univ#1short_R CTTTGCAGCAGCTTCTGCACCACC
univ#3_F GCTGAAGCAGCTGCTAAAGAAGCAGCAGCTAAAGAAGCTGCTGCTAAAGAAGCTGCAGCTAAAGAAGCAGCTGCT
univ#3_R TGCCTTAGCAGCTGCTTCTTTAGCTGCAGCTTCTTTAGCAGCAGCTTCTTTAGCTGCTGCTTCTTTAGCAGCTGC
bad2#2_F GCAAAGGTGAACCTGACAGCT
bad2#2_R TTCAGCAGCTGTCAGGTTCAC
bad2#4_F AAGGCAAAAACCGCAGCTGAAGCTGCTGCAAAAGAAGCTGCAGCTAAAGAAGCTGCTGCAAAAGCTCGTGGTACC
bad2#4_R AGCAGGTACCACGAGCTTTTGCAGCAGCTTCTTTAGCTGCAGCTTCTTTTGCAGCAGCTTCAGCTGCGGTTTT
bad3#2_F GCAAAGGCATCTCTGCCGGCAGCT
bad3#2_R TTCAGCAGCTGCCGGCAGAGATGC
bad3#4_F AAGGCAAACGTGCTGGCAGAAGCAGCTGCTAAAGCACGTGGTACC
bad3#4_R AGCAGGTACCACGTGCTTTAGCAGCTGCTTCTGCCAGCACGTT
bad4#2_F GCAGCTAAAGAAGCTGCTGCTAAAGAAGCAGCTGCTAAAGAAGCAGCAGCTAAAGCTGTGAACCTGACCGCA
bad4#2_R TTCAGCTGCGGTCAGGTTCACAGCTTTAGCTGCTGCTTCTTTAGCAGCTGCTTCTTTAGCAGCAGCTTCTTT
bad4#4_F AAGGCAGTGAACCTGACCGCAGCTGAAGCTGCAGCTAAAGAAGCAGCTGCTAA
bad4#4_R GCTTCTTTAGCAGCTGCTTCTTTAGCTGCAGCTTCAGCTGCGGTCAGGTTCAC
bad4#5_F AGAAGCAGCTGCTAAAGAAGCAGCTGCTAAAGAAGCAGCTGCTAAAGCACGTGGTACC
bad4#5_R AGCAGGTACCACGTGCTTTAGCAGCTGCTTCTTTAGCAGCTGCTTCTTTAGCAGCT
may2#2_F GCAAAGGCTAAAACCGCTGCTGAAGCAGCAGCTAAAGAAGCAGCTGCGAAACGTGGTACC
may2#2_R AGCAGGTACCACGTTTCGCAGCTGCTTCTTTAGCTGCTGCTTCAGCAGCGGTTTTAGC
may3#2_F GCAGCTAAAGCTACCGGTGATCTGGCTGCAGAAGCAGCTGCAAAAGAAGCTGCTGCAAAAGCTCGCGGTACC
may3#2_R AGCAGGTACCGCGAGCTTTTGCAGCAGCTTCTTTTGCAGCTGCTTCTGCAGCCAGATCACCGGTAGCTTT
ord1#2_F GCAGCTAAAGCTACCGGTGATCTGGCTGCTGAAGCAGCAGCTAAAGCTGCACGTGGTACC
ord1#2_R AGCAGGTACCACGTGCAGCTTTAGCTGCTGCTTCAGCAGCCAGATCACCGGTAGCTTT
ord2#2_F GCAAAGGCTGCTGCAGCTGATGGTACCCTGGCAGAAGCTGCTGCTAAAGCAGCTCGTGGTACC
ord2#2_R AGCAGGTACCACGAGCTGCTTTAGCAGCAGCTTCTGCCAGGGTACCATCAGCTGCAGCAGC
ord3#2_F GCAGCTAAAGCTAGCCTGCCGGCTGCTGCAGAAGCTGCTGCAAAAGAAGCTGCAGCTAAACGTGGTACC
ord3#2_R AGCAGGTACCACGTTTAGCTGCAGCTTCTTTTGCAGCAGCTTCTGCAGCAGCCGGCAGGCTAGCTTT
ord4#2_F GCAGCTAAAGCTACCGGTGATCTGGCAGCAGAAGCTGCAGCTAAACGTGGTACC
ord4#2_R AGCAGGTACCACGTTTAGCTGCAGCTTCTGCTGCCAGATCACCGGTAGCTTT
ord5#2_F GCAAAGGCTGCTACCGGTGATCTGGCAGCAGAAGCAGCTGCTAAAGCACGTGGTACC
ord5#2_R AGCAGGTACCACGTGCTTTAGCAGCTGCTTCTGCTGCCAGATCACCGGTAGCAGC
ord6#2_F GCAAAGGCTAGCCTGCCGGCTGCAGCTGAAGCTGCAGCGAAAGAAGCAGCAGCTAAAGCTCGCGGTACC
ord6#2_R AGCAGGTACCGCGAGCTTTAGCTGCTGCTTCTTTCGCTGCAGCTTCAGCTGCAGCCGGCAGGCTAGC
sgt3#2_F GCAAAGGTGAACCTGACCGCTGCTGAAGCTGCAGCTAAACGTGGTACC
sgt3#2_R AGCAGGTACCACGTTTAGCTGCAGCTTCAGCAGCGGTCAGGTTCAC
sgt4#2_F GCAAAGGCTGCAGCACATCCGGAAGCTGCTGAAGCAGCTGCAAAAGCACGTGGTACC
sgt4#2_R AGCAGGTACCACGTGCTTTTGCAGCTGCTTCAGCAGCTTCCGGATGTGCTGCAGC
sho3#2_F GCAAAGGCTACCGGTGATCTGGCAGAAGCAGCTGCTAAACGTGGTACC
sho3#2_R AGCAGGTACCACGTTTAGCAGCTGCTTCTGCCAGATCACCGGTAGC
