Team:Heidelberg/Toolbox Guide

From 2014.igem.org

(Difference between revisions)
Line 122: Line 122:
</div>
</div>
<div data-bind="fadeVisible: data.q9A" style="display:none;">
<div data-bind="fadeVisible: data.q9A" style="display:none;">
-
<h3>Additionally, check the DNA sequence of your proteins for EcoRI, XbaI, SpeI, PstI and BsaI recognition sites. If there are E/X/S/P sites, you might have problems to change your backbone or add a promotor. If there is a BsaI recognition site, the cloning will be more difficult.</h3>
+
<h4>Additionally, check the DNA sequence of your proteins for EcoRI, XbaI, SpeI, PstI and BsaI recognition sites. If there are E/X/S/P sites, you might have problems to change your backbone or add a promotor. If there is a BsaI recognition site, the cloning will be more difficult.</h4>
<div class="panel panel-default">
<div class="panel panel-default">
<div class="panel-body">
<div class="panel-body">
Line 373: Line 373:
<li>Avoid self annealing</li>
<li>Avoid self annealing</li>
</ul>
</ul>
 +
 +
<!-- Module 4 -->
 +
<p>Design and order primers for your <span data-bind="if: data.linkerLength() == 2 || data.linkerLength() == 3">protein</span> insert. </p>
 +
<ol>
 +
<li><p>In 5'-3' direction, the forward primer should have the following sequence:</p>
 +
<p>CT GGTCTCA <span data-bind="if: !data.useSortase()">CAAC</span><span data-bind="if: data.useSortase()">GGGT</span><span data-bind="if: data.exteins().N == 'RGK' || data.exteins().N == 'RGT'">TGCTGGGAA</span><span data-bind="if: data.exteins().N == 'AEY'">TGCTTCAAC</span><span data-bind="if: data.exteins().N == 'XXX'">TGC</span> + binding part
 +
(=additional random nucleotides, BsaI site, <span data-bind="if: !data.useSortase()">RFC <span data-bind="text: RFCnumber"></span> E</span> <span data-bind="if: data.useSortase()">overhang</span><span data-bind="if: data.exteins().N == 'RGK' || data.exteins().N == 'RGT'">, CWE</span><span data-bind="if: data.exteins().N == 'AEY'">, CFN</span><span data-bind="if: data.exteins().N == 'XXX'">, Cys</span>)
 +
</p>
 +
</li>
 +
<li><p>In 5'-3' direction, the reverse primer should have the following sequence:</p>
 +
<p><span data-bind="if: data.linkerLength() == 1 || data.linkerLength() == 2 || !data.gotProteinStructure()">CT GGTCTCT + binding part
 +
(=additional random nucleotides, BsaI site)</span>
 +
<span data-bind="if: data.endsAreClose() || data.linkerLength() == 0 || data.linkerLength() == 1">CT GGTCTCT <span data-bind="if: !data.useSortase()">AGCA</span><span data-bind="if: data.useSortase()">GAAG</span> <span data-bind="if: data.exteins().N == 'RGK'">TTTACCACG</span><span data-bind="if: data.exteins().N == 'RGT'"> GGTACCACG</span><span data-bind="if: data.exteins().N == 'AEY'">ATATTCCGC</span> <span data-bind="if: data.linkerLength() == 1">+ linker sequence (reverse complement)</span> + binding part
 +
(=additional random nucleotides, BsaI site, <span data-bind="if: !data.useSortase()">RFC <span data-bind="text: RFCnumber"></span> B</span><span data-bind="if: data.useSortase()">overhang</span> <span data-bind="if: data.exteins().N == 'RGK'">, RGK</span><span data-bind="if: data.exteins().N == 'RGT'">, RGT</span><span data-bind="if: data.exteins().N == 'AEY'">, AEY</span><span data-bind="if: data.exteins().N == 'RGK' || data.exteins().N == 'RGT' || data.exteins().N == 'AEY'">reverse complement</span>)</span>
