Team:Aix-Marseille/Parts

From 2014.igem.org

(Difference between revisions)
Line 92: Line 92:
       <!-- ******* -->
       <!-- ******* -->
       <div class="col-md-9 project">
       <div class="col-md-9 project">
-
        <br><br><br>
+
     
-
        <i>The list will be updated each time we'll create or modify a part</i>
+
-
        <br><br><br>
+
-
 
+
         <div class="project-section">
         <div class="project-section">
-
           <span class="project-tag" id="details"></span>
+
           <span class="project-tag" id="fav_parts"></span>
-
           <h1>Part BBa_K1349000</h1>
+
           <h1>Favorite parts</h1>
-
       
+
         
-
           <div class="project-subsection">
+
           <span class="project-tag" id="part001"></span>
-
            <span class="project-tag" id="serine_part"></span>
+
          <h2 class="subtitle">Part BBa_K1349001</h3>
-
            <h3 class="subtitle">Short description</h3>
+
          <p><a href="" target="_blank">Link to registry</a></p>
-
             <p>SerA_mut</p>
+
          <div class="parts-subsection">
 +
            <h3>Name</h3>
 +
             <p>RelA-2stop</p>
 +
           
 +
            <h3>Description</h3>
 +
            <p>The <i>relA</i> gene encodes a ppGpp synthetase. In bacteria, ppGpp (guanosine 3'-diphosphate 5-' diphosphate) acts as a signaling molecule that regulates a variety of cellular metabolisms in response to changes in the nutritional state of the cells. The relA sequence amplified from <i>E. coli</i> W3110 was mutated by site-directed mutagenesis to remove the PstI site.</p>
           </div>
           </div>
-
       
+
         
-
           <div class="project-subsection">
+
           <span class="project-tag" id="part002"></span>
-
            <span class="project-tag" id="serine_part"></span>
+
          <h2 class="subtitle">Part BBa_K1349002</h3>
-
            <h3 class="subtitle">DNA Sequence</h3>
+
          <p><a href="" target="_blank">Link to registry</a></p>
-
            <p>ATGGCAAAGGTATCGCTGGAGAAAGACAAGATTAAGTTTCTGCTGGTAGAAGGCGTGCACCAAAAGGCGC <br>TGGAAAGCCTTCGTGCAGCTGGTTACACCAACATCGAATTTCACAAAGGCGCGCTGGATGATGAACAATT <br>AAAAGAATCCATCCGCGATGCCCACTTCATCGGCCTGCGATCCCGTACCCATCTGACTGAAGACGTGATC <br>AACGCCGCAGAAAAACTGGTCGCTATTGGCTGTTTCTGTATCGGAACAAACCAGGTTGATCTGGATGCGG <br>CGGCAAAGCGCGGGATCCCGGTATTTAACGCACCGTTCTCAAATACGCGCTCTGTTGCGGAGCTGGTGAT <br>TGGCGAACTGCTGCTGCTATTGCGCGGCGTGCCGGAAGCCAATGCTAAAGCGCACCGTGGCGTGTGGAAC <br>AAACTGGCGGCGGGTTCTTTTGAAGCGCGCGGCAAAAAGCTGGGTATCATCGGCTACGGTCATATTGGTA <br>CGCAATTGGGCATTCTGGCTGAATCGCTGGGAATGTATGTTTACTTTTATGATATTGAAAATAAACTGCC <br>GCTGGGCAACGCCACTCAGGTACAGCATCTTTCTGACCTGCTGAATATGAGCGATGTGGTGAcgctGCAT <br>GTACCAGAGAATCCGTCCACCAAAAATATGATGGGCGCGAAAGAAATTTCACTAATGAAGCCCGGCTCGC <br>TGCTGATTAATGCTTCGCGCGGTACTGTGGTGGATATTCCGGCGCTGTGTGATGCGCTGGCGAGCAAACA <br>TCTGGCGGGGGCGGCAATCGACGTATTCCCGACGGAACCGGCGACCAATAGCGATCCATTTACCTCTCCG <br>CTGTGTGAATTCGACAACGTCCTTCTGACGCCACACATTGGCGGTTCGACTCAGGAAGCGCAGGAGAATA <br>TCGGCCTGGAAGTTGCGGGTAAATTGATCAAGTATTCTGACAATGGCTCAACGCTCTCTGCGGTGAACTT
+
           <div class="parts-subsection">
-
<br>CCCGGAAGTCTCGCTGCCACTGCACGGT</p>
+
             <h3>Name</h3>
-
          </div>
+
             <p>CusR box</p>
-
       
+
              
-
          <div class="project-subsection">
+
             <h3>Description</h3>
-
            <span class="project-tag" id="serine_part"></span>
+
             <p>The CusR box allow the binding of the CusR regulator. In <i>E. coli</i>, the CusR/CusS two-component system induces expression of genes involved in metal efflux under condition of elevated Cu concentration. Phosphorylated CusR specifically bind to CusR-dependent promoters.</p>
-
            <h3 class="subtitle">Logic and explanation for part and construction</h3>
+
-
            <p>This construct encodes a truncated version of E. coli W3110 SerA ( D-3-phosphoglycerate dehydrogenase), missing the last 75 aa of the full sequence, and without stop codon. SerA is requiered for serine biosynthesis. Following the work of Peters-Wendisch et al. 2005, this mutated version of the enzyme is expected to be no-longer inhibited by Serine, and to allow the production of a high serine concentration. </p>
+
-
          </div>
+
-
       
