http://2014.igem.org/wiki/index.php?title=Special:Contributions/Hyht2011&feed=atom&limit=50&target=Hyht2011&year=&month=
2014.igem.org - User contributions [en]
2024-03-29T01:34:39Z
From 2014.igem.org
MediaWiki 1.16.5
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2015-07-17T19:11:07Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
<script src="http://jquery-csv.googlecode.com/git/src/jquery.csv.js"><br />
displayVals();<br />
</script><br />
<br />
<br />
<br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>Catalog for regulatory RNAs</h2><br />
<p><font color="white"> Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.Over the years, the number of non-coding RNAs in Part Registry has increased steadily over time and many have been made available to end users. More than 400 entries in the Part Registry are related to RNA devices (updated 25-12-2014). Based on different mode of actions and natures of non-coding RNAs (ncRNAs), they can be grouped under different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing ncRNAs. Some of them are simply grouped under type "RNA", while others are not. This is not useful for looking up and utilizing them. For example, BBa_K145013, which is a part for antisense LuxI, could be used to add an extra layer of control to the widely utilized quorum sensing Lux pathway but it has not been extensively reused. It is likely that Part Registry users are unaware of its existence because there has yet to be an information hub for ncRNA. <br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of non-coding RNAs by the <parttable> function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently. Ultimately we want to facilitate the implementation of the philosophy of Part Registry, which is to get and give (and share), through a better organization of ncRNA parts in the registry.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is far from complete and is expected to take shape by Summer 2015. We welcome and encourage constant update and adoption of this page in the future.</font><br />
<br><br />
<br><br />
For more information on categorized ncRNAs on this page, please refer to <a href="https://static.igem.org/mediawiki/2014/b/bd/BBF_RFC_X_categorization_of_ncRNA_Raul_formated_Eric_edited_FINAL.pdf">A Guideline for Categorization of non-coding RNA In Part Registry</a>.<br />
</p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<br />
<div class='content_1'><h3>ncRNA devices by YEAR</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
To use this catalog, please select the desired type of ncRNA in the following box. <br />
</p><br />
<p><br />
<br />
<select id="multiple"><br />
<option>RNA_aptamer</option><br />
<option>aptamer</option><br />
<option>CRISPR</option><br />
<option>RNA_OUT</option><br />
<option>RNA_IN</option><br />
<option>riboregulator</option><br />
<option>riboswitch</option><br />
<option>antisense_RNA</option><br />
<option>asRNA</option><br />
<option>RNAi</option><br />
<option>aptazyme</option><br />
<option>ribozyme</option><br />
<option>pT181</option><br />
<option>others</option><br />
<option>complex</option><br />
<option>ligand</option><br />
<option>target_sequence</option><br />
</select><br />
<button type="button" onclick="resettable()">Click to reset</button><br />
</p><br />
</p><br />
<br />
</div><br />
<br />
<div class = "catalog_table_area"><br />
<table id="result2" class= "catalog_table"><tbody><tr><br />
<td>YEAR</td><br />
<td>Team</td><br />
<td>part number</td><br />
<td>part name</td><br />
<td>category 1</td><br />
<td>category 2</td><br />
<td>category 3</td><br />
<td>category 4</td><br />
<td>category 5</td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01008</td><br />
<td>Riboregulator key 1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01060</td><br />
<td>OnLock1 = [pTet][Lock1]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01141</td><br />
<td>[pLacI pL][key1]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01142</td><br />
<td>[pLacI pL][key3]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01010</td><br />
<td>Riboregulator Lock 1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01020</td><br />
<td>OnKey1 = [Key promoter KP3][key1]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01025</td><br />
<td>Non mobilizable TraJR, OnRFP, Key1 = [pRM TraJR][DblTerminator][OnRFP][OnKey1]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01055</td><br />
<td>OnKey2 = [Key promoter KP3][Key 2]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01063</td><br />
<td>TEST [pTet][Lock1][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01066</td><br />
<td>TEST arabinose inducible key 1 [pBad/araC][Key1]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01068</td><br />
<td>TEST [pTet][Lock2][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01069</td><br />
<td>TEST [pBad/araC][Key1][pTet][Lock1][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01071</td><br />
<td>TEST [pBad/araC][Key2][pTet][Lock1][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01072</td><br />
<td>TEST [pBad/araC][Key2][pTet][Lock2][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01080</td><br />
<td>Lock3</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01081</td><br />
<td>Lock4</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01082</td><br />
<td>Lock5</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01083</td><br />
<td>Lock6</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01084</td><br />
<td>Lock7</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01085</td><br />
<td>Lock8</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01086</td><br />
<td>Key3</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01087</td><br />
<td>Key4</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01088</td><br />
<td>Key5</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01089</td><br />
<td>Key6</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01090</td><br />
<td>Key7</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01091</td><br />
<td>Key8</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01109</td><br />
<td>[pTet][Lock3]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01110</td><br />
<td>[pTet][Lock4]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01124</td><br />
<td>[pTet][Lock5]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01125</td><br />
<td>[pTet][Lock6]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01126</td><br />
<td>[pTet][Lock7]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01127</td><br />
<td>[pTet][Lock8]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01128</td><br />
<td>[pTet][key1]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01129</td><br />
<td>[pTet][key3]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01130</td><br />
<td>[pTet][key4]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01131</td><br />
<td>[pTet][Key5]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01132</td><br />
<td>[pTet][Key6]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01133</td><br />
<td>[pTet][Key7]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01134</td><br />
<td>[pTet][Key8]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01135</td><br />
<td>[OriTF][pTet][Lock1]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01143</td><br />
<td>[pLacI pL][pTET][Lock1]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Berkeley</td><br />
<td>BBa_J01144</td><br />
<td>[pLac pL][pTET][Lock3]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Davidson </td><br />
<td>BBa_J04605</td><br />
<td>R0010 with Anti-Sense Theophillline Induced Antiswitch ("On Switch")</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Davidson </td><br />
<td>BBa_J04676</td><br />
<td>R0010 with Anti-Sense Theophillline Induced Antiswitch ("Off Switch")</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Davidson </td><br />
<td>BBa_J04685</td><br />
<td>Antiswitch enabling production of EYFP ("On" switch)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Davidson </td><br />
<td>BBa_J04686</td><br />
<td>Antiswitch repressing production of EYFP ("Off" switch)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Davidson </td><br />
<td>BBa_J04700</td><br />
<td>Part containing promoter, riboswitch mTCT8-4 theophylline aptamer (J04705), and RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Davidson </td><br />
<td>BBa_J04705</td><br />
<td>Riboswitch designed to turn "ON" a protein</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Davidson </td><br />
<td>BBa_J04800</td><br />
<td>J04800 (RevAptRibo) contains a theophylline aptamer upstream of the RBS that should act as a riboswi</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Davidson </td><br />
<td>BBa_J04805</td><br />
<td>Promoter with Riboswitch designed to turn "ON" a protein</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2005</td><br />
<td>Davidson </td><br />
<td>BBa_J04900</td><br />
<td>Part containing promoter, 8 bp, RBS, and riboswitch mTCT8-4 theophylline aptamer (J04705)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23048</td><br />
<td>[lock3c][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23049</td><br />
<td>[lock3d][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23066</td><br />
<td>[key3c][key3d][B0015]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23071</td><br />
<td>[Ptet][lock3i][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23086</td><br />
<td>[key3c][key3d][TT][oriTr]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23008</td><br />
<td>[key3c]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23009</td><br />
<td>[key3d] riboregulator for lock3 variants</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23030</td><br />
<td>[lock3b]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23031</td><br />
<td>[lock3c]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23032</td><br />
<td>[lock3d]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23062</td><br />
<td>Ser2-derived key</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23007</td><br />
<td>[key3b]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23036</td><br />
<td>[lock3h]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23020</td><br />
<td>[key3b][TT]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23021</td><br />
<td>[key3c][TT]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23022</td><br />
<td>[key3d][TT]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23024</td><br />
<td>Dropped</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23033</td><br />
<td>[lock3e]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23034</td><br />
<td>[lock3f]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23035</td><br />
<td>[lock3g]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23037</td><br />
<td>[Ser2AGGA]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23041</td><br />
<td>[PK2][key3c]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23042</td><br />
<td>[PK3][key3c]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23043</td><br />
<td>[key3c][key3d]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23044</td><br />
<td>[key3d][key3c]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23047</td><br />
<td>[lock3b][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23050</td><br />
<td>[lock3e][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23051</td><br />
<td>[lock3f][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23052</td><br />
<td>[lock3g][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23053</td><br />
<td>[lock3h][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23058</td><br />
<td>[GFPmut3] inserted into [key3d]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23059</td><br />
<td>[key3e] key3d-like riboregulator with longer spacers</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23060</td><br />
<td>[key3f] key3d variant with shorter linkers</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23061</td><br />
<td>Part to construct Ser2-derived keys</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23063</td><br />
<td>[P_con (strong)][Ser2AGGA]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23064</td><br />
<td>[P_con A2 (medium)][Ser2AGGA]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23072</td><br />
<td>lock3j RFP reporter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23073</td><br />
<td>lock3k RFP reporter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23078</td><br />
<td>[lock3i]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23080</td><br />
<td>b0034 derived RBS to match spacing of J01122</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23081</td><br />
<td>[Ser2 tRNA Key(-23)][b0015]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23082</td><br />
<td>[Ser2 tRNA key(-33)][b0015]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23083</td><br />
<td>[Ser2 tRNA key(-28)][b0015]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23084</td><br />
<td>[Ser2 tRNA key(-18)][b0015]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23085</td><br />
<td>[tRNA precursor][b0015]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23088</td><br />
<td>[lock3][trbC]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23090</td><br />
<td>[Ptet][lock3m][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23091</td><br />
<td>[lock3m]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23092</td><br />
<td>[lock3n]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23093</td><br />
<td>[Ptet][lock3n][RFP]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23094</td><br />
<td>Ser2 tRNA key(-33)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23095</td><br />
<td>Ser2 tRNA key(-28)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23096</td><br />
<td>Ser2 tRNA key(-18)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23098</td><br />
<td>Ser2 tRNA key(-17)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23099</td><br />
<td>Ser2 tRNA key (-16)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23121</td><br />
<td>J01003::J23007 key3 and OriT (goes with J23120) </td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23122</td><br />
<td>Ser2 tRNA key (-15)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23123</td><br />
<td>Ser2 tRNA key (-14)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23124</td><br />
<td>Ser2 tRNA key (-19)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23125</td><br />
<td>Ser2 tRNA key (-20)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23126</td><br />
<td>Ser2 tRNA key (-21)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23127</td><br />
<td>Ser2 tRNA key (-22)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23128</td><br />
<td>Ser2 tRNA key (-24)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23129</td><br />
<td>Ser2 tRNA key (-25)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23130</td><br />
<td>Ser2 tRNA key (-26)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23131</td><br />
<td>Ser2 tRNA key (-27)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23132</td><br />
<td>Ser2 tRNA key (-29)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23133</td><br />
<td>Ser2 tRNA key (-30)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23134</td><br />
<td>Ser2 tRNA key (-31)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23135</td><br />
<td>Ser2 tRNA key (-32)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23136</td><br />
<td>Ser2 tRNA key (-34)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23200</td><br />
<td>[key3???]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23201</td><br />
<td>Ser2-tRNA key with 5bp spacer</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23202</td><br />
<td>Ser2-tRNA key with 7bp spacer</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23203</td><br />
<td>Ser2-tRNA key with 9bp spacer</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23204</td><br />
<td>Ser2-tRNA key with 13bp spacer</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23205</td><br />
<td>Ser2-tRNA key with 15bp spacer</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23206</td><br />
<td>Ser2-tRNA key with 17bp spacer</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23207</td><br />
<td>Ser2-tRNA key with 19bp spacer</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Berkeley </td><br />
<td>BBa_J23208</td><br />
<td>Ser2-tRNA key with 21bp spacer</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Davidson</td><br />
<td>BBa_J31014</td><br />
<td>crRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Davidson</td><br />
<td>BBa_J31015</td><br />
<td>crRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Davidson</td><br />
<td>BBa_J31017</td><br />
<td>produces the RNA crRNA-RBS-GFPLVA-tt</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Davidson</td><br />
<td>BBa_J31018</td><br />
<td>produces the RNA crRNA-RBS-GFPLVA-tt</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Davidson</td><br />
<td>BBa_J31019</td><br />
<td>produces the RNA crRNA-RBS-GFPLVA-tt</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Davidson</td><br />
<td>BBa_J31020</td><br />
<td>produces taRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>Davidson</td><br />
<td>BBa_J31021</td><br />
<td>contains both taRNA and crRNA under control of different promoters</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>ETHZ</td><br />
<td>BBa_J34000</td><br />
<td>Half Adder (HA), 2x PoPS input, 2x PoPS output</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>ETHZ</td><br />
<td>BBa_J34100</td><br />
<td>AND gate, 2x PoPS input, 1x PoPS output</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2006</td><br />
<td>ETHZ</td><br />
<td>BBa_J34812</td><br />
<td>tRNA loading Glutamate on stop codon TTT</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Peking 2007</td><br />
<td>BBa_I714070</td><br />
<td>[R0040][J23078] ([pTet][Lock3])</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Peking 2007</td><br />
<td>BBa_I714073</td><br />
<td>[R0040][I714033]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Peking 2007</td><br />
<td>BBa_I714074</td><br />
<td>[R0010][J23066] ([pLac][Key3][Double Terminator])</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Peking 2007</td><br />
<td>BBa_I714077</td><br />
<td>[R0010][I714075] ([pLac][Key1][Double Terminator])</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Peking 2007</td><br />
<td>BBa_I714080</td><br />
<td>[R0040][J23078][E0040][B0015]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Peking 2007</td><br />
<td>BBa_I714081</td><br />
<td>[R0040][J01010][E0040][B0015]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Peking 2007</td><br />
<td>BBa_I714083</td><br />
<td>[R0040][I714033][E0040][B0015]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Calgary</td><br />
<td>BBa_I737003</td><br />
<td>OmpF controlled RNA Key (key3c)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Calgary</td><br />
<td>BBa_I737004</td><br />
<td>AraC, arabinose activated, self sustaining GFP reporter.</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Calgary</td><br />
<td>BBa_I737005</td><br />
<td>AHL and RNA lock controlled AraC (lock3c)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Calgary</td><br />
<td>BBa_I737006</td><br />
<td>Temperature induced repression/activation of an RNA key</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Lethbridge</td><br />
<td>BBa_I752000</td><br />
<td>Riboswitch(theophylline)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Lethbridge</td><br />
<td>BBa_I752002</td><br />
<td>Riboswitch + CheZ</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Lethbridge</td><br />
<td>BBa_I752003</td><br />
<td>full RS+CheZ</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759016</td><br />
<td>cis4-repressed, tet-regulated YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759020</td><br />
<td>cis8-repressed, tet-regulated YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759023</td><br />
<td>pBAD-trans2</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759027</td><br />
<td>cis3-repressed, tet-regulated Q</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759028</td><br />
<td>cis4-repressed, tet-regulated Q</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759014</td><br />
<td>cis2-repressed, tet-regulated YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759017</td><br />
<td>cis5-repressed, tet-regulated YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759018</td><br />
<td>cis6-repressed, tet-regulated YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759019</td><br />
<td>cis7-repressed, tet-regulated YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759011</td><br />
<td>pTet-Q with L3</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759012</td><br />
<td>pTet-Q with L4</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759013</td><br />
<td>cis1-repressed, tet-regulated YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759015</td><br />
<td>cis3-repressed, tet-regulated YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759022</td><br />
<td>pBAD-trans1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759024</td><br />
<td>pBAD-trans3</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759025</td><br />
<td>pBAD-trans4</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759026</td><br />
<td>pBAD-trans5</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759032</td><br />
<td>Ptet_cis1_YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759034</td><br />
<td>Ptet_cis2_YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759036</td><br />
<td>Ptet_cis3_YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759038</td><br />
<td>Ptet_cis4_YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759040</td><br />
<td>Ptet_cis5_YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759042</td><br />
<td>Ptet_cis6_YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759044</td><br />
<td>Ptet_cis7_YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Caltech</td><br />
<td>BBa_I759046</td><br />
<td>Ptet_cis8_YFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Princeton</td><br />
<td>BBa_I745009</td><br />
<td>siGata3-3</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Princeton</td><br />
<td>BBa_I745010</td><br />
<td>Gata3-5</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Princeton</td><br />
<td>BBa_I745011</td><br />
<td>miR661</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Princeton</td><br />
<td>BBa_I745016</td><br />
<td>pLV-UBC-GFP-siGata3-5'</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Princeton</td><br />
<td>BBa_I745013</td><br />
<td>pLV-UBC-GFP-siGata3-3'</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Princeton</td><br />
<td>BBa_I745014</td><br />
<td>pLV-UBC-siGata3-3'-GFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Princeton</td><br />
<td>BBa_I745015</td><br />
<td>pLV-UBC-miR661-GFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>Princeton</td><br />
<td>BBa_I745016</td><br />
<td>pLV-UBC-GFP-siGata3-5'</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2007</td><br />
<td>KULeuven</td><br />
<td>BBa_K145013</td><br />
<td>antisense LuxI</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Melbourne</td><br />
<td>BBa_K085000</td><br />
<td>(lacI)promoter-&gt;key3c</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Melbourne</td><br />
<td>BBa_K085002</td><br />
<td>pTet-&gt;lock3d-&gt;GFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Melbourne</td><br />
<td>BBa_K085003</td><br />
<td>lock3d-&gt;GFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Melbourne</td><br />
<td>BBa_K085004</td><br />
<td>riboswitch system with GFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Melbourne</td><br />
<td>BBa_K085005</td><br />
<td>(lacI)promoter-&gt;key3c-&gt;Terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Melbourne</td><br />
<td>BBa_K085006</td><br />
<td>pTet-&gt;lock3d-&gt;GFP-&gt;Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Guelph</td><br />
<td>BBa_K152009</td><br />
<td>Zea mays Actin1 Intron RNAi Production Tool</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td>New classification</td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Guelph</td><br />
<td>BBa_K152008</td><br />
<td>250 bp fragment from the Zea mays gene TB1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td>New classification</td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Guelph</td><br />
<td>BBa_K152010</td><br />
<td>TB1 RNAi construct</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td>New classification</td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Guelph</td><br />
<td>BBa_K152011</td><br />
<td>GFP RNAi construct</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td>New classification</td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145013</td><br />
<td>antisense LuxI</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/antisense_RNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145003</td><br />
<td>T7 PoPS -&gt; RiboKey 3d</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145004</td><br />
<td>T7 PoPS + RiboLock |&gt; LuxI</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145005</td><br />
<td>T7 PoPS + PR -&gt; cI</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145102</td><br />
<td>RiboKey3d under TetR promoter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145103</td><br />
<td>T7 with UmuD derived tag under constitutive promotor + RiboLock3d</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145211</td><br />
<td>MEMORY OUTPUT asLuxI</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/antisense_RNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145216</td><br />
<td>FILTER T7 RNA pol</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145251</td><br />
<td>OLD RESET lactonase</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145253</td><br />
<td>OLD INVERTIMER Part 1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145255</td><br />
<td>NEW INVERTIMER part 1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145272</td><br />
<td>GFP regulated by AND-gate</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145277</td><br />
<td>T7 DNA polymerase regulated by lock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145278</td><br />
<td>T7 DNA polymerase regulated by [lock3d]</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145112</td><br />
<td>cI under T7 and PRR dual promotor</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_KULeuven</td><br />
<td>BBa_K145105</td><br />
<td>cI under T7 and PR dual promotor</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115001</td><br />
<td>RNA thermometer (ROSE)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115002</td><br />
<td>RNA thermometer (FourU)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115003</td><br />
<td>RNA thermometer (PrfA)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115008</td><br />
<td>RNA thermometer (ROSE)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115009</td><br />
<td>RNA thermometer (FourU)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115016</td><br />
<td>RNA thermometer (ROSE 27?C)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115017</td><br />
<td>RNA thermometer (ROSE 32?C)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115020</td><br />
<td>RNA thermometer (ROSE hairpin 37?C)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115021</td><br />
<td>construction of K115001 expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115022</td><br />
<td>construction of K115002 expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115023</td><br />
<td>construction of K115003 expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115024</td><br />
<td>construction of K115008 test expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115025</td><br />
<td>construction of K115009 expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115026</td><br />
<td>construction of K115016 expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115027</td><br />
<td>construction of K115017 expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_TUDelft</td><br />
<td>BBa_K115028</td><br />
<td>construction of K115020 expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2008</td><br />
<td>iGEM08_Rice_University</td><br />
<td>BBa_K122007</td><br />
<td>pTet - amber suppressor tRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>British_Columbia 2009</td><br />
<td>BBa_K206030</td><br />
<td>Lock 1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>British_Columbia 2009</td><br />
<td>BBa_K206031</td><br />
<td>Key 1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235010</td><br />
<td>[K145303] (ribokey-controlled GFP generator)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235000</td><br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235001</td><br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235009</td><br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235011</td><br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235013</td><br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235014</td><br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235016</td><br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235019</td><br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235022</td><br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235024</td><br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235030</td><br />
<td>[J23102][K115017] (constituitive promoter+32°C RBS thermometer)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>VictoriaBC 2009</td><br />
<td>BBa_K235033</td><br />
<td>[K235030][K235031] (constituitive promoter+32°C RBS thermometer+LacI+stop)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>KULeuven 2009</td><br />
<td>BBa_K238024</td><br />
<td>lock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>KULeuven 2009</td><br />
<td>BBa_K238005</td><br />
<td>Anti sense key</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>TUDelft 2009</td><br />
<td>BBa_K175029</td><br />
<td>Lock for weak RBS (B0031) from the lock/key library TUD09</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>TUDelft 2009</td><br />
<td>BBa_K175030</td><br />
<td>Key for lock of weak (K175029) RBS (B0031) from the lock/key library TUD09</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>TUDelft 2009</td><br />
<td>BBa_K175031</td><br />
<td>Lock for medium RBS (B0032) from the lock/key library TUD09</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>TUDelft 2009</td><br />
<td>BBa_K175032</td><br />
<td>Key for lock of medium (K175031) RBS (B0032) from the lock/key library TUD09</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>TUDelft 2009</td><br />
<td>BBa_K175029</td><br />
<td>Lock for weak RBS (B0031) from the lock/key library TUD09</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>TUDelft 2009</td><br />
<td>BBa_K175030</td><br />
<td>Key for lock of weak (K175029) RBS (B0031) from the lock/key library TUD09</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>TUDelft 2009</td><br />
<td>BBa_K175031</td><br />
<td>Lock for medium RBS (B0032) from the lock/key library TUD09</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>TUDelft 2009</td><br />
<td>BBa_K175032</td><br />
<td>Key for lock of medium (K175031) RBS (B0032) from the lock/key library TUD09</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273020</td><br />
<td>E1A1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273021</td><br />
<td>E1A2</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273022</td><br />
<td>E1A3</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273023</td><br />
<td>E1A4</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273024</td><br />
<td>E1B1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273025</td><br />
<td>E1B2</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273026</td><br />
<td>E1B3</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273027</td><br />
<td>E1B4</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273028</td><br />
<td>E21</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273029</td><br />
<td>E22</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273030</td><br />
<td>E23</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273031</td><br />
<td>E24</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273032</td><br />
<td>E1A1 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273033</td><br />
<td>E1A2 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273034</td><br />
<td>E1A3 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273035</td><br />
<td>E1A4 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273036</td><br />
<td>E1B1 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273037</td><br />
<td>E1B2 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273038</td><br />
<td>E1B3 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273039</td><br />
<td>E1B4 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273040</td><br />
<td>E21 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273041</td><br />
<td>E22 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273042</td><br />
<td>E23 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Uppsala-Sweden 2009</td><br />
<td>BBa_K273043</td><br />
<td>E24 - Ter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>UNICAMP-Brazil 2009</td><br />
<td>BBa_K284033</td><br />
<td>finP misc_RNA from Plasmid F</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Illinois 2009</td><br />
<td>BBa_K252002</td><br />
<td>MicF small RNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Illinois 2009</td><br />
<td>BBa_K252000</td><br />
<td>MicA small RNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Illinois 2009</td><br />
<td>BBa_K252001</td><br />
<td>MicC small RNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Illinois 2009</td><br />
<td>BBa_K252003</td><br />
<td>GcvB small RNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Illinois 2009</td><br />
<td>BBa_K252004</td><br />
<td>Sgrs small RNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Illinois 2009</td><br />