 +
</p>
 +
</li>
 +
<li data-bind="if: (data.linkerLength() == 1 &amp;&amp; data.testSeveral()) || data.proteinSize() == 0 || data.proteinSize() == 1 || data.proteinSize() == 2">
 +
<p>For any additional linker you want to test, you just need one additional reverse primer with the corresponding reverse complement linker DNA sequence.</p>
 +
</li>
 +
</ol>
 +
<p>The Tm values of the binding parts should be between 60 °C and 70 °C and as similar as possible.</p>
 +
<span data-bind="if: data.linkerLength() == 2 || data.linkerLength() == 3 || data.proteinSize() == 3 || data.proteinSize() == 4 || data.proteinSize() == 5">
 +
Design and order oligos for your linker insert<span data-bind="if: data.testSeveral() || !data.gotProteinStructure()">s</span>.
 +
<ol>
 +
<li>
 +
<p>
 +
In 5'-3' direction, the forward <span data-bind="if: !data.linkerLength() == 3">oligo</span><span data-bind="if: data.linkerLength() == 3">strand</span> should have the following sequence:
 +
</p>
 +
<p>
 +
Last 4 nucleotides of your protein + linker sequence + <span data-bind="if: data.exteins().N == 'RGK'">CGTGGTAAA (=RGK)</span><span data-bind="if: data.exteins().N == 'RGT'">CGTGGTACC (=RGT)</span><span data-bind="if: data.exteins().N == 'AEY'">GCGGAATAT (=AEY)</span>
 +
</p>
 +
</li>
 +
<li>
 +
<p>
 +
In 5'-3' direction, the reverse <span data-bind="if: !data.linkerLength() == 3">oligo</span><span data-bind="if: data.linkerLength() == 3">strand</span> should have the following sequence:</p>
 +
<p><span data-bind="if: !data.useSortase()">AGCA</span><span data-bind="if: data.useSortase()">GAAG</span> <span data-bind="if: data.exteins().N == 'RGK'">TTTACCACG</span><span data-bind="if: data.exteins().N == 'RGT'">GGTACCACG</span><span data-bind="if: data.exteins().N == 'AEY'">ATATTCCGC</span> + linker sequence (reverse complement)
 +
(=<span data-bind="if: !data.useSortase()">RFC <span data-bind="text: RFCnumber"></span> B</span> <span data-bind="if: data.useSortase()">overhang</span> <span data-bind="if: data.exteins().N == 'RGK'">, RGK)</span><span data-bind="if: data.exteins().N == 'RGT'">, RGT</span><span data-bind="if: data.exteins().N == 'AEY'">, AEY</span><span data-bind="if: data.exteins().N == 'RGK' || data.exteins().N == 'RGT' || data.exteins().N == 'AEY'">reverse complement</span>)
 +
 +
</p>
 +
</li>
 +
</ol>
 +
</span> <!-- Strange span ... check with max-->
 +
 +
<span data-bind="if: data.linkerLength() == 3">Probably these oligos would be longer than 90 nucleotides. In this case we recommend you to split the insert into several smaller inserts and order them as pairs of oligos. Use overhangs of 4-6 nucleotides and be careful that every overhang remains unique.
 +
The largest linker we have successfully cloned this way was composed of 65 amino acids. ]
 +
<span data-bind="if: data.testSeveral() || !data.gotProteinStructure()">For any additional linker you want to test, you just need another linker insert with the corresponding linker sequence.</span>
 +
</span>
</div>
</div>
</div>
</div>