rigid_RGT_F TGTAGGTGGCGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCACCGCGTGGTACC
rigid_RGT_R AGCAGGTACCACGCGGTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCGCCACC
ccdB_R_BsmBI=ATCA-H5SGRGT-TGCT=BsaI CAGAACGGTCTCAAGCAGGTACCACGGCCGCTGTGATGATGATGATGATTGAGACGCGCGTGGATCCGGCTTAC
ccdB_R_BsmBI=ATCA-H5SGRGT-iGEMHD CGTGCATTTCACCGATTTATTAGGTACCACGGCCGCTGTGATGATGATGATGATTGAGACGCGCGTGGATCCGGCTTAC
Smt3_F_T7RBS TTTGTTTAACTTTAAGAAGGAGATACTAGATGTCGGACTCAGAAGTCAATCAAGAAG
DNMT1_F_Smt3-CWE GTGGATGCTGGGAAAAAGATCGCATTAGCTGGCTGG
Smt3_R_CWE-DNMT1 TCTTTTTCCCAGCATCCACCAATCTGTTCTCTGTGAGC
DNMT1_R_H6SGRGT-iGEMHD CGTGCATTTCACCGATTTATTAGGTACCACGGCCGCTGTGATGATGATGATGATGTGCGCTGCTCAGCAGACAC
DNMT1_R_RFC10suffix TGCAGCGGCCGCTACTAGTATTATTATGCGCTGCTCAGCAGAC
DNMT1/BB1_R_DNMT1/BB2 CATACTGACCTGCTTGCAGAACACCAAAGG
DNMT1/BB2_F_DNMT1/BB1 GGTGTTCTGCAAGCAGGTCAGTATGGTGTTGC
DNMT1/BB2_R_DNMT1/BB3 CATCATGAAAGGTATATTGCAGTTTATGTGCAATAAC
DNMT1/BB3_F_DNMT1/BB2 GCACATAAACTGCAATATACCTTTCATGATGTG
pSB**3_F_TAATAA TAATAATACTAGTAGCGGCCGCTGCAGTCC
Cas9CtrlSplit1_Fw TGCTTCAACGGCGATAGCCTGCACGAG
Cas9CtrlSplit1_Re GTTGAAGCAGGACACCTGGGCTTTCTGG
Cas9CtrlSplit2_Fw GCCAGAGAGTACTGCTTCAACCAGACCACCCAGAAGG
Cas9CtrlSplit2_Re CTGGTTGAAGCAGTACTCTCTGGCCATTTCGATC
Cas9Split1C_F_CFN_NpuDnaEC CAACTGCTTCAACGGCGATAGTCTGCACGAGCAC
Cas9Split1N_R_NpuDnaEN CATAGCTCAAGCAGGACACCTGGGCTTTCTGGATG
Cas9Split2C_F_CF_NpuDnaEC CCAACTGCTTCAACCAGACCACCCAGAAGGG
Cas9Split2N_R_Y_NpuDnaEN CATAGCTCAAGCAGTACTCTCTGGCCATTTCGATC
mCherry_Fw_BamHI ATCGCGGATCCGGCACCATGGTGAGCAAGGGCGAGGAG
mCherry_Rv_HindIII GCGATAAGCTTCTACTTGTACAGCTCGTCCATGCCGC
NpuDnaECSplit1&2C_F_NLS_Flag AGACGATGACGATAAGCCAAAGAAGAAGCGGAAGGTCGGTGGTATCAAAATAGCCACACGTAAATATTTAGGC
NpuDnaECSplit1C_R_CFN_Cas9Split1C CTATCGCCGTTGAAGCAGTTGGAAGCTATGAAGCCATTTTTG
NpuDnaECSplit2C_R_CF_Cas9Split2C GTGGTCTGGTTGAAGCAGTTGGAAGCTATGAAGCCATTTTTG
NpuDnaENSplit1&2N_R_NLS CTCCGTGGATACCGACCTTCCGCTTCTTCTTTGGGGCACCACCATTCGGCAAATTATCAACCC
NpuDnaENSplit1N_F_Cas9Split1N CCAGGTGTCCTGCTTGAGCTATGAAACGG
NpuDnaENSplit2N_Fw_Y_Cas9Split2N GCCAGAGAGTACTGCTTGAGCTATGAAACGG
PCDna3.1Split1&2C_R_Flag_NLS CTTCTTTGGCTTATCGTCATCGTCTTTGTAATCCATGGTGGCGGATCCACTAG
PCDna3.1Split1N_F_NLS GAAGGTCGGTATCCACGGAGTCCCAGCAGCCTGAAAGCTTAAGTTTAAACCGCTGATCAGC
PCDna3.1Split2N_F_NLS GAAGGTCGGTATCCACGGAGTCCCAGCAGCCTGAAAGCTTAAGTTTAAACCGCTG
FS_47_Cas9#49535_BamHI_fw ATCGCGGATCCGCCACCATGGATTAC
FS_48_Cas9#49535_HindIII_rv GCGATAAGCTTTTTCTTTTTCTTAGCTTGACCAGC
LOV-muta-PstI-middle2_F GTGAAGAAATTTTGGGAAGAAACTGTAGGTTTCTACAAGGTCCTG
LOV-muta-PstI-middle2_R CAGTTTCAGGACCTTGTAGAAACCTACAGTTTCTTCCCAAAATTTC