<td>BBa_K252005</td><br />
<td>DicF small RNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2009</td><br />
<td>Illinois 2009</td><br />
<td>BBa_K252006</td><br />
<td>MicF small RNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UT-Tokyo</td><br />
<td>BBa_K313023</td><br />
<td>asRNA 1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UT-Tokyo</td><br />
<td>BBa_K313024</td><br />
<td>as RNA target1</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UT-Tokyo</td><br />
<td>BBa_K313025</td><br />
<td>as RNA 2</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UT-Tokyo</td><br />
<td>BBa_K313026</td><br />
<td>as RNA target2</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UT-Tokyo</td><br />
<td>BBa_K313031</td><br />
<td>asRNA measurement device 1</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UT-Tokyo</td><br />
<td>BBa_K313032</td><br />
<td>asRNA measurement device 2</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UT-Tokyo</td><br />
<td>BBa_K313033</td><br />
<td>as RNA generator 1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UT-Tokyo</td><br />
<td>BBa_K313034</td><br />
<td>as RNA generator 2</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337052</td><br />
<td>synthetic binding site of shRNA miRhaat (perfect) KD:97%</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337055</td><br />
<td>synthetic binding site of shRNA 122 (perfect) KD96:%</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337000</td><br />
<td>hsa-miR-122 Binding site pattern (3BS)</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337003</td><br />
<td>hsa-miR-122 Binding site pattern (4BS)</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337004</td><br />
<td>hsa-miR-122 Binding site pattern (2BS)</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337005</td><br />
<td>hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer)</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337006</td><br />
<td>hsa-miR-122 Binding site pattern (2BS) with randomised nt9-12</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337007</td><br />
<td>hsa-miR-122 Binding site pattern (2BS) with randomised nt9-12</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337008</td><br />
<td>hsa-miR-122 Binding site pattern (2BS) with randomised nt9-12</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337009</td><br />
<td>hsa-miR-122 Binding site pattern (2BS) with randomised nt9-12</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337010</td><br />
<td>hsa-miR-122 Binding site pattern (3BS)</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337011</td><br />
<td>hsa-miR-221 Binding site pattern (2BS)</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337016</td><br />
<td>synthetic microRNA HD10</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337020</td><br />
<td>BGH(rc)/shRNA10(rc)/sv40(rc)/RSV(fw)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337021</td><br />
<td>BGH(rc)/shRNA10(rc)/sv40(rc)/CMV(fw)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337022</td><br />
<td>BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337023</td><br />
<td>BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)_TetO2(fw)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337024</td><br />
<td>BGH(rc)/shRNA6(rc)/sv40(rc)/RSV(fw)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337026</td><br />
<td>BGH(rc)/shRNA6(rc)/sv40(rc)/CMV(fw)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337029</td><br />
<td>BGH(rc)/shRNA6(rc)/RSV(rc)/CMV(fw)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337031</td><br />
<td>BGH(rc)/shRNA6(rc)/RSV(rc)/CMV_TetO2(fw)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337032</td><br />
<td>pSMB_miTuner Plasmid HD1 (BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH )</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337035</td><br />
<td>pSMB_miTuner Plasmid HD2 (BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337038</td><br />
<td>pSMB_miTuner Plasmid HD4 (BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337040</td><br />
<td>pSMB_miTuner Plasmid HD5 (BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337042</td><br />
<td>pSMB_miTuner Plasmid HD6 (BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337044</td><br />
<td>pSMB_miTuner Plasmid HD7 (BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH )</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337046</td><br />
<td>pSMB_miTuner Plasmid HD8 (BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH )</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337051</td><br />
<td>BGH(rc)/shRNA10(rc)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337053</td><br />
<td>synthetic binding site of shRNA miRhaat (imperfect) KD:69 %%</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337054</td><br />
<td>synthetic binding site of shRNA miRhaat (imperfect) KD:28%</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337056</td><br />
<td>synthetic binding site of miR 122 (imperfect) KD: 64%</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Heidelberg</td><br />
<td>BBa_K337057</td><br />
<td>synthetic binding site of miR 122 (imperfect) KD: 24%</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM09_MoWestern_Davidson</td><br />
<td>BBa_K199047</td><br />
<td>CCAAU tRNA Suppressor (Produces Serine)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119093</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CCAAU+pLac+tRNA CUAGC+pLac+tRNA CUACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119094</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CCAAU+pLac+tRNA CUAGC+pLac+tRNA CUACU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119095</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CUAAU+pLac+tRNA AGGAC+pLac+tRNA CUACU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119096</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CCACC+pLac+tRNA AGGAC+pLac+tRNA CUACU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119097</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CCACC+pLac+tRNA CUAGC+pLac+tRNA CUACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119098</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CCACC+pLac+tRNA CUAGC+pLac+tRNA CUACU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119099</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CCACC+pLac+tRNA AGGAC+pLac+tRNA CUACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119100</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CCAAU+pLac+tRNA AGGAC+pLac+tRNA CUACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119101</td><br />
<td>pT7-RBS-GFP-pLac+tRNA CCAAU+pLac+tRNA CUAGC+pLac+tRNA CUACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119102</td><br />
<td>pT7-RBS-GFP-pLac+tRNA CCAAU+pLac+tRNA CUAGC+pLac+tRNA CUACU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119103</td><br />
<td>pT7-RBS-GFP-pLac+tRNA CUAAU+pLac+tRNA AGGAC+pLac+tRNA CUACU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119104</td><br />
<td>pT7-RBS-GFP-pLac+tRNA CCACC+pLac+tRNA AGGAC+pLac+tRNA CUACU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119105</td><br />
<td>pT7-RBS-GFP-pLac+tRNA CCACC+pLac+tRNA CUAGC+pLac+tRNA CUACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119106</td><br />
<td>pT7-RBS-GFP-pLac+tRNA CCACC+pLac+tRNA CUAGC+pLac+tRNA CUACU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119107</td><br />
<td>pT7-RBS-GFP-pLac+tRNA CCACC+pLac+tRNA AGGAC+pLac+tRNA CUACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119108</td><br />
<td>pT7-RBS-GFP-pLac+tRNA CCAAU+pLac+tRNA AGGAC+pLac+tRNA CUACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119109</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CCAAU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119110</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CCACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119111</td><br />
<td>pT7-RBS-RFP-pLac+tRNA AGGAC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119112</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CUAGC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119113</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CUACC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119114</td><br />
<td>pT7-RBS-RFP-pLac+tRNA CUACU</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119328</td><br />
<td>Ammeline Fitness Module with Riboswitch + TetA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119329</td><br />
<td>Ammeline Biosensor with Riboswitch M6C'' + RFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119330</td><br />
<td>Ammeline Fitness Module with Riboswitch + ThyA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119331</td><br />
<td>Ammeline Biosensor with Riboswitch AddA + RFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119332</td><br />
<td>Ammeline Biosensor with Riboswitch M6 + RF</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119333</td><br />
<td>Ammeline Biosensor with Riboswitch M6C (A172G)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119334</td><br />
<td>Ammeline Biosensor with Riboswitch M6 prime</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119335</td><br />
<td>Ammeline Biosensor with Riboswitch M6 double prime</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119336</td><br />
<td>Ammeline Biosensor with Riboswitch M6C prime</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119337</td><br />
<td>Ammeline Biosensor with Riboswitch M6C (T92C)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119338</td><br />
<td>Ammeline Fitness Module with Riboswitch M6 + ThyA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119339</td><br />
<td>Ammeline Fitness Module with Riboswitch M6 prime + ThyA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119340</td><br />
<td>Ammeline Fitness Module with Riboswitch M6 double prime + ThyA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119341</td><br />
<td>Ammeline Biosensor with Riboswitch M6C</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119342</td><br />
<td>Ammeline Biosensor with Riboswitch M6C prime (T167C)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119343</td><br />
<td>Ammeline Biosensor with Riboswitch M6C prime</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119344</td><br />
<td>eCDM8 expression + Theophylline riboswitch tetracycline resistance protein</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119345</td><br />
<td>RFP and eCDM8 expression + Theophylline riboswitch tetracycline resistance protein</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>Davidson-MissouriW</td><br />
<td>BBa_J119346</td><br />
<td>eCDM8 expression + Theophylline riboswitch tetracycline resistance protein + RFP expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Stanford </td><br />
<td>BBa_K353002</td><br />
<td>I0500 + K353010 + B0034 + E0040 + B1006</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Stanford </td><br />
<td>BBa_K353009</td><br />
<td>F2620 + sRNA1</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_Stanford </td><br />
<td>BBa_K353011</td><br />
<td>sRNA1</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UIUC-Illinois </td><br />
<td>BBa_K310000</td><br />
<td>micA (sRNA)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UIUC-Illinois </td><br />
<td>BBa_K310001</td><br />
<td>gadY (sRNA)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UIUC-Illinois </td><br />
<td>BBa_K310002</td><br />
<td>MicF (sRNA)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UIUC-Illinois </td><br />
<td>BBa_K310003</td><br />
<td>ompA 5</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UIUC-Illinois </td><br />
<td>BBa_K310004</td><br />
<td>ompF 5'UTR (micF target)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2010</td><br />
<td>iGEM10_UIUC-Illinois </td><br />
<td>BBa_K310017</td><br />
<td>gadX 3'UTR (gadY target)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619888</td><br />
<td>RNA Thermometer or thermosensor (30-37 Celsius)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619889</td><br />
<td>prfA-UTR, RNA thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619890</td><br />
<td>mutated prfA thermosensor from listeria</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619891</td><br />
<td>Mutated prfA thermosensor from listeria</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619892</td><br />
<td>mutated prfA thermosensor from listeria</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619893</td><br />
<td>mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619894</td><br />
<td>mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619895</td><br />
<td>mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619897</td><br />
<td>shortened prfA-UTR thermosensor</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_BYU_Provo </td><br />
<td>BBa_K619898</td><br />
<td>medium length prfA-UTR thermosensor from Lysteria Monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_ITESM__Queretaro</td><br />
<td>BBa_K587008</td><br />
<td>Crxst -&gt; Lock sequence for low concentration mechanism</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_ITESM__Queretaro</td><br />
<td>BBa_K587009</td><br />
<td>Crxwk -&gt; Lock sequence for high concentration mechanism</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_ITESM__Queretaro</td><br />
<td>BBa_K587010</td><br />
<td>Tast -&gt; Key sequence for low concentration mechanism</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_ITESM__Queretaro</td><br />
<td>BBa_K587011</td><br />
<td>Tawk -&gt; Key sequence for high concentration mechanism</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_ITESM__Queretaro</td><br />
<td>BBa_K587012</td><br />
<td>iTast -&gt; Antikey sequence for high concentration mechanism</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_MIT</td><br />
<td>BBa_K511101</td><br />
<td>EYFP-FF4x4 MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_MIT</td><br />
<td>BBa_K511103</td><br />
<td>amCyan-miRFF4 MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_MIT</td><br />
<td>BBa_K511206</td><br />
<td>LacI-miRFF4 Repressor MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_MIT</td><br />
<td>BBa_K511303</td><br />
<td>Delta-mCherry-4xFF4 Juxtacrine Signaling Ligand MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_MIT</td><br />
<td>BBa_K511803</td><br />
<td>Repressible Fluorescence/Repression Generator (Hef1a-LacO-AmCyan-miRFF4) MammoBlock Device</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_UNAM-Genomics_Mexico </td><br />
<td>BBa_K535008</td><br />
<td>repC - ctRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Virginia</td><br />
<td>BBa_K635000</td><br />
<td>siRNA gene silencer for use in yeast</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598000</td><br />
<td>TPP Down-regulated Hammerhead Ribozyme 2.5 with Native RBS+E0040+B0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598001</td><br />
<td>Theophylline Responsive Riboswitch 1G1 with Engineered RBS+GFP generator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598003</td><br />
<td>TPP Down-regulated Hammerhead Ribozyme 2.5 with Native RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598005</td><br />
<td>Theophylline Responsive Riboswitch P1G1 with Native RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598006</td><br />
<td>Theophylline Responsive Riboswitch 1G1 with Engineered RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598007</td><br />
<td>Theophylline Responsive Riboswitch P1G1 with Native RBS+E0040+B0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598008</td><br />
<td>TPP Up-regulated Hammerhead Ribozyme 1.20 with Native RBS+E0040+B0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598009</td><br />
<td>pBAD+Theophylline Responsive Riboswitch P1G1 with Native RBS+E0040+B0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598010</td><br />
<td>pBAD+Theophylline Responsive Riboswitch 1G1 with Engineered RBS+E0040+B0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598011</td><br />
<td>pBAD+TPP Down-regulated Hammerhead Ribozyme 2.5 with Native RBS+E0040+B0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598012</td><br />
<td>pBAD+TPP Up-regulated Hammerhead Ribozyme 1.20 with Native RBS+E0040+B0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598014</td><br />
<td>pBAD+HH+CdIntron+E0040+b0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598019</td><br />
<td>B0015+pBAD+vioABD+B0015+pBAD+TPP Down-regulated Hammerhead Ribozyme 2.5+vioE</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598020</td><br />
<td>B0015+pBAD+vioAB+B0015+pBAD+TPP Up-regulated Hammerhead Ribozyme 1.20+vioD+B0015+pBAD+vioE</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598023</td><br />
<td>Bistable Switch with TPP Up-regulated Hammerhead Ribozyme 1.20 Regulating CI434 Expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598024</td><br />
<td>Bistable Switch with TPP Down-regulated Hammerhead Ribozyme 2.5 Regulating CI434 Expression</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598025</td><br />
<td>Bistable Switch with TPP Hammerhead Ribozyme 2.5 and Theophyline Riboswitch N8-3</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598004</td><br />
<td>TPP Up-regulated Hammerhead Ribozyme 1.20 with Native RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598013</td><br />
<td>pBAD+theoHH+CdIntron+E0040+B0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598015</td><br />
<td>T7-promoter+TPP Up-regulated Hammerhead Ribozyme 1.20 with Native RBS+GFP+T7-terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598016</td><br />
<td>T7-promoter+TPP Down-regulated Hammerhead Ribozyme 2.5 with Native RBS+GFP+T7-terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598017</td><br />
<td>pBAD+Adenine Hammerhead Ribozyme+RBS+E0040+B0015</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598026</td><br />
<td>AND gate (BBa_K228258) regulated by TPP riboswitch 1.20 (BBa_K598004)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_pku_riboclamp </td><br />
<td>BBa_K598027</td><br />
<td>AND gate (BBa_K228258) regulated by theophylline riboswitch P1G1 (BBa_K598005)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_UNIST_KOREA</td><br />
<td>BBa_K526002</td><br />
<td>Temperature dependent Ribo-Switch fused to GFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_USTC</td><br />
<td>BBa_K557001</td><br />
<td>Aptamer-CheZ: theophylline-sensitive synthetic riboswitch+phosphatase which dephosphorylates CheY-P</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_USTC</td><br />
<td>BBa_K557002</td><br />
<td>Toggle-switch+Aptamer+CheZ</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_USTC</td><br />
<td>BBa_K557008</td><br />
<td>Reversed Toggle switch+Aptamer-CheZ+lasI-lasR</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_USTC</td><br />
<td>BBa_K557010</td><br />
<td>ColicinE7+Toggle-switch+Aptamer-CheZ+lysis</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_USTC</td><br />
<td>BBa_K557005</td><br />
<td>Reversed Toggle switch+Aptamer-CheZ</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_USTC</td><br />
<td>BBa_K557009</td><br />
<td>Toggle-switch+Aptamer+CheZ+Lysis</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564012</td><br />
<td>promoter and RBS of E. coli chitoporin translationally fused with lacZ.</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564013</td><br />
<td>Upstream mutated chitoporin part fused with lacZ</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564000</td><br />
<td>ChiX</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564004</td><br />
<td>ChiP promoter and 5' UTR; WT RBS (AAGAGG)</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564006</td><br />
<td>small RNA involved in RNA regulation of ChiP</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564010</td><br />
<td>small RNA regulating ChiX</td><br />
<td>//RNA/ncRNA/regulation_level/protein</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564011</td><br />
<td>ara--&gt;chiXR (sRNA) device</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564014</td><br />
<td>atC--&gt;chiX</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564015</td><br />
<td>ChiP promoter and 5' UTR; RBS mutated AAGAGG--&gt;AGGAGA</td><br />
<td>//RNA/ncRNA/regulation_level/protein</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564019</td><br />
<td>Mutated small RNA involved in RNA regulation of ChiP.</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_DTU_Denmark</td><br />
<td>BBa_K564020</td><br />
<td>Mutated small RNA involved in RNA regulation of ChiP.</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Grenoble </td><br />
<td>BBa_K545005</td><br />
<td>fha</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Grenoble </td><br />
<td>BBa_K545006</td><br />
<td>mag</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Grenoble </td><br />
<td>BBa_K545007</td><br />
<td>rsmA repressor</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Grenoble </td><br />
<td>BBa_K545008</td><br />
<td>rsmY iRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Grenoble </td><br />
<td>BBa_K545666</td><br />
<td>rpos leader sequence</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_KULeuven </td><br />
<td>BBa_K584014</td><br />
<td>HybB promoter + Ribokey</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_KULeuven </td><br />
<td>BBa_K584029</td><br />
<td>http://parts.igem.org/wiki/index.php?title=Part:BBa_K584029</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>?</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_KULeuven </td><br />
<td>BBa_K584015</td><br />
<td>Lambda cI and LuxR regulated hybrid promoter + Ribolock-CeaB + Terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_KULeuven </td><br />
<td>BBa_K584016</td><br />
<td>Lac-Lux hybrid promoter + Ribolock-CeaB + Terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606041</td><br />
<td>pHyperspank Tyrosine amber supressor tRNA double terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606034</td><br />
<td>Tyrosine amber supressor tRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606042</td><br />
<td>pVeg SpoVG Tyrosine amber supressor tRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606048</td><br />
<td>pHyperspank Tyrosine amber supressor tRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606053</td><br />
<td>Tyrosine amber supressor tRNA double terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606032</td><br />
<td>T7 RNA polymerase with tyrosine amber codons</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606043</td><br />
<td>GFPmut3b tyrosine amber</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606050</td><br />
<td>pVeg SpoVG tyrosine amber supressor tRNA double terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606066</td><br />
<td>Upstream LacI expression IPTG inducible tRNA emitter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606067</td><br />
<td>Upstream LacI expression IPTG inducible tRNA emitter with RFP Monitor</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_Paris_Bettencourt </td><br />
<td>BBa_K606066</td><br />
<td>Upstream LacI expression IPTG inducible tRNA emitter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_TU_Munich </td><br />
<td>BBa_K568004</td><br />
<td>Optogenetical AND-Gate blue light - without first promoter - choose your first input</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_TU_Munich </td><br />
<td>BBa_K568006</td><br />
<td>Intermediate synthetic part of optogenetical AND-Gate</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_TU_Munich </td><br />
<td>BBa_K568005</td><br />
<td>Intermediate optogenetical AND-Gate without T7ptag</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_TU_Munich </td><br />
<td>BBa_K568001</td><br />
<td>Optogenetical AND-Gate red/blue light</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537001</td><br />
<td>Theophylline Riboswitch 1-CheZ</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537002</td><br />
<td>Theophylline Riboswitch 2-CheZ</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537003</td><br />
<td>Theophylline Riboswitch 1-Venus</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537010</td><br />
<td>Promoter-Theophylline riboswitch 2-Venus-Double terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537011</td><br />
<td>Promoter-Theophylline riboswitch 1-CheZ-Venus-Double terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537004</td><br />
<td>Theophylline Riboswitch 2-Venus</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537000</td><br />
<td>Atrazine Riboswitch-CheZ fusion</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537008</td><br />
<td>Atrazine Riboswitch-mRFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537014</td><br />
<td>Promoter-Atrazine riboswitch-mCherry-Double terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537015</td><br />
<td>Promoter-Atrazine riboswitch-CheZ-mCherry-Double terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537016</td><br />
<td>Promoter-RBS-CheZ-mCherry-Double terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2011</td><br />
<td>iGEM11_WITS_CSIR_SA</td><br />
<td>BBa_K537009</td><br />
<td>Promoter-Theophylline riboswitch 1-Venus-Double terminator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012 </td><br />
<td>BBa_K779311</td><br />
<td>HH-mKate - Hammerhead attached to front of mKate MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012 </td><br />
<td>BBa_K779312</td><br />
<td>mKate-HH - Hammerhead attached behind mKate MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012 </td><br />
<td>BBa_K779313</td><br />
<td>HHm-mKate - Repressible hammerhead attached to front of mKate MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779314</td><br />
<td>mKate-HHm - Repressible hammerhead behind mKate MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779315</td><br />
<td>5' Hammerhead with loss-of-function mutation MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779316</td><br />
<td>3' Hammerhead with loss-of-function mutation MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779317</td><br />
<td>5' Hammerhead MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779318</td><br />
<td>3' Hammerhead MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779608</td><br />
<td>Hef1a-HH-mKate Mammoblock Device</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779609</td><br />
<td>Hef1a-mKate-HH Mammoblock Device</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779404</td><br />
<td>U6-TetO-DecoyFF4-3p MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779405</td><br />
<td>U6-TetO-DecoyFF4-3p-4ntin MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779406</td><br />
<td>U6-TetO-TuDFF4-3p MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779407</td><br />
<td>U6-TetO-TuDFF4-3p-4ntin MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779408</td><br />
<td>U6-TetO-Sa MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>MIT 2012</td><br />
<td>BBa_K779409</td><br />
<td>U6-TetO-Sc MammoBlock</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Austin Texas 2012</td><br />
<td>BBa_K734002</td><br />
<td>Spinach Aptamer with Stabilizing tRNA Scaffold</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/reporter</td><br />
<td>//RNA/ncRNA/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833001</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833002</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833003</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833004</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833005</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833006</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833007</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833008</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833009</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833010</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>BYUProvo 2012</td><br />
<td>BBa_K833011</td><br />
<td>Mutated prfA-UTR thermosensor from Listeria monocytogenes</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902008</td><br />
<td>MgtA riboswitch</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902015</td><br />
<td>MgtA riboswitch with GFP-LVA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902023</td><br />
<td>Moco Riboswitch</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902012</td><br />
<td>pLacI(R0010)+mgtA riboswitch</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902013</td><br />
<td>MgtA promoter with mgtA riboswitch</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902014</td><br />
<td>LacI(R0010)+mgtA riboswitch+GFP-LVA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902025</td><br />
<td>Moco Riboswitch- GFP(LVA)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902026</td><br />
<td>Moco Riboswitch-S7</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902027</td><br />
<td>LacI(R0010)-MOCO riboswitch-CviAII</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902028</td><br />
<td>Moco Riboswitch-CviAII</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902074</td><br />
<td>mntP riboswitch</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902075</td><br />
<td>mntP riboswitch + GFP(+LVA)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902078</td><br />
<td>mntP promoter-mntP riboswitch-s7</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902082</td><br />
<td>TetR Promoter-moco riboswitch-GFP LacI Promoter-rbs</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902083</td><br />
<td>R0040-moco-S7-J04500-moaoperon</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Calgary 2012</td><br />
<td>BBa_K902085</td><br />
<td>R0040-mocoRibo-S7-J04500</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Fudan_D 2012</td><br />
<td>BBa_K798002</td><br />
<td>Ribozyme sequence</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Fudan_D 2012</td><br />
<td>BBa_K798003</td><br />
<td>Ribozyme sequence</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Fudan_D 2012</td><br />
<td>BBa_K798004</td><br />
<td>Ribozyme sequence</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Fudan_D 2012</td><br />
<td>BBa_K798011</td><br />
<td>Ribozyme sequence</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Fudan_D 2012</td><br />
<td>BBa_K798012</td><br />
<td>Ribozyme sequence</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Fudan_D 2012</td><br />
<td>BBa_K798013</td><br />
<td>Ribozyme sequence</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/ribozyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>OUC-China 2012</td><br />
<td>BBa_K737031</td><br />
<td>Spot42 based small RNA1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/siRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>OUC-China 2012</td><br />
<td>BBa_K737032</td><br />
<td>Spot42 based small RNA2</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/siRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>SEU_O_China 2012</td><br />
<td>BBa_K897624</td><br />
<td>Antisense FtsZ</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>SJTU-BioX-Shanghai 2012</td><br />
<td>BBa_K771009</td><br />
<td>RNA?D0</td><br />
<td>//RNA/ncRNA/regulation_level/protein</td><br />
<td>//RNA/ncRNA/function/colocalization_scaffold</td><br />
<td>//RNA/ncRNA/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>ZJU-China 2012</td><br />
<td>BBa_K738000</td><br />
<td>RNA Scaffold generator</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>ZJU-China 2012</td><br />
<td>BBa_K738002</td><br />
<td>Theophyline riboswitch regulated RNA Scaffold</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Cambridge 2012</td><br />
<td>BBa_K911001</td><br />
<td>Magnesium sensitive riboswitch</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Cambridge 2012</td><br />
<td>BBa_K911003</td><br />
<td>Fluoride Sensitive Riboswitch</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Cambridge 2012</td><br />
<td>BBa_K911002</td><br />
<td>Magnesium sensitive riboswitch (8 codon substitution)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Uppsala 2012</td><br />
<td>BBa_K864440</td><br />
<td>Small RNA spot42</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/siRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2012</td><br />
<td>Colombia 2012</td><br />
<td>BBa_K831004</td><br />
<td>istR (inhibitor of SOS-induced toxicity by RNA) is small ncRNA of Escherichia coli K12</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/siRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Chiba</td><br />
<td>BBa_K1057014</td><br />
<td>CRISPRi-fur</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Chiba</td><br />
<td>BBa_K1057015</td><br />
<td>CRISPRi-fieF</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Chiba</td><br />
<td>BBa_K1057016</td><br />
<td>CRISPRi-gor</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Chiba</td><br />
<td>BBa_K1057017</td><br />
<td>CRISPRi-trxB</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100014</td><br />
<td>ALeaderT (with insulator)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100000</td><br />
<td>ALeader</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100012</td><br />
<td>OUTS1 repressible cI</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_IN</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100061</td><br />
<td>RNA-OUT S1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_OUT</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100062</td><br />
<td>RNA-OUT S4</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_OUT</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100063</td><br />
<td>RNA-OUT S5</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_OUT</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100064</td><br />
<td>RNA-OUT S31</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_OUT</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100065</td><br />
<td>RNA-OUT S34</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_OUT</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100066</td><br />
<td>RNA-OUT S49</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_OUT</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100020</td><br />