Revision as of 09:39, 16 October 2014

use the intein
TOOLBOX to
CIRCULARIZE
OLIGOMERIZE
FUSE & TAG
PURIFY
ACTIVATE &
DEACTIVATE

Please go to www.rcsb.org and get a pdb file of your protein. If the 3D structure of your protein is known, we will be able to provide you an appropriate linker.

If the 3D structure is unknown, we will help you to find a set of potentially suitable linkers.

Additionally, check the DNA sequence of your proteins for EcoRI, XbaI, SpeI, PstI and BsaI recognition sites. If there are E/X/S/P sites, you might have problems to change your backbone or add a promotor. If there is a BsaI recognition site, the cloning will be more difficult.

Do you want to use split inteins or sortase to circularize your protein?

  • Successfully used in our project
  • High efficiency
  • In vivo circularization
  • In vitro only
  • Well-purified protein required
  • Not successfully tested yet

Can your protein be easily expressed in E. coli?

Which exteins do you want to use? They will remain as scars in your circular protein.

If you want to save time, check manually whether the ends are close together (approx.  Å or closer). For example, you can use the Swiss-PdbViewer or PyMOL.

Please use to generate a linker for your circular protein. [LINK] This step might take up to 11 days.
NILS – hier könnte dein instruction-file-ersatz stehen
NILS – hier auch
NILS – hier immernoch
NILS – hier ebnfalls und auch gerne noch umfangreicher
Please save this link:
https://2014.igem.org/#
 Clipboard icon Copy to clipboard
In order to generate your linker, needs to know the scar amino acid sequence that is caused by circularization. In your case, it is .

Hello again. What is the result of ?

Have you decided to use one linker or try different linkers?

How large is your protein?

Protocol:

Get BBa_K1362000123 NpuDnaE intein RFC Sortase A circularization construct (with FLAG and Smt3)(with His6)(with Smt3 and His6) from the registry.

Get the DNA of the protein you want to circularize.

We recommend you to try circularization without a linker and with flexible GS-linkers of different lenghts up to 81015202530 amino acids (including exteins).

Backtranslate the amino acid sequence of your linkers to a nucleic acid sequence. Be aware of:
  • Balanced GC-content
  • Restriction sites (especially PstI)
  • Codon usage
  • Avoid self annealing

Design and order primers for your protein insert.

  1. In 5'-3' direction, the forward primer should have the following sequence:

    CT GGTCTCA CAACGGGTTGCTGGGAATGCTTCAACTGC + binding part (=additional random nucleotides, BsaI site, RFC E overhang, CWE, CFN, Cys)

  2. In 5'-3' direction, the reverse primer should have the following sequence:

    CT GGTCTCT + binding part (=additional random nucleotides, BsaI site) CT GGTCTCT AGCAGAAG TTTACCACG GGTACCACGATATTCCGC + linker sequence (reverse complement) + binding part (=additional random nucleotides, BsaI site, RFC Boverhang , RGK, RGT, AEYreverse complement)

  3. For any additional linker you want to test, you just need one additional reverse primer with the corresponding reverse complement linker DNA sequence.

The Tm values of the binding parts should be between 60 °C and 70 °C and as similar as possible.

Design and order oligos for your linker inserts.

  1. In 5'-3' direction, the forward oligostrand should have the following sequence:

    Last 4 nucleotides of your protein + linker sequence + CGTGGTAAA (=RGK)CGTGGTACC (=RGT)GCGGAATAT (=AEY)

  2. In 5'-3' direction, the reverse oligostrand should have the following sequence:

    AGCAGAAG TTTACCACGGGTACCACGATATTCCGC + linker sequence (reverse complement) (=RFC B overhang , RGK), RGT, AEYreverse complement)

Probably these oligos would be longer than 90 nucleotides. In this case we recommend you to split the insert into several smaller inserts and order them as pairs of oligos. Use overhangs of 4-6 nucleotides and be careful that every overhang remains unique. The largest linker we have successfully cloned this way was composed of 65 amino acids. ] For any additional linker you want to test, you just need another linker insert with the corresponding linker sequence.

Retrieved from "http://2014.igem.org/Team:Heidelberg/Toolbox_Guide"