Team:Evry/Notebook/Interlabstudy/week8
From 2014.igem.org
(5 intermediate revisions not shown) | |||
Line 10: | Line 10: | ||
<h2> 08.18.2014 </h2> | <h2> 08.18.2014 </h2> | ||
- | |||
<p align="justify"> Sequencing results were received for BBa_J23101 (26DJ62 and 26DJ63) and BBa_J23115 (26DJ64 and 26DJ65) PCR products. | <p align="justify"> Sequencing results were received for BBa_J23101 (26DJ62 and 26DJ63) and BBa_J23115 (26DJ64 and 26DJ65) PCR products. | ||
<br/> 26DJ62 <br/> <p align="justify">TCAGANNAAAAAAATCCTTAGCTNNCGCTAAGGATGANNTCTGGAATTCGCGGCCGCTTCTAGAG'''TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC'''TACTAGTAG CGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTC GCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAGAG</p> | <br/> 26DJ62 <br/> <p align="justify">TCAGANNAAAAAAATCCTTAGCTNNCGCTAAGGATGANNTCTGGAATTCGCGGCCGCTTCTAGAG'''TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC'''TACTAGTAG CGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTC GCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAGAG</p> | ||
Line 21: | Line 20: | ||
The mapping was perfect for BBa_J23101. There were 2 mismatches for BBa-J23115, one at 17 and the other t 21 on the promoter sequence that correspond to the K823012 as mentioned on 2014.igem.org/Tracks/Measurement/Measurement_Worksheet. The mapping was perfect between sequencing reads and K823012 sequence was perfect. | The mapping was perfect for BBa_J23101. There were 2 mismatches for BBa-J23115, one at 17 and the other t 21 on the promoter sequence that correspond to the K823012 as mentioned on 2014.igem.org/Tracks/Measurement/Measurement_Worksheet. The mapping was perfect between sequencing reads and K823012 sequence was perfect. | ||
- | <br/> Colony PCRs were performed on 8 colonies for BBa_E0240 and BBa_I20260. | + | <br/> |
+ | <br/> Colony PCRs were performed on 8 colonies for BBa_E0240 and BBa_I20260, form plates from the transformation of 16th August. | ||
<div class="center"> | <div class="center"> | ||
Line 81: | Line 81: | ||
</div> | </div> | ||
- | We decided to amplify the colony 1 for BBa_E0240 and BBa_I20260. So PCR products were purified via with the GeneJET purification kit (Thermo Scientific)followed by DNA quantification with the NanoDrop 2000 (Thermo Scientific). BBa_E0240 purified PCR product: 61 ng/µl and BBa_I20260 purified PCR product: 37.8 ng/µl. | + | We decided to amplify the colony 1 for BBa_E0240 and colony 2 BBa_I20260. So PCR products were purified via with the GeneJET purification kit (Thermo Scientific)followed by DNA quantification with the NanoDrop 2000 (Thermo Scientific). BBa_E0240 purified PCR product: 61 ng/µl and BBa_I20260 purified PCR product: 37.8 ng/µl. |
<br/> Purified PCR product aliquot was send to sequencing. The sequencing number were 26DJ68, 69, 70, 71. | <br/> Purified PCR product aliquot was send to sequencing. The sequencing number were 26DJ68, 69, 70, 71. | ||
- | <br/> Preparation of miniprep culture of BBa_I20260 and BBa_E0240 selected colonies in 5 ml of LB. Incubattion overnight at 37°C and 300 rpm. | + | <br/> Preparation of miniprep culture of BBa_I20260 and BBa_E0240 selected colonies in 5 ml of LB with respectively 5 µl of Kana or chloram solution stock.Incubattion overnight at 37°C and 300 rpm. |
<h2> 08.20.2014 </h2> | <h2> 08.20.2014 </h2> | ||
Line 90: | Line 90: | ||
<h2> 08.21.2014 </h2> | <h2> 08.21.2014 </h2> | ||
- | + | <br/>Transformations of registry parts (BBa_J23115 and J23101) were performed to obtain colonies with plasmid containing parts for future amplifications. <br/> The transformation was performed on DH5 alpha ''E. coli'', as followed: </p> | |
+ | <ol> | ||
+ | <li> Remove E. coli competent tubes from -80°C and keep it on ice | ||
+ | <li> Add 3 µl of template (here solubilized plasmids from the registry distribution kit) and mix gently | ||
+ | <li> Incubate 10 minutes on ice | ||
+ | <li> Perform an heat shock 30 seconds at 42°C | ||
+ | <li> Incubate 2 minutes on ice | ||
+ | <li> Add 2 ml of LB medium and incubate 60 minutes at 37°C with an agitation at 200 rpm | ||
+ | <li> Plate 200 µl of BBa_J23115 (K823012) on a chloramphenicol LB agar plate or ampiciline for BBa_J23101 | ||
+ | <li> Incubate plate overnight at 37°C | ||
+ | </ol> | ||
<h2> 08.22.2014 </h2> | <h2> 08.22.2014 </h2> | ||
+ | <br/> Transformation plate observation: | ||
+ | <br/>- BBa_J23101: nothing grown | ||
+ | <br/>- BBa_J23115 (K823012): 100-150 isolated colonies | ||
+ | <br/> | ||
+ | <br/> A PCR was performed on 8 colonies for BBa_J23115 (K823012) following the protocol Table 3 and 4. | ||
+ | |||
<h2> 08.23.2014 </h2> | <h2> 08.23.2014 </h2> |
Latest revision as of 13:27, 22 August 2014
Week 8
Interlab Study
08.18.2014
Sequencing results were received for BBa_J23101 (26DJ62 and 26DJ63) and BBa_J23115 (26DJ64 and 26DJ65) PCR products.