<td>J23100-ALeader</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100021</td><br />
<td>J23101-ALeader</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100125</td><br />
<td>J23105-ALeader</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100130 </td><br />
<td>J23110-ALeader</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100140</td><br />
<td>J23100-ALeaderT</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100141</td><br />
<td>J23100-ALeaderT</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100144</td><br />
<td>J23104-ALeaderT</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100145</td><br />
<td>J23105-ALeaderT</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100150</td><br />
<td>J23110-ALeaderT</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100021</td><br />
<td>R0040-Aleader</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100022</td><br />
<td>R0063-ALeader</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100085</td><br />
<td>R0040-ALeaderT </td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100086</td><br />
<td>R1051-ALeaderT </td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100087</td><br />
<td>R0063-ALeaderT Mut(G4A) </td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100071</td><br />
<td>RNA-IN S1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_IN</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100072</td><br />
<td>RNA-IN S4</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_IN</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100073</td><br />
<td>RNA-IN S5</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_IN</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100074</td><br />
<td>RNA-IN S31</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_IN</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100075</td><br />
<td>RNA-IN S34</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_IN</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100076</td><br />
<td>RNA-IN S49</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_IN</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100013</td><br />
<td>R1051-OUT S1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_OUT</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Fudan</td><br />
<td>BBa_K1100001</td><br />
<td>ALeaderT:The First Artificial Triphase Riboswitch</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Kyoto</td><br />
<td>BBa_K1126001</td><br />
<td>TetR aptamer 12_1P</td><br />
<td>//RNA/ncRNA/regulation_level/protein</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Kyoto</td><br />
<td>BBa_K1126008</td><br />
<td>Fusion1 antisense</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/pT181</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Kyoto</td><br />
<td>BBa_K1126000</td><br />
<td>TetR aptamer 12_1R</td><br />
<td>//RNA/ncRNA/regulation_level/protein</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Kyoto</td><br />
<td>BBa_K1126002</td><br />
<td>TetR aptamer 12_1M</td><br />
<td>//RNA/ncRNA/regulation_level/protein</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Kyoto</td><br />
<td>BBa_K1126003</td><br />
<td>pT181 attenuator</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td>//RNA/ncRNA/nature/pT181</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Kyoto</td><br />
<td>BBa_K1126004</td><br />
<td>Fusion3m2 attenuator</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Kyoto</td><br />
<td>BBa_K1126005</td><br />
<td>Fusion1 attenuator</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Kyoto</td><br />
<td>BBa_K1126006</td><br />
<td>pT181 antisense</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td>//RNA/ncRNA/nature/pT181</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Kyoto</td><br />
<td>BBa_K1126007</td><br />
<td>Fusion6 antisense</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Nanjing-China</td><br />
<td>BBa_K1145003</td><br />
<td>A ribosome switch which can be opened by atrazine</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>NCTU_Formosa</td><br />
<td>BBa_K1017202</td><br />
<td>Regulation RBS-2</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>NCTU_Formosa</td><br />
<td>BBa_K1017404</td><br />
<td>sRNA-2</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>NCTU_Formosa</td><br />
<td>BBa_K1017403</td><br />
<td>sRNA-1 (with Plux)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>NCTU_Formosa</td><br />
<td>BBa_K1017602</td><br />
<td>37? RBS + mGFP</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>NCTU_Formosa</td><br />
<td>BBa_K1017603</td><br />
<td>37? RBS + LuxR</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>NCTU_Formosa</td><br />
<td>BBa_K1017401</td><br />
<td>sRNA+rRBS-1</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>NCTU_Formosa</td><br />
<td>BBa_K1017402</td><br />
<td>sRNA+rRBS-2</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>NJU_China</td><br />
<td>BBa_K1180000</td><br />
<td>anti-HBV siRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>SCU_China</td><br />
<td>BBa_K1087004</td><br />
<td>Ptet-Riboregulator(lock 3d)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Shenzhen_BGIC_ATCG</td><br />
<td>BBa_K1051700</td><br />
<td>SRC1 Intron -4bp at 5</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/function/insulating</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Shenzhen_BGIC_ATCG</td><br />
<td>BBa_K1051701</td><br />
<td>SRC1 Intron+GG</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/function/insulating</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Shenzhen_BGIC_ATCG</td><br />
<td>BBa_K1051702</td><br />
<td>SRC1 Intron+CGG</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/function/insulating</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Shenzhen_BGIC_ATCG</td><br />
<td>BBa_K1051802</td><br />
<td>sgRNA targeting to GFP gene</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Shenzhen_BGIC_ATCG</td><br />
<td>BBa_K1051703</td><br />
<td>SRC1 Intron with additional 6bp at both directions</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/function/insulating</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Shenzhen_BGIC_ATCG</td><br />
<td>BBa_K1051704</td><br />
<td>Mer2 Intron</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/function/insulating</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>SJTU-BioX-Shanghai</td><br />
<td>BBa_K1026002</td><br />
<td>Constitutively Expressed gRNA targeting mRFP</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>SJTU-BioX-Shanghai</td><br />
<td>BBa_K1026003</td><br />
<td>gRNA targeting mRFP</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tokyo-NoKoGen</td><br />
<td>BBa_K1053000</td><br />
<td>taRNA responsive Hammerhead Ribozyme(TR-HHR) with RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tokyo-NoKoGen</td><br />
<td>BBa_K1053003</td><br />
<td>taRNA responsive Hammerhead Ribozyme with RBS + GFPuv + DT</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tokyo-NoKoGen</td><br />
<td>BBa_K1053011</td><br />
<td>taRNA(taR42) responsive Hammerhead Ribozyme(TR(42)-HHR) with RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tokyo-NoKoGen</td><br />
<td>BBa_K1053012</td><br />
<td>taRNA(taR12y) responsive Hammerhead Ribozyme(TR(12y)-HHR) with RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tokyo-NoKoGen</td><br />
<td>BBa_K1053014</td><br />
<td>TR(12)-HHR-taR12y</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tokyo-NoKoGen</td><br />
<td>BBa_K1053100</td><br />
<td>RNA scaffold</td><br />
<td>//RNA/ncRNA/function/colocalization_scaffold</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tokyo-NoKoGen</td><br />
<td>BBa_K1053101</td><br />
<td>HHR with RNA scaffold</td><br />
<td>//RNA/ncRNA/function/colocalization_scaffold</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tokyo-NoKoGen</td><br />
<td>BBa_K1053120</td><br />
<td>RNA scaffold containing HTLV-1 Rex peptide and ?N peptide aptamer</td><br />
<td>//RNA/ncRNA/function/colocalization_scaffold</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tsinghua-A </td><br />
<td>BBa_K1116000</td><br />
<td>LacI with miR-21 and miR-FF3 target</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Tsinghua-A </td><br />
<td>BBa_K1116001</td><br />
<td>LacI with miR-FF5 and miR-FF3 target</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1124005</td><br />
<td>MicC sRNA scaffold (w/o antisense)</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1124006</td><br />
<td>anti-mCherry sRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1124007</td><br />
<td>anti-luxI sRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1124008</td><br />
<td>anti-hycA sRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1124009</td><br />
<td>anti-tyrR sRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1124010</td><br />
<td>anti-csrA sRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1124012</td><br />
<td>anti-trpD sRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1124112</td><br />
<td>sRNA scaffold (-antisense, +terminator)</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Goettingen</td><br />
<td>BBa_K1045007</td><br />
<td>YdaO Riboswitch only</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Goettingen</td><br />
<td>BBa_K1045006</td><br />
<td>YdaO Riboswitch with native Promoter</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Goettingen</td><br />
<td>BBa_K1045005</td><br />
<td>YdaO Riboswitch with native RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>INSA_Toulouse</td><br />
<td>BBa_K1132005</td><br />
<td>R0 riboregulator switch with pTET and pLuxRCI</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>INSA_Toulouse</td><br />
<td>BBa_K1132006</td><br />
<td>R1 riboregulator switch with with pTET and pLuxRCI</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>INSA_Toulouse</td><br />
<td>BBa_K1132007</td><br />
<td>R2 riboregulator switch with with pTET and pFixJ</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>INSA_Toulouse</td><br />
<td>BBa_K1132042</td><br />
<td>R1-pLac riboregulator switch with with pTET and pLac</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>METU_Turkey</td><br />
<td>BBa_K1197000</td><br />
<td>Antisense RNA to inhibit MazF activity in B.subtilis</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Paris_Bettencourt</td><br />
<td>BBa_K1137009</td><br />
<td>sRNA anti Kan</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Paris_Bettencourt</td><br />
<td>BBa_K1137010</td><br />
<td>sRNA anti Cm</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Paris_Bettencourt</td><br />
<td>BBa_K1137011</td><br />
<td>sRNA anti lac</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Paris_Bettencourt</td><br />
<td>BBa_K1137012</td><br />
<td>gRNA anti KAN</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Paris_Bettencourt</td><br />
<td>BBa_K1137013</td><br />
<td>crRNA anti KAN</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>British_Columbia</td><br />
<td>BBa_K1129008</td><br />
<td>Sense tracrRNA from Streptococcus thermophilus</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>British_Columbia</td><br />
<td>BBa_K1129009</td><br />
<td>Anti-sense tracrRNA from Streptococcus thermophilus</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>British_Columbia</td><br />
<td>BBa_K1129027</td><br />
<td>sense tracRNA under arabinose promoter</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>British_Columbia</td><br />
<td>BBa_K1129028</td><br />
<td>antisense tracRNA under arabinose promoter</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Concordia </td><br />
<td>BBa_K1165002</td><br />
<td>PenI-cleaving Ribozyme 1 of XOR Gate 1</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Concordia </td><br />
<td>BBa_K1165003</td><br />
<td>PenI-cleaving Ribozyme 1 of XOR Gate 1</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Concordia </td><br />
<td>BBa_K1165004</td><br />
<td>PenI-cleaving Ribozyme 1 of XOR Gate 2</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Lethbridge</td><br />
<td>BBa_K1210001</td><br />
<td>PK401 Pseudoknot</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>Stanford-Brown</td><br />
<td>BBa_K1218000</td><br />
<td>Minimal CRISPR Array</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UCSF</td><br />
<td>BBa_K1062000</td><br />
<td>Guide RNA (gRNA) target for RFP</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UCSF</td><br />
<td>BBa_K1062001</td><br />
<td>Guide RNA (gRNA) target for GFP</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UCSF</td><br />
<td>BBa_K1062002</td><br />
<td>Guide RNA (gRNA) target for XylE (middle of gene)</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UCSF</td><br />
<td>BBa_K1062003</td><br />
<td>Guide RNA (gRNA) target for XylE (end of gene)</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UCSFUC_Davis</td><br />
<td>BBa_K1212000</td><br />
<td>Theophylline Riboswitch (Clone 8.1*)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2013</td><br />
<td>UCSFUC_Davis</td><br />
<td>BBa_K1212001</td><br />
<td>Theophylline Riboswitch (Clone E)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>BIT-China</td><br />
<td>BBa_K1325012</td><br />
<td>sRNA+antisicA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>BIT-China</td><br />
<td>BBa_K1325013</td><br />
<td>sRNA+antiipgc</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>BIT-China</td><br />
<td>BBa_K1325014</td><br />
<td>sRNA+antiMinC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>BIT-China</td><br />
<td>BBa_K1325015</td><br />
<td>sRNA+antiMinD</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>BIT-China</td><br />
<td>BBa_K1325017</td><br />
<td>sRNA+antiexsC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Gifu</td><br />
<td>BBa_K1332008</td><br />
<td>mRNA circularization device (5´ side)</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Gifu</td><br />
<td>BBa_K1332010</td><br />
<td>mRNA circularization device (3´ side)</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Gifu</td><br />
<td>BBa_K1332009</td><br />
<td>mRNA circularization device (3´ side) (endless translation)</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Gifu</td><br />
<td>BBa_K1332003</td><br />
<td>The 5´ side of the intron(+exon fragment) from td gene of T4 phage without stop codon</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Gifu</td><br />
<td>BBa_K1332004</td><br />
<td>The 5' side of the intron(+exon fragment) from td gene of T4 phage</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Gifu</td><br />
<td>BBa_K1332005</td><br />
<td>The 3' side of the intron(+exon fragment) from td gene of T4 phage</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/ribozyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>HokkaidoU_Japan</td><br />
<td>BBa_K1524100</td><br />
<td>H-stem expression vector</td><br />
<td>//RNA/ncRNA/function/stability_control</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>HokkaidoU_Japan</td><br />
<td>BBa_K1524104</td><br />
<td>stemmed anti-sense mRFP (90 nt)</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>HokkaidoU_Japan</td><br />
<td>BBa_K1524105</td><br />
<td>stemmed anti-sense mRFP (120 nt)</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>HokkaidoU_Japan</td><br />
<td>BBa_K1524106</td><br />
<td>stemmed anti-sense mRFP (150 nt)</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379018</td><br />
<td>HKUST Lock 1</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379019</td><br />
<td>HKUST Key 1</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379020</td><br />
<td>Lock 1-GFP-B0015</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379022</td><br />
<td>Lock 3-GFP-B0015</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379023</td><br />
<td>Key 3-B0015</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379024</td><br />
<td>Lock 3c-GFP-B0015</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379026</td><br />
<td>K175031-GFP-B0015</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379027</td><br />
<td>K175032-B0015</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379028</td><br />
<td>HKUST Lock 1-GFP-B0015</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379029</td><br />
<td>HKUST Key 1-B0015</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379033</td><br />
<td>pBad/araC-Key 3</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379035</td><br />
<td>pBad/araC-Key 3c</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379037</td><br />
<td>pBad/araC-K175032</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Hong_Kong_HKUST</td><br />
<td>BBa_K1379039</td><br />
<td>pBad/araC-HKUST Key 1</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>HZAU-China</td><br />
<td>BBa_K1368010</td><br />
<td>Spinach Aptamer 13-2 RNA driven by c1 promoter</td><br />
<td>//RNA/ncRNA/function/reporter</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>HZAU-China</td><br />
<td>BBa_K1368011</td><br />
<td>Spinach Aptamer 13-2 RNA with Stabilizing tRNA Scaffold</td><br />
<td>//RNA/ncRNA/function/reporter</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Nanjing-China</td><br />
<td>BBa_K1520001</td><br />
<td>Riboswitch MC7</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Nanjing-China</td><br />
<td>BBa_K1520002</td><br />
<td>Riboswitch MC31</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>NJAU_China</td><br />
<td>BBa_K1555006</td><br />
<td>sgRNA which cooperates with dCAS9 protein can target copa's CDS specifically</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>NJAU_China</td><br />
<td>BBa_K1555007</td><br />
<td>copA's 20nt target sequence+sgRNA scaffold</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>SUSTC-Shenzhen</td><br />
<td>BBa_K1431402</td><br />
<td>gRNA1 for HBV</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>SUSTC-Shenzhen</td><br />
<td>BBa_K1431403</td><br />
<td>gRNA2 for HBV</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>SUSTC-Shenzhen</td><br />
<td>BBa_K1431501</td><br />
<td>Upstream Activation Sequence(UAS) bind to the GAL4 protein and then activate gene transcription</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td>//RNA/ncRNA/function/colocalization_scaffold</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>SUSTC-Shenzhen</td><br />
<td>BBa_K1431502</td><br />
<td>Upstream Activation Sequence(UAS) bind to the GAL4 protein and then activate gene transcription</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td>//RNA/ncRNA/function/colocalization_scaffold</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>SUSTC-Shenzhen</td><br />
<td>BBa_K1431503</td><br />
<td>Upstream Activation Sequence(UAS) bind to the GAL4 protein and then activate gene transcription</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td>//RNA/ncRNA/function/colocalization_scaffold</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>NYMU-Taipei </td><br />
<td>BBa_K1510101</td><br />
<td>sRNA targets histidine kinase 11 mRNA in S.mutans</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>NYMU-Taipei </td><br />
<td>BBa_K1510102</td><br />
<td>sRNA targets G protein mRNA in S.mutans</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>NYMU-Taipei </td><br />
<td>BBa_K1510103</td><br />
<td>MicC scaffold from E.coli MG1655</td><br />
<td>//RNA/ncRNA/function/colocalization_scaffold</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>SYSU-China</td><br />
<td>BBa_K1333303</td><br />
<td>I13453-Rose42</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>SYSU-China</td><br />
<td>BBa_K1333304</td><br />
<td>I13453-PrfA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>SYSU-China</td><br />
<td>BBa_K1333305</td><br />
<td>I13453-FourU</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473001</td><br />
<td>gRNA 1</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473002</td><br />
<td>gRNA 2</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473003</td><br />
<td>gRNA 3</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473004</td><br />
<td>gRNA 4</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473006</td><br />
<td>gRNA for ampR 1</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473007</td><br />
<td>gRNA for ampR 2</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473008</td><br />
<td>gRNA for ampR 3</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473010</td><br />
<td>gRNA for ampR 4</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473011</td><br />
<td>gRNA for ampR 5</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473012</td><br />
<td>gRNA for NeoR/kanR 1</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473013</td><br />
<td>gRNA for NeoR/kanR 2</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473014</td><br />
<td>gRNA for NeoR/kanR 3</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473015</td><br />
<td>gRNA for NeoR/kanR 4</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473016</td><br />
<td>gRNA for NeoR/kanR 5</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473017</td><br />
<td>gRNA for tetR 1</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473018</td><br />
<td>gRNA for tetR 2</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473019</td><br />
<td>gRNA for tetR 3</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473020</td><br />
<td>gRNA for tetR 4</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>TCU_Taiwan</td><br />
<td>BBa_K1473021</td><br />
<td>gRNA for tetR 5</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UB_Indonesia</td><br />
<td>BBa_K1367004</td><br />
<td>siRNA for LAR ( leucoanthocyanidin reductase) gene in Camelia sinensis</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UB_Indonesia</td><br />
<td>BBa_K1367005</td><br />
<td>siRNA GFP</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UI-Indonesia </td><br />
<td>BBa_K1344006</td><br />
<td>J23100-ROSE</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363600</td><br />
<td>a aptamyze regulator sensetive to Theophylline</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363601</td><br />
<td>the gate of yes of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363602</td><br />
<td>key of yes of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363603</td><br />
<td>gate of no of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363604</td><br />
<td>key of no of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363605</td><br />
<td>gate of and of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363606</td><br />
<td>key-1-of and-gate of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363607</td><br />
<td>key-2 of and-gate of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363609</td><br />
<td>gate of or of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363610</td><br />
<td>key-1-of-or of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>USTC-China</td><br />
<td>BBa_K1363611</td><br />
<td>key-1 of gate-of-or of RNA logic gates</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>XMU-China</td><br />
<td>BBa_K1412088</td><br />
<td>A combination of theophylline aptamer and taRNA that can response theophylline to regulate circuit</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>XMU-China</td><br />
<td>BBa_K1412089</td><br />
<td>Riboregulator which combines crRNA and RBS acting as a lock to the gene cuicuit</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1461000</td><br />
<td>crRBS</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Tokyo</td><br />
<td>BBa_K1461003</td><br />
<td>taRNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Bielefeld-CeBiTec</td><br />
<td>BBa_K1465225</td><br />
<td>Knock-down of phosphofructokinase A using sRNA (sRNA:pfkA)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Bielefeld-CeBiTec</td><br />
<td>BBa_K1465225</td><br />
<td>sRNA of phosphofructokinase A under the control of ptac promoter (ptac_sRNA:pfkA)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Bielefeld-CeBiTec</td><br />
<td>BBa_K1465227</td><br />
<td>sRNA of phosphofructokinase A under the control of T7 promoter (T7_sRNA:pfkA)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>DTU-Denmark </td><br />
<td>BBa_K1330000</td><br />
<td>Spinach2.1 flanked by tRNALys3</td><br />
<td>//RNA/ncRNA/function/reporter</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>DTU-Denmark </td><br />
<td>BBa_K1330001</td><br />
<td>Spinach2.1 flanked by tRNALys3 with terminator BBa_B0052</td><br />
<td>//RNA/ncRNA/function/reporter</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>ETH_Zurich</td><br />
<td>BBa_K1541023</td><br />
<td>P(Lux) with riboregulator RR12y</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>ETH_Zurich</td><br />
<td>BBa_K1541024</td><br />
<td>P(Rhl) with riboregulator RR12</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboregulator/cis_repressive</td><br />
<td>//RNA/ncRNA/nature/riboregulator/trans_activating</td><br />
<td>//RNA/ncRNA/nature/complex</td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Freiburg</td><br />
<td>BBa_K1470003</td><br />
<td>Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE)</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>LMU-Munich</td><br />
<td>BBa_K1351019</td><br />
<td>Reverse complementary RNA sequence which binds the mRNA of the SdpI immunity</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>LMU-Munich</td><br />
<td>BBa_K1351022</td><br />
<td>FsrA: Fur-regulated sRNA which binds the binding site sdhC</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Manchester </td><br />
<td>BBa_K1434001</td><br />
<td>glmS riboswitch</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/riboswitch</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UCL</td><br />
<td>BBa_K1336005</td><br />
<td>Antisense for octaprenyl diphosphate synthase (ispB gene)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/asRNA</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Uppsala</td><br />
<td>BBa_K1381014</td><br />
<td>Silencing sRNA (10 bases long) for USP45 (Based on Spot42)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Uppsala</td><br />
<td>BBa_K1381015</td><br />
<td>Silencing sRNA (15 bases long) for USP45 (Based on Spot42)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Uppsala</td><br />
<td>BBa_K1381016</td><br />
<td>Silencing sRNA (20 bases long) for USP45 (Based on Spot42) </td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Warwick </td><br />
<td>BBa_K1442006</td><br />
<td>Anti-theophylline Aptazyme</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/aptazyme</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Warwick </td><br />
<td>BBa_K1442041</td><br />
<td>MS2 bacteriophage protein binding box (hairpin)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Warwick </td><br />
<td>BBa_K1442111</td><br />
<td>DPP-IV (our siRNA target)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/target_sequence</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Warwick </td><br />
<td>BBa_K1442113</td><br />
<td>siRNA for DPP-IV</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Tec-Monterrey</td><br />
<td>BBa_K1366105</td><br />
<td>Production of survivin siRNA under the hTERT promoter (C6)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Tec-Monterrey</td><br />
<td>BBa_K1366106</td><br />
<td>Production of survivin siRNA under a hTERT promoter (C7)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Tec-Monterrey</td><br />
<td>BBa_K1366107</td><br />
<td>Production of survivin siRNA under an hTERT promoter (C8)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Tec-Monterrey</td><br />
<td>BBa_K1366108</td><br />
<td>Apoptin and survivin siRNA production (C9)</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Lethbridge </td><br />
<td>BBa_K1419002</td><br />
<td>RNA-OUT component for an Arabinose inducible lysis casette</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_OUT</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Lethbridge </td><br />
<td>BBa_K1419001</td><br />
<td>Arabinose inducible lysis casette with RNA-IN</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_IN</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Lethbridge </td><br />
<td>BBa_K1419003</td><br />
<td>Universal riboregulatable RBS</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_IN_OUT/RNA_IN</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Northwestern </td><br />
<td>BBa_K1417000</td><br />
<td>Red Fluorescent Protein - Spacer - Spinach Aptamer</td><br />
<td>//RNA/ncRNA/function/reporter</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Northwestern </td><br />
<td>BBa_K1417002</td><br />
<td>RFP-Spinach-Aptamer</td><br />
<td>//RNA/ncRNA/function/reporter</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Northwestern </td><br />
<td>BBa_K1417003</td><br />
<td>Red Fluorescent Protein - Spacer - Spinach Aptamer</td><br />
<td>//RNA/ncRNA/function/reporter</td><br />
<td>//RNA/ncRNA/nature/aptamer</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>StanfordBrownSpelman</td><br />
<td>BBa_K1499251</td><br />
<td>supP tRNA</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/others</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Toronto </td><br />
<td>BBa_K1559000</td><br />
<td>tracr RNA to be used with Cas9</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Tufts</td><br />
<td>BBa_K1427000</td><br />
<td>merRNA, c-di-GMP aptamer</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNA_aptamer</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487000</td><br />
<td>Guide RNA (gRNA) target for acfA</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487001</td><br />
<td>Guide RNA (gRNA) target for acfB</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487002</td><br />
<td>Guide RNA (gRNA) target for acfC</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487003</td><br />
<td>Guide RNA (gRNA) target for acfD</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487004</td><br />
<td>Guide RNA (gRNA) target for ctxA</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487005</td><br />
<td>Guide RNA (gRNA) target for ctxB</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487006</td><br />
<td>Guide RNA (gRNA) target for tcpA</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487007</td><br />
<td>Guide RNA (gRNA) target for tcpB</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487008</td><br />
<td>Guide RNA (gRNA) target for tcpC</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487009</td><br />
<td>Guide RNA (gRNA) target for tcpD</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487010</td><br />
<td>Guide RNA (gRNA) target for tcpE</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487011</td><br />
<td>Guide RNA (gRNA) target for tcpF</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487012</td><br />
<td>Guide RNA (gRNA) target for tcpH</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487013</td><br />
<td>Guide RNA (gRNA) target for tcpI</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487014</td><br />
<td>Guide RNA (gRNA) target for tcpJ</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487015</td><br />
<td>Guide RNA (gRNA) target for tcpP</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487016</td><br />
<td>Guide RNA (gRNA) target for tcpQ</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487017</td><br />
<td>Guide RNA (gRNA) target for tcpR</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487018</td><br />
<td>Guide RNA (gRNA) target for tcpS</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487019</td><br />
<td>Guide RNA (gRNA) target for tcpT</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>UT-Dallas</td><br />
<td>BBa_K1487020</td><br />
<td>Guide RNA (gRNA) target for toxT</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Waterloo </td><br />
<td>BBa_K1323000</td><br />
<td>sgRNA (1): CRISPR Silencing of YFP</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Waterloo </td><br />
<td>BBa_K1323001</td><br />
<td>sgRNA (2): CRISPR Silencing of YFP</td><br />
<td>//RNA/ncRNA/regulation_level/DNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/CRISPR</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Waterloo </td><br />
<td>BBa_K1323005</td><br />
<td>sRNA (1): YFP-targeting molecule</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Waterloo </td><br />
<td>BBa_K1323006</td><br />
<td>sRNA (2): YFP-targeting molecule</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Waterloo </td><br />
<td>BBa_K1323007</td><br />
<td>sRNA (3): YFP-targeting molecule</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
<tr><br />
<td>2014</td><br />
<td>Waterloo </td><br />
<td>BBa_K1323008</td><br />
<td>sRNA control for S. epidermidis: targets the non-coding region</td><br />
<td>//RNA/ncRNA/regulation_level/RNA</td><br />
<td>//RNA/ncRNA/function/regulation</td><br />
<td>//RNA/ncRNA/nature/RNAi</td><br />
<td></td><br />
<td></td><br />
</tr><br />
</tbody></table><br />
<br />
<script><br />
$("tr:contains('BBa_')").css( "display", "none" );<br />
function resettable(){<br />
$("tr:contains('BBa_')").css( "display", "none" );<br />
}<br />
function displayVals() {<br />
<br />
var multipleValues = $( "#multiple" ).val() || [];<br />
<br />
$("tr:contains("+multipleValues+")").css( "display", "table-row" );<br />
<br />
}<br />
<br />
$( "select" ).change( displayVals );<br />
<br />
<br />
</script><br />
</div><br />
<!--end of catalog --><br />
<br />
</div><br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div style= "text-align:center; background-color:#00CAAA; font-size: 12px;" class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body></html><br />
}}</div>
Hyht2011
http://2014.igem.org/File:BBF_RFC_X_categorization_of_ncRNA_Raul_formated_Eric_edited_FINAL.pdf
File:BBF RFC X categorization of ncRNA Raul formated Eric edited FINAL.pdf
2015-07-17T19:08:40Z
<p>Hyht2011: BBF_RFC_X__categorization_of_ncRNA_Raul_formated_Eric_edited_FINAL.pdf</p>
<hr />
<div>BBF_RFC_X__categorization_of_ncRNA_Raul_formated_Eric_edited_FINAL.pdf</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization
Team:Hong Kong HKUST/riboregulator/characterization