Plasmids

NameDateBrief DescriptionGenotypePlasmid MapGenBank-File
pJJDuet30 https://www.addgene.org/11962/
pSFBAD09 https://www.addgene.org/11963/
pHYRSF1 https://www.addgene.org/34549/
pHYRSF1-02 https://www.addgene.org/24765/
pGBMCS-SortA https://www.addgene.org/21931/

Instruments

Instrument Type Manufacturer
Table Centrifuge Microfuge® 18 Centrifuge Beckman CoulterTM
Table Centrifuge Microfuge® 22R Centrifuge Beckman CoulterTM
Centrifuge Allegra X-12R Beckman CoulterTM
Shaker VORTEXGENIE 2 Scientific Industries, SITM
Heating plate (magnet stirrer)MR Hei-Standard Heidolph
Heatblock QBD4 Grant
Heatblock (shakeing function) Thermomixer comfort Eppendorf
PCR-MachineMyCyclerTM thermo cyclerBioRad
PCR-MachineT100 Therma CyclerBioRad
UV-Chamber Transluminator Vilber Lourmat
Scale (fine)PioneerTM PA114C OHAUS
ScalePioneerTM PA4101C OHAUS
FACS Cytomics FC 500 MPL Beckman Coulter
Fridge KTP 1750 Premium Liebherr
Freezer GP 1366 Premium Liebherr
HoodTischabzugWesemann® Laboreinrichtung
Draw-Off PumpVacuhand controlVacubrand
Incubator HT Multitron Version 2 INFORS
Plate Reader Infinite M200 Tecan
Computer Sun Microsystems
UV/VIS Spectrometer Ultrospec 3300 pro Amersham Biosciences
Photometer NanoDrop® ND-1000 Spectrophotometer peQLab Biotechnologie GmbH
Photometer NanoVue General Electric
Ice Machine MF22SCOTSMAN®
Gel Electrophoresis Chamber Mupid®-One Advance
Mini-PROTEAN Tetra Cell 165-8001 BioRad
Cell Density Meter Ultrospec10 Amersham Biosciences
PH-Meter PH-Meter 765 Calimatic Knick
Incubator Heraeus Thermo Scientific
Lyophilizer Gefriertrocknungsanlage ALPHA 1-2 LD Plus Best. Nr. 101521 Christ
Ultra Sonification Stick Sonoplus Gm 2070 (2002)Bandelin
Vacuum Manifold Qiavac 24 Plus QIAGEN
Gas Cartridge Ventil CV470 Burner 13883
NuPAGE(R) Novex 3-8% Tris-Acetate Gel 1 SDS-Gel Life Technologies GmbH


