Team:Harvard BioDesign/Parts

From 2014.igem.org

(Difference between revisions)
 
(7 intermediate revisions not shown)
Line 70: Line 70:
<tr><td bgColor="#e7e7e7" colspan="3" height="1px"> </tr>
<tr><td bgColor="#e7e7e7" colspan="3" height="1px"> </tr>
<tr> <td colspan="3"  height="5px"> </td></tr>
<tr> <td colspan="3"  height="5px"> </td></tr>
-
 
+
</table>
<!--Parts Submitted to the Registry  -->
<!--Parts Submitted to the Registry  -->
 +
<table  width="70%" align="center">
<tr><td > <h3> Parts Submitted to the Registry </h3></td>
<tr><td > <h3> Parts Submitted to the Registry </h3></td>
-
<td ></td >
+
<tr><td>
-
<td > <h3>What information do I need to start putting my parts on the Registry? </h3></td>
+
-
</tr>
+
-
<tr>
+
-
<td width="45%"  valign="top">
+
-
<p>
+
-
An important aspect of the iGEM competition is the use and creation of standard  biological parts. Each team will make new parts during iGEM and will submit them to the <a href="http://partsregistry.org"> Registry of Standard Biological Parts</a>. The iGEM software provides an easy way to present the parts your team has created. The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox. 
+
-
 
+
-
<p>
+
-
<strong>Note that if you want to document a part you need to document it on the <a href="http://partsregistry.org Registry"> Registry</a>, not on your team wiki.</strong> Future teams and other users and are much more likely to find parts on the Registry than on your team wiki.
+
-
</p>
+
-
 
+
-
<p>
+
-
Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without a need to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.
+
-
</p>
+
-
 
+
-
 
+
-
 
+
-
<h3>When should you put parts into the Registry?</h3>
+
-
 
+
-
<p>
+
-
As soon as possible! We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better recall you will have of all details surrounding your parts. Remember you don't need to send us the DNA to create an entry for a part on the Registry. However, you must send us the sample/DNA before the Jamboree. Only parts for which you have sent us samples/DNA are eligible for awards and medal requirements.
+
-
</p>
+
-
</td>
+
-
 
+
-
<td > </td>
+
-
<td width="45%" valign="top">
+
-
 
+
-
<p>
+
-
The information needed to initially create a part on the Registry is:
+
-
</p>
+
<ol>
<ol>
<li>Part Name</li>
<li>Part Name</li>
 +
  <p><a href = "http://parts.igem.org/Part:BBa_K1457000">mRFP_Spycatcher</a></p>
<li>Part type</li>
<li>Part type</li>
 +
  <p>Coding</p>
<li>Creator</li>
<li>Creator</li>
-
<li>Sequence</li>
+
  <p>Michelle Long, Nicholas Larus-Stone, Jonah Saltzman, Tiana Raphel</p>
<li>Short Description (60 characters on what the DNA does)</li>
<li>Short Description (60 characters on what the DNA does)</li>
 +
  <p>This part is the coding sequence for a modified red fluorescent protein fused to 'Spycatcher' protein.</p>
<li>Long Description (Longer description of what the DNA does)</li>
<li>Long Description (Longer description of what the DNA does)</li>
 +
  <p>Spycatcher specifically amide bonds to an orthogonal polypeptide sequence called 'Spytag'. This part can be used to bind and detect any engineered constructs displaying Spytag. In our specific system, it is engineered to bind csgA protein fused to spytag and is applied extracellularly to easily detect CsgA production. The red chromoprotein in this part is conjugated to the SpyCatcher peptide tag. This tag has been demonstrated to spontaneously form a covalent bond to the corresponding SpyTag domain when the two come close to one another in a solution (Zakeri 2011). Therefore, this construct can be used to tag any protein or protein complex fused to a SpyTag domain with a red chromoprotein, allowing the complex to absorb light around the 490nm wavelength.</p>
<li>Design considerations</li>
<li>Design considerations</li>
 +
  <p>Included between the red chromoprotein and the SpyCatcher sequence is a short amino-acid linker sequence. This linker ensures that the SpyCatcher domain will be fully available to react with other SpyTag domains in the solution, and will be less likely to be unavailable to due the specific geometry of a direct chromoprotein-SpyCatcher fusion protein that lacks a linker sequence.</p>
 +
<li>Sequence</li>
 +
  <p>atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg
 +
aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta
 +
cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa
 +
gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc
 +
cggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaact
 +
gaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggac
 +
atcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctgattacgacatcccaacgaccgaaa
 +
acctgtattttcagggcgccatggttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctaccca
 +
tattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttca
 +
gatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattaccttta
 +
cagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatttaaat</p>
</ol>
</ol>
-
 
