Team:Aix-Marseille/Parts
From 2014.igem.org
Line 1: | Line 1: | ||
- | {{ | + | <script> |
+ | // Function to handle the movement of the sidebar in the Project | ||
+ | $(document).ready(function () { | ||
+ | var sidebar = $('#sidebar-project'); | ||
+ | var sidebarContainer = $('#sidebar-project-div'); | ||
+ | |||
+ | $(window).scroll(function (event) { | ||
+ | var ypos = $(this).scrollTop(); | ||
+ | var scrollTop = $(window).scrollTop(), | ||
+ | elementOffset = sidebar.offset().top, | ||
+ | distance = (elementOffset - scrollTop); | ||
+ | |||
+ | var collision_top = sidebar.overlaps($('#stop_top')); | ||
+ | var collision_bot = sidebar.overlaps($('#stop_bot')); | ||
+ | |||
+ | if (collision_top.hits.length) { /* Collision TOP */ | ||
+ | // To fix at the top of the .row div | ||
+ | sidebar.css({ top: '', | ||
+ | bottom: '', | ||
+ | position: '', | ||
+ | width: '' | ||
+ | }); | ||
+ | sidebarContainer.css({ position:'', | ||
+ | bottom: '', | ||
+ | right: '' | ||
+ | }); | ||
+ | if (distance < 141) { | ||
+ | // To fix at the top of the page while scrolling | ||
+ | sidebar.css({ top: '141px', | ||
+ | bottom: '', | ||
+ | position: 'fixed', | ||
+ | width: '262.5px' | ||
+ | }); | ||
+ | sidebarContainer.css({ position: '', | ||
+ | bottom: '', | ||
+ | right: '' | ||
+ | }); | ||
+ | } | ||
+ | } | ||
+ | else if (collision_bot.hits.length) { /* Collision BOTTOM */ | ||
+ | // To fix at the bottom of the .row div | ||
+ | sidebar.css({ bottom: '', | ||
+ | top: '', | ||
+ | position: '', | ||
+ | width: '' | ||
+ | }); | ||
+ | sidebarContainer.css({ position: 'absolute', | ||
+ | bottom: '0px', | ||
+ | right: '0px' | ||
+ | }); | ||
+ | if (distance > 141) { | ||
+ | // To fix at the top of the page while scrolling | ||
+ | sidebar.css({ top: '141px', | ||
+ | bottom: '', | ||
+ | position: 'fixed', | ||
+ | width: '262.5px' | ||
+ | }); | ||
+ | sidebarContainer.css({ position: '', | ||
+ | bottom: '', | ||
+ | right: '' | ||
+ | }); | ||
+ | } | ||
+ | } | ||
+ | else if (distance <= 141) { | ||
+ | // To fix at the top of the page while scrolling | ||
+ | sidebar.css({ top: '141px', | ||
+ | bottom: '', | ||
+ | position: 'fixed', | ||
+ | width: '262.5px' | ||
+ | }); | ||
+ | sidebarContainer.css({ position: '', | ||
+ | bottom: '', | ||
+ | right: '' | ||
+ | }); | ||
+ | } | ||
+ | }); | ||
+ | |||
+ | |||
+ | }); | ||
+ | </script> | ||
+ | |||
+ | |||
- | |||
<div class="container"> | <div class="container"> | ||
<h1 class="project-title">Our parts</h1> | <h1 class="project-title">Our parts</h1> | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | <div class="project- | + | <div class="row" style="position:relative;"> |
- | <span class="project-tag" id="serine_part"></span> | + | <!-- Content --> |
- | + | <!-- ******* --> | |
- | + | <div class="col-md-9 project"> | |
- | + | <br><br><br> | |
+ | <i>The list will be updated each time we'll create or modify a part</i> | ||
+ | <br><br><br> | ||
+ | |||
+ | <div class="project-section"> | ||
+ | <span class="project-tag" id="details"></span> | ||
+ | <h1>Part BBa_K1349000</h1> | ||
+ | |||