26DJ62
TCAGANNAAAAAAATCCTTAGCTNNCGCTAAGGATGANNTCTGGAATTCGCGGCCGCTTCTAGAG'''TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC'''TACTAGTAG CGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTC GCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAGAG
26DJ63
GAGCGCANCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGTTTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTG CAGCGGCCGCTACTAGTA'''GCTAGCATAATACCTAGGACTGAGCTAGCTGTAAA'''CTCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGGATTTTT TTTATCTGAAATTCTGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGCAAGGTGGCAAA
26DJ64
TCAGANNAAAAAAATCCTTAGCTNNCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAG'''GTTTATAGCTAGCTCA[[T]]CCT[[A]]GGTACAATGCTAGC'''TACTAG TAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGAC TCGCTGCGC TCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAGG
26DJ65
CNGCGAGTCAGTNAGCGAGGAAGCCTGCANNACGCGAAGTNATCTTTTTCGGTTTTAAAGAAAAAGGGCAGGGTGGTGACACCTNGCCCTTTTTTGCCGGACTGCAGC GGCCGCTACTAGTA'''GCTAGCATTGTACCTAGGACTGAGCTAGCTATAAA'''CTCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGGATTTTTTTTA TCTGAAATTCTGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAAC
The mapping was perfect for BBa_J23101. There were 2 mismatches for BBa-J23115, one at 17 and the other t 21 on the promoter sequence that correspond to the K823012 as mentioned on 2014.igem.org/Tracks/Measurement/Measurement_Worksheet. The mapping was perfect between sequencing reads and K823012 sequence was perfect.Colony PCRs were performed on 8 colonies for BBa_E0240 and BBa_I20260, form plates from the transformation of 16th August. 49 µl of mix were distributed in each PCR tubes. The One Taq PCR program was applied.
08.19.2014
Preparation of a 1% agarose gel: 1.01 g of Top Vision agarose (Thermo Scientific) + 100 ml of TAE 1X. Microwave 30s by 30s until agarose total dissolution Gel was cooling down until to be lukewarm, one BET drop was added. Gel was loaded with 10µl per sample previously added with 2 µl of loading dye 6X, and 5 µl for ladders. Gel running 45 minutes at 100 mV in TAE 1X buffer. We decided to amplify the colony 1 for BBa_E0240 and colony 2 BBa_I20260. So PCR products were purified via with the GeneJET purification kit (Thermo Scientific)followed by DNA quantification with the NanoDrop 2000 (Thermo Scientific). BBa_E0240 purified PCR product: 61 ng/µl and BBa_I20260 purified PCR product: 37.8 ng/µl.Purified PCR product aliquot was send to sequencing. The sequencing number were 26DJ68, 69, 70, 71.
Preparation of miniprep culture of BBa_I20260 and BBa_E0240 selected colonies in 5 ml of LB with respectively 5 µl of Kana or chloram solution stock.Incubattion overnight at 37°C and 300 rpm.
08.20.2014
Miniprep cultures from the 19th August was purified with the NucleoSpin Plasmid kit (Macherey-Nagel). DNA was quantify with the Nanodrop 2000. DNA concentrations and A260/280 were respectively for BBa_E0240 and BBa_I20260: 42 ng/µl and 1.91 ; 13.7 ng/µl and 1.71.08.21.2014
Transformations of registry parts (BBa_J23115 and J23101) were performed to obtain colonies with plasmid containing parts for future amplifications.
The transformation was performed on DH5 alpha ''E. coli'', as followed:
- Remove E. coli competent tubes from -80°C and keep it on ice
- Add 3 µl of template (here solubilized plasmids from the registry distribution kit) and mix gently
- Incubate 10 minutes on ice
- Perform an heat shock 30 seconds at 42°C
- Incubate 2 minutes on ice
- Add 2 ml of LB medium and incubate 60 minutes at 37°C with an agitation at 200 rpm
- Plate 200 µl of BBa_J23115 (K823012) on a chloramphenicol LB agar plate or ampiciline for BBa_J23101
- Incubate plate overnight at 37°C
08.22.2014
Transformation plate observation:
- BBa_J23101: nothing grown
- BBa_J23115 (K823012): 100-150 isolated colonies
A PCR was performed on 8 colonies for BBa_J23115 (K823012) following the protocol Table 3 and 4.