+
</td></tr>
-
<p>
+
</table>
-
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. Check out part <a href="http://parts.igem.org/Part:BBa_K404003">BBa_K404003</a> for an excellent example of a highly characterized part.
+
<table align="center">
-
</p>
+
-
 
+
-
<p>
+
-
You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry"> Add a Part to the Registry</a> link.
+
-
</p>
+
-
</td>
+
-
</tr>
+
-
 
+
-
 
+
-
<tr> <td colspan="3"  height="15px"> </td></tr>
+
<tr><td colspan="3" > <h3> Parts Table</h3></td></tr>
<tr><td colspan="3" > <h3> Parts Table</h3></td></tr>
-
<tr><td width="45%" colspan="3"  valign="top">
+
<tr><td width="45%" colspan="3"  valign="top"></td></tr>
-
Any parts your team has created will appear in this table below:</td></tr>
+
</table>
</table>
</html>
</html>
-
<groupparts>iGEM013 Harvard_BioDesign</groupparts>
+
<groupparts>iGEM014 Harvard_BioDesign</groupparts>

Latest revision as of 01:50, 18 October 2014


Home Team Project Parts Notebook Safety Attributions

Parts Submitted to the Registry

  1. Part Name

    2. mRFP_Spycatcher

  2. Part type

    3. Coding

  3. Creator

    4. Michelle Long, Nicholas Larus-Stone, Jonah Saltzman, Tiana Raphel

  4. Short Description (60 characters on what the DNA does)

    5. This part is the coding sequence for a modified red fluorescent protein fused to 'Spycatcher' protein.

  5. Long Description (Longer description of what the DNA does)

    6. Spycatcher specifically amide bonds to an orthogonal polypeptide sequence called 'Spytag'. This part can be used to bind and detect any engineered constructs displaying Spytag. In our specific system, it is engineered to bind csgA protein fused to spytag and is applied extracellularly to easily detect CsgA production. The red chromoprotein in this part is conjugated to the SpyCatcher peptide tag. This tag has been demonstrated to spontaneously form a covalent bond to the corresponding SpyTag domain when the two come close to one another in a solution (Zakeri 2011). Therefore, this construct can be used to tag any protein or protein complex fused to a SpyTag domain with a red chromoprotein, allowing the complex to absorb light around the 490nm wavelength.

  6. Design considerations

    7. Included between the red chromoprotein and the SpyCatcher sequence is a short amino-acid linker sequence. This linker ensures that the SpyCatcher domain will be fully available to react with other SpyTag domains in the solution, and will be less likely to be unavailable to due the specific geometry of a direct chromoprotein-SpyCatcher fusion protein that lacks a linker sequence.

  7. Sequence

    8. atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc cggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaact gaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggac atcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctgattacgacatcccaacgaccgaaa acctgtattttcagggcgccatggttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctaccca tattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttca gatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattaccttta cagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatttaaat

Parts Table

<groupparts>iGEM014 Harvard_BioDesign</groupparts>

Retrieved from "http://2014.igem.org/Team:Harvard_BioDesign/Parts"