2015-01-23T03:38:26Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
</head></html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<br />
<div id="description_area"><br />
<br><h2>Riboregulator Characterization</h2><br><br />
</div><br />
<br />
<br />
<!-- one row of content , two column--><br />
<div class='content_1'><h3>Introduction</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<div class="ienlarger"><br />
<a href="#nogo"><br />
<br />
<br />
</a></div><br />
<br />
<p>Riboregulator is a type regulatory RNA that can regulate translation. One component of the riboregulator system, <br />
cis-repressing RNA, crRNA, contains a cis-repressing sequence which is located at the 5’ of the RBS and the gene of interest.<br />
When the transcript is formed, the cis-repressing sequence can form a loop to form complementary base pairs with the RBS and blocking the ribosome's entry <br />
to RBS. crRNA is commonly called “lock” because it “locks” the translation of proteins. When there is a lock, we need a “key”. The taRNA is the component of the <br />
system that<br />
act as a key. It can interact (in trans) with the cis-repressing sequence to unlock the RBS and therefore activate translation. The HKUST iGEM 2014 <br />
team characterized 4 riboregulator already available in the Part Registry and 1 riboregulator introduced by our team. <br />
<br />
<br><br><b>Table 1 List of riboregulator pairs characterized by HKUST iGEM 2014 team:</b><br><br />
<br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Name and registry code</th><br />
<th scope="col">Group</th><br />
<th scope="col">Cognate pair</th><br />
<br />
</tr><br />
</thead><br />
<tbody><br />
<br />
<tr><br />
<td scope="row">Lock 1 <a href="http://parts.igem.org/Part:BBa_J01010">BBa_J01010 </a> Key 1<a href="http://parts.igem.org/Part:BBa_J01008">BBa_J01008 </a></td> <br />
<td>iGEM 2005_Berkeley (Golden Bear)</td> <br />
<td>Yes</td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">Lock 3 <a href="http://parts.igem.org/Part:BBa_J01080">BBa_J01080 </a> Key3 <a href="http://parts.igem.org/Part:BBa_J01086">BBa_J01086 </a></td> <br />
<td>iGEM 2005_Berkeley (Golden Bear)</td> <br />
<td>Yes</td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">Medium lock <a href="http://parts.igem.org/Part:BBa_K175031">BBa_K175031</a> Key for medium lock <a href="http://parts.igem.org/Part:BBa_K175032">BBa_K175032 </a> </td> <br />
<td>iGEM09_TUDelft</td> <br />
<td>Yes</td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">Lock 3c <a href="http://parts.igem.org/Part:BBa_J23031">BBa_J23031 </a> Key 3c<a href="http://parts.igem.org/Part:BBa_J23008">BBa_J23008 </a></td> <br />
<td>iGEM 2006_Berkeley</td> <br />
<td>No</td> <br />
</tr><br />
<br />
</table><br />
<p>Riboregulators have cognate pairs. For certain crRNA, there is a corresponding taRNA that can activate and “unlock” the repression by crRNA. We originally thought that <br />
Lock 3c and Key 3c (Table 1.) were cognate pairs, but they turned out to be that the iGEM 2006_Berkeley simply made variants of Lock 3 and Key 3. They put an <br />
alphabet at the end of the name every time they produced different variants of lock 3 and key 3. The lock 3 and key 3 variants were created independently from each other so <br />
the letters at the end of name does not mean correspondence. Other teams should take note of this when they consider using riboregulator variants from iGEM 2006_Berkeley.</p><br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class='content_1'><h3>Riboregulator Results</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<a href="#nogo"></a><img src="https://static.igem.org/mediawiki/2014/f/fe/HKUST_ribo_characterizationA.png" /><br><img style="width:90%;" src="https://static.igem.org/mediawiki/2014/c/cc/HKUST_ribo_characterizationB.png"/><br />
<br />
<h5 style="font-size: 13px">Figure 1. Fluorescence (F)/OD600 measurements of riboregulator pairs after arabinose induction and their corresponding controls. </h5><br />
<h6 style= "font-size: 13px"> All samples were inoculated in M9 minimal salt medium overnight in no or various arabinose concentrations (%w/v). The samples were diluted around 10 fold the next day. Measurements were made when the samples reached around the mid-log phase (OD600 = 0.3 to 0.5). <br />
Graphs depict the triplicate mean + standard deviation. (A) Schematic diagram of the genetic context of the experiment. Note that the diagram generalized the CR and TA sequences. (B) Measurement for Lock 1 (<a href="http://parts.igem.org/Part:BBa_J01010">BBa_J01010</a>) and Key 1 (<a href="http://parts.igem.org/Part:BBa_J01008">BBa_J01008</a>) cognate pair. (C) Measurement for Lock 3(<a href="http://parts.igem.org/Part:BBa_J01080">BBa_J01080</a>) and Key 3 (<a href="http://parts.igem.org/Part:BBa_J01086">BBa_J01086</a>) cognate pair. (D) Measurement for Medium lock (<a href="http://parts.igem.org/Part:BBa_K175031">BBa_K175031</a>) and Key for medium lock (<a href="http://parts.igem.org/Part:BBa_K175032">BBa_K175032</a>) cognate pair. (E) Measurement for Lock 3c (<a href="http://parts.igem.org/Part:BBa_J23031">BBa_J23031</a>) and Key 3c (<a href="http://parts.igem.org/Part:BBa_J23008">BBa_J23008</a>). </h6><br />
<br><br><br />
<p><br />
To characterize the different riboregulator pairs, we kept the genetic context identical except for the various cr-repressing sequences, trans-activating sequences and the RBS. The <br />
RBS sequence also had to be different for some of the riboregulator systems because the cr-repressing sequence depends on the RBS sequence. In order to repress translation, the <br />
cis-repressing sequence need to interact with the RBS, and so the interaction depends on the sequences. Since different teams used different RBS to design their cis-repressing <br />
sequences, we also had to use corresponding RBS for characterization. We had a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23102">BBa_J23102 </a>) to drive the <br />
expression of the cis-repressed GFP translation unit. For the expression taRNA, we wanted to control the expression and therefore we decided to use the arabinose inducible <br />
P<sub>BAD</sub> promoter (<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a>). The promoter was chosen because the 3’ end after the transcription start site of the <br />
promoter is short. Longer 3’ end can affect the function of the taRNA (Isaacs et al., 2004) (Figure 1. A). <br />
<br />
</p><br />
<br><br><br />
<br />
<br />
<br />
<p>For the riboregulator system to work, the repression of GFP synthesis needs to be first observed when the cis-repressing sequence is added 5’ of the RBS of the system. <br />
Significant repression can be seen in Lock 1-Key1, Lock 3-Key 3, and Medium lock (Lock m)-Key for medium lock (Key m) cognate pairs (Figure 1. B, C, D respectively). Almost <br />
full repression was observed for the three cognate pairs. For Lock 3c-Key 3c pair, we do not see repression when cis-repressing sequence is introduced to the system. Instead,<br />
converse can be observed. When we don’t have cis-repressing sequence, we see significant drop in the fluorescence (Figure 1.E). One possible reason could be that the RBS <br />
sequence that we used for the controls of Lock 3c Key 3c was incorrect. For Lock3c the target RBS sequence was not mentioned. It seemed like a variation of <br />
<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034 </a> with shorter 3’ end. In order to build the construct type 2 and 3 (Figure 1. A), the RBS sequence had to be <br />
deduced from the Lock 3c sequence. From the Lock 3c sequence, we have used a part of sequence that resembled the RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034<br />
</a>). The RBS sequence used may have been too short to be functional. Therefore, no fluorescence is observed when cis-repressing sequence is not present. On the other hand, <br />
fluorescence can be observed when cis-repressing sequence is present because firstly, the RBS is sequence is correct, and secondly because the cis-repressing sequence failed <br />
to repress the translation. <br><br> </p><br />
<br />
<p><br />
After repression, the system needs to be activated when taRNA is expressed. After the addition of arabinose, taRNA is expressed. Out of the three cognate riboregulator pairs that <br />
were repressed, only two showed significant increase after arabinose induction. Lock 1- Key 1 cognate pair showed around 13-fold increase for both 1% and 2.5% (%w/v) arabinose <br />
induction. Lock 3- Key 3 cognate pair showed around 1.5 and 3 fold increase for 1% and 2.5% of arabinose induction respectively. Lock 1-Key 1 and Lock 3- Key 3 behaved differently <br />
for different concentrations of arabinose induction. Full induction was observed at 1% arabinose for Lock 1- Key 1 cognate pairs while full induction for Lock 3- Key 3 was observed at<br />
2.5% arabinose. Statistically, no significant fold increase could be observed for Lock m- Key m cognate pair. </p><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class='content_1'><h3>Discussion</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><i>The fold increase for Lock 1- Key 1 is lower than that of riboregulator pair mentioned in the Isaacs et al.’s paper. </i><br><br><br />
<br />
iGEM 2005_Berkely, when they first introduced the riboregulator system to the iGEM community, they mentioned in the Part Registry page that Lock 1 and Key 1 are “Biobricked <br />
version of Isaacs’ riboregulator” crR12 and taR12 respectively. We can therefore expect the Lock 1 and Key 1 fold increase after induction to be similar to what Isaacs et al. have <br />
observed and mentioned in the paper. Isaacs et al. mention that for crR12 and taR12 cognate pair, they have observed 19-fold increase (Isaacs et al., 2004), our results showed only <br />
showed around 13 fold increase. One possibility for the deviation could be because the Lock 1 and Key 1 sequences are not 100% match with crR12 and taR12. Because scars are <br />
introduced in 5’ and 3’ end of a Biobricked parts, iGEM 2005_Berekeley had to shorten the original 5’ and 3’ end of the crR12 and taR12. This change actually changes the crRNA and <br />
taRNA sequence and therefore could result to the deviated results. Another possibility is simply because the genetic context that we did our characterization was different from what <br />
Isaac et al. used to characterize their riboregulator system. If this is the case, we can at least see that the system is not very modular: changing the genetic context can change <br />
the fold increase. <br><br><br />
<br />
<i>The fluorescence after induction is still low compared to that of unrepressed controls. </i><br><br><br />
<br />
Although we saw significant fold increase for two riboregulator systems that we have characterize, compared to the fluorescence of unrepressed controls, the fluorescence is very low.<br />
For Lock 1-Key 1 riboeregulator system, the fluorescence after induction only correspond to around 0.4% of the that of the unrepressed control. For the Lock 3-Key3 system, <br />
the value was around 0.3%. The lower expression partly is because of the lower mRNA levels. After the introduction of the cis-repressing sequence the mRNA level was 40% of <br />
that of the controls (Isaacs et al., 2004). Another reason for low fluorescence after induction could have resulted because of our genetic context. We have used a relatively <br />
strong constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23102">BBa_J23102</a>) to express the crRNA and a relatively weak arabinose inducible promoter <br />
(<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a>). This could have caused imbalance of crRNA and taRNA levels. We could have had lower taRNA level and therefore failed<br />
to fully activate the riboregulator system. Further investigation is required. Simply changing the arabinose inducible promoter to a strong promoter can tell us whether this is the <br />
case. <br><br><br />
<br />
<i>Different Lock-Key cognate pairs behaved differently to different arabinose concentration.</i><br><br><br />
<br />
Lock 1- Key 1 riboregulator cognate pair was fully induced and leveled off at 1% arabinose concentration. For Lock 3- Key 3 pair, the full induction was observed at 2.5% arabinose<br />
concentration. We did not conduct further investigation to understand the difference in the response. Further investigation on how changing the riboregulator sequence can change<br />
the sensitivity of the system could be an interesting study.<br />
</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class='content_1'><h3>Methods</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><i>Fluorometry </i><br><br><br />
<br />
Triplicate of each sample were inoculated overnight in a deep-well 96 well plate. M9 minimal salt solution was used for the inoculation because it gives low background fluorescence.<br />
1% and 2.5% (w/v) arabinose concentration was used for overnight induction. Samples were diluted around 10-fold the next day and regrown to mid-log phase (OD600=0.3 ~ 0.6). 200µl <br />
of sample were drawn out from the deep-well plate and plated on a clear round bottom plate for measurement. For each sample, OD<sub>595</sub> and Fluorescence was measured using <br />
EnVision Multilabel Reader. The excitation wavelength was 485/14nm and the emission wavelength was 535/25nm. Conversion factor for OD<sub>595</sub> to OD<sub>600</sub> was obtained<br />
by calculating the slope of the OD<sub>600</sub> v.s. OD<sub>595</sub> graph. The conversion factor, 1.24 was multiplied to OD<sub>595</sub> reading to covert the measurements to<br />
OD<sub>600</sub>. Background fluorescence was subtracted for each fluorescence measurement by making another standard Fluorescence v.s. OD<sub>600</sub> graph. DH10B with <br />
pSB3K3-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> was used to produce the standard curve. The corrected fluorescence was then divided by the corresponding <br />
OD<sub>600</sub>. Finally the average and standard deviation were calculated. <br />
<br />
</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<!-- end of one row of content , two column--><br />
</div><br />
<br><br><br />
<br />
<br />
<div id="content_container"><br />
<!-- one row of content , two column one picture right--><br />
<div id="description_area"><br />
<br><h2>P<sub>BAD</sub> Characterization<br><br />
<b>(Please note that the following data has been shown to be problematic because our new data do not match our old data. We will update the following information as soon as possible - HKUST iGEM 2015.23Jan2015)</b></h2><br><br />
</div><br />
<br />
<div class='content_1'><h3>Introduction</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>P<sub>BAD</sub> promoter is an arabinose inducible promoter. In nature, the promoter exist in the arabinose operon to regulate the transcription of araB, araA, and araD. <br />
The arabinose operon or the ara operon encodes enzymes needed or the catabolism of arabinose to xylulose 5- phosphate which is an intermediate of the pentose phosphate pathway<br />
. The Pc promoter which is adjacent to the P<sub>BAD</sub> promoter transcribes the araC gene in the opposite direction. AraC protein is responsible to repress the activity of<br />
the P<sub>BAD</sub> promoter when arabinose is absent. Once arabinose is present,the AraC protein binds to the arabinose and dimerize. The dimerize form of AraC-arabinose can<br />
activate the P<sub>BAD</sub> promoter (Schleif, 2010).</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<div class='content_1'><h3>P<sub>BAD</sub> promoter <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a> in Part Registry</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p> <br />
<br />
There are several P<sub>BAD</sub> promoters in the Part Registry. The promoter that we were interested in was <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a> because of <br />
two reasons. First, <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>, along with P<sub>BAD</sub>, has araC gene is regulated by the Pc promoter. Without the AraC, the <br />
repression and induction of P<sub>BAD</sub> can only work on strains that are AraC+. By coupling the araC gene with the P<sub>BAD</sub> promoter, we can be free from such restraints.<br />
Second, <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a> needed debugging. <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>, although it is useful, it is not<br />
requestable because of inconsistency in sequencing. Also, in the experience page, two teams, Groningen 2011 and Cambridge 2011 had some discrepancy on how the promoter responded<br />
to the arabinose induction. In brief, Groningen results show that the induction of the promoter by arabinose was gradual while Cambridge results show that it was an “on-or-off” <br />
response. We wanted to analyze these problems so that the part could be more reliable for other users. Cambridge cited a paper that mentioned that variation in response could have <br />
resulted from cell strain variation. (Khelbnikov, 2001)</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<br />
<div class='content_1'><h3>Results</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><u>All-or-none response was observed for individual cells</u>.<br>Flow cytometry can measure the fluorescence of individual cells. The individual measurement of cell <br />
fluorescence can be plotted in a forward scatter (FSC) intensity value versus fluorescence graph. An arbitrary vertical line divided the region of the graph with low <br />
fluorescence (Q3) and high fluorescence (Q4). <br><br><br />
<br />
For the negative control, DH10B transformed with pSB3K3-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>, we see cells distributed in Q3 while absent in Q4. <br />
The reverse was true for the positive control, DH10B transformed with pSB3K3-<a href="http://parts.igem.org/Part:BBa_I20260">BBa_I20260</a> (GFP generator regulated by <br />
<a href="http://parts.igem.org/Part:BBa_J23101">BBa_J23101</a>). We see most cells distributed in Q4. For our experimental sample, <br />
(pSB3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) similar trend could observed for three strains. <br />
At no arabinose induction, we see most of the cells in Q3. The distribution of cells shifted to Q4 when arabinose was added to the medium. We also see that the cells remained in Q3 <br />
even after arabinose induction. The bimodal distribution indicate that some cells got induced while other cells were in repressed state. <br />
</p><br />
<br><br />
<br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/0/02/FACS_hkust.png" /><br />
<h5 style="font-size: 13px">Figure 2. Forward scatter intensity (FSC) versus GFP graphs for samples with P<sub>BAD</sub> promoter regulating GFP generator. </h5><br />
<h6 style= "font-size: 13px"> All samples were inoculated in M9 minimal salt medium overnight in various arabinose concentrations (%w/v). The samples were <br />
diluted around 10 fold the next day. Sample were fixed and the fluorescence was measured using flow cytometer. The graphs were plotted for the control <br />
constructs, pSB3K3-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> (-) and pSB3K3-<a href="http://parts.igem.org/Part:BBa_I20260">BBa_I20260</a> <br />
(<a href="http://parts.igem.org/Part:BBa_J23101">BBa_J23101</a>) in the absence of arabinose. FSC versus GFP graphs for pSB3K3-<br />
<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a><br />
(<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>) in 0, 0.2 and 1.0% arabinose concentration were plotted. <br />
Each set of graphs were obtained for three different cell strains, DH10B, DH5α and BW25113. </h6> <br><br><br />
<br />
<br />
<p>The distribution can also give us some idea of P<sub>BAD</sub> promoter leakage in different cells strain. If the data points are on or near the boundary between Q3 and Q4, <br />
we know that the promoter is leaky. The results indicate that the promoter is relatively more leaky in DH10B compared to other cell strains. <br><br><br />
<br />
The percentages of cells in each Q3 and Q4 are highlighted in Figure 2. After addition of arabinose, we clearly see more percentage in Q4. Around 80% of the cells for DH10B <br />
and BW25113 are in Q4. Relatively lower percentage of cells in Q4 is observed for DH5α. Only around 60 to 70% of cells were in Q4 after arabinose induction. The shift in the <br />
distribution from Q3 to Q4 also corresponded to the increase of RPU across different arabinose concentration. At 0% arabinose concentration, for all three strain, higher percentage <br />
of cells are in Q3 and therefore the RPU is low. After arabinose induction, more cells are in Q4 and RPU is high. The percentage of cells in Q4 levels off for arabinose concentration<br />
that we have tested. The trend was observed for RPU measurement. <br><br><br />
<br />
We can also conclude that even after maximum period of induction (overnight induction) of arabinose, we still see some cells uninduced (in Q3). <br><br><br />
<br />
</p><br />
<img style="width:50%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/8/88/Percentageofcells_pbad_HKUST.png" /><br />
<h5 style="font-size: 13px">Figure 3. The percentage of cells in induced and uninduced state, and RPU across different arabinose concentration. </h5><br />
<h6 style= "font-size: 13px"> Q3 and Q4 represent the 3<sup>rd</sup> and 4<sup>th</sup> quadrants of the forward scatter versus GFP curve mentioned in <br />
Figure 2. The experimental condition was the same as the procedure mentioned in the caption of the Figure 1. The left y-axis is for the percent of cells in<br />
Q3 and Q4 while the right y-axis is for RPU. Graphs depict the triplicate mean ± standard deviation. (A) Graph for pSB3K3-<br />
<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> in DH10B. (B) Graph for <br />
pSBK3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> in DH5α. (C) Graph for <br />
pSB3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> in BW25113. </h6> <br><br><br />
<br />
<p><br />
<b><u>RPU of P<sub>BAD</sub> in different cell strains</u></b><br><br />
<br />
In order to solve the discrepancy between Groningen 2011 and Cambridge 2011, we have calculated the Relative Promoter Unit of the P<sub>BAD</sub> promoter in three different cell <br />
strains across increasing arabinose concentration. The three strains that were chosen was: DH10B, BW25113, and DH5α. Groningen 2011 used cell strain DH5α to obtain the 3-D graph <br />
while Cambridge 2011 used BW27783. Unfortunately, we did not had access to the strain, so we had to use another strain, BW25113, which is commonly used by synthetic biologists. <br />
Only DH5alpha has araC in its genome. All other strains have deletion of araC (and other genes in the L-arabinose operon). <br><br><br />
</p><br />
<br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/a/ab/Pbad_RPU_3strains.png" /><br />
<h5 style="font-size: 13px">Figure 4. RPU of P<sub>BAD</sub> promoter in three different cell strains across different arabinose concentration. </h5><br />
<h6 style= "font-size: 13px"> Relative Promoter Unit of P<sub>BAD</sub> promoter was calculated in three strains: DH10B, BW25113 and DH5alpha. Gradient arabinose concentration (% w/v) from 0% to 1.0% with 0.2% increments was used to test the variation of promoter strength (RPU) in different concentration of arabinose. Each strain of cells inoculated overnight in various arabinose concentration above. The cells were diluted around 10 fold and grown until they reached mid-log phase (OD<sub>600</sub> 0.3-0.5). Cells were fixed and fluorescence was measured using flow cytometer. The graph represent triplicate mean ±SD. </h6> <br><br><br />
<br />
<p><br />
We thought that Relative Promoter Unit (RPU) defined by Endy et al. would be a better a measure of promoter strength at different arabinose concentration than simply comparing the <br />
fluorescence measurement of different strains. This is because simply measuring and comparing fluorescence as an output can also be affected by other experimental factors such as the<br />
genetic context. Because RPU is a ratio to fluorescence measurement, the effects caused by these factors can be minimized (See Methods for RPU calculation). <br><br><br />
<br />
We observed clearly a different promoter response among the three cell strains. The all-or-none response was observed for the strains, but the levels of RPU were different. <br />
For DH10B, RPU leveled off around 0.45. For BW25113, RPU leveled off around 0.3. For DH10B and BW25113 we see a very clear “all-or-none” response. The RPU reaches a plateau at <br />
0.2% of arabinose. For DH5&alpha;, it is less obvious, because the initial increase of RPU at 0.2% arabinose is around 0.1, lower than the other two strains. With the given graph, <br />
statically, we cannot say that the RPU level gradually increases as % arabinose increases. <br><br><br />
<br />
The lower RPU of DH5&alpha; was expected because DH5&alpha; has araC gene, gene for the repressor, in its genome. This could have caused the lower promoter strength of <br />
P<sub>BAD</sub> in DH5&alpha;. All in all, all three strains produced all-or-none response. <br><br><br />
<br />
For DH10B and BW25113 we see a very clear “all-or-none” response. The RPU reaches a plateau at 0.2% of arabinose. For DH5&alpha;, it is less obvious, because the initial increase <br />
of RPU at 0.2% arabinose is around 0.1, lower than the other two strains. With the given graph, statically, we cannot say that the RPU level gradually increases as % arabinose <br />
increases. All in all, all three strains produced all-or-none response. <br><br><br />
<br />
<p><b><u>P<sub>BAD</sub> Leakage</u></b><br><br />
Leakage was observed for P<sub>BAD</sub> promoter in DH10B. Although the RPU was relatively higher compared to that of other two strains, DH10B showed leakage at no arabinose <br />
induction. The RPU was around 0.16 for DH10B which is quite significant if we want to have a non-leaky system. For BW25113 and DH5&alpha; the leakages were below RPU of 0.1. <br />
The lowest leakage was observed for DH5&alpha;. The low leakage in DH5&alpha;, once again, could be explained by the additional copy of araC in the genome. The low leakage BW25113, <br />
however, is harder to explain. Nonetheless, if we want a low-leakage system that can reach relatively high RPU upon arabinose induction, out of the three strain we have used, <br />
BW25113 would be the best option. <br><br><br />
<br />
<p><b><u>3-D graphs for DH10B and DH5&alpha;</u></b><br><br />
We also tried to produce a 3-D graph. We, however, had some changes from the genetic context that Groningen 2011 used. At 3’ of the P<sub>BAD</sub> promoter, instead of using <br />
<a href="http://parts.igem.org/Part:BBa_E0840">BBa_E0840</a> (GFP generator), we used <a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> (GFP generator). We also used a <br />
low copy pSB3K3 plasmid as the backbone instead of the high copy pSB1C3. We also could not take measurements every 15 minutes interval because we had to measure the fluorescence at <br />
each time point manually. Fluorescence was instead measured every two hours. Lastly, OD<sub>600</sub> was also monitored and graphed (Figure 4. A and B) <br><br><br />
<br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/3/33/3dgraph_pbad.png" /><br />
<h5 style="font-size: 13px">Figure 5. Fluorescence and OD<sub>600</sub> measurements of DH10B and DH5&alpha; induced in different arabinose concentrations. </h5><br />
<h6 style= "font-size: 13px"> Triplicate of DH10B and DH5&alpha; samples were inoculated in deep well 96 well plate overnight in M9 minimal salt medium.<br />
Arabinose was added to match the final working concentration from 0 to 1.0 % (w/v) with 0.2% increments. Fluorescence and OD<sub>600</sub> was measured every<br />
two hours for ten hours. (A) Increase of OD<sub>600</sub> measurement for DH10B strain in different arabinose concentration. The graph represents triplicate <br />
mean ± SD (B) Increase of OD<sub>600</sub> measurement for DH5&alpha; strain in different arabinose concentration. (C) Fluorescence VS arabinose concentration<br />
VS Time 3-D graph for DH10B. Each point represent triplicate mean. (D) Fluorescence VS arabinose concentration VS Time 3-D graph for DH5&alpha;. Each point <br />
represent triplicate mean. </h6> <br><br><br />
</p><br />
<br />
<p><br />
The OD<sub>600</sub> value reflects cell concentration. OD<sub>600</sub> for both strain in different arabinose concentration increased exponentially. Growth rate for cells without <br />
arabinose induction (0%) was greatest for both DH10B and DH5&alpha;. For other concentration of arabinose induction the growth rates were similar for both of the cell strains (Figure<br />
4. A and B). The similar growth rate across the 10 hour period indicates that the cell concentration for samples in different arabinose concentration increased similarly and <br />
therefore the cell concentration at each point of measurement was similar across different arabinose concentration. We can therefore assume that differences in the cell <br />
concentrations have minimal effect on the different fluorescence levels at different arabinose concentration. <br><br><br />
<br />
Unlike what Groningen 2011 observed in their experiment, (<a href="http://parts.igem.org/Part:BBa_I0500:Experience">Experience page.</a>) we observed all-or-none response for both <br />
of the cell strains. For DH10B and DH5&alpha; the fluorescence levelled off at 0.2% arabinose concentration. In the process of subtracting autofluorescence, we got some negative <br />
corrected fluorescence. These region correspond to the blue areas of the 3-D graphs. <br />
<br />
<br />
</p><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<br />
<div class='content_1'><h3>Discussion</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><i>Groningen 2011 results may not truly represent the gradual induction of P<sub>BAD</sub> promoter </i><br><br><br />
We believe that it is actually difficult to analyze the promoter’s gradual or all-or-none response looking the 3-dimensional graph that Groningen 2011 team presented. The 3 <br />
dimensional graph has three parameters: time, various arabinose concentrations and fluorescence. The graph does not consider the OD<sub>600</sub> value which can represent the <br />
concentration of cells. If the growth rate of the cells are different in different arabinose concentration, the final concentration of cells at given point of time can vary. <br />
Groningen 2011 team did not provide with OD<sub>600</sub> versus time graphs. Therefore it is hard to tell well there was variation in the cell growth under the context of Groningen<br />
2011’s experiment. Because the fluorimetry measurements, the method that Groningen 2011 used, measures the fluorescence of the entire population of cells, the fluorescence can be <br />
affected by the concentration of cells and hence show a response that is not all-or-none. Looking at Groningen’s results, it would be more appropriate to say that the population of<br />
cells that is transformed with plasmid containing <a href= "http://parts.igem.org/Part:BBa_K607036">BBa_K607036</a>(<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 <br />
</a>-<a href="http://parts.igem.org/Part:BBa_E0840">BBa_E0840 </a>) showed gradual response to increasing arabinose concentration. <br><br><br />
<br />
<i>Different genetic context could be responsible for the different response of the P<sub>BAD</sub> promoter. </i><br><br><br />
<br />
Due to lack of manpower, unfortunately, we could not produce 3-D graphs for cells with pSB1C3 backbone as controls. Assuming that Groningen 2011 result was valid, we can speculate <br />
that difference of the P<sub>BAD</sub> promoter response could have resulted from the different backbone that we have used to characterize the promoter. In fact, Cambridge 2011, <br />
who also observed all-or-none response (<a href="http://parts.igem.org/Part:BBa_I0500:Experience">Experience page.</a>) used pSB3K3 as backbone for their constructs. Without proper <br />
controls, it is hard to make a conclusion.<br />
</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class='content_1'><h3>Methods</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<br />
<br />
<p><u><b>Construction</b></u><br><br><br />
1. Construct pSB3K3-<a href= "http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a><br><br><br />
<br />
2. Transforming pSB3K3-<a href= "http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> to DH10B, DH5&alpha;, and BW25113.<br />
<br><br><br />
<br />
3. Transforming pSB3K3-<a href= "http://parts.igem.org/Part:BBa_I20260">BBa_I20260</a> (Standard Constitutive Promoter/Reference Promoter) from the 2014 Distribution Kit to DH10B,<br />
DH5&alpha;, and BW25113.<br><br><br />
<br />
4. Transforming pSB3K3<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> (GFP generator) from the 2014 Distribution Kit to DH10B, DH5&alpha;, and BW25113.<br><br><br />
<br><br />
<br />
<p><u><b>Measurement</b></u><br><br><br />
1. Preparing supplemented M9 medium <br>(M9 Minimal salt medium protocols could be seen on the <a href= "https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/protocols">Protocols</a><br />
page, or download the <a href= "https://static.igem.org/mediawiki/2014/8/8b/M9_Minimal_medium_protocol.pdf">PDF</a> file) <br><br><br />
<br />
2. Culturing <i>E. coli</i> DH10B strain carrying the whole construct listed on the construction part. Grow cell culture overnight (Incubate 37°C and shake for 15 hours) with M9 <br />
minimal medium (we used Corning® 96 well storage system storage block, 2 mL, V-bottom, sterile to culture the cells, and Corning® microplate sealing tape white Rayon (with acrylic), sterile, suitable for cell/tissue culture applications, breathable sterile membrane.)<br><br><br />
<br />
3. Take out 20-30μl of overnight cell culture (we used Multichannel Pipetman) and mix it with M9 medium and arabinose with specific concentration (0%, 0.2%, 0.4%, 0.6%, 0.8%, 1%) <br />
in the 96 Deep Well plate. <br><br><br />
<br />