Lab Materials

Material Name Manufacturer
Bottle 50 ml, 100 ml, 200 ml, 500 ml, 1000 ml
Beaker 50 ml, 100 ml, 200 ml, 500 ml 1000 ml
Conical Flask 500 ml, 1000 ml, 100 ml
Conical Flask 300 ml
Single Channel Pipette Pipetman® P2, P20, P200, P1000 Gilson
Multichannel Pipette
Multistep Pipette
Pipette
Scalpels Bayha 13569
HISTRAP HP 5 X 1 ML, 5 EA Th. Geyer GmbH AM/17524701/000001
neoScrew-Microtubes 1,5 ml NEOLAB GMBH 290174576
CM SEPHADEX Sigma-Aldrich Chemie GmbH C50120-10G
Dialysis Tubing 1784.1 Carl Roth GmbH
Amicon Ultra 15ml 30K 8pk UFC903008 Merck Chemicals GmbH
0.2 ml PCR Tube, Flat Cap, Natural I1402-8200 Starlab GmbH
KLEENEX KIMWIPES Kimberly-Clark 4254
Microcentrifuge Tubes
Centrifugetubes
PCR 8-Strips
Gloves Nitril Gr. L Starlab powderfree Starlab
Gloves Nitril Gr. M Starlab powderfree Starlab
Gloves Nitril Gr. S Starlab powderfree Starlab
Filtertips
Inoculating Loop
Disposal Bags
Flasks
Plate
Petri Dishes P5731-500EA Sigma-Aldrich Chemie GmbH
Petri Dishes N221.2 Carl Roth GmbH & Co.KG
Petri Dishes 10558071 Fischer Scientific
TipOne® Pipette Tip S1110-1700 Starlab GmbH
TipOne® Pipette Tip, 1000µl, Graduated S1111-2721 Starlab GmbH
NeoBox-81 6er Set, je 1 x Transparent, g 22916
NeoLab-Marker for Reaction-Flaks 19079
Gene Pulser/MicroPulser Cuvettes, 0.1 cm 165-2089
NeoLab-Paper Scissors, 23 cm Long, Even 23272
TipOne® Pipette Tip, 200µl S1110-1700 Starlab GmbH
TipOne® Pipette Tip, 10µl, Graduated, Re S1111-3700 Starlab GmbH
Pipette, 5 ml 606180 Greiner bio-one GmbH
Micro Plates, 96 well 655101 Greiner bio-one GmbH
Ring out of Plumbum with Vinyl Coating, 57 mm In 310161013 NEOLAB GmbH
Reaction Tube,S.L.1.5 ml,Colorless. 12682 Eppendorf, Fisher Scientific GmbH
Reaction Tube,S.L.,2 ml, Colorless 12776 Eppendorf
NeoTape-Writing Tape, 13 mm, Gray 280126114 NEOLAB GMBH
NeoTape-Writing Tape, 25 mm, Salmon-Colored 280126229 NEOLAB GMBH
10 ml Serological Pipette, Filter, Sterile E4860-1011 Starlab GmbH
Gloves Latex + Alovera L 14089
Gloves Latex + Alovera M 14088
Gloves Latex + Alovera S 14087
CYTOONE 96W F-BTM TC PLT CC7682-7596 Starlab Gmbh
PH-Stripes WHAT10362000 PANPEHA PLUS
PCR Plates 96 well GK96HIGH Kisker Biotec
100 Run24Barcode 20110099-100 GATC Biotech AG
Adhesive PCR Film 82-0558-A Peqlab GmbH
Tube Conical, Polypropylen, 50 ml 352070 NEOLAB GMBH
Gene Pulser/MicroPulser Cuvettes, 0.1 cm 165-2089 Bio-Rad Laboratories GmbH
0.2 ml 8-Tube Strips Without Caps, Nature TBS-0201 Bio-Rad Laboratories GmbH
Round-Bottom Tubule, Polypropylen, 14 ml 352059 NEOLAB GMBH
Optical Flat 8-Cap Strips TCS-0803 Bio-Rad Laboratories GmbH
Inoculation Loop 10 µl, Blue, Sterile 2900254437
Corning Serological Pipette 50 ml 14303
Weighing Dish 500 ST 1884.1 Carl Roth GmbH & Co.KG
Filter Paper Z274836-1PAK Sigma-Aldrich Chemie GmbH
Inoculation Loop 10 µl 2900254437 NEOLAB GMBH
Immobilon-PSQ Membran, PVDF ISEQ00010 Merck Milipore