+ | <div class="project-subsection"> | ||
+ | <span class="project-tag" id="serine_part"></span> | ||
+ | <h3 class="subtitle">Short description</h3> | ||
+ | <p>SerA_mut</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="project-subsection"> | ||
+ | <span class="project-tag" id="serine_part"></span> | ||
+ | <h3 class="subtitle">DNA Sequence</h3> | ||
+ | <p>ATGGCAAAGGTATCGCTGGAGAAAGACAAGATTAAGTTTCTGCTGGTAGAAGGCGTGCACCAAAAGGCGC TGGAAAGCCTTCGTGCAGCTGGTTACACCAACATCGAATTTCACAAAGGCGCGCTGGATGATGAACAATT AAAAGAATCCATCCGCGATGCCCACTTCATCGGCCTGCGATCCCGTACCCATCTGACTGAAGACGTGATC AACGCCGCAGAAAAACTGGTCGCTATTGGCTGTTTCTGTATCGGAACAAACCAGGTTGATCTGGATGCGG CGGCAAAGCGCGGGATCCCGGTATTTAACGCACCGTTCTCAAATACGCGCTCTGTTGCGGAGCTGGTGAT TGGCGAACTGCTGCTGCTATTGCGCGGCGTGCCGGAAGCCAATGCTAAAGCGCACCGTGGCGTGTGGAAC AAACTGGCGGCGGGTTCTTTTGAAGCGCGCGGCAAAAAGCTGGGTATCATCGGCTACGGTCATATTGGTA CGCAATTGGGCATTCTGGCTGAATCGCTGGGAATGTATGTTTACTTTTATGATATTGAAAATAAACTGCC GCTGGGCAACGCCACTCAGGTACAGCATCTTTCTGACCTGCTGAATATGAGCGATGTGGTGAcgctGCAT GTACCAGAGAATCCGTCCACCAAAAATATGATGGGCGCGAAAGAAATTTCACTAATGAAGCCCGGCTCGC TGCTGATTAATGCTTCGCGCGGTACTGTGGTGGATATTCCGGCGCTGTGTGATGCGCTGGCGAGCAAACA TCTGGCGGGGGCGGCAATCGACGTATTCCCGACGGAACCGGCGACCAATAGCGATCCATTTACCTCTCCG CTGTGTGAATTCGACAACGTCCTTCTGACGCCACACATTGGCGGTTCGACTCAGGAAGCGCAGGAGAATA TCGGCCTGGAAGTTGCGGGTAAATTGATCAAGTATTCTGACAATGGCTCAACGCTCTCTGCGGTGAACTT CCCGGAAGTCTCGCTGCCACTGCACGGT</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="project-subsection"> | ||
+ | <span class="project-tag" id="serine_part"></span> | ||
+ | <h3 class="subtitle">Logic and explanation for part and construction</h3> | ||
+ | <p>This construct encodes a truncated version of E. coli W3110 SerA ( D-3-phosphoglycerate dehydrogenase), missing the last 75 aa of the full sequence, and without stop codon. SerA is requiered for serine biosynthesis. Following the work of Peters-Wendisch et al. 2005, this mutated version of the enzyme is expected to be no-longer inhibited by Serine, and to allow the production of a high serine concentration. </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="project-subsection"> | ||
+ | <span class="project-tag" id="serine_part"></span> | ||
+ | <h3 class="subtitle">Purpose</h3> | ||
+ | <p>This part is designed to allow the synthesis of serine in E. coli without the normal feedback inhibition, thus permitting the accumulation of high concentrations.</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="project-subsection"> | ||
+ | <span class="project-tag" id="serine_part"></span> | ||
+ | <h3 class="subtitle">Origin and method of construction</h3> | ||
+ | <p>The part was obtained by PCR from E.coli strain W3110 and SLIC assembly. The construction removed the EcoR1 restriction site in the gene by the silent mutations of a GAA codon to a GAG codon.</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="project-subsection"> | ||
+ | <span class="project-tag" id="serine_part"></span> | ||
+ | <h3 class="subtitle">Propreties expected and validation</h3> | ||