4. Incubate in 37°C and shake for 3 - 4 hours.<br><br><br />
<br />
5. Take out 200ul of cells from the 96 deep well plates, and put it on a micro test plate 96 well flat bottom. (we used Micro test plate 96 well flat bottom, made by SARSTEDT.)<br />
<br><br><br />
<br />
6. Measuring the GFP intensity and OD<sub>595</sub> values (we used <b>Envision Multilabel Reader</b>) every 30 minutes after the above mentioned <i>E. coli</i> strains are <br />
cultured to mid-log phase (OD<sub>600</sub> = 0.3 - 0.5)<br><br><br />
<br />
Filter used on Envision Multilabel Reader: <br><br />
- Absorbance :Photometric 595nm,<br><br />
- Excitation :485nm FITC,<br> <br />
- Emission :535nm FITC, <br><br />
- Mirror module : FITC (403) at bottom. <br><br><br />
<br />
- In between measurements, keep incubating the cells in 37°C while shaking. <br><br><br />
<br />
<b>OR</b><br><br><br />
<br />
- When cells were in the mid-log phase, cells were fixed and fluorescence was measured using <b>FACS</b>. <br><br><br />
<br />
7. Calculating the Relative Promoter Units (RPU) using the obtained data; <br><br><br />
</p><br />
<br />
<br />
<p><br><u><b>Data Processing for data from Envision Multilabel Reader</b></u><br><br><br />
1. After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD<sub>595</sub> were measured every 30 minutes (up to 120min); <br><br><br />
<br />
2. GFP intensity are subtracted with the background fluorescence which is the fluorescence of pSB3K3-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>. Curve reflecting <br />
GFP expression change was plotted (from 4 measurements from time=0 to time=120); OD<sub>595</sub> was converted to OD<sub>600</sub>, and average values were taken; <br><br><br />
<br />
3. GFP synthesis rate was then obtained by calculating the slope of the above mentioned curve; <br><br><br />
<br />
4. Absolute promoter activity of P<sub>BAD</sub> and <a href= "http://parts.igem.org/Part:BBa_I20260">BBa_I20260</a> were calculated by dividing the GFP synthesis rate with the <br />
average OD<sub>600</sub> value; <br><br><br />
<br />
5. Averaged absolute promoter activity was then obtained by averaging the respective 3 sets of absolute promoter activity values; <br><br><br />
<br />
<br />
6. Finally, R.P.U was calculated by dividing the averaged P<sub>BAD</sub> and absolute promoter activity over the averaged <a href= "http://parts.igem.org/Part:BBa_J23101"><br />
BBa_J23101</a> absolute promoter activity. R.P.U value of P<sub>BAD</sub> in different concentration of arabinose is shown. Leakage could be analyzed according to the R.P.U value <br />
that shows the GFP expression of P<sub>BAD</sub> promoter in the absence of arabinose (0%).<br><br><br />
Equation of the RPU calculation is shown below: <br><br />
<br />
<img style= "width:50%" src= "https://static.igem.org/mediawiki/2014/e/e0/RPUequation_ust2014.png"/><br />
<br><br />
<br />
Based on this equation, the GFP synthesis rate (dF/dt) for the experiment (<a href= "http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) divided by the ABS (which means the absorbance or OD<sub>600</sub>) of the cells containing the experiment construct. GFP synthesis rate (dF/dt) for the reference promoter (<a href= "http://parts.igem.org/Part:BBa_J23101">BBa_J23101</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) divided by the ABS (which means the absorbance or OD<sub>600</sub>) of the cells containing the reference promoter construct.<br><br><br />
<br />
Then, RPU is obtained by dividing the GFP synthesis rate/ABS of experiment with the GFP synthesis rate/ABS of the reference promoter.<br />
<br />
<br />
<br><br />
</p><br />
<br />
<p><br><u><b>Data Processing for data from FACS</b></u><br><br><br />
1. RPU was calculated by first subtracting the autofluorescence (fluorescence of cells with pSB3K3-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240 </a>)<br><br><br />
2. Dividing the fluorescence of cells containing pSB3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240 </a> <br />
with cells containing pSB3K3-<a href="http://parts.igem.org/Part:BBa_I20260">BBa_I20260 </a>.<br><br><br />
Equation is shown below:<br />
<img style= "width:50%" src= "https://static.igem.org/mediawiki/2014/6/60/Riboregulator_ust_Equation.png"/> <br><br><br />
<br />
Based on this equation, the amount of fluorescence [F] for the experiment (<a href= "http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) multiplied by the growth rate (μ) of the cells containing the experiment construct. Amount of fluorescence [F] for the reference promoter (<a href= "http://parts.igem.org/Part:BBa_J23101">BBa_J23101</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) multiplied by the growth rate (μ) of the cells containing the reference promoter construct.<br><br><br />
<br />
Then, RPU is obtained by dividing the fluorescence*growth rate of experiment with the fluorescence*growth rate of the reference promoter.<br><br><br />
<br />
3. For simplicity, we assumed the growth rate of the cells transformed with pSB3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240 </a> and cells transformed with pSB3K3-<a href="http://parts.igem.org/Part:BBa_I20260">BBa_I20260 </a> had same similar growth rate. <br />
<br />
<br />
<br />
</div><br />
</td></tr></table></div><br />
<br><br><br />
<br />
</p><br />
<br><br />
<br />
<br />
<br />
<br />
<!-- end of one row of content , two column one picture left--><br />
<br />
<div class='content_1'><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" ><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_two_row"><br />
<p><br />
<br><br />
<u><b>References</b></u><br><br></p><br />
<p><br />
<br />
Schleif R. <i>AraC protein, regulation of the L-arabinose operon in Escherichia coli, and the light switch mechanism of AraC action.</i> FEMS Microbiol Rev (2010) 1–18.<br><br><br />
<br />
Khelbnikov, A., Datsenko, K., Skaug, T., Wanner, B., & Keasling, J. (2001).<i> Homogeneous expression of the P(BAD) promoter in Escherichia coli by constitutive expression of the low-affinity high-capacity AraE transporter. </i> Microbiology, 147(12), 3241-3247.<br><br><br />
<br />
J. R. Kelly, A. J. Rubin, J. H. Davis, J. Cumbers, M. J. Czar, ..., D. Endy. (2009). Measuring the activity of BioBrick promoters using an in vivo reference standard. <i>Journal of Biological Engineering</i>, 3, 4. doi: 10.1186/1754-1611-3-4<br />
<br />
Isaacs, F., Dwyer, D., Ding, C., Pervouchine, D., Cantor, C., & Collins, J. (2004).<i> Engineered riboregulators enable post-transcriptional control of gene expression. </i> Nature Biotechnology, 841-847.<br />
</p> <br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
<br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body></html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization
Team:Hong Kong HKUST/riboregulator/characterization
2015-01-23T03:37:47Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
</head></html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<br />
<div id="description_area"><br />
<br><h2>Riboregulator Characterization</h2><br><br />
</div><br />
<br />
<br />
<!-- one row of content , two column--><br />
<div class='content_1'><h3>Introduction</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<div class="ienlarger"><br />
<a href="#nogo"><br />
<br />
<br />
</a></div><br />
<br />
<p>Riboregulator is a type regulatory RNA that can regulate translation. One component of the riboregulator system, <br />
cis-repressing RNA, crRNA, contains a cis-repressing sequence which is located at the 5’ of the RBS and the gene of interest.<br />
When the transcript is formed, the cis-repressing sequence can form a loop to form complementary base pairs with the RBS and blocking the ribosome's entry <br />
to RBS. crRNA is commonly called “lock” because it “locks” the translation of proteins. When there is a lock, we need a “key”. The taRNA is the component of the <br />
system that<br />
act as a key. It can interact (in trans) with the cis-repressing sequence to unlock the RBS and therefore activate translation. The HKUST iGEM 2014 <br />
team characterized 4 riboregulator already available in the Part Registry and 1 riboregulator introduced by our team. <br />
<br />
<br><br><b>Table 1 List of riboregulator pairs characterized by HKUST iGEM 2014 team:</b><br><br />
<br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Name and registry code</th><br />
<th scope="col">Group</th><br />
<th scope="col">Cognate pair</th><br />
<br />
</tr><br />
</thead><br />
<tbody><br />
<br />
<tr><br />
<td scope="row">Lock 1 <a href="http://parts.igem.org/Part:BBa_J01010">BBa_J01010 </a> Key 1<a href="http://parts.igem.org/Part:BBa_J01008">BBa_J01008 </a></td> <br />
<td>iGEM 2005_Berkeley (Golden Bear)</td> <br />
<td>Yes</td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">Lock 3 <a href="http://parts.igem.org/Part:BBa_J01080">BBa_J01080 </a> Key3 <a href="http://parts.igem.org/Part:BBa_J01086">BBa_J01086 </a></td> <br />
<td>iGEM 2005_Berkeley (Golden Bear)</td> <br />
<td>Yes</td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">Medium lock <a href="http://parts.igem.org/Part:BBa_K175031">BBa_K175031</a> Key for medium lock <a href="http://parts.igem.org/Part:BBa_K175032">BBa_K175032 </a> </td> <br />
<td>iGEM09_TUDelft</td> <br />
<td>Yes</td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">Lock 3c <a href="http://parts.igem.org/Part:BBa_J23031">BBa_J23031 </a> Key 3c<a href="http://parts.igem.org/Part:BBa_J23008">BBa_J23008 </a></td> <br />
<td>iGEM 2006_Berkeley</td> <br />
<td>No</td> <br />
</tr><br />
<br />
</table><br />
<p>Riboregulators have cognate pairs. For certain crRNA, there is a corresponding taRNA that can activate and “unlock” the repression by crRNA. We originally thought that <br />
Lock 3c and Key 3c (Table 1.) were cognate pairs, but they turned out to be that the iGEM 2006_Berkeley simply made variants of Lock 3 and Key 3. They put an <br />
alphabet at the end of the name every time they produced different variants of lock 3 and key 3. The lock 3 and key 3 variants were created independently from each other so <br />
the letters at the end of name does not mean correspondence. Other teams should take note of this when they consider using riboregulator variants from iGEM 2006_Berkeley.</p><br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class='content_1'><h3>Riboregulator Results</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<a href="#nogo"></a><img src="https://static.igem.org/mediawiki/2014/f/fe/HKUST_ribo_characterizationA.png" /><br><img style="width:90%;" src="https://static.igem.org/mediawiki/2014/c/cc/HKUST_ribo_characterizationB.png"/><br />
<br />
<h5 style="font-size: 13px">Figure 1. Fluorescence (F)/OD600 measurements of riboregulator pairs after arabinose induction and their corresponding controls. </h5><br />
<h6 style= "font-size: 13px"> All samples were inoculated in M9 minimal salt medium overnight in no or various arabinose concentrations (%w/v). The samples were diluted around 10 fold the next day. Measurements were made when the samples reached around the mid-log phase (OD600 = 0.3 to 0.5). <br />
Graphs depict the triplicate mean + standard deviation. (A) Schematic diagram of the genetic context of the experiment. Note that the diagram generalized the CR and TA sequences. (B) Measurement for Lock 1 (<a href="http://parts.igem.org/Part:BBa_J01010">BBa_J01010</a>) and Key 1 (<a href="http://parts.igem.org/Part:BBa_J01008">BBa_J01008</a>) cognate pair. (C) Measurement for Lock 3(<a href="http://parts.igem.org/Part:BBa_J01080">BBa_J01080</a>) and Key 3 (<a href="http://parts.igem.org/Part:BBa_J01086">BBa_J01086</a>) cognate pair. (D) Measurement for Medium lock (<a href="http://parts.igem.org/Part:BBa_K175031">BBa_K175031</a>) and Key for medium lock (<a href="http://parts.igem.org/Part:BBa_K175032">BBa_K175032</a>) cognate pair. (E) Measurement for Lock 3c (<a href="http://parts.igem.org/Part:BBa_J23031">BBa_J23031</a>) and Key 3c (<a href="http://parts.igem.org/Part:BBa_J23008">BBa_J23008</a>). </h6><br />
<br><br><br />
<p><br />
To characterize the different riboregulator pairs, we kept the genetic context identical except for the various cr-repressing sequences, trans-activating sequences and the RBS. The <br />
RBS sequence also had to be different for some of the riboregulator systems because the cr-repressing sequence depends on the RBS sequence. In order to repress translation, the <br />
cis-repressing sequence need to interact with the RBS, and so the interaction depends on the sequences. Since different teams used different RBS to design their cis-repressing <br />
sequences, we also had to use corresponding RBS for characterization. We had a constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23102">BBa_J23102 </a>) to drive the <br />
expression of the cis-repressed GFP translation unit. For the expression taRNA, we wanted to control the expression and therefore we decided to use the arabinose inducible <br />
P<sub>BAD</sub> promoter (<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a>). The promoter was chosen because the 3’ end after the transcription start site of the <br />
promoter is short. Longer 3’ end can affect the function of the taRNA (Isaacs et al., 2004) (Figure 1. A). <br />
<br />
</p><br />
<br><br><br />
<br />
<br />
<br />
<p>For the riboregulator system to work, the repression of GFP synthesis needs to be first observed when the cis-repressing sequence is added 5’ of the RBS of the system. <br />
Significant repression can be seen in Lock 1-Key1, Lock 3-Key 3, and Medium lock (Lock m)-Key for medium lock (Key m) cognate pairs (Figure 1. B, C, D respectively). Almost <br />
full repression was observed for the three cognate pairs. For Lock 3c-Key 3c pair, we do not see repression when cis-repressing sequence is introduced to the system. Instead,<br />
converse can be observed. When we don’t have cis-repressing sequence, we see significant drop in the fluorescence (Figure 1.E). One possible reason could be that the RBS <br />
sequence that we used for the controls of Lock 3c Key 3c was incorrect. For Lock3c the target RBS sequence was not mentioned. It seemed like a variation of <br />
<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034 </a> with shorter 3’ end. In order to build the construct type 2 and 3 (Figure 1. A), the RBS sequence had to be <br />
deduced from the Lock 3c sequence. From the Lock 3c sequence, we have used a part of sequence that resembled the RBS (<a href="http://parts.igem.org/Part:BBa_B0034">BBa_B0034<br />
</a>). The RBS sequence used may have been too short to be functional. Therefore, no fluorescence is observed when cis-repressing sequence is not present. On the other hand, <br />
fluorescence can be observed when cis-repressing sequence is present because firstly, the RBS is sequence is correct, and secondly because the cis-repressing sequence failed <br />
to repress the translation. <br><br> </p><br />
<br />
<p><br />
After repression, the system needs to be activated when taRNA is expressed. After the addition of arabinose, taRNA is expressed. Out of the three cognate riboregulator pairs that <br />
were repressed, only two showed significant increase after arabinose induction. Lock 1- Key 1 cognate pair showed around 13-fold increase for both 1% and 2.5% (%w/v) arabinose <br />
induction. Lock 3- Key 3 cognate pair showed around 1.5 and 3 fold increase for 1% and 2.5% of arabinose induction respectively. Lock 1-Key 1 and Lock 3- Key 3 behaved differently <br />
for different concentrations of arabinose induction. Full induction was observed at 1% arabinose for Lock 1- Key 1 cognate pairs while full induction for Lock 3- Key 3 was observed at<br />
2.5% arabinose. Statistically, no significant fold increase could be observed for Lock m- Key m cognate pair. </p><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class='content_1'><h3>Discussion</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><i>The fold increase for Lock 1- Key 1 is lower than that of riboregulator pair mentioned in the Isaacs et al.’s paper. </i><br><br><br />
<br />
iGEM 2005_Berkely, when they first introduced the riboregulator system to the iGEM community, they mentioned in the Part Registry page that Lock 1 and Key 1 are “Biobricked <br />
version of Isaacs’ riboregulator” crR12 and taR12 respectively. We can therefore expect the Lock 1 and Key 1 fold increase after induction to be similar to what Isaacs et al. have <br />
observed and mentioned in the paper. Isaacs et al. mention that for crR12 and taR12 cognate pair, they have observed 19-fold increase (Isaacs et al., 2004), our results showed only <br />
showed around 13 fold increase. One possibility for the deviation could be because the Lock 1 and Key 1 sequences are not 100% match with crR12 and taR12. Because scars are <br />
introduced in 5’ and 3’ end of a Biobricked parts, iGEM 2005_Berekeley had to shorten the original 5’ and 3’ end of the crR12 and taR12. This change actually changes the crRNA and <br />
taRNA sequence and therefore could result to the deviated results. Another possibility is simply because the genetic context that we did our characterization was different from what <br />
Isaac et al. used to characterize their riboregulator system. If this is the case, we can at least see that the system is not very modular: changing the genetic context can change <br />
the fold increase. <br><br><br />
<br />
<i>The fluorescence after induction is still low compared to that of unrepressed controls. </i><br><br><br />
<br />
Although we saw significant fold increase for two riboregulator systems that we have characterize, compared to the fluorescence of unrepressed controls, the fluorescence is very low.<br />
For Lock 1-Key 1 riboeregulator system, the fluorescence after induction only correspond to around 0.4% of the that of the unrepressed control. For the Lock 3-Key3 system, <br />
the value was around 0.3%. The lower expression partly is because of the lower mRNA levels. After the introduction of the cis-repressing sequence the mRNA level was 40% of <br />
that of the controls (Isaacs et al., 2004). Another reason for low fluorescence after induction could have resulted because of our genetic context. We have used a relatively <br />
strong constitutive promoter (<a href="http://parts.igem.org/Part:BBa_J23102">BBa_J23102</a>) to express the crRNA and a relatively weak arabinose inducible promoter <br />
(<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a>). This could have caused imbalance of crRNA and taRNA levels. We could have had lower taRNA level and therefore failed<br />
to fully activate the riboregulator system. Further investigation is required. Simply changing the arabinose inducible promoter to a strong promoter can tell us whether this is the <br />
case. <br><br><br />
<br />
<i>Different Lock-Key cognate pairs behaved differently to different arabinose concentration.</i><br><br><br />
<br />
Lock 1- Key 1 riboregulator cognate pair was fully induced and leveled off at 1% arabinose concentration. For Lock 3- Key 3 pair, the full induction was observed at 2.5% arabinose<br />
concentration. We did not conduct further investigation to understand the difference in the response. Further investigation on how changing the riboregulator sequence can change<br />
the sensitivity of the system could be an interesting study.<br />
</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class='content_1'><h3>Methods</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><i>Fluorometry </i><br><br><br />
<br />
Triplicate of each sample were inoculated overnight in a deep-well 96 well plate. M9 minimal salt solution was used for the inoculation because it gives low background fluorescence.<br />
1% and 2.5% (w/v) arabinose concentration was used for overnight induction. Samples were diluted around 10-fold the next day and regrown to mid-log phase (OD600=0.3 ~ 0.6). 200µl <br />
of sample were drawn out from the deep-well plate and plated on a clear round bottom plate for measurement. For each sample, OD<sub>595</sub> and Fluorescence was measured using <br />
EnVision Multilabel Reader. The excitation wavelength was 485/14nm and the emission wavelength was 535/25nm. Conversion factor for OD<sub>595</sub> to OD<sub>600</sub> was obtained<br />
by calculating the slope of the OD<sub>600</sub> v.s. OD<sub>595</sub> graph. The conversion factor, 1.24 was multiplied to OD<sub>595</sub> reading to covert the measurements to<br />
OD<sub>600</sub>. Background fluorescence was subtracted for each fluorescence measurement by making another standard Fluorescence v.s. OD<sub>600</sub> graph. DH10B with <br />
pSB3K3-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> was used to produce the standard curve. The corrected fluorescence was then divided by the corresponding <br />
OD<sub>600</sub>. Finally the average and standard deviation were calculated. <br />
<br />
</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<!-- end of one row of content , two column--><br />
</div><br />
<br><br><br />
<br />
<br />
<div id="content_container"><br />
<!-- one row of content , two column one picture right--><br />
<div id="description_area"><br />
<br><h2>P<sub>BAD</sub> Characterization<br><br />
<b>(Please note that the following data has been shown to be problematic because our new data do not match our old data. We will update the following information as soon as possible)</b></h2><br><br />
</div><br />
<br />
<div class='content_1'><h3>Introduction</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>P<sub>BAD</sub> promoter is an arabinose inducible promoter. In nature, the promoter exist in the arabinose operon to regulate the transcription of araB, araA, and araD. <br />
The arabinose operon or the ara operon encodes enzymes needed or the catabolism of arabinose to xylulose 5- phosphate which is an intermediate of the pentose phosphate pathway<br />
. The Pc promoter which is adjacent to the P<sub>BAD</sub> promoter transcribes the araC gene in the opposite direction. AraC protein is responsible to repress the activity of<br />
the P<sub>BAD</sub> promoter when arabinose is absent. Once arabinose is present,the AraC protein binds to the arabinose and dimerize. The dimerize form of AraC-arabinose can<br />
activate the P<sub>BAD</sub> promoter (Schleif, 2010).</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<div class='content_1'><h3>P<sub>BAD</sub> promoter <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a> in Part Registry</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p> <br />
<br />
There are several P<sub>BAD</sub> promoters in the Part Registry. The promoter that we were interested in was <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a> because of <br />
two reasons. First, <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>, along with P<sub>BAD</sub>, has araC gene is regulated by the Pc promoter. Without the AraC, the <br />
repression and induction of P<sub>BAD</sub> can only work on strains that are AraC+. By coupling the araC gene with the P<sub>BAD</sub> promoter, we can be free from such restraints.<br />
Second, <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a> needed debugging. <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>, although it is useful, it is not<br />
requestable because of inconsistency in sequencing. Also, in the experience page, two teams, Groningen 2011 and Cambridge 2011 had some discrepancy on how the promoter responded<br />
to the arabinose induction. In brief, Groningen results show that the induction of the promoter by arabinose was gradual while Cambridge results show that it was an “on-or-off” <br />
response. We wanted to analyze these problems so that the part could be more reliable for other users. Cambridge cited a paper that mentioned that variation in response could have <br />
resulted from cell strain variation. (Khelbnikov, 2001)</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<br />
<div class='content_1'><h3>Results</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><u>All-or-none response was observed for individual cells</u>.<br>Flow cytometry can measure the fluorescence of individual cells. The individual measurement of cell <br />
fluorescence can be plotted in a forward scatter (FSC) intensity value versus fluorescence graph. An arbitrary vertical line divided the region of the graph with low <br />
fluorescence (Q3) and high fluorescence (Q4). <br><br><br />
<br />
For the negative control, DH10B transformed with pSB3K3-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>, we see cells distributed in Q3 while absent in Q4. <br />
The reverse was true for the positive control, DH10B transformed with pSB3K3-<a href="http://parts.igem.org/Part:BBa_I20260">BBa_I20260</a> (GFP generator regulated by <br />
<a href="http://parts.igem.org/Part:BBa_J23101">BBa_J23101</a>). We see most cells distributed in Q4. For our experimental sample, <br />
(pSB3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) similar trend could observed for three strains. <br />
At no arabinose induction, we see most of the cells in Q3. The distribution of cells shifted to Q4 when arabinose was added to the medium. We also see that the cells remained in Q3 <br />
even after arabinose induction. The bimodal distribution indicate that some cells got induced while other cells were in repressed state. <br />
</p><br />
<br><br />
<br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/0/02/FACS_hkust.png" /><br />
<h5 style="font-size: 13px">Figure 2. Forward scatter intensity (FSC) versus GFP graphs for samples with P<sub>BAD</sub> promoter regulating GFP generator. </h5><br />
<h6 style= "font-size: 13px"> All samples were inoculated in M9 minimal salt medium overnight in various arabinose concentrations (%w/v). The samples were <br />
diluted around 10 fold the next day. Sample were fixed and the fluorescence was measured using flow cytometer. The graphs were plotted for the control <br />
constructs, pSB3K3-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> (-) and pSB3K3-<a href="http://parts.igem.org/Part:BBa_I20260">BBa_I20260</a> <br />
(<a href="http://parts.igem.org/Part:BBa_J23101">BBa_J23101</a>) in the absence of arabinose. FSC versus GFP graphs for pSB3K3-<br />
<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a><br />
(<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>) in 0, 0.2 and 1.0% arabinose concentration were plotted. <br />
Each set of graphs were obtained for three different cell strains, DH10B, DH5α and BW25113. </h6> <br><br><br />
<br />
<br />
<p>The distribution can also give us some idea of P<sub>BAD</sub> promoter leakage in different cells strain. If the data points are on or near the boundary between Q3 and Q4, <br />
we know that the promoter is leaky. The results indicate that the promoter is relatively more leaky in DH10B compared to other cell strains. <br><br><br />
<br />
The percentages of cells in each Q3 and Q4 are highlighted in Figure 2. After addition of arabinose, we clearly see more percentage in Q4. Around 80% of the cells for DH10B <br />
and BW25113 are in Q4. Relatively lower percentage of cells in Q4 is observed for DH5α. Only around 60 to 70% of cells were in Q4 after arabinose induction. The shift in the <br />
distribution from Q3 to Q4 also corresponded to the increase of RPU across different arabinose concentration. At 0% arabinose concentration, for all three strain, higher percentage <br />
of cells are in Q3 and therefore the RPU is low. After arabinose induction, more cells are in Q4 and RPU is high. The percentage of cells in Q4 levels off for arabinose concentration<br />
that we have tested. The trend was observed for RPU measurement. <br><br><br />
<br />
We can also conclude that even after maximum period of induction (overnight induction) of arabinose, we still see some cells uninduced (in Q3). <br><br><br />
<br />
</p><br />
<img style="width:50%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/8/88/Percentageofcells_pbad_HKUST.png" /><br />
<h5 style="font-size: 13px">Figure 3. The percentage of cells in induced and uninduced state, and RPU across different arabinose concentration. </h5><br />
<h6 style= "font-size: 13px"> Q3 and Q4 represent the 3<sup>rd</sup> and 4<sup>th</sup> quadrants of the forward scatter versus GFP curve mentioned in <br />
Figure 2. The experimental condition was the same as the procedure mentioned in the caption of the Figure 1. The left y-axis is for the percent of cells in<br />
Q3 and Q4 while the right y-axis is for RPU. Graphs depict the triplicate mean ± standard deviation. (A) Graph for pSB3K3-<br />
<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> in DH10B. (B) Graph for <br />
pSBK3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> in DH5α. (C) Graph for <br />
pSB3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> in BW25113. </h6> <br><br><br />
<br />
<p><br />
<b><u>RPU of P<sub>BAD</sub> in different cell strains</u></b><br><br />
<br />
In order to solve the discrepancy between Groningen 2011 and Cambridge 2011, we have calculated the Relative Promoter Unit of the P<sub>BAD</sub> promoter in three different cell <br />
strains across increasing arabinose concentration. The three strains that were chosen was: DH10B, BW25113, and DH5α. Groningen 2011 used cell strain DH5α to obtain the 3-D graph <br />
while Cambridge 2011 used BW27783. Unfortunately, we did not had access to the strain, so we had to use another strain, BW25113, which is commonly used by synthetic biologists. <br />
Only DH5alpha has araC in its genome. All other strains have deletion of araC (and other genes in the L-arabinose operon). <br><br><br />
</p><br />
<br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/a/ab/Pbad_RPU_3strains.png" /><br />
<h5 style="font-size: 13px">Figure 4. RPU of P<sub>BAD</sub> promoter in three different cell strains across different arabinose concentration. </h5><br />
<h6 style= "font-size: 13px"> Relative Promoter Unit of P<sub>BAD</sub> promoter was calculated in three strains: DH10B, BW25113 and DH5alpha. Gradient arabinose concentration (% w/v) from 0% to 1.0% with 0.2% increments was used to test the variation of promoter strength (RPU) in different concentration of arabinose. Each strain of cells inoculated overnight in various arabinose concentration above. The cells were diluted around 10 fold and grown until they reached mid-log phase (OD<sub>600</sub> 0.3-0.5). Cells were fixed and fluorescence was measured using flow cytometer. The graph represent triplicate mean ±SD. </h6> <br><br><br />
<br />
<p><br />
We thought that Relative Promoter Unit (RPU) defined by Endy et al. would be a better a measure of promoter strength at different arabinose concentration than simply comparing the <br />
fluorescence measurement of different strains. This is because simply measuring and comparing fluorescence as an output can also be affected by other experimental factors such as the<br />
genetic context. Because RPU is a ratio to fluorescence measurement, the effects caused by these factors can be minimized (See Methods for RPU calculation). <br><br><br />
<br />
We observed clearly a different promoter response among the three cell strains. The all-or-none response was observed for the strains, but the levels of RPU were different. <br />
For DH10B, RPU leveled off around 0.45. For BW25113, RPU leveled off around 0.3. For DH10B and BW25113 we see a very clear “all-or-none” response. The RPU reaches a plateau at <br />
0.2% of arabinose. For DH5&alpha;, it is less obvious, because the initial increase of RPU at 0.2% arabinose is around 0.1, lower than the other two strains. With the given graph, <br />
statically, we cannot say that the RPU level gradually increases as % arabinose increases. <br><br><br />
<br />
The lower RPU of DH5&alpha; was expected because DH5&alpha; has araC gene, gene for the repressor, in its genome. This could have caused the lower promoter strength of <br />
P<sub>BAD</sub> in DH5&alpha;. All in all, all three strains produced all-or-none response. <br><br><br />
<br />
For DH10B and BW25113 we see a very clear “all-or-none” response. The RPU reaches a plateau at 0.2% of arabinose. For DH5&alpha;, it is less obvious, because the initial increase <br />
of RPU at 0.2% arabinose is around 0.1, lower than the other two strains. With the given graph, statically, we cannot say that the RPU level gradually increases as % arabinose <br />
increases. All in all, all three strains produced all-or-none response. <br><br><br />
<br />
<p><b><u>P<sub>BAD</sub> Leakage</u></b><br><br />
Leakage was observed for P<sub>BAD</sub> promoter in DH10B. Although the RPU was relatively higher compared to that of other two strains, DH10B showed leakage at no arabinose <br />
induction. The RPU was around 0.16 for DH10B which is quite significant if we want to have a non-leaky system. For BW25113 and DH5&alpha; the leakages were below RPU of 0.1. <br />
The lowest leakage was observed for DH5&alpha;. The low leakage in DH5&alpha;, once again, could be explained by the additional copy of araC in the genome. The low leakage BW25113, <br />
however, is harder to explain. Nonetheless, if we want a low-leakage system that can reach relatively high RPU upon arabinose induction, out of the three strain we have used, <br />
BW25113 would be the best option. <br><br><br />
<br />
<p><b><u>3-D graphs for DH10B and DH5&alpha;</u></b><br><br />
We also tried to produce a 3-D graph. We, however, had some changes from the genetic context that Groningen 2011 used. At 3’ of the P<sub>BAD</sub> promoter, instead of using <br />
<a href="http://parts.igem.org/Part:BBa_E0840">BBa_E0840</a> (GFP generator), we used <a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> (GFP generator). We also used a <br />
low copy pSB3K3 plasmid as the backbone instead of the high copy pSB1C3. We also could not take measurements every 15 minutes interval because we had to measure the fluorescence at <br />
each time point manually. Fluorescence was instead measured every two hours. Lastly, OD<sub>600</sub> was also monitored and graphed (Figure 4. A and B) <br><br><br />
<br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/3/33/3dgraph_pbad.png" /><br />