+
-
           <div class="project-subsection">
+
-
            <span class="project-tag" id="serine_part"></span>
+
-
             <h3 class="subtitle">Purpose</h3>
+
-
             <p>This part is designed to allow the synthesis of serine in E. coli without the normal feedback inhibition, thus permitting the accumulation of high concentrations.</p>
+
-
          </div>
+
-
       
+
-
          <div class="project-subsection">
+
-
             <span class="project-tag" id="serine_part"></span>
+
-
             <h3 class="subtitle">Origin and method of construction</h3>
+
-
             <p>The part was obtained by PCR from E.coli strain W3110 and SLIC assembly. The construction removed the EcoR1 restriction site in the gene by the silent mutations of a GAA codon to a GAG codon.</p>
+
-
          </div>
+
-
       
+
-
          <div class="project-subsection">
+
-
            <span class="project-tag" id="serine_part"></span>
+
-
            <h3 class="subtitle">Propreties expected and validation</h3>
+
-
            <p>We designed this sequence that in an E.coli mutant strain unable to catabolise serine correctly and without a serine import system, production of this coding sequence will lead to serine secretion into the growth media. The sequence does not contain a stop codon so it should be incorporated into composite bricks for testing synthesis and activity.</p>
+
-
          </div>
+
-
       
+
-
          <div class="project-subsection">
+
-
            <span class="project-tag" id="serine_part"></span>
+
-
            <h3 class="subtitle">Current backbone</h3>
+
-
            <p>pSB1C3</p>
+
-
          </div>
+
-
       
+
-
          <div class="project-subsection">
+
-
            <span class="project-tag" id="serine_part"></span>
+
-
            <h3 class="subtitle">Sequenced clone</h3>
+
-
            <p>ok SerA Cm1</p>
+
           </div>
           </div>
 +
        </div>
          
          
 +
        <div class="project-section">
 +
          <span class="project-tag" id="o_parts"></span>
 +
          <h1>Other parts</h1>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349000</h3>
 +
          <p class="parts-subsection"><a href="" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349003</h3>
 +
          <p class="parts-subsection"><a href="" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349004</h3>
 +
          <p class="parts-subsection"><a href="" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349005</h3>
 +
          <p class="parts-subsection"><a href="" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349006</h3>
 +
          <p class="parts-subsection"><a href="" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349007</h3>
 +
          <p class="parts-subsection"><a href="" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349008</h3>
 +
          <p class="parts-subsection"><a href="" target="_blank">Link to registry</a></p>
         </div>
         </div>
-
   
 
       </div> <!-- /Content -->
       </div> <!-- /Content -->
        
        
Line 161: Line 155:
           <ul class="nav">
           <ul class="nav">
             <li class="active">
             <li class="active">
-
               <a data-scroll href="#intro">Introduction</a>
+
               <a data-scroll href="#fav_parts">Favorite parts</a>
 +
              <ul class="nav">
 +
                <li><a data-scroll href="#part001">BBa_K1349001</a></li>
 +
                <li><a data-scroll href="#part002">BBa_K1349002</a></li>
 +
              </ul>
             </li>
             </li>
             <li>
             <li>
-
               <a data-scroll href="#mod_sys">Model system</a>
+
               <a data-scroll href="#o_parts">Other parts</a>
-
            </li>
+
-
            <li>
+
-
              <a data-scroll href="#simplify">Simplifying assumptions</a>
+
-
            </li>
+
-
            <li>
+
-
              <a data-scroll href="#diff_equa">Differential equations</a>
+
-
            </li>
+
-
            <li>
+
-
              <a data-scroll href="#init_val">Initial values</a>
+
-
            </li>
+
-
            <li>
+
-
              <a data-scroll href="#resolv_sys">Resolution of the system</a>
+
-
              <ul class="nav">
+
-
                <li><a data-scroll href="#case1">First case</a></li>
+
-
                <li><a data-scroll href="#case2">Second case</a></li>
+
-
                <li><a data-scroll href="#case3">Third case</a></li>
+
-
                <li><a data-scroll href="#case4">Fourth case</a></li>
+
-
              </ul>
+
             </li>
             </li>
           </ul>
           </ul>

Revision as of 22:31, 15 October 2014

Our parts

Favorite parts

Part BBa_K1349001

Link to registry

Name

RelA-2stop

Description

The relA gene encodes a ppGpp synthetase. In bacteria, ppGpp (guanosine 3'-diphosphate 5-' diphosphate) acts as a signaling molecule that regulates a variety of cellular metabolisms in response to changes in the nutritional state of the cells. The relA sequence amplified from E. coli W3110 was mutated by site-directed mutagenesis to remove the PstI site.

Part BBa_K1349002

Link to registry

Name

CusR box

Description

The CusR box allow the binding of the CusR regulator. In E. coli, the CusR/CusS two-component system induces expression of genes involved in metal efflux under condition of elevated Cu concentration. Phosphorylated CusR specifically bind to CusR-dependent promoters.

Other parts

Part BBa_K1349000

Link to registry

Part BBa_K1349003

Link to registry

Part BBa_K1349004

Link to registry

Part BBa_K1349005

Link to registry

Part BBa_K1349006

Link to registry

Part BBa_K1349007

Link to registry

Part BBa_K1349008

Link to registry

Contact us

Email : equipe.igem.amu@gmail.com

Follow us

iGEM_AMU   iGEM.AMU

Our sponsors

   

Retrieved from "http://2014.igem.org/Team:Aix-Marseille/Parts"