+ | <p>We designed this sequence that in an E.coli mutant strain unable to catabolise serine correctly and without a serine import system, production of this coding sequence will lead to serine secretion into the growth media. The sequence does not contain a stop codon so it should be incorporated into composite bricks for testing synthesis and activity.</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="project-subsection"> | ||
+ | <span class="project-tag" id="serine_part"></span> | ||
+ | <h3 class="subtitle">Current backbone</h3> | ||
+ | <p>pSB1C3</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="project-subsection"> | ||
+ | <span class="project-tag" id="serine_part"></span> | ||
+ | <h3 class="subtitle">Sequenced clone</h3> | ||
+ | <p>ok SerA Cm1</p> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
- | <div class="project- | + | </div> <!-- /Content --> |
- | < | + | |
- | + | ||
- | + | <!-- Table of Contents --> | |
+ | <!-- ***************** --> | ||
+ | <div class="col-md-3" id="sidebar-project-div"> | ||
+ | <div id="stop_top" style="height:50px"></div> | ||
+ | <div id="sidebar-project"> | ||
+ | <ul class="nav"> | ||
+ | <li class="active"> | ||
+ | <a data-scroll href="#intro">Introduction</a> | ||
+ | </li> | ||
+ | <li> | ||
+ | <a data-scroll href="#mod_sys">Model system</a> | ||
+ | </li> | ||
+ | <li> | ||
+ | <a data-scroll href="#simplify">Simplifying assumptions</a> | ||
+ | </li> | ||
+ | <li> | ||
+ | <a data-scroll href="#diff_equa">Differential equations</a> | ||
+ | </li> | ||
+ | <li> | ||
+ | <a data-scroll href="#init_val">Initial values</a> | ||
+ | </li> | ||
+ | <li> | ||
+ | <a data-scroll href="#resolv_sys">Resolution of the system</a> | ||
+ | <ul class="nav"> | ||
+ | <li><a data-scroll href="#case1">First case</a></li> | ||
+ | <li><a data-scroll href="#case2">Second case</a></li> | ||
+ | <li><a data-scroll href="#case3">Third case</a></li> | ||
+ | <li><a data-scroll href="#case4">Fourth case</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | </ul> | ||
+ | </div> | ||
</div> | </div> | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
</div> | </div> | ||
+ | <div id="stop_bot"></div> | ||
</div> | </div> | ||
</html> | </html> | ||
{{Team:Aix-Marseille/footer}} | {{Team:Aix-Marseille/footer}} |
Revision as of 21:02, 15 October 2014
<script> // Function to handle the movement of the sidebar in the Project $(document).ready(function () { var sidebar = $('#sidebar-project'); var sidebarContainer = $('#sidebar-project-div');
$(window).scroll(function (event) { var ypos = $(this).scrollTop(); var scrollTop = $(window).scrollTop(), elementOffset = sidebar.offset().top, distance = (elementOffset - scrollTop);
var collision_top = sidebar.overlaps($('#stop_top')); var collision_bot = sidebar.overlaps($('#stop_bot'));