<h5 style="font-size: 13px">Figure 5. Fluorescence and OD<sub>600</sub> measurements of DH10B and DH5&alpha; induced in different arabinose concentrations. </h5><br />
<h6 style= "font-size: 13px"> Triplicate of DH10B and DH5&alpha; samples were inoculated in deep well 96 well plate overnight in M9 minimal salt medium.<br />
Arabinose was added to match the final working concentration from 0 to 1.0 % (w/v) with 0.2% increments. Fluorescence and OD<sub>600</sub> was measured every<br />
two hours for ten hours. (A) Increase of OD<sub>600</sub> measurement for DH10B strain in different arabinose concentration. The graph represents triplicate <br />
mean ± SD (B) Increase of OD<sub>600</sub> measurement for DH5&alpha; strain in different arabinose concentration. (C) Fluorescence VS arabinose concentration<br />
VS Time 3-D graph for DH10B. Each point represent triplicate mean. (D) Fluorescence VS arabinose concentration VS Time 3-D graph for DH5&alpha;. Each point <br />
represent triplicate mean. </h6> <br><br><br />
</p><br />
<br />
<p><br />
The OD<sub>600</sub> value reflects cell concentration. OD<sub>600</sub> for both strain in different arabinose concentration increased exponentially. Growth rate for cells without <br />
arabinose induction (0%) was greatest for both DH10B and DH5&alpha;. For other concentration of arabinose induction the growth rates were similar for both of the cell strains (Figure<br />
4. A and B). The similar growth rate across the 10 hour period indicates that the cell concentration for samples in different arabinose concentration increased similarly and <br />
therefore the cell concentration at each point of measurement was similar across different arabinose concentration. We can therefore assume that differences in the cell <br />
concentrations have minimal effect on the different fluorescence levels at different arabinose concentration. <br><br><br />
<br />
Unlike what Groningen 2011 observed in their experiment, (<a href="http://parts.igem.org/Part:BBa_I0500:Experience">Experience page.</a>) we observed all-or-none response for both <br />
of the cell strains. For DH10B and DH5&alpha; the fluorescence levelled off at 0.2% arabinose concentration. In the process of subtracting autofluorescence, we got some negative <br />
corrected fluorescence. These region correspond to the blue areas of the 3-D graphs. <br />
<br />
<br />
</p><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<br />
<div class='content_1'><h3>Discussion</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><i>Groningen 2011 results may not truly represent the gradual induction of P<sub>BAD</sub> promoter </i><br><br><br />
We believe that it is actually difficult to analyze the promoter’s gradual or all-or-none response looking the 3-dimensional graph that Groningen 2011 team presented. The 3 <br />
dimensional graph has three parameters: time, various arabinose concentrations and fluorescence. The graph does not consider the OD<sub>600</sub> value which can represent the <br />
concentration of cells. If the growth rate of the cells are different in different arabinose concentration, the final concentration of cells at given point of time can vary. <br />
Groningen 2011 team did not provide with OD<sub>600</sub> versus time graphs. Therefore it is hard to tell well there was variation in the cell growth under the context of Groningen<br />
2011’s experiment. Because the fluorimetry measurements, the method that Groningen 2011 used, measures the fluorescence of the entire population of cells, the fluorescence can be <br />
affected by the concentration of cells and hence show a response that is not all-or-none. Looking at Groningen’s results, it would be more appropriate to say that the population of<br />
cells that is transformed with plasmid containing <a href= "http://parts.igem.org/Part:BBa_K607036">BBa_K607036</a>(<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 <br />
</a>-<a href="http://parts.igem.org/Part:BBa_E0840">BBa_E0840 </a>) showed gradual response to increasing arabinose concentration. <br><br><br />
<br />
<i>Different genetic context could be responsible for the different response of the P<sub>BAD</sub> promoter. </i><br><br><br />
<br />
Due to lack of manpower, unfortunately, we could not produce 3-D graphs for cells with pSB1C3 backbone as controls. Assuming that Groningen 2011 result was valid, we can speculate <br />
that difference of the P<sub>BAD</sub> promoter response could have resulted from the different backbone that we have used to characterize the promoter. In fact, Cambridge 2011, <br />
who also observed all-or-none response (<a href="http://parts.igem.org/Part:BBa_I0500:Experience">Experience page.</a>) used pSB3K3 as backbone for their constructs. Without proper <br />
controls, it is hard to make a conclusion.<br />
</p><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class='content_1'><h3>Methods</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<br />
<br />
<p><u><b>Construction</b></u><br><br><br />
1. Construct pSB3K3-<a href= "http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a><br><br><br />
<br />
2. Transforming pSB3K3-<a href= "http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> to DH10B, DH5&alpha;, and BW25113.<br />
<br><br><br />
<br />
3. Transforming pSB3K3-<a href= "http://parts.igem.org/Part:BBa_I20260">BBa_I20260</a> (Standard Constitutive Promoter/Reference Promoter) from the 2014 Distribution Kit to DH10B,<br />
DH5&alpha;, and BW25113.<br><br><br />
<br />
4. Transforming pSB3K3<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> (GFP generator) from the 2014 Distribution Kit to DH10B, DH5&alpha;, and BW25113.<br><br><br />
<br><br />
<br />
<p><u><b>Measurement</b></u><br><br><br />
1. Preparing supplemented M9 medium <br>(M9 Minimal salt medium protocols could be seen on the <a href= "https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/protocols">Protocols</a><br />
page, or download the <a href= "https://static.igem.org/mediawiki/2014/8/8b/M9_Minimal_medium_protocol.pdf">PDF</a> file) <br><br><br />
<br />
2. Culturing <i>E. coli</i> DH10B strain carrying the whole construct listed on the construction part. Grow cell culture overnight (Incubate 37°C and shake for 15 hours) with M9 <br />
minimal medium (we used Corning® 96 well storage system storage block, 2 mL, V-bottom, sterile to culture the cells, and Corning® microplate sealing tape white Rayon (with acrylic), sterile, suitable for cell/tissue culture applications, breathable sterile membrane.)<br><br><br />
<br />
3. Take out 20-30μl of overnight cell culture (we used Multichannel Pipetman) and mix it with M9 medium and arabinose with specific concentration (0%, 0.2%, 0.4%, 0.6%, 0.8%, 1%) <br />
in the 96 Deep Well plate. <br><br><br />
<br />
4. Incubate in 37°C and shake for 3 - 4 hours.<br><br><br />
<br />
5. Take out 200ul of cells from the 96 deep well plates, and put it on a micro test plate 96 well flat bottom. (we used Micro test plate 96 well flat bottom, made by SARSTEDT.)<br />
<br><br><br />
<br />
6. Measuring the GFP intensity and OD<sub>595</sub> values (we used <b>Envision Multilabel Reader</b>) every 30 minutes after the above mentioned <i>E. coli</i> strains are <br />
cultured to mid-log phase (OD<sub>600</sub> = 0.3 - 0.5)<br><br><br />
<br />
Filter used on Envision Multilabel Reader: <br><br />
- Absorbance :Photometric 595nm,<br><br />
- Excitation :485nm FITC,<br> <br />
- Emission :535nm FITC, <br><br />
- Mirror module : FITC (403) at bottom. <br><br><br />
<br />
- In between measurements, keep incubating the cells in 37°C while shaking. <br><br><br />
<br />
<b>OR</b><br><br><br />
<br />
- When cells were in the mid-log phase, cells were fixed and fluorescence was measured using <b>FACS</b>. <br><br><br />
<br />
7. Calculating the Relative Promoter Units (RPU) using the obtained data; <br><br><br />
</p><br />
<br />
<br />
<p><br><u><b>Data Processing for data from Envision Multilabel Reader</b></u><br><br><br />
1. After <i>E. coli</i> carrying the right construct was grown to mid-log phase, GFP intensity and OD<sub>595</sub> were measured every 30 minutes (up to 120min); <br><br><br />
<br />
2. GFP intensity are subtracted with the background fluorescence which is the fluorescence of pSB3K3-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>. Curve reflecting <br />
GFP expression change was plotted (from 4 measurements from time=0 to time=120); OD<sub>595</sub> was converted to OD<sub>600</sub>, and average values were taken; <br><br><br />
<br />
3. GFP synthesis rate was then obtained by calculating the slope of the above mentioned curve; <br><br><br />
<br />
4. Absolute promoter activity of P<sub>BAD</sub> and <a href= "http://parts.igem.org/Part:BBa_I20260">BBa_I20260</a> were calculated by dividing the GFP synthesis rate with the <br />
average OD<sub>600</sub> value; <br><br><br />
<br />
5. Averaged absolute promoter activity was then obtained by averaging the respective 3 sets of absolute promoter activity values; <br><br><br />
<br />
<br />
6. Finally, R.P.U was calculated by dividing the averaged P<sub>BAD</sub> and absolute promoter activity over the averaged <a href= "http://parts.igem.org/Part:BBa_J23101"><br />
BBa_J23101</a> absolute promoter activity. R.P.U value of P<sub>BAD</sub> in different concentration of arabinose is shown. Leakage could be analyzed according to the R.P.U value <br />
that shows the GFP expression of P<sub>BAD</sub> promoter in the absence of arabinose (0%).<br><br><br />
Equation of the RPU calculation is shown below: <br><br />
<br />
<img style= "width:50%" src= "https://static.igem.org/mediawiki/2014/e/e0/RPUequation_ust2014.png"/><br />
<br><br />
<br />
Based on this equation, the GFP synthesis rate (dF/dt) for the experiment (<a href= "http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) divided by the ABS (which means the absorbance or OD<sub>600</sub>) of the cells containing the experiment construct. GFP synthesis rate (dF/dt) for the reference promoter (<a href= "http://parts.igem.org/Part:BBa_J23101">BBa_J23101</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) divided by the ABS (which means the absorbance or OD<sub>600</sub>) of the cells containing the reference promoter construct.<br><br><br />
<br />
Then, RPU is obtained by dividing the GFP synthesis rate/ABS of experiment with the GFP synthesis rate/ABS of the reference promoter.<br />
<br />
<br />
<br><br />
</p><br />
<br />
<p><br><u><b>Data Processing for data from FACS</b></u><br><br><br />
1. RPU was calculated by first subtracting the autofluorescence (fluorescence of cells with pSB3K3-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240 </a>)<br><br><br />
2. Dividing the fluorescence of cells containing pSB3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240 </a> <br />
with cells containing pSB3K3-<a href="http://parts.igem.org/Part:BBa_I20260">BBa_I20260 </a>.<br><br><br />
Equation is shown below:<br />
<img style= "width:50%" src= "https://static.igem.org/mediawiki/2014/6/60/Riboregulator_ust_Equation.png"/> <br><br><br />
<br />
Based on this equation, the amount of fluorescence [F] for the experiment (<a href= "http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) multiplied by the growth rate (μ) of the cells containing the experiment construct. Amount of fluorescence [F] for the reference promoter (<a href= "http://parts.igem.org/Part:BBa_J23101">BBa_J23101</a>-<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>) multiplied by the growth rate (μ) of the cells containing the reference promoter construct.<br><br><br />
<br />
Then, RPU is obtained by dividing the fluorescence*growth rate of experiment with the fluorescence*growth rate of the reference promoter.<br><br><br />
<br />
3. For simplicity, we assumed the growth rate of the cells transformed with pSB3K3-<a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500 </a>-<a href="http://parts.igem.org/Part:BBa_E0240">BBa_E0240 </a> and cells transformed with pSB3K3-<a href="http://parts.igem.org/Part:BBa_I20260">BBa_I20260 </a> had same similar growth rate. <br />
<br />
<br />
<br />
</div><br />
</td></tr></table></div><br />
<br><br><br />
<br />
</p><br />
<br><br />
<br />
<br />
<br />
<br />
<!-- end of one row of content , two column one picture left--><br />
<br />
<div class='content_1'><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" ><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_two_row"><br />
<p><br />
<br><br />
<u><b>References</b></u><br><br></p><br />
<p><br />
<br />
Schleif R. <i>AraC protein, regulation of the L-arabinose operon in Escherichia coli, and the light switch mechanism of AraC action.</i> FEMS Microbiol Rev (2010) 1–18.<br><br><br />
<br />
Khelbnikov, A., Datsenko, K., Skaug, T., Wanner, B., & Keasling, J. (2001).<i> Homogeneous expression of the P(BAD) promoter in Escherichia coli by constitutive expression of the low-affinity high-capacity AraE transporter. </i> Microbiology, 147(12), 3241-3247.<br><br><br />
<br />
J. R. Kelly, A. J. Rubin, J. H. Davis, J. Cumbers, M. J. Czar, ..., D. Endy. (2009). Measuring the activity of BioBrick promoters using an in vivo reference standard. <i>Journal of Biological Engineering</i>, 3, 4. doi: 10.1186/1754-1611-3-4<br />
<br />
Isaacs, F., Dwyer, D., Ding, C., Pervouchine, D., Cantor, C., & Collins, J. (2004).<i> Engineered riboregulators enable post-transcriptional control of gene expression. </i> Nature Biotechnology, 841-847.<br />
</p> <br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
<br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body></html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T22:57:07Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>Catalog for regulatory RNAs</h2><br />
<p><font color="white">(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the &lt;parttable&gt; function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is far from complete and is expected to take shape by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</font></p><br />
<br />
</div><br />
<br />
<div class='content_1'><h3>Guideline for adding Categories </h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Some guidelines for categorizing RNA devices under this scheme:</h2><br />
<ol><br />
<li>Confirm it is non-coding RNA devices</li><br />
<li>Give category for “level of regulation”</li><br />
<li>List the natures of RNA devices currently under exam (the RNA devices)</li><br />
<li>Compare with the properties of different types of RNA devices with the RNA devices </li><br />
<li>Assign categories about “nature of part” to the RNA devices currently under exam only if the RNA device fulfils all the requirements listed for any type of RNA devices</li><br />
<ol><li>Assign “//RNA/ncRNA/others” if no matches</li><br />
<li>Assign “//RNA/ncRNA/target_sequence” if it is target sequence of other ncRNA devices; Be sure also assign corresponding categories of ncRNA devices. For example, target sequence of sgRNA should be assigned for :</li><ul><li>//RNA/ncRNA/target_sequence</li><br />
<li>//RNA/ncRNA/sgRNA</li></ul></ol><br />
<li>Assign categories of “function of part”. <u>Note that it may not be limited to the two function listed above. Check the existing categories to assign appropriate categories.</u></li><br />
</ol><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<!--catalog --><br />
<br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA Aptamer</h3><br />
<div class= "catalog_description_area"><br />
<p>A RNA apatamer is any RNA molecule that can fold into a tertiary confirmation that binds with strong affinity and high specificity to small molecules through non-Watson-Crick base pairing.</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch</h3><br />
<div class= "catalog_description_area"><br />
<p>A riboswitch is a segment on mRNA that has the ability to detect small molecules or temperature, and regulates gene expression in an on or off manner. Riboswitches usually contain sensor domain for binding of small molecules and a regulatory domain for gene regulation. Riboswitches are therefore also aptamers in nature. Upon binding of a suitable ligand in the sensor domain, riboswitches undergo confirmation changes that can lead to different outcomes like translation inhibition or mRNA degradation.</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Antisense RNAs &#40;asRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>asRNAs are single stranded RNAs that usually form base pair extensively with the target sense RNA / DNA. RNAs belonging to this class are capable of blocking translation, interfering with transcription, or modulating RNA stability. A review by Thomason and Storz provided detailed descriptions to their properties and functions.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>siRNAs work in the RNA interference (RNAi) pathway. siRNAs are usually produced by "dicing" exogenous, long double stranded RNA into 21-nucleotides small fragments. The siRNAs will then bind to Argonaute in RNA-induced silencing complex (RISC) and one strand is discarded. The remaining strand then guides the RISC to RNA targets with complementary base pairs and in most cases degrades the latter, result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>microRNAs &#40;miRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>miRNAs, like siRNA, work through the RNA interference (RNAi) pathway They are usually 19-25nt single stranded RNA that have an endogenous origin. They started as hairpin transcripts and processed by Drosha in non-random manner and are then processed by Dicer. Following binding to RISC, they regulate normal biological processes by degrading or inhibiting mRNAs that it has complementarity to.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
<!--catalog --><br />
<div class='content_1'><h3>Single guiding RNA &#40;sgRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>sgRNAs work in the CRISPR/Cas system. They are constructed by fusing functional domains of CRISPR RNA (crRNA) and trans-acting crRNA (taRNA) together through RNA linkers. They associate with Cas9 proteiens or their derivatives and guide them to DNA with complementarity with the targeting sequence of crRNA. </p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
<!--catalog --><br />
<div class='content_1'><h3>Ribozyme</h3><br />
<div class= "catalog_description_area"><br />
<p>A ribozyme is a RNA molecule with intrinsic catalytic activity, that can catalyse conversion of substrate into a product.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
<!--catalog --><br />
<div class='content_1'><h3>Aptazymes</h3><br />
<div class= "catalog_description_area"><br />
<p>RNA aptazymes, as the name suggests, are RNAs that carry properties from both aptamers and ribozymes. They are capable of sensing small molecules. Upon activation by a ligand, they can trigger ribozyme-mediated cleavage.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Structural Scaffolds</h3><br />
<div class= "catalog_description_area"><br />
<p>These ncRNAs have multiple interaction domains concatenated into a single molecule so as to facilitate co-localization of functional modules.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>pT181-RNAI</h3><br />
<div class= "catalog_description_area"><br />
<p>The pT181-RNAI is a special class of regulatory RNAs derived from elements in Staphylococcus aureus pathogenicity plasmid pT181. A specific 5’ UTR region would normally form an anti-termination loop. Upon interacting with a pT181-RNAI, a premature terminator loop 5’ to the CDS will form and result in early termination before the mRNA can be completely transcribed.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Stability Control Elements</h3><br />
<div class= "catalog_description_area"><br />
<p>This class of ncRNAs can help to stabilize or destabilize a RNA molecule, typically by giving rise to hairpin structures that block or facilitate access of ribonucleases to the RNA itself.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Complex</h3><br />
<div class= "catalog_description_area"><br />
<p>This category contains ncRNA with dual or more functions resulting from combining 2 or multiple natures / functions of existing ncRNAs.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Targeted Sequence</h3><br />
<div class= "catalog_description_area"><br />
<p>This category deals with segments of ncRNAs that serve as recognizable targets by other ncRNAs.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Others</h3><br />
<div class= "catalog_description_area"><br />
<p>ncRNAs not belonging to the any of the above categories are listed here.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Designer</th><br />
<th scope="col">Part Number</th><br />
<th scope="col">Description</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<br />
<div class='content_1'><h3>Differentiation</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>siRNA VS miRNA</h2><br />
<p > siRNA and miRNA are two very similar RNA devices. Both of them will be processed by Dicer and both of them will from a RISC complex to carry out their function. However there are substantial differences between the two.</p><p> First, siRNA are 20 to 25 nucleotides long; while miRNAs are 19-25 nucleotides long.</p><p> Second, siRNA usually fully complement with the target mRNA; while miRNA can be partially complement with target mRNA.As a result, siRNA usually target few mRNA while miRNA can target 250-500 different mRNAs. Last but not least, siRNAs usually stem from exogenous DNA; while miRNA usually stem from endogenous DNA.</p><br />
</div><br />
</td><br />
</tr><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>siRNA / miRNA VS asRNA</h2><br />
<p > asRNAs refers to single stranded RNAs that are complementary to mRNA. Although no specific length requirement is imposed on asRNAs, asRNAs usually refers to RNA with longer length by historical reason. Whereas siRNA refers to short double stranded RNAs that are 20-25 nt long; miRNA usually refers to single stranded RNA that are 19-25 nt long.<br />
asRNA form duplex with mRNA, which will blocks the access of ribosome to mRNA, also the duplex may be degraded by ribonuclease exist in the cell. Either functions of siRNA and miRNA depends on RISC. </p><br />
</div><br />
</td><br />
</tr><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Structural scaffold VS Stability control elements</h2><br />
<p > Structural scaffold refers to the folding of RNA, which has the ability to recruit various molecules, mostly proteins. Scaffold may stabilize RNA devices and therefore a scaffold can also be stability control elements.<br />
While stability control elements refers to any RNA devices that contribute to the stability of RNA devices. It is not limited to RNA scaffold. One example is poly A tail elements for mRNA, it contributes to the stability of mRNA, however it is not a loop.<br />
</p><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</div> <br />
<div class='content_1'><h3>Case Study</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Case one: Spinach Aptamer</h2><br />
<div class="case_table"><br />
<table><br />
<tr><th>Type of Category </th><th>THE PROPOSED CATEGORIES</th></tr><br />
<tr><td>FUNCTION OF PART</td><td>//RNA/ncRNA/function/reporter</td></tr><br />
<tr><td>LEVEL OF CONTROL</td><td>None</td></tr><br />
<tr><td>NATURE OF PART</td><td>//RNA/ncRNA/aptamer</td></tr><br />
<tr><td rowspan="2">Chassis</td><td>//Chassis/prokaryote/ecoli</td></tr><br />
<tr><td style='background-color:#FFF6E5; '>//Chassis/eukaryote/human</td></tr><br />
<br />
</table><br />
<h5>Justification</h5><br />
<p>FUNCTION OF PART : <b>//RNA/ncRNA/function/reporter</b><br />
<br>Spinach RNA aptamer binds with fluorophores mimics the GFP, and RNA fluorophore complex emit green fluorescence upon exposure of UV light.<br />
</p><br />
<p>LEVEL OF REGULATION:<b> NONE</b><br />
<br>Since this RNA devices is not involved in gene regulation, it is not assigned with any category related to level of regulation.<br />
</p><br />
<p>CHASSIS:<b> //Chassis/prokaryote/ecoli & //Chassis/eukaryote/human</b><br />
<br>There are evident that part are functional in the two chassis. <br />
</p><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<br />
</table><br />
<br />
<br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Case two: RNA_OUT</h2><br />
<div class="case_table"><br />
<table><br />
<tr><th>Type of Category </th><th>THE PROPOSED CATEGORIES</th></tr><br />
<tr><td>FUNCTION OF PART</td><td>//RNA/ncRNA/function/regulation</td></tr><br />
<tr><td>LEVEL OF REGULATION</td><td>//RNA/ncRNA/function/regulation/RNA_level</td></tr><br />
<tr><td rowspan="2">NATURE OF PART</td><td>//RNA/ncRNA/RNA_OUT_type/ RNA_OUT</td></tr><br />
<tr><td style='background-color:#FFF6E5; '>//RNA/ncRNA/asRNA</td></tr><br />
<tr><td>Chassis</td><td>//Chassis/prokaryote/ecoli</td></tr><br />
<br />
<br />
</table><br />
<h5>Justification</h5><br />
<p>FUNCTION OF PART : <b>//RNA/ncRNA/function/regulation</b><br />
<br>RNA_OUT binds to upstream of CDS of mRNA preventing ribosomal binding, thus down-regulate gene expression.<br />
</p><br />
<p>LEVEL OF REGULATION:<b>//RNA/ncRNA/function/regulation/RNA_level</b><br />
<br>RNA_OUT regulate gene expression by interacting with mRNA. Since it’s target is a RNA and it is exerting gene regulation.<br />
</p><br />
<p>NATURE OF PART:<b> //RNA/ncRNA/RNA_OUT_type/ RNA_OUT</b><br />
<br>This device fit all the requirements for RNA_OUT as mention.<br />
<ol><br />
<li>is asRNA</li><br />
<li>contains stem and loop where loop can interact with RNA_IN</li><br />
<li>base pair with RNA_IN will complement to 5’ of mRNA and block access of RBS from ribosome</li><br />
<li>active in trans</li><br />
</ol><br />
</p><br />
<p>NATURE OF PART:<b> //RNA/ncRNA/asRNA</b><br />
<br>This device fit all the requirements for RNA_OUT as mention.<br />
This RNA device will form complementary base pairs with mRNA, also it is a single stranded RNA. Since it fulfil all requirement of antisense RNA, It is assigned to this category.<br />
</p><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<br />
</table><br />
</div> <br />
</div><br />
</div><br />
</div><br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div style= "text-align:center; background-color:#00CAAA; font-size: 12px;" class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body></html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T22:43:48Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>Catalog for regulatory RNAs</h2><br />
<p><font color="white">(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the &lt;parttable&gt; function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is far from complete and is expected to take shape by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</font></p><br />
<br />
</div><br />
<br />
<div class='content_1'><h3>Guideline for adding Categories </h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Some guidelines for categorizing RNA devices under this scheme:</h2><br />
<ol><br />
<li>Confirm it is non-coding RNA devices</li><br />
<li>Give category for “level of regulation”</li><br />
<li>List the natures of RNA devices currently under exam (the RNA devices)</li><br />
<li>Compare with the properties of different types of RNA devices with the RNA devices </li><br />
<li>Assign categories about “nature of part” to the RNA devices currently under exam only if the RNA device fulfils all the requirements listed for any type of RNA devices</li><br />
<ol><li>Assign “//RNA/ncRNA/others” if no matches</li><br />
<li>Assign “//RNA/ncRNA/target_sequence” if it is target sequence of other ncRNA devices; Be sure also assign corresponding categories of ncRNA devices. For example, target sequence of sgRNA should be assigned for :</li><ul><li>//RNA/ncRNA/target_sequence</li><br />
<li>//RNA/ncRNA/sgRNA</li></ul></ol><br />
<li>Assign categories of “function of part”. <u>Note that it may not be limited to the two function listed above. Check the existing categories to assign appropriate categories.</u></li><br />
</ol><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<!--catalog --><br />
<br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA Aptamer</h3><br />
<div class= "catalog_description_area"><br />
<p>A RNA apatamer is any RNA molecule that can fold into a tertiary confirmation that binds with strong affinity and high specificity to small molecules through non-Watson-Crick base pairing.</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p>A riboswitch is a segment on mRNA that has the ability to detect small molecules or temperature, and regulates gene expression in an on or off manner. Riboswitches usually contain sensor domain for binding of small molecules and a regulatory domain for gene regulation. Riboswitches are therefore also aptamers in nature. Upon binding of a suitable ligand in the sensor domain, riboswitches undergo confirmation changes that can lead to different outcomes like translation inhibition or mRNA degradation.</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>siRNAs work in the RNA interference (RNAi) pathway. siRNAs are usually produced by "dicing" exogenous, long double stranded RNA into 21-nucleotides small fragments. The siRNAs will then bind to Argonaute in RNA-induced silencing complex (RISC) and one strand is discarded. The remaining strand then guides the RISC to RNA targets with complementary base pairs and in most cases degrades the latter, result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>microRNAs &#40;miRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>miRNAs, like siRNA, work through the RNA interference (RNAi) pathway They are usually 19-25nt single stranded RNA that have an endogenous origin. They started as hairpin transcripts and processed by Drosha in non-random manner and are then processed by Dicer. Following binding to RISC, they regulate normal biological processes by degrading or inhibiting mRNAs that it has complementarity to.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
<!--catalog --><br />
<div class='content_1'><h3>Single guiding RNA &#40;sgRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>sgRNAs work in the CRISPR/Cas system. They are constructed by fusing functional domains of CRISPR RNA (crRNA) and trans-acting crRNA (taRNA) together through RNA linkers. They associate with Cas9 proteiens or their derivatives and guide them to DNA with complementarity with the targeting sequence of crRNA. </p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
<br />
<div class='content_1'><h3>Differentiation</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>siRNA VS miRNA</h2><br />
<p > siRNA and miRNA are two very similar RNA devices. Both of them will be processed by Dicer and both of them will from a RISC complex to carry out their function. However there are substantial differences between the two.</p><p> First, siRNA are 20 to 25 nucleotides long; while miRNAs are 19-25 nucleotides long.</p><p> Second, siRNA usually fully complement with the target mRNA; while miRNA can be partially complement with target mRNA.As a result, siRNA usually target few mRNA while miRNA can target 250-500 different mRNAs. Last but not least, siRNAs usually stem from exogenous DNA; while miRNA usually stem from endogenous DNA.</p><br />
</div><br />
</td><br />
</tr><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>siRNA / miRNA VS asRNA</h2><br />
<p > asRNAs refers to single stranded RNAs that are complementary to mRNA. Although no specific length requirement is imposed on asRNAs, asRNAs usually refers to RNA with longer length by historical reason. Whereas siRNA refers to short double stranded RNAs that are 20-25 nt long; miRNA usually refers to single stranded RNA that are 19-25 nt long.<br />
asRNA form duplex with mRNA, which will blocks the access of ribosome to mRNA, also the duplex may be degraded by ribonuclease exist in the cell. Either functions of siRNA and miRNA depends on RISC. </p><br />
</div><br />
</td><br />
</tr><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Structural scaffold VS Stability control elements</h2><br />
<p > Structural scaffold refers to the folding of RNA, which has the ability to recruit various molecules, mostly proteins. Scaffold may stabilize RNA devices and therefore a scaffold can also be stability control elements.<br />
While stability control elements refers to any RNA devices that contribute to the stability of RNA devices. It is not limited to RNA scaffold. One example is poly A tail elements for mRNA, it contributes to the stability of mRNA, however it is not a loop.<br />
</p><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</div> <br />
<div class='content_1'><h3>Case Study</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Case one: Spinach Aptamer</h2><br />
<div class="case_table"><br />
<table><br />
<tr><th>Type of Category </th><th>THE PROPOSED CATEGORIES</th></tr><br />
<tr><td>FUNCTION OF PART</td><td>//RNA/ncRNA/function/reporter</td></tr><br />
<tr><td>LEVEL OF CONTROL</td><td>None</td></tr><br />
<tr><td>NATURE OF PART</td><td>//RNA/ncRNA/aptamer</td></tr><br />
<tr><td rowspan="2">Chassis</td><td>//Chassis/prokaryote/ecoli</td></tr><br />
<tr><td style='background-color:#FFF6E5; '>//Chassis/eukaryote/human</td></tr><br />
<br />
</table><br />
<h5>Justification</h5><br />
<p>FUNCTION OF PART : <b>//RNA/ncRNA/function/reporter</b><br />
<br>Spinach RNA aptamer binds with fluorophores mimics the GFP, and RNA fluorophore complex emit green fluorescence upon exposure of UV light.<br />
</p><br />
<p>LEVEL OF REGULATION:<b> NONE</b><br />
<br>Since this RNA devices is not involved in gene regulation, it is not assigned with any category related to level of regulation.<br />
</p><br />
<p>CHASSIS:<b> //Chassis/prokaryote/ecoli & //Chassis/eukaryote/human</b><br />
<br>There are evident that part are functional in the two chassis. <br />
</p><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<br />
</table><br />
<br />
<br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Case two: RNA_OUT</h2><br />
<div class="case_table"><br />
<table><br />
<tr><th>Type of Category </th><th>THE PROPOSED CATEGORIES</th></tr><br />