Further Recipies and Stocks

Ampicillin Stock Solution

Stock Ampicillin 100 mg / ml
Amount 50 ml
Storage -24°C freezer
Notes Use in 1:1000 dilution


Chloramphenicol Stock Solution

Stock Chloramphenicol 30 mg / ml
Amount 10 ml
Storage -24°C freezer
Notes Solved in 100% ethanol. Use in 1:3000 dilution

E.Coli BAP 1 Glycerol Stock

Stock E. coli BAP1 glycerol stock
Amount 2 x 1.3 ml
Storage -80°C freezer

E.Coli BAP1, Competent

Stock E. coli BAP1
Amount 18 x 100 µl
Storage -80°C freezer
Notes Grows extremely fast. Be careful with miniPreps,
at least in cultures with ampicillin it tends
to degrade all available ampicillin
and then lose the respective plasmid.

E. coli BAP1-pKD46 Glycerol Stock

What E. coli BAP1-pKD46 glycerol stock (Ampr)
Amount 2 x 1.3 ml
Storage -80°C freezer
Notes Grow at 30°C only! Growth at 37°C
will lead to loss of pKD46 plasmid.

E.Coli BAP1-pLF03 Glycerol Stock

Stock E. coli BAP1-pLF03 glycerol stock (Ampr)
Amount 1 x 1.3 ml
Storage -80°C freezer
Notes Might have low amount of plasmid-carrying bacteria
due to long culturing time
(all Amp in medium cleaved)

E. Coli DH5a-pCP20 Glycerol Stock

Stock E. coli DH5a-pCP20 glycerol stock (Ampr, Cmr)
Amount 2 x 1.3 ml
Storage -80°C freezer
Notes Grow at 30°C only!
Growth at 37°C will lead to loss of pCP20 plasmid.

Heat-Shock Competent E. Coli TOP10

Stock E. coli TOP10, Heat-shock competent
Amount 200 x 100 µl
Storage -80°C freezer
Notes Verified on 2013-06-07.

Figure 3 Control transformation of competent TOP10 cells with 80 ng pSB4K5 with insert J04450 (IPTG-inducible mRFP production). Left: transformation with plasmid; right: transformation with water.

E. Coli TOP10-BBa I746200/pSB1AK3 Glycerol Stock

Stock E. coli TOP10-(BBa I746200 in pSB1AK3) (Ampr, Kanr)
Amount 1 x 1.3 ml
Storage -80°C freezer

E. Coli TOP10-BBa J04450/pSB3C5 Glycerol Stock

Stock E. coli TOP10-(BBa_J04450 in pSB3C5) glycerol stock (Cmr)
Amount 1 x 1.3 ml
Storage -80°C freezer

E. Coli TOP10-pIK1 Glycerol Stock

Stock E. coli TOP10-pIK1 glycerol stock (Cmr)
Amount 1 x 1.3 ml
Storage -80°C freezer

E. Coli TOP10-pKD46 Glycerol Stock

Stock E. coli TOP10-pKD46 glycerol stock (Ampr)
Amount 2 x 1.3 ml
Storage -80°C freezer
Notes Grow at 30°C only! Growth at 37°C
will lead to loss of pKD46 plasmid.

E. Coli TOP10-pMM65 Glycerol Stock

Stock E. coli TOP10-pMM65 glycerol stock (Kanr)
Amount 1 x 1.3 ml
Storage -80°C freezer

IPTG Stock Solution

Stock IPTG 23.8 mg / ml
Amount 10 ml
Storage -20°C freezer
Notes Use 0.1 to 1 mM

Kanamycin Stock Solution

Stock Kanamycin 50 mg / ml
Amount 10 ml
Storage -24°C freezer
Notes Use in 1:1000 dilution

M9 Medium

Name M9 Minimal Salts 5x, Powder
Amount 1 l
Storage room temperature
Notes close tightly, hygroscopic

  • Add 200 ml of sterile M9 salt solution to 750 ml sterile, distilled H2O (45-50°C)
  • Add sterile 20 ml 20% Glucose-solution, 2 ml 1 M MgSO4 and (optionally) 1 M CaCal

Reactivation Medium

for 1L

  • 5.0 g Peptone
  • 3.0 g Meat extract
  • 1000.0 ml Distilled water
Adjust pH to 7.0