if (collision_top.hits.length) { /* Collision TOP */ // To fix at the top of the .row div sidebar.css({ top: , bottom: , position: , width: }); sidebarContainer.css({ position:, bottom: , right: }); if (distance < 141) { // To fix at the top of the page while scrolling sidebar.css({ top: '141px', bottom: , position: 'fixed', width: '262.5px' }); sidebarContainer.css({ position: , bottom: , right: }); } } else if (collision_bot.hits.length) { /* Collision BOTTOM */ // To fix at the bottom of the .row div sidebar.css({ bottom: , top: , position: , width: }); sidebarContainer.css({ position: 'absolute', bottom: '0px', right: '0px' }); if (distance > 141) { // To fix at the top of the page while scrolling sidebar.css({ top: '141px', bottom: , position: 'fixed', width: '262.5px' }); sidebarContainer.css({ position: , bottom: , right: }); } } else if (distance <= 141) { // To fix at the top of the page while scrolling sidebar.css({ top: '141px', bottom: , position: 'fixed', width: '262.5px' }); sidebarContainer.css({ position: , bottom: , right: }); } });
}); </script>
Contents |
Our parts
The list will be updated each time we'll create or modify a part
Part BBa_K1349000
Short description
SerA_mut
DNA Sequence
ATGGCAAAGGTATCGCTGGAGAAAGACAAGATTAAGTTTCTGCTGGTAGAAGGCGTGCACCAAAAGGCGC TGGAAAGCCTTCGTGCAGCTGGTTACACCAACATCGAATTTCACAAAGGCGCGCTGGATGATGAACAATT AAAAGAATCCATCCGCGATGCCCACTTCATCGGCCTGCGATCCCGTACCCATCTGACTGAAGACGTGATC AACGCCGCAGAAAAACTGGTCGCTATTGGCTGTTTCTGTATCGGAACAAACCAGGTTGATCTGGATGCGG CGGCAAAGCGCGGGATCCCGGTATTTAACGCACCGTTCTCAAATACGCGCTCTGTTGCGGAGCTGGTGAT TGGCGAACTGCTGCTGCTATTGCGCGGCGTGCCGGAAGCCAATGCTAAAGCGCACCGTGGCGTGTGGAAC AAACTGGCGGCGGGTTCTTTTGAAGCGCGCGGCAAAAAGCTGGGTATCATCGGCTACGGTCATATTGGTA CGCAATTGGGCATTCTGGCTGAATCGCTGGGAATGTATGTTTACTTTTATGATATTGAAAATAAACTGCC GCTGGGCAACGCCACTCAGGTACAGCATCTTTCTGACCTGCTGAATATGAGCGATGTGGTGAcgctGCAT GTACCAGAGAATCCGTCCACCAAAAATATGATGGGCGCGAAAGAAATTTCACTAATGAAGCCCGGCTCGC TGCTGATTAATGCTTCGCGCGGTACTGTGGTGGATATTCCGGCGCTGTGTGATGCGCTGGCGAGCAAACA TCTGGCGGGGGCGGCAATCGACGTATTCCCGACGGAACCGGCGACCAATAGCGATCCATTTACCTCTCCG CTGTGTGAATTCGACAACGTCCTTCTGACGCCACACATTGGCGGTTCGACTCAGGAAGCGCAGGAGAATA TCGGCCTGGAAGTTGCGGGTAAATTGATCAAGTATTCTGACAATGGCTCAACGCTCTCTGCGGTGAACTT CCCGGAAGTCTCGCTGCCACTGCACGGT
Logic and explanation for part and construction
This construct encodes a truncated version of E. coli W3110 SerA ( D-3-phosphoglycerate dehydrogenase), missing the last 75 aa of the full sequence, and without stop codon. SerA is requiered for serine biosynthesis. Following the work of Peters-Wendisch et al. 2005, this mutated version of the enzyme is expected to be no-longer inhibited by Serine, and to allow the production of a high serine concentration.
Purpose
This part is designed to allow the synthesis of serine in E. coli without the normal feedback inhibition, thus permitting the accumulation of high concentrations.
Origin and method of construction
The part was obtained by PCR from E.coli strain W3110 and SLIC assembly. The construction removed the EcoR1 restriction site in the gene by the silent mutations of a GAA codon to a GAG codon.
Propreties expected and validation
We designed this sequence that in an E.coli mutant strain unable to catabolise serine correctly and without a serine import system, production of this coding sequence will lead to serine secretion into the growth media. The sequence does not contain a stop codon so it should be incorporated into composite bricks for testing synthesis and activity.
Current backbone
pSB1C3
Sequenced clone
ok SerA Cm1
</html>