<tr><td>FUNCTION OF PART</td><td>//RNA/ncRNA/function/regulation</td></tr><br />
<tr><td>LEVEL OF REGULATION</td><td>//RNA/ncRNA/function/regulation/RNA_level</td></tr><br />
<tr><td rowspan="2">NATURE OF PART</td><td>//RNA/ncRNA/RNA_OUT_type/ RNA_OUT</td></tr><br />
<tr><td style='background-color:#FFF6E5; '>//RNA/ncRNA/asRNA</td></tr><br />
<tr><td>Chassis</td><td>//Chassis/prokaryote/ecoli</td></tr><br />
<br />
<br />
</table><br />
<h5>Justification</h5><br />
<p>FUNCTION OF PART : <b>//RNA/ncRNA/function/regulation</b><br />
<br>RNA_OUT binds to upstream of CDS of mRNA preventing ribosomal binding, thus down-regulate gene expression.<br />
</p><br />
<p>LEVEL OF REGULATION:<b>//RNA/ncRNA/function/regulation/RNA_level</b><br />
<br>RNA_OUT regulate gene expression by interacting with mRNA. Since it’s target is a RNA and it is exerting gene regulation.<br />
</p><br />
<p>NATURE OF PART:<b> //RNA/ncRNA/RNA_OUT_type/ RNA_OUT</b><br />
<br>This device fit all the requirements for RNA_OUT as mention.<br />
<ol><br />
<li>is asRNA</li><br />
<li>contains stem and loop where loop can interact with RNA_IN</li><br />
<li>base pair with RNA_IN will complement to 5’ of mRNA and block access of RBS from ribosome</li><br />
<li>active in trans</li><br />
</ol><br />
</p><br />
<p>NATURE OF PART:<b> //RNA/ncRNA/asRNA</b><br />
<br>This device fit all the requirements for RNA_OUT as mention.<br />
This RNA device will form complementary base pairs with mRNA, also it is a single stranded RNA. Since it fulfil all requirement of antisense RNA, It is assigned to this category.<br />
</p><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<br />
</table><br />
</div> <br />
</div><br />
</div><br />
</div><br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div style= "text-align:center; background-color:#00CAAA; font-size: 12px;" class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body></html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T22:41:34Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>Catalog for regulatory RNAs</h2><br />
<p><font color="white">(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the &lt;parttable&gt; function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is far from complete and is expected to take shape by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</font></p><br />
<br />
</div><br />
<br />
<div class='content_1'><h3>Guideline for adding Categories </h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Some guidelines for categorizing RNA devices under this scheme:</h2><br />
<ol><br />
<li>Confirm it is non-coding RNA devices</li><br />
<li>Give category for “level of regulation”</li><br />
<li>List the natures of RNA devices currently under exam (the RNA devices)</li><br />
<li>Compare with the properties of different types of RNA devices with the RNA devices </li><br />
<li>Assign categories about “nature of part” to the RNA devices currently under exam only if the RNA device fulfils all the requirements listed for any type of RNA devices</li><br />
<ol><li>Assign “//RNA/ncRNA/others” if no matches</li><br />
<li>Assign “//RNA/ncRNA/target_sequence” if it is target sequence of other ncRNA devices; Be sure also assign corresponding categories of ncRNA devices. For example, target sequence of sgRNA should be assigned for :</li><ul><li>//RNA/ncRNA/target_sequence</li><br />
<li>//RNA/ncRNA/sgRNA</li></ul></ol><br />
<li>Assign categories of “function of part”. <u>Note that it may not be limited to the two function listed above. Check the existing categories to assign appropriate categories.</u></li><br />
</ol><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<!--catalog --><br />
<br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>siRNAs work in the RNA interference (RNAi) pathway. siRNAs are usually produced by "dicing" exogenous, long double stranded RNA into 21-nucleotides small fragments. The siRNAs will then bind to Argonaute in RNA-induced silencing complex (RISC) and one strand is discarded. The remaining strand then guides the RISC to RNA targets with complementary base pairs and in most cases degrades the latter, result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>microRNAs &#40;miRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>miRNAs, like siRNA, work through the RNA interference (RNAi) pathway They are usually 19-25nt single stranded RNA that have an endogenous origin. They started as hairpin transcripts and processed by Drosha in non-random manner and are then processed by Dicer. Following binding to RISC, they regulate normal biological processes by degrading or inhibiting mRNAs that it has complementarity to.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
<!--catalog --><br />
<div class='content_1'><h3>Single guiding RNA &#40;sgRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p>sgRNAs work in the CRISPR/Cas system. They are constructed by fusing functional domains of CRISPR RNA (crRNA) and trans-acting crRNA (taRNA) together through RNA linkers. They associate with Cas9 proteiens or their derivatives and guide them to DNA with complementarity with the targeting sequence of crRNA. </p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
<br />
<div class='content_1'><h3>Differentiation</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>siRNA VS miRNA</h2><br />
<p > siRNA and miRNA are two very similar RNA devices. Both of them will be processed by Dicer and both of them will from a RISC complex to carry out their function. However there are substantial differences between the two.</p><p> First, siRNA are 20 to 25 nucleotides long; while miRNAs are 19-25 nucleotides long.</p><p> Second, siRNA usually fully complement with the target mRNA; while miRNA can be partially complement with target mRNA.As a result, siRNA usually target few mRNA while miRNA can target 250-500 different mRNAs. Last but not least, siRNAs usually stem from exogenous DNA; while miRNA usually stem from endogenous DNA.</p><br />
</div><br />
</td><br />
</tr><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>siRNA / miRNA VS antisense RNA</h2><br />
<p > Antisense RNAs refers to single stranded RNAs that are complementary to mRNA. Although no specific length requirement is imposed on antisense RNA, antisense RNA usually refers to RNA with longer length by historical reason. Whereas siRNA refers to short double stranded RNAs that are 20-25 nt long; miRNA usually refers to single stranded RNA that are 19-25 nt long.<br />
Antisense RNA form duplex with mRNA, which will blocks the access of ribosome to mRNA, also the duplex may be degraded by ribonuclease exist in the cell. Either functions of siRNA and miRNA depends on RISC. </p><br />
</div><br />
</td><br />
</tr><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Structural scaffold VS Stability control elements</h2><br />
<p > Structural scaffold refers to the folding of RNA, which has the ability to recruit various molecules, mostly proteins. Scaffold may stabilize RNA devices and therefore a scaffold can also be stability control elements.<br />
While stability control elements refers to any RNA devices that contribute to the stability of RNA devices. It is not limited to RNA scaffold. One example is poly A tail elements for mRNA, it contributes to the stability of mRNA, however it is not a loop.<br />
</p><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</div> <br />
<div class='content_1'><h3>Case Study</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Case one: Spinach Aptamer</h2><br />
<div class="case_table"><br />
<table><br />
<tr><th>Type of Category </th><th>THE PROPOSED CATEGORIES</th></tr><br />
<tr><td>FUNCTION OF PART</td><td>//RNA/ncRNA/function/reporter</td></tr><br />
<tr><td>LEVEL OF CONTROL</td><td>None</td></tr><br />
<tr><td>NATURE OF PART</td><td>//RNA/ncRNA/aptamer</td></tr><br />
<tr><td rowspan="2">Chassis</td><td>//Chassis/prokaryote/ecoli</td></tr><br />
<tr><td style='background-color:#FFF6E5; '>//Chassis/eukaryote/human</td></tr><br />
<br />
</table><br />
<h5>Justification</h5><br />
<p>FUNCTION OF PART : <b>//RNA/ncRNA/function/reporter</b><br />
<br>Spinach RNA aptamer binds with fluorophores mimics the GFP, and RNA fluorophore complex emit green fluorescence upon exposure of UV light.<br />
</p><br />
<p>LEVEL OF REGULATION:<b> NONE</b><br />
<br>Since this RNA devices is not involved in gene regulation, it is not assigned with any category related to level of regulation.<br />
</p><br />
<p>CHASSIS:<b> //Chassis/prokaryote/ecoli & //Chassis/eukaryote/human</b><br />
<br>There are evident that part are functional in the two chassis. <br />
</p><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<br />
</table><br />
<br />
<br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<h2>Case two: RNA_OUT</h2><br />
<div class="case_table"><br />
<table><br />
<tr><th>Type of Category </th><th>THE PROPOSED CATEGORIES</th></tr><br />
<tr><td>FUNCTION OF PART</td><td>//RNA/ncRNA/function/regulation</td></tr><br />
<tr><td>LEVEL OF REGULATION</td><td>//RNA/ncRNA/function/regulation/RNA_level</td></tr><br />
<tr><td rowspan="2">NATURE OF PART</td><td>//RNA/ncRNA/RNA_OUT_type/ RNA_OUT</td></tr><br />
<tr><td style='background-color:#FFF6E5; '>//RNA/ncRNA/antisense_RNA</td></tr><br />
<tr><td>Chassis</td><td>//Chassis/prokaryote/ecoli</td></tr><br />
<br />
<br />
</table><br />
<h5>Justification</h5><br />
<p>FUNCTION OF PART : <b>//RNA/ncRNA/function/regulation</b><br />
<br>RNA_OUT binds to upstream of CDS of mRNA preventing ribosomal binding, thus down-regulate gene expression.<br />
</p><br />
<p>LEVEL OF REGULATION:<b>//RNA/ncRNA/function/regulation/RNA_level</b><br />
<br>RNA_OUT regulate gene expression by interacting with mRNA. Since it’s target is a RNA and it is exerting gene regulation.<br />
</p><br />
<p>NATURE OF PART:<b> //RNA/ncRNA/RNA_OUT_type/ RNA_OUT</b><br />
<br>This device fit all the requirements for RNA_OUT as mention.<br />
<ol><br />
<li>is antisense RNA’</li><br />
<li>contains stem and loop where loop can interact with RNA_IN</li><br />
<li>base pair with RNA_IN will complement to 5’ of mRNA and block access of RBS from ribosome</li><br />
<li>active in trans</li><br />
</ol><br />
</p><br />
<p>NATURE OF PART:<b> //RNA/ncRNA/antisense_RNA</b><br />
<br>This device fit all the requirements for RNA_OUT as mention.<br />
This RNA device will form complementary base pairs with mRNA, also it is a single stranded RNA. Since it fulfil all requirement of antisense RNA, It is assigned to this category.<br />
</p><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<br />
</table><br />
</div> <br />
</div><br />
</div><br />
</div><br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div style= "text-align:center; background-color:#00CAAA; font-size: 12px;" class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body></html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/data
Team:Hong Kong HKUST/data
2014-10-17T22:34:46Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
</head></html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div id="description_area"><br />
<a id="Pneumosensor"></a><h2>Pneumosensor Data Page</h2><br />
<p style="font-size: 18px" align="center">This page shows all the parts we have made or used in our whole project. Click on the links below to see our constructs on the Registry of Standard Biological Parts in detail. Click <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/results"> here</a> to access our result page for an overview of our achievements with those parts.</p><br />
</div><br />
<hr><br />
<br />
<div class='content_1'><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" ><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_two_row"><br />
<p><br />
<br />
<h5>How our system works:</h5><br><br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/thumb/7/74/Pneu_Datapage_HKUST.jpg/800px-Pneu_Datapage_HKUST.jpg"><br />
<br><br />
<br><br />
<p><b>Data For Our Favorite New Parts:</b><br />
<ul><br />
<br />
<li> <b>&sigma;<sup>x</sup>, <a href= "http://parts.igem.org/Part:BBa_K1379004">BBa_K1379004</a></b>: gene sequence of competence protein ComX which produces &sigma;<sup>x</sup> factor. &sigma;<sup>x</sup> factor induces promoter containing Com-Box sequence (P<sub>celA</sub> and P<sub>comFA</sub>).<br />
<li> <b>P<sub>celA</sub> promoter, <a href= "http://parts.igem.org/Part:BBa_K1379000"> BBa_K1379000</a></b>: a &sigma;<sup>x</sup>-inducible promoter (containing Com-Box sequence) which initiates the transcription of competence CelA protein.<br />
<li> <b>P<sub>comFA</sub> promoter, <a href= "http://parts.igem.org/Part:BBa_K1379001"> BBa_K1379001</a></b>: a &sigma;<sup>x</sup>-inducible promoter (containing Com-Box sequence) which initiates the transcription of ComFA protein.<br />
</ul><br />
<br />
<br><br />
<br><br />
<p><br />
<b>Data for Pre-existing Parts:</b><br />
<ul><br />
<br />
<li><b>Strong promoter, strong RBS combination, <a href= "http://parts.igem.org/Part:BBa_K880005">BBa_K880005</a></b> (Team Michigan iGEM, 2012): combination of strong constitutive promoter (<a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a>) and strong RBS (<a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">BBa_B0034</a>) was used as a backbone for a very high level of expression of ComX protein (&sigma;<sup>x</sup> factor).<br />
<li><b>GFP generator</b>, <a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a></b> (Antiquity Boston University iGEM, 2004): green fluorescent protein reporter (<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0040</a>) with RBS (<a href= "http://parts.igem.org/Part:BBa_B0032">BBa_B0032</a>) and double terminator (<a href= "http://parts.igem.org/Part:BBa_B0015">BBa_B0015</a>) was used as a reporter for characterization of P<sub>celA</sub> and P<sub>comFA</sub> promoters.<br />
</ul><br />
<br><br />
<br><br />
<p><br />
<b>We Also Built and Characterized the Following Parts:</b><br />
<ul><br />
<br />
<li> <b>&sigma;<sup>x</sup> Generator, <a href="http://parts.igem.org/Part:BBa_K1379006"> BBa_K1379006</a></b>: <i>comX</i> gene sequence was assembled with constitutive promoter, RBS and double terminator so ComX protein is produced constitutively.<br />
<li> <b> P<sub>celA</sub>-GFP Generator, <a href="http://parts.igem.org/Part:BBa_K1379002"> BBa_K1379002</a></b>: &sigma;<sup>x</sup>-inducible P<sub>celA</sub> promoter was assembled with GFP generator.<br />
<li> <b>P<sub>comFA</sub>-GFP Generator, <a href= "http://parts.igem.org/Part:BBa_K1379003"> BBa_K1379003</a></b>: &sigma;<sup>x</sup>-inducible P<sub>comFA</sub> promoter was assembled with GFP generator.<br />
<li> <b>&sigma;<sup>x</sup> Generator, P<sub>celA</sub>-GFP Generator, <a href= "http://parts.igem.org/Part:BBa_K1379005"> BBa_K1379005</a></b>: &sigma;<sup>x</sup>-generator was assembled with P<sub>celA</sub>-GFP generator. Following the assemblage of both constructs, GFP was successfully expressed.<br />
<li> <b>&sigma;<sup>x</sup> Generator, P<sub>comFA</suB>-GFP Generator, <a href="http://parts.igem.org/Part:BBa_K1379007"> BBa_K1379007</a></b>: &sigma;<sup>x</sup>-generator was assembled with P<sub>comFA</sub>-GFP generator. Following the assemblage of both constructs, GFP was successfully expressed. <br />
</ul><br />
</p><br />
<br />
<br><br />
<br><br />
<p><br />
<b>We Built but did not Characterize the Following Parts:</b><br />
<ul><br />
<br />
<li> <b><i>comE</i>, <a href="http://parts.igem.org/Part:BBa_K1379051"> BBa_K1379051</a></b>: gene sequence of response regulator ComE which induces the P<sub>comCDE</sub> promoter.<br />
<br />
</ul><br />
</p><br />
<br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br><br><br />
<div id="content_container"><br />
<div id="description_area"><br />
<a id="riboregulator"></a><h2>Riboregulator Data Page</h2><br />
<p style="font-size: 18px" align="center">This page shows all the parts we have made or used in our whole project. Click on the links below to see our constructs on the Registry of Standard Biological Parts in detail. Click <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results"> here </a>to access our result page for an overview of our achievements with those parts.</p><br />
</div><br />
<br />
<div class='content_1'><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" ><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_two_row"><br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/thumb/f/f6/YYYHKUST.jpg/800px-YYYHKUST.jpg"><br />
<p><br />
<p><b>Data for parts with qualified sample in the Part Registry:</b><br />
<ul><br />
<br />
<li><b>Lock 1, <a href= "http://parts.igem.org/Part:BBa_J01008">BBa_J01008</a></b> (Golden Bear, 2005): BioBricked version of Isaacs' riboregulator trans-activating key, taR12<br />
<li><b>Lock3c, <a href= "http://parts.igem.org/Part:BBa_J23031">BBa_J23031</a></b> (Team Berkeley iGEM, 2006): lock3c.<br />
<li><b>Encodes a short RNA sequence that "unlocks" the biobrick part J01122 (lock3) which is locked RFP., <a href= "http://parts.igem.org/Part:BBa_J23008">BBa_J23008</a></b> (Berkeley iGEM, 2006): Key 3c</li><br />
</ul><br />
</p><br />
<br><br />
<p><br />
<b>Data and submitted physical DNA for parts without qualified sample in the Part Registry:</b><br />
<ul><br />
<br />
<li> <b>Inducible pBad/araC promoter, <a href="http://parts.igem.org/Part:BBa_I0500"> BBa_I0500</a></b>: Inducible pBad/araC promoter.<br />
<li> <b>Riboregulator Lock 1, <a href="http://parts.igem.org/Part:BBa_J01010"> BBa_J01010</a></b>:Biobrick version of Isaacs' riboregulator cis repressed lock, crR12.<br />
<li> <b>Lock3, <a href= "http://parts.igem.org/Part:BBa_J01080"> BBa_J01080</a></b>: Biobrick version of Isaacs' riboregulator cis repressed lock, crR12, and modified version of Riboregulator Lock 1.<br />
<li> <b>Key3, <a href= "http://parts.igem.org/Part:BBa_J01086"> BBa_J01086</a></b>: Biobricked version of Isaacs' riboregulator trans activating key, taR12, and modified version of Riboregulator Key 1.<br />
<li> <b>Lock for medium RBS (B0032) from the lock/key library TUD09, <a href="http://parts.igem.org/Part:BBa_K175031"> BBa_K175031</a></b>: This biobrick generates a mRNA which forms a secondary structure blocking the (medium) RBS.<br />
<li> <b>Key for lock of medium (K175031) RBS (B0032) from the lock/key library TUD09, <a href="http://parts.igem.org/Part:BBa_K175032"> BBa_K175032</a></b>: This biobrick generates a mRNA which forms a secondary structure that opens LMR (K175031).<br />
<li> <b>B0034 derived RBS to match spacing of J01122, <a href="http://parts.igem.org/Part:BBa_J23080"> BBa_J23080</a></b>: RBS spacing modification to [RBS] such that the spacing between the shine-delgarno and the ORF is the same as it is in J01122.</li><br />
</ul> <br />
<p><br />
<br><br />
<b>Data and submitted physical DNA for constructs used in characterization:</b><br />
<ul><br />
<br />
<li> <b>RBS(Lock 3c), <a href= "http://http://parts.igem.org/Part:BBa_K1379015">BBa_K1379015</a></b>: B0032 derivate for Lock 3C.<br />
<li> <b>Lock 1-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379020"> BBa_K1379020</a></b>: Cis-repressed GFP Generator Lock 1<br />
<li> <b>Lock 3-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379022> BBa_K1379022</a></b>: Cis-repressed GFP Generator Lock 3<br />
<li> <b>Lock 3c-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379024> BBa_K1379024</a></b>: Cis-repressed GFP Generator Lock 3C<br />
<li> <b>K175031-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379026> BBa_K1379026</a></b>: Cis-repressed GFP Generator MCR<br />
<li> <b>RBS(Lock 1)-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379046> BBa_K1379046</a></b>: GFP generator using a Lock 1 modified RBS.<br />
<li> <b>RBS(Lock 3c)-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379047> BBa_K1379047</a></b>: GFP generator using a Lock 3C modified RBS.<br />
<li> <b>J23102-Lock 1-GFP-B0015-pBad/araC-Key 1-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379048> BBa_K1379048</a></b>: Repression measurement device 1 with trans activator.</li><br />
</ul><br />
<br><br />
<br />
</ul><br />
</p><br />
<br />
<p><br />
<b>We also constructed the following new parts:</b><br />
<ul><br />
<br />
<li> <b>HKUST Lock 1, <a href= "http://parts.igem.org/Part:BBa_K1379018"> BBa_K1379018</a></b>: Cis-Repressor HKUST Lock 1.<br />
<li> <b>HKUST Key 1, <a href= "http://parts.igem.org/Part:BBa_K1379019"> BBa_K1379019</a></b>: Trans-Activator for HKUST Key 1.<br />
<li> <b>HKUST Lock 1-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379028"> BBa_K1379028</a></b>: Cis-repressed GFP Generator HKUST Lock 1</li><br />
</ul><br />
<br><br />
</p><br />
<br />
<br />
<p><br />
<b>We constructed the following intermediates/measurement devices during characterization:</b><br />
<ul><br />
<li> <b>Key 3-B0015, <a href="http://parts.igem.org/Part:BBa_K1379023"> BBa_K1379023</a></b><br />
<li> <b>K175032-B0015, <a href="http://parts.igem.org/Part:BBa_K1379027"> BBa_K1379027</a></b><br />
<li> <b>HKUST Key 1-B0015, <a href="http://parts.igem.org/Part:BBa_K1379029"> BBa_K1379029</a></b><br />
<li> <b>J23102-Lock 1-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379030"> BBa_K1379030</a></b><br />
<li> <b>J23102-Lock 3-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379032"> BBa_K1379032</a></b><br />
<li> <b>pBad/araC-Key 3, <a href="http://parts.igem.org/Part:BBa_K1379033"> BBa_K1379033</a></b><br />
<li> <b>J23102-Lock 3c-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379034"> BBa_K1379034</a></b><br />
<li> <b>pBad/araC-Key 3c, <a href="http://parts.igem.org/Part:BBa_K1379035"> BBa_K1379035</a></b><br />
<li> <b>J23102-K175031-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379036"> BBa_K1379036</a></b><br />
<li> <b>pBad/araC-K175032, <a href="http://parts.igem.org/Part:BBa_K1379037"> BBa_K1379037</a></b><br />
<li> <b>J23102-HKUST Lock 1-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379038"> BBa_K1379038</a></b><br />
<li> <b>pBad/araC-HKUST Key 1, <a href="http://parts.igem.org/Part:BBa_K1379039"> BBa_K1379039</a></b></li><br />
<br />
<br />
</ul><br />
</p><br />
<br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
<br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/search_engine
Team:Hong Kong HKUST/human practice/start-up kit/search engine
2014-10-17T22:31:04Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html lang="en"><br />
<head><br />
<!-- meta --><br />
<meta charset="utf-8" /><br />
<meta name="viewport" content="width=device-width, initial-scale=1.0" /><br />
<br />
<!-- page title --><br />
<title>iGEM Record Listing</title><br />
<br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/anti-main.css&action=raw&ctype=text/css" type="text/css" ><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/indexpage.css&action=raw&ctype=text/css" type="text/css" ><br />
<br />
<!-- stylesheet vendor imports --><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/css/normalize&action=raw&ctype=text/css" /><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/css/foundation&action=raw&ctype=text/css" /><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/css/custom&action=raw&ctype=text/css" /><br />
<!-- import Modernizr as Foundation requirement --><br />
<script src="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/js/vendor/modernizr.js&action=raw&ctype=text/css"></script><br />
<style type="text/css"><br />
.access-menu{<br />
font-size:14px;<br />
}<br />
body{<br />
line-height: 100%;<br />
}<br />
div#description_area{<br />
border-bottom:none;<br />
}<br />
.sort{<br />
height:10px;<br />
width:10px;<br />
}<br />
nav{<br />
top:0;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><br />
<body><br />
<!-- BODY BEGINS HERE --><br />
<br />
<!-- content wrapped by top bar --><br />
<div id="content-wrapper"><br />
<div id="content_container"><br />
<div id="description_area"><br />
<h2>Search Engine for database</h2><br />
<p>Input keyword(s) of your interest.<br><br />
Example: To search information about HKUST iGEM teams, input “HKUST”<br><br />
<br />
If you have keywords for more than one category, click 'Advance search'. <br><br />
Example: To search information about talks done by HKUST iGEM team, input “Talk” under “Type”, and “HKUST” under “Name”. <br><br />
*Abbreviation: [N.America]: North America <br><br><br />
You can download the database <a href="https://static.igem.org/mediawiki/2014/4/4f/Finalized_database_for_HP_2.0.xls">here<br />
</a>. </p><br />
</div><br />
</div><br />
<br><br><br><br />
<!-- Table Listing - search interface & search results --><br />
<div id="table-wrapper"><br />
<br />
<!-- search interface --><br />
<div><br />
<div class="row"><br />
<!-- search interface toggle --><br />
<div class="small-4 columns"><br />
<a id="advanced_search_toggle">Click for Advanced Search >></a><br />
</div><br />
<!-- search results # info --><br />
<div class="small-4 columns" id="hits_info"><br />
Matched dummy_val of dummy_val.<br />
</div><br />
<!-- pagination interface --><br />
<div class="small-4 columns"><br />
<ul class="pagination inline-list"></ul><br />
</div><br />
</div><br />
<!-- basic search input here --><br />
<div class="row" id="basic_search_interface"><br />
<input class="multifieldsearch small-12 columns" id="basic_search_field" placeholder="Search all fields" /><br />
</div><br />
<div id="advanced_search_interface" style="display: none"><br />
<div class="row advanced_search"><br />
<br />
<!-- row 1 adv. search --><br />
<div class="small-2 columns"><br />
Year:<br />
</div><br />
<br />
<div class="small-10 columns"><br />
<div class="row"><br />
<input class="small-5 columns" id="adv_field_fromyear" placeholder="From Year" /><br />
<div class="small-2 columns">to</div><br />
<input class="small-5 columns" id="adv_field_toyear" placeholder="To Year" /><br />
</div><br />
</div><br />
<br />
<!-- row 2 adv. search --><br />
<div class="small-2 columns"><br />
Region:<br />
</div><br />
<div class="small-10 columns"><br />
<div class="row"><br />
<input class="small-12 columns" id="adv_field_region" placeholder="Region" /><br />
</div><br />
</div><br />
<br />
<!-- row 3 adv. search --><br />
<div class="small-2 columns"><br />
Type:<br />
</div><br />
<div class="small-10 columns"><br />
<div class="row"><br />
<input class="small-12 columns" id="adv_field_type" placeholder="Type" /><br />
</div><br />
</div><br />
<br />
<!-- row 4 adv. search --><br />
<div class="small-2 columns"><br />
Name:<br />
</div><br />
<div class="small-10 columns"><br />
<div class="row"><br />
<input class="small-12 columns" id="adv_field_name" placeholder="Name" /><br />
</div><br />
</div><br />
<br />
<!-- row 5 adv. search --><br />
<div class="small-2 columns"><br />
Description:<br />
</div><br />
<div class="small-10 columns"><br />
<div class="row"><br />
<input class="small-12 columns" id="adv_field_description" placeholder="Description" /><br />
</div><br />
</div><br />
<br />
<!-- row 6 adv. search --><br />
<div class="small-2 columns"><br />
Medal:<br />
</div><br />
<div class="small-10 columns"><br />
<div class="row"><br />
<input class="small-12 columns" id="adv_field_medal" placeholder="Medal" /><br />
</div><br />
</div><br />
<br />
<!-- row 7 adv. search --><br />
<div class="small-2 columns"><br />
Advancement:<br />
</div><br />
<div class="small-10 columns"><br />
<div class="row"><br />
<input class="small-12 columns" id="adv_field_advancement" placeholder="Advancement" /><br />
</div><br />
</div><br />
<br />
<!-- row 8 adv. search --><br />
<div class="small-2 columns"><br />
Best Human Practice:<br />
</div><br />
<div class="small-10 columns"><br />
<div class="row"><br />
<input class="small-12 columns" id="adv_field_medalforhp" placeholder="Best Human Practice" /><br />
</div><br />
</div><br />
<br />
<!-- row 9 adv. search --><br />
<div class="small-2 right columns"><br />
<a class="button expand" id="advanced_search_submit">Submit</a><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<!-- records table --><br />
<table class="small-12 columns"><br />
<br />
<!-- table header --><br />
<thead><br />
<tr class="row"><br />
<th class="small-1 columns">Year<img src="https://static.igem.org/mediawiki/2014/a/af/HKUST_HP_Search_Engine_Sort_Arrow.png" class="sort" data-sort="year" /></th><br />
<th class="small-2 columns">Region<img src="https://static.igem.org/mediawiki/2014/a/af/HKUST_HP_Search_Engine_Sort_Arrow.png" class="sort" data-sort="region" /></th><br />
<th class="small-1 columns">Type<img src="https://static.igem.org/mediawiki/2014/a/af/HKUST_HP_Search_Engine_Sort_Arrow.png" class="sort" data-sort="type" /></th><br />
<th class="small-1 columns">Name<img src="https://static.igem.org/mediawiki/2014/a/af/HKUST_HP_Search_Engine_Sort_Arrow.png" class="sort" data-sort="name" /></th><br />
<th class="small-2 columns">Description<img src="https://static.igem.org/mediawiki/2014/a/af/HKUST_HP_Search_Engine_Sort_Arrow.png" class="sort" data-sort="description" /></th><br />
<th class="small-1 columns">Medal<img src="https://static.igem.org/mediawiki/2014/a/af/HKUST_HP_Search_Engine_Sort_Arrow.png" class="sort" data-sort="medal" /></th><br />
<th class="small-2 columns">Advancement<img src="https://static.igem.org/mediawiki/2014/a/af/HKUST_HP_Search_Engine_Sort_Arrow.png" class="sort" data-sort="advancement" /></th><br />
<th class="small-2 columns">Best Human Practice<img src="https://static.igem.org/mediawiki/2014/a/af/HKUST_HP_Search_Engine_Sort_Arrow.png" class="sort" data-sort="medalForHP" /></th><br />
</tr><br />
</thead><br />
<br />
<!-- search results listing --><br />
<tbody id="table_content_region" class="list"><br />
</tbody><br />
</table><br />
<br />
<!-- bottom row pagination --><br />
<div class="small-2 small-centered columns"><br />
<a href="#" class="top_link">Go to top</a><br />
</div><br />
</div><br />
</div><br />
<br />
<!-- script vendor imports --><br />
<script src="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/js/vendor/jquery.js&action=raw&ctype=text/css"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/js/vendor/fastclick.js&action=raw&ctype=text/css"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/js/vendor/placeholder.js&action=raw&ctype=text/css"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/js/vendor/underscore.js&action=raw&ctype=text/css"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/js/vendor/list.js&action=raw&ctype=text/css"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/js/vendor/list.pagination.min.js&action=raw&ctype=text/css"></script><br />
<!-- foundation script import --><br />
<script src="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/js/foundation.min.js&action=raw&ctype=text/css"></script><br />
<!-- data import here --><br />
<script src="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/human_practice/start-up_kit/database/data&action=raw&ctype=text/css"></script><br />
<!-- scripts and functionality --><br />
<script><br />
<!-- template for each record --><br />
window.record_entry_template = function(record_entry){<br />
var result_string = "<tr>";<br />
result_string += "<td class=\"small-1 columns year\">"+record_entry.year+"</td>";<br />
result_string += "<td class=\"small-2 columns region\">"+record_entry.region+"</td>";<br />
result_string += "<td class=\"small-1 columns type\">"+record_entry.type+"</td>";<br />
result_string += "<td class=\"small-1 columns name\">"+record_entry.name+"</td>";<br />
result_string += "<td class=\"small-2 columns description\">"+record_entry.description+"</td>";<br />
result_string += "<td class=\"small-1 columns medal\">"+record_entry.medal+"</td>";<br />
result_string += "<td class=\"small-2 columns advancement\">"+record_entry.advancement+"</td>";<br />
result_string += "<td class=\"small-2 columns medalForHP\">"+record_entry.medalForHP+"</td>";<br />
result_string += "</tr>";<br />
return result_string;<br />
};<br />
<!-- populate table with template & data --><br />
_.each(originalDataList, function(item){<br />
$('#table_content_region').append(window.record_entry_template(item));<br />
});<br />
<br />
<!-- options for List.js --><br />
var options = {<br />
valueNames: ['year','region','name','type','description','medal','advancement','medalForHP']<br />
, page: 50<br />
, plugins: [ ListPagination({<br />
innerWindow: 2<br />
,outerWindow: 1<br />
}) ]<br />
, searchClass: 'multifieldsearch'<br />
};<br />
<br />
<!-- create List.js instance on table with filled-in templates --><br />
window.recordsList = new List('table-wrapper', options, originalDataList);<br />
<br />
window.updateHitsInfo = function(){<br />
$('#hits_info').html("Matched "+window.recordsList.matchingItems.length+" of "+window.recordsList.size()+" records.");<br />
<br />
};<br />
<!-- function to handle toggle showing the adv. search interface - show and hide --><br />
window.advanced_shown = false;<br />
$('#advanced_search_toggle').click(function(event){<br />
event.preventDefault();<br />
if(window.advanced_shown){<br />
$('#advanced_search_interface').hide();<br />
$('#basic_search_interface').show();<br />
$('#advanced_search_toggle').html("Click for Advanced Search >>");<br />
$('#adv_field_fromyear').val('');<br />
$('#adv_field_toyear').val('');<br />
$('#adv_field_region').val('');<br />
$('#adv_field_type').val('');<br />
$('#adv_field_name').val('');<br />
$('#adv_field_description').val('');<br />
$('#adv_field_medal').val('');<br />
$('#adv_field_advancement').val('');<br />
$('#adv_field_medalforhp').val('');<br />
window.recordsList.search();<br />
window.recordsList.filter();<br />
advanced_shown = false;<br />
} else {<br />
$('#advanced_search_interface').show();<br />
$('#basic_search_interface').hide();<br />
$('#advanced_search_toggle').html("<< Back to Basic Search");<br />
$('#basic_search_field').val('');<br />
window.recordsList.search();<br />
window.recordsList.filter();<br />
advanced_shown = true;<br />
}<br />
window.updateHitsInfo();<br />
});<br />
<br />
<!-- function to handle advanced search button click - activate List filter --><br />
$('#advanced_search_submit').click(function(event){<br />
event.preventDefault();<br />
if(window.advanced_shown){<br />
<br />
window.recordsList.filter(function(record){<br />
if(!$('#adv_field_fromyear').val()==""){<br />
if(record._values.year<$('#adv_field_fromyear').val()){<br />
return false;<br />
}<br />
};<br />
if(!$('#adv_field_toyear').val()==""){<br />
if(record._values.year>$('#adv_field_toyear').val()){<br />
return false;<br />
}<br />
};<br />
if(!$('#adv_field_region').val()==""){<br />
if(record._values.region.toLowerCase().indexOf($('#adv_field_region').val().toLowerCase())<0){<br />
return false;<br />
}<br />
};<br />
if(!$('#adv_field_type').val()==""){<br />
if(record._values.type.toLowerCase().indexOf($('#adv_field_type').val().toLowerCase())<0){<br />
return false;<br />
}<br />
};<br />
if(!$('#adv_field_name').val()==""){<br />
if(record._values.name.toLowerCase().indexOf($('#adv_field_name').val().toLowerCase())<0){<br />
return false;<br />
}<br />
};<br />
if(!$('#adv_field_description').val()==""){<br />
if(record._values.description.toLowerCase().indexOf($('#adv_field_description').val().toLowerCase())<0){<br />
return false;<br />
}<br />
};<br />
if(!$('#adv_field_medal').val()==""){<br />
if(record._values.medal.toLowerCase().indexOf($('#adv_field_medal').val().toLowerCase())<0){<br />
return false;<br />
}<br />
};<br />
if(!$('#adv_field_advancement').val()==""){<br />
if(record._values.advancement.toLowerCase().indexOf($('#adv_field_advancement').val().toLowerCase())<0){<br />
return false;<br />
}<br />
};<br />
if(!$('#adv_field_medalforhp').val()==""){<br />
if(record._values.medalForHP.toLowerCase().indexOf($('#adv_field_medalforhp').val().toLowerCase())<0){<br />
return false;<br />
}<br />
};<br />
return true;<br />
});<br />
window.updateHitsInfo();<br />
}<br />
});<br />
window.updateHitsInfo();<br />
window.setInterval(updateHitsInfo,500);<br />
$(document).foundation();<br />
</script><br />
<br><br><br />
<p style = "text-align: right; padding-right: 5em;">Code provided kindly by Kevin Christian Wongso, HKUST Computer Science major 2014 graduate.<p><br />
<br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.nextPage').fadeIn();<br />
} else {<br />
$('.nextPage').fadeOut();<br />
}<br />
});<br />
<br />
});<br />
</script><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/interview" class="nextPage"><br />
<div class="nextPage" style="box-sizing:content-box;"><br />
<br><br />
NEXT<br />
</div><br />
</a><br />
</footer><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/data
Team:Hong Kong HKUST/data
2014-10-17T22:24:29Z
<p>Hyht2011: link space adjust</p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
</head></html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div id="description_area"><br />
<a id="Pneumosensor"></a><h2>Pneumosensor Data Page</h2><br />
<p style="font-size: 18px" align="center">This page shows all the parts we have made or used in our whole project. Click on the links below to see our constructs on the Registry of Standard Biological Parts in detail. Click <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/results"> here</a> to access our result page for an overview of our achievements with those parts.</p><br />
</div><br />
<hr><br />
<br />
<div class='content_1'><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" ><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_two_row"><br />
<p><br />
<br />
<h5>How our system works:</h5><br><br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/thumb/7/74/Pneu_Datapage_HKUST.jpg/800px-Pneu_Datapage_HKUST.jpg"><br />
<br><br />
<br><br />
<p><b>Data For Our Favorite New Parts:</b><br />
<ul><br />
<br />
<li> <b>&sigma;<sup>x</sup>, <a href= "http://parts.igem.org/Part:BBa_K1379004">BBa_K1379004</a></b>: gene sequence of competence protein ComX which produces &sigma;<sup>x</sup> factor. &sigma;<sup>x</sup> factor induces promoter containing Com-Box sequence (P<sub>celA</sub> and P<sub>comFA</sub>).<br />
<li> <b>P<sub>celA</sub> promoter, <a href= "http://parts.igem.org/Part:BBa_K1379000"> BBa_K1379000</a></b>: a &sigma;<sup>x</sup>-inducible promoter (containing Com-Box sequence) which initiates the transcription of competence CelA protein.<br />
<li> <b>P<sub>comFA</sub> promoter, <a href= "http://parts.igem.org/Part:BBa_K1379001"> BBa_K1379001</a></b>: a &sigma;<sup>x</sup>-inducible promoter (containing Com-Box sequence) which initiates the transcription of ComFA protein.<br />
</ul><br />
<br />
<br><br />
<br><br />
<p><br />
<b>Data for Pre-existing Parts:</b><br />
<ul><br />
<br />
<li><b>Strong promoter, strong RBS combination, <a href= "http://parts.igem.org/Part:BBa_K880005">BBa_K880005</a></b> (Team Michigan iGEM, 2012): combination of strong constitutive promoter (<a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a>) and strong RBS (<a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">BBa_B0034</a>) was used as a backbone for a very high level of expression of ComX protein (&sigma;<sup>x</sup> factor).<br />
<li><b>GFP generator</b>, <a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a></b> (Antiquity Boston University iGEM, 2004): green fluorescent protein reporter (<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0040</a>) with RBS (<a href= "http://parts.igem.org/Part:BBa_B0032">BBa_B0032</a>) and double terminator (<a href= "http://parts.igem.org/Part:BBa_B0015">BBa_B0015</a>) was used as a reporter for characterization of P<sub>celA</sub> and P<sub>comFA</sub> promoters.<br />
</ul><br />
<br><br />
<br><br />
<p><br />
<b>We Also Built and Characterized the Following Parts:</b><br />
<ul><br />
<br />
<li> <b>&sigma;<sup>x</sup> Generator, <a href="http://parts.igem.org/Part:BBa_K1379006"> BBa_K1379006</a></b>: <i>comX</i> gene sequence was assembled with constitutive promoter, RBS and double terminator so ComX protein is produced constitutively.<br />
<li> <b> P<sub>celA</sub>-GFP Generator, <a href="http://parts.igem.org/Part:BBa_K1379002"> BBa_K1379002</a></b>: &sigma;<sup>x</sup>-inducible P<sub>celA</sub> promoter was assembled with GFP generator.<br />
<li> <b>P<sub>comFA</sub>-GFP Generator, <a href= "http://parts.igem.org/Part:BBa_K1379003"> BBa_K1379003</a></b>: &sigma;<sup>x</sup>-inducible P<sub>comFA</sub> promoter was assembled with GFP generator.<br />
<li> <b>&sigma;<sup>x</sup> Generator, P<sub>celA</sub>-GFP Generator, <a href= "http://parts.igem.org/Part:BBa_K1379005"> BBa_K1379005</a></b>: &sigma;<sup>x</sup>-generator was assembled with P<sub>celA</sub>-GFP generator. Following the assemblage of both constructs, GFP was successfully expressed.<br />
<li> <b>&sigma;<sup>x</sup> Generator, P<sub>comFA</suB>-GFP Generator, <a href="http://parts.igem.org/Part:BBa_K1379007"> BBa_K1379007</a></b>: &sigma;<sup>x</sup>-generator was assembled with P<sub>comFA</sub>-GFP generator. Following the assemblage of both constructs, GFP was successfully expressed. <br />
</ul><br />
</p><br />
<br />
<br><br />
<br><br />
<p><br />
<b>We Built but did not Characterize the Following Parts:</b><br />
<ul><br />
<br />
<li> <b><i>comE</i>, <a href="http://parts.igem.org/Part:BBa_K1379051"> BBa_K1379051</a></b>: gene sequence of response regulator ComE which induces the P<sub>comCDE</sub> promoter.<br />
<br />
</ul><br />
</p><br />
<br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br><br><br />
<div id="content_container"><br />
<div id="description_area"><br />
<a id="riboregulator"></a><h2>Riboregulator Data Page</h2><br />
<p style="font-size: 18px" align="center">This page shows all the parts we have made or used in our whole project. Click on the links below to see our constructs on the Registry of Standard Biological Parts in detail. Click <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results"> here </a>to access our result page for an overview of our achievements with those parts.</p><br />
</div><br />
<br />
<div class='content_1'><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" ><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_two_row"><br />
<img style="width:80%; display: block;<br />
margin-left: auto;<br />
margin-right: auto" src="https://static.igem.org/mediawiki/2014/thumb/f/f6/YYYHKUST.jpg/800px-YYYHKUST.jpg"><br />
<p><br />
<p><b>Data for parts with qualified sample in the Part Registry:</b><br />
<ul><br />
<br />
<li><b>Lock 1, <a href= "http://parts.igem.org/Part:BBa_J01008">BBa_J01008</a></b> (Golden Bear, 2005): BioBricked version of Isaacs' riboregulator trans-activating key, taR12<br />
<li><b>Lock3c, <a href= "http://parts.igem.org/Part:BBa_J23031">BBa_J23031</a></b> (Team Berkeley iGEM, 2006): lock3c.<br />
<li><b>Encodes a short RNA sequence that "unlocks" the biobrick part J01122 (lock3) which is locked RFP., <a href= "http://parts.igem.org/Part:BBa_J23008">BBa_J23008</a></b> (Berkeley iGEM, 2006): Key 3c<br />
</ul><br />
</p><br />
<p><br />
<b>Data and submitted physical DNA for parts without qualified sample in the Part Registry:</b><br />
<ul><br />
<br />
<li> <b>Inducible pBad/araC promoter, <a href="http://parts.igem.org/Part:BBa_I0500"> BBa_I0500</a></b>: Inducible pBad/araC promoter.<br />
<li> <b>Riboregulator Lock 1, <a href="http://parts.igem.org/Part:BBa_J01010"> BBa_J01010</a></b>:Biobrick version of Isaacs' riboregulator cis repressed lock, crR12.<br />
<li> <b>Lock3, <a href= "http://parts.igem.org/Part:BBa_J01080"> BBa_J01080</a></b>: Biobrick version of Isaacs' riboregulator cis repressed lock, crR12, and modified version of Riboregulator Lock 1.<br />
<li> <b>Key3, <a href= "http://parts.igem.org/Part:BBa_J01086"> BBa_J01086</a></b>: Biobricked version of Isaacs' riboregulator trans activating key, taR12, and modified version of Riboregulator Key 1.<br />
<li> <b>Lock for medium RBS (B0032) from the lock/key library TUD09, <a href="http://parts.igem.org/Part:BBa_K175031"> BBa_K175031</a></b>: This biobrick generates a mRNA which forms a secondary structure blocking the (medium) RBS.<br />
<li> <b>Key for lock of medium (K175031) RBS (B0032) from the lock/key library TUD09, <a href="http://parts.igem.org/Part:BBa_K175032"> BBa_K175032</a></b>: This biobrick generates a mRNA which forms a secondary structure that opens LMR (K175031).<br />
<li> <b>B0034 derived RBS to match spacing of J01122, <a href="http://parts.igem.org/Part:BBa_J23080"> BBa_J23080</a></b>: RBS spacing modification to [RBS] such that the spacing between the shine-delgarno and the ORF is the same as it is in J01122.<br />
<br />
<p><br />
<br><br />
<br><br />
<b>Data and submitted physical DNA for composite constructs used in characterization:</b><br />
<ul><br />
<br />
<li> <b>RBS(Lock 3c), <a href= "http://http://parts.igem.org/Part:BBa_K1379015">BBa_K1379015</a></b>: B0032 derivate for Lock 3C.<br />
<li> <b>Lock 1-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379020"> BBa_K1379020</a></b>: Cis-repressed GFP Generator Lock 1<br />
<li> <b>Lock 3-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379022> BBa_K1379022</a></b>: Cis-repressed GFP Generator Lock 3<br />
<li> <b>Lock 3c-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379024> BBa_K1379024</a></b>: Cis-repressed GFP Generator Lock 3C<br />
<li> <b>K175031-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379026> BBa_K1379026</a></b>: Cis-repressed GFP Generator MCR<br />
<li> <b>RBS(Lock 1)-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379046> BBa_K1379046</a></b>: GFP generator using a Lock 1 modified RBS.<br />
<li> <b>RBS(Lock 3c)-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379047> BBa_K1379047</a></b>: GFP generator using a Lock 3C modified RBS.<br />
<li> <b>J23102-Lock 1-GFP-B0015-pBad/araC-Key 1-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379048> BBa_K1379048</a></b>: Repression measurement device 1 with trans activator.<br />
</ul><br />
<br />
<br><br />
<br><br />
<br />
<br />
</ul><br />
</p><br />
<br><br />
<br><br />
<br />
<p><br />
<b>We also constructed the following new parts:</b><br />
<ul><br />
<br />
<li> <b>HKUST Lock 1, <a href= "http://parts.igem.org/Part:BBa_K1379018"> BBa_K1379018</a></b>: Cis-Repressor HKUST Lock 1.</li><br />
<li> <b>HKUST Key 1, <a href= "http://parts.igem.org/Part:BBa_K1379019"> BBa_K1379019</a></b>: Trans-Activator for HKUST Key 1.</li><br />
<li> <b>HKUST Lock 1-GFP-B0015, <a href= "http://parts.igem.org/Part:BBa_K1379028"> BBa_K1379028</a></b>: Cis-repressed GFP Generator HKUST Lock 1</li><br />
</ul><br />
<br><br />
<br><br />
</p><br />
<br />
<br />
<p><br />
<b>We constructed the following intermediates/measurement devices during characterization:</b><br />
<ul><br />
<li> <b>Key 3-B0015, <a href="http://parts.igem.org/Part:BBa_K1379023"> BBa_K1379023</a></b><br />
<li> <b>K175032-B0015, <a href="http://parts.igem.org/Part:BBa_K1379027"> BBa_K1379027</a></b><br />
<li> <b>HKUST Key 1-B0015, <a href="http://parts.igem.org/Part:BBa_K1379029"> BBa_K1379029</a></b><br />
<li> <b>J23102-Lock 1-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379030"> BBa_K1379030</a></b><br />
<li> <b>J23102-Lock 3-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379032"> BBa_K1379032</a></b><br />
<li> <b>pBad/araC-Key 3, <a href="http://parts.igem.org/Part:BBa_K1379033"> BBa_K1379033</a></b><br />
<li> <b>J23102-Lock 3c-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379034"> BBa_K1379034</a></b><br />
<li> <b>pBad/araC-Key 3c, <a href="http://parts.igem.org/Part:BBa_K1379035"> BBa_K1379035</a></b><br />
<li> <b>J23102-K175031-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379036"> BBa_K1379036</a></b><br />
<li> <b>pBad/araC-K175032, <a href="http://parts.igem.org/Part:BBa_K1379037"> BBa_K1379037</a></b><br />
<li> <b>J23102-HKUST Lock 1-GFP-B0015, <a href="http://parts.igem.org/Part:BBa_K1379038"> BBa_K1379038</a></b><br />
<li> <b>pBad/araC-HKUST Key 1, <a href="http://parts.igem.org/Part:BBa_K1379039"> BBa_K1379039</a></b><br />
<br />
<br />
</ul><br />
</p><br />
<br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/results
Team:Hong Kong HKUST/pneumosensor/results
2014-10-17T22:02:22Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<style type="text/css"><br />
.under_line{<br />
border-bottom-style: solid;<br />
border-width: 1px;<br />
text-indent: 0 !important;<br />
}<br />
</style><br />
</head></html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div id="description_area"><br />
<br><h2>Pneumosensor Results</h2><br><br />
</div><br />
<br />
<div class="quick_link_area"> <br />
<div class= "quick_link_row"><br />
<br />
<div> <br />
<a class="quick_link_sub" href="#1"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/5/56/Module1.HKUST.png/610px-Module1.HKUST.png"/><p><br>Detection Module<br></p><br />
</a><br />
</div><br />
<br />
<div><br />
<a class="quick_link_sub" href="#2"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/5/5d/Module_2HKUST.png/610px-Module_2HKUST.png"/> <p><i>S. pneumoniae</i> &sigma;<sup>x</sup> promoters Module</p><br />
</a> <br />
</div><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br><br><br />
<div id="content_container"><br />
<div id="description_area"><br />
<div id="1"><br><p style= "font-size: 30px; text-align:center">Detection Module</p><br></div><br />
</div><br />
<!-- one row of content , two column--><br />
<div class='content_1'><h3>Overview</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>The two-component regulatory system in <i>S. pneumoniae</i>, consisting of the receptor ComD and its response regulator ComE was to be used in detecting the <br />
autoinducer molecule, competence-stimulating peptide (CSP) and so detect <i>S. pneumoniae</i> populations correspondingly. The activity of the <i>comCDE</i> operon<br />
promoter (P<sub>comCDE</sub>) is induced by phosphorylated ComE. In order to facilitate characterization of P<sub>comCDE</sub>, we use the phosphorylmimetic ComE <br />
mutant, ComE<sup>D58E</sup>, in the pKHS plasmid which was kindly sent to us by Martin et al., from the Université de Toulouse. The characterization of <br />
P<sub>comCDE</sub> is for the purpose of linkage to the &sigma;<sup>x</sup> promoters module by regulating expression of the sigma factor. </p><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<!-- end of one row of content , two column--><br />
<br />
<!-- one row of content , two column one picture right--><br />
<div class='content_1'><h3>Construct</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div ><br />
<p><br />
<b><u>Bacterial Strain</u></b><br><br />
The bacterial strain of <i>E. coli</i> used was DH10B.<br />
<br />
<br><br><br />
<b><u><i>comD</i> and <i>comE</i> gene</u></b><br><br />
<i>comD</i> gene and <i>comE</i> gene were cloned from NCTC 7465 <i>S.pneumoniae</i> strain genomic DNA by PCR using Phusion Polymerase. <br />
<br><br><br><br />
<br />
</p><br />
<b><p class="under_line">ComD Tag Protein</p></b><br />
<p><br />
<br><br />
We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in <i>comD</i> extraction primer.<br />
<br><br><br />
<i>comD</i> forward primer: <br>TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG<br />
<br><i>[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]</i><br />
<br><br><br />
<i>comD</i> reverse primer with FLAG tag: <br>GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT <br />
<br><i>[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]</i><br />
<br><br />
<br><br />
<i>comD</i> sequence contained two illegal EcoRI sites, so we designed a set of partially overlapping primers for site-directed mutagenesis:<br />
<br><br />
1st site Mutagenesis forward primer: GACCTTCTTTGCAATGAACTCTCATAAAG<br />
<br><br />
1st site Mutagenesis reverse primer: CCATTTGAACTTTATGAGAGTTCATTGC<br />
<br><br />
2nd site Mutagenesis forward primer: GAAACAGTTATTGTGATTCAAAATTCATG<br />
<br><br />
2nd site Mutagenesis reverse primer: CGTCATTTTACATGAATTTTGAATCAC<br />
<br><br><br />
However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in three parts using (i) <i>comD</i> forward primer & 1st site mutagenesis <br />
reverse primer; (ii) 1st site forward primer & 2nd site reverse primer; (iii) <i>comD</i> reverse primer & 2nd site mutagenesis forward primer. The two fragments were then ligated with the pSB1C3 backbone through Gibson Assembly.<br />
<br><br><br />
<br><br><br />
<br />
</p><br />
<p class="under_line"><b>ComE Protein</b> (<a href="http://parts.igem.org/Part:BBa_K1379051">BBa_K1379051</a>)</p><br><br />
<p><br />
<i>comE</i> was extracted from pKHS-<i>comE</i> kindly sent to us by Dr. Don Morrison (Université de Toulouse, UPS, Laboratoire de Microbiologie et Génétique Moléculaires). <br />
Extraction was done using the following primers:<br />
<br><br><br />
<i>comE</i> forward primer: <br>TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG<br />
<br><i>[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]</i><br />
<br><br />
<br><br />
<i>comE</i> reverse primer: <br>GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA<br />
<br><i>[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]</i><br />
<br><br />
<br><br />
<br />
<br />
<i>comE</i> sequence contained an illegal SpeI site, so we designed a set of overlapping primers for site-directed mutagenesis:<br />
<br><br />
Mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC<br />
<br><br />
Mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG<br />
<br><br><br />
However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) <i>comE</i> forward primer & mutagenesis <br />
reverse primer; (ii) <i>comE</i> reverse primer & mutagenesis forward primer. The two fragments were then ligated with the pSB1C3 backbone through Gibson Assembly.<br />
<br><br><br />
<br />
</p><br />
<p class="under_line"><b>P<sub>comCDE</sub></b></p><br><br />
<p><br />
The promoter region of the <i>comCDE</i> operon only contains 67bp. By estimating the position of the transcription start site of P<sub>comCDE</sub>, the total size of the <br />
promoter region should be 89bp. We obtain the promoter region by oligo annealing. In designing the forward and reverse oligos, we added the XbaI cut site to the prefix and <br />
SpeI cut site to the suffix at the two ends of the oligos respectively. The backbone pSB1C3 was used. P<sub>comCDE</sub> was ligated with GFP generator (BBa_E0240), which <br />
contains a RBS (BBa_B0032), GFP (BBa_E0040) and double terminator (BBa_B0015). The purpose of this construct is to measure the functionality of P<sub>comCDE</sub> in the presence <br />
and absence of phosphorylated ComE by green fluorescence. BBa_E0240 was obtained from 2014 iGEM distribution kit. The bacterial strain of E.coli used was DH10B. We have tried to <br />
ligate P<sub>comCDE</sub> with BBa_E0240, but unfortunately due to time limitation, we were not able to verify the sequence of our ligated products.<br />
<br><br><br />
<br><br><br />
<br />
P<sub>comCDE</sub> forward oligo:<br><br />
CTAGAGAAAAAGTACACTTTGGGAGAAAAAAATGACAGTTGAGAGAATTTTATCTAAAACGAAATTCCATTTTGTATAATGGTTTTTGTAA<br>GTTATA<br><br />
[6'XbaI prefix][89'PcomCDEregion][2'SpeI suffix]<br />
<br><br><br />
P<sub>comCDE</sub> reverse oligo:<br><br />
CTAGTATAACTTACAAAAACCATTATACAAAATGGAATTTCGTTTTAGATAAAATTCTCTCAACTGTCATTTTTTTCTCCCAAAGTGTACTTT<br>TTCT<br> [6'SpeI suffix][89'PcomCDEregion][2'XbaI prefix]<br />
<br><br><br />
<br><br><br />
<br />
</p><br />
<p class="under_line"><b>ComE<sup>D58E</sup></b></p><br />
<p><br />
<br><br />
The phosphorylmimetic comE mutant, comE<sup>D58E</sup> was sent by Martin et al., the pKHS plasmid. pKHS is an expression vector, which contains a T7 promoter and kanamycin <br />
resistance gene. T7 promoter is induced by isopropyl β-D-1-thiogalactopyranoside (IPTG). </p><br />
</div><br />
</tr><br />
</td><br />
</table><br />
</div><br />
<!-- end of one row of content , two column--><br />
</div><br />
<br><br><br />
<div id="content_container"><br />
<div id="description_area"><div id="2"><br />
<br><p style= "font-size: 30px; text-align:center"><i>S. pneumoniae</i> &sigma;<sup>x</sup> Promoters Module</p><br></div><br />
<br />
</div><br />
<!-- one row of content , two column--><br />
<div class='content_1'><h3>Overview</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>The activity of Com-Box promoter is turned on by a specific sigma factor that is produced by a regulatory gene <i>comX</i>. The &sigma;<sup>x</sup> will bind to the Com-Box promoter region and activate gene expression. &sigma;<sup>x</sup> serve as an inducer with high specificity as it binds to an area of several specific 8 base pairs (TACGAATA) on the Com-Box promoter. This &sigma;<sup>x</sup>-Com-Box system could be used as a highly specific reporting system in our <i>S.pneumonia</i> detection platform.<br />
However in nature, ComX protein will be degraded by ClpXP enzyme which exists in <i>E. coli</i> and some other bacteria. Hence, to ensure the induction of Com-Box promoter by &sigma;<sup>x</sup>, ComW protein is needed as it functions to protect &sigma;<sup>x</sup> from being degraded by ClpXP. ComW protein will be degraded instead, increasing the amount of &sigma;<sup>x</sup> produced.<br />
<br><br> </p><br />
</div><br />
</td><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><b><u>Construct</u></b><br><br />
The three main components of the construct are <i>comX</i> gene, <i>comW</i> gene, and Com-Box promoter. We assembled <i>comX</i> and Com-Box promoter in one <br />
vector plasmid, while <i>comW</i> in a different plasmid. The system will be fused with a tagging protein and a reporting protein. Tagging protein is essential <br />
for detecting the &sigma;<sup>x</sup> and ComW protein expression by means of western blot. Reporting protein which is fluorescence protein is needed for <br />
reporting purpose, hence &sigma;<sup>x</sup>-Com-Box system could serve as a specific reporting system that will be useful for many synthetic constructs. <br />
&sigma;<sup>x</sup> generator and Com-Box promoter construct will be assembled separately in different plasmid before being combined into one plasmid. </p><br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!-- end of one row of content , two column--><br />
<br />
<!-- one row of content , two column one picture right--><br />
<div class='content_1'><h3>&sigma;<sup>x</sup> Generator construct (<a href="http://parts.igem.org/Part:BBa_K1379006">BBa_K1379006</a>) and <i>comW</i> construct </h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>Backbone pSB1C3 was used for &sigma;<sup>x</sup> generator construct and <i>comW</i> construct. <i>comX</i> gene / <i>comW</i> gene were fused with <a href= "http://parts.igem.org/Part:BBa_K880005">BBa_K880005</a> which contains a constitutive promoter (<a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a>) and strong RBS (<a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">BBa_B0034</a>). The purpose of this strong constitutive promoter and strong RBS is to unsure the large production of &sigma;<sup>x</sup> and ComW protein throughout time. Then, a double terminator (<a href= "http://parts.igem.org/Part:BBa_B0015">BBa_B0015</a>) is fused with the promoter, RBS, and <i>comX</i>. BBa_K880005 and BBa_B0015 were obtained from 2014 iGEM distribution kit. <br><br><br />
<br />
Construct using pSB1C3 backbone consisting only &sigma;<sup>x</sup> CDS (<a href= "http://parts.igem.org/Part:BBa_K1379004">BBa_K1379004</a>), and &sigma;<sup>x</sup> followed by double terminator BBa_B0015(<a href= "http://parts.igem.org/Part:BBa_K1379045">BBa_K1379045</a>) was also built to facilitate assembly of &sigma;<sup>x</sup> to promoters and RBSs of choice.<br />
<br><br><br />
<br />
<b><u>Bacterial Strain</u></b><br><br />
The bacterial strain of <i>E. coli</i> used was DH10B. Since this strain of <i>E. coli</i> has clpXP degradation enzyme which targets ComX for degradation, an excess amount of ComX protein is required to maintain enough amount of ComX for Com-Box promoter induction.<br />
<br />
<br><br><br />
<b><u><i>comX</i> and <i>comW</i> gene</u></b><br><br />
<i>comX</i> gene and <i>comW</i> gene were cloned from NCTC 7465 <i>S.pneumoniae</i> strain genomic DNA by PCR using Vent Polymerase. <br />
<br><br><br />
<br><br><br />
</p><br />
<p class="under_line"><b>ComX Tag Protein</p></b><br><br />
<p><br />
We engineered a C-myc protein tag in the 3’ ends of <i>comX</i> by including the sequence in <i>comX</i> extraction primer. <br><br><br />
3’ primer to extract <i>comX</i> with engineered C-myc tag gene sequence:<br><br><br />
GCCGGA<br />
CTGCAGCGGCCGCTACTAGTA<br />
TTATTA<br />
CAGATCCTCTTCTGAGATGAGTTTTTGTTC GTGGGTACGGATAGTAAACTCCTTAAACAC <br />
<br><br><br />
<i><br />
[6’ Cap]<br />
[21’ SpeI and PstI restriction site]<br />
[6’ terminator sequence]<br />
[30’ C-myc protein]<br />
[30' reverse complementary of 3’ <i>comX</i>]<br />
</i><br />
<br />
<br><br><br />
<br><br><br />
<br />
<br />
</p><br />
<p class="under_line"><b>ComW Tag Protein</b></p><br />
<p><br />
We engineered a FLAG protein tag in the 3’ ends of <i>comW</i> by including the sequence in <i>comW</i> extraction primer. <br><br><br />
3’ primer to extract <i>comW</i> with engineered FLAG tag gene sequence:<br><br><br />
GCCGGA<br />
CTGCAGCGGCCGCTACTAGTA<br />
TTATTA<br />
CTTGTCGTCATCGTCTTTGTAGTC<br />
ACAAGAAATAAAACCCCGATTCATTACCAATT <br />
<br><br><br />
<br />
<i><br />
[6’ Cap]<br />
[21’ SpeI and PstI restriction site]<br />
[6’ terminator sequence]<br />
[24’ FLAG protein]<br />
[32' reverse complementary of 3’ <i>comW</i>]<br />
<br />
<br />
</i><br />
<br />
</p><br />
</div><br />
</td><br />
<br />
</tr><br />
</div><br />
</table><br />
</div><br />
<!-- one row of content , two column one picture right--><br />
<br />
<!-- one row of content , two column one picture left--><br />
<div class='content_1'><h3>P<sub>celA</sub> (<a href="http://parts.igem.org/Part:BBa_K1379002">BBa_ K1379002</a>) and P<sub>comFA</sub> (<a href= "http://parts.igem.org/Part:BBa_K1379003">BBa_ K1379003</a>) construct </h3><br />
<table class="content_table" align= "center" ><br />
<br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<br />
<div class= "content_area_one_row"><br />
<div class="content_image"><br />
<br />
</div><br />
<p><br />
Backbone pSB1C3 was used for P<sub>celA</sub> and P<sub>comFA</sub> construct. P<sub>celA</sub> / P<sub>comFA</sub> gene was fused with <a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a>, which contains a medium RBS (<a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">BBa_B0034</a>), GFP (<a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0040</a>) and double terminator (<a href= "http://parts.igem.org/Part:BBa_B0015">BBa_B0015</a>). The purpose of this GFP generator is to indicate the functionality of P<sub>celA</sub> and P<sub>comFA</sub> in the presence and absence of &sigma;<sup>x</sup>. <a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> was obtained from 2014 iGEM distribution kit. The bacterial strain of <i>E. coli</i> used is DH10B.<br />
<br><br><br />
<br><br><br />
</p><br />
<p class="under_line"><b>P<sub>CelA</sub> / P<sub>comFA</sub> gene</b></p><br><br><br />
<p><br />
<u>Identifying the Possible Promoter Regions</u><br><br />
<br />
To date (12 Oct 2014), the core/minimal promoter region of P<sub>celA</sub> has not yet been experimentally defined. In locating the promoter region required to initiate transcription, iGEM 2014 Hong_Kong_HKUST team attempted in making educated guesses based on relevant information available from the literature. The Com-Box promoter consensus sequence “TACGAATA” was BLASTed for targets in the Streptococcus pneumoniae genomes of strains R6, D39, ATCC7699 and NCTC7465 in the NCBI database. Genome of strain NCTC7465 was particularly given attention because its gDNA was available for manipulation. A list of loci with annotated genes returned. &sigma;<sup>x</sup> was known to turn on late competence gene and therefore loci containing any of those genes documented were favored and filtered for. Those loci were then manually checked for consensus among the 4 genomes mentioned above. A sequence of 67 base pairs stood out as a promising target because it was 1) upstream of a late competence genes celA (encodes competence protein CelA), and 2) was identical across the 4 genomes. This 67 bp region has varying upstream sequences and the potential promoter region can reach as far as 200bp. Different truncations (67, 100, 150, 180, 249, 300 bp) were planned for deciding the minimal promoter region, but in the course of construction, only the 100bp version could be finished in time. It was tested to be functional and therefore submitted as P<sub>celA</sub>. <br><br><br />
<br />
P<sub>celA</sub> and P<sub>comFA</sub> gene were both cloned from the genomic DNA of <i>S. pneumoniae</i> strain NCTC7465 by PCR using Vent Polymerase. The difference between these two promoters is the whole sequence of P<sub>comFA</sub> was obtained from Wellcome Trust Sanger Institute, a British genomics and genetics research institute. (https://www.sanger.ac.uk/) <br />
<br />
<br><br><br />
P<sub>celA</sub> Forward primer: TTTCTGTCTAGAGTTGACCAAGGAAGACTATTTTGC<br><br><br />
P<sub>celA</sub> Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAATTTTCTCCTCTCTTAGATTATTCGTAAGAGG<br><br><br />
P<sub>comFA</sub> Forward primer: TTTCTGTCTAGAGTGGACTTGGCCGTCCTCT<br><br><br />
P<sub>comFA</sub> Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAGACGTTCTTCTTCTGTTAATTCATTCTCAG<br><br><br />
<br />
</p><br />
<br />
</td><br />
<br />
<br />
</tr><br />
</div><br />
</table><br />
</div><br />
<br />
<br />
<br />
<br />
<!-- one row of content , two column one picture left--><br />
<div class='content_1'><h3>Assembly and Characterization </h3><br />
<table class="content_table" align= "center" ><br />
<br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<br />
<div class= "content_area_one_row"><br />
<div class="content_image"><br />
<br />
</div><br />
<p><b><u>Assembly</b></u><br><br />
<i>comX</i> and <i>comW</i> construct contain 3 parts that need to be assembled: <a href= "http://parts.igem.org/Part:BBa_K880005">BBa_K880005</a> which contains constitutive promoter and RBS, <i>comX</i> engineered with C-myc tag / comW engineered with FLAG tag, and a double terminator in pSB1C3 backbone. Promoter, RBS, <i>comX</i> engineered with C-myc tag, and double terminator were combined using traditional digestion and ligation method. The ligation product was confirmed by digestion check and sequencing. <br><br><br />
Com-Box construct also contains 3 parts that need to be assembled: P<sub>celA</sub>/P<sub>comFA</sub> promoter, <a href= "http://parts.igem.org/Part:BBa_E0240">BBa_E0240</a> which contains RBS, GFP and double terminator, and pSB1C3 backbone. All three parts were combined using traditional digestion and ligation method. The final ligation product was confirmed by digestion check and sequencing.<br />
<br />
<br />
<Br><br><br />
<b><u>Characterization</u></b><br><br />
RPU (Relative promoter unit) and leakage will be measured as a characterization of 100 base pairs Com-Box promoter (P<sub>celA</sub>), and 160 base pairs Com-Box promoter (P<sub>comFA</sub>). For Com-Box promoter characterization, &sigma;<sup>x</sup> generator construct which contains <a href= "http://parts.igem.org/Part:BBa_K880005">BBa_K880005</a>, <i>comX</i> gene, and <a href= "http://parts.igem.org/Part:BBa_B0015">BBa_B0015</a>, is ligated with P<sub>celA</sub> / P<sub>comFA</sub> construct containing Com-Box promoter and GFP generator. In order to characterize the two Com-Box promoters, &sigma;<sup>x</sup> generator-Com-Box construct was migrated from pSB1C3 to pSB3K3. RPU are measured with <a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_J23101">BBa_J23101</a> Andersen family promoter as a reference promoter.<br />
<br />
</p><br />
<br />
</td><br />
<br />
<br />
</tr><br />
</div><br />
</table><br />
</div><br />
<!-- end of one row of content , two column one picture left--><br />
</div><br />
</div><br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body></html><br />
}}</div>
Hyht2011
http://2014.igem.org/Template:Team:Hong_Kong_HKUST/anti-main.css
Template:Team:Hong Kong HKUST/anti-main.css
2014-10-17T21:54:26Z
<p>Hyht2011: Undo revision 358581 by Hyht2011 (talk)</p>
<hr />
<div>/* <br />
** This CSS file is intended to <br />
** To cancel the effect of main.css<br />
** Imposed by default on the iGEM server<br />
*/<br />
<br />
body {<br />
font: inherit;<br />
color: inherit;<br />
margin: auto;<br />
padding: 0;visited<br />
background-color: none;<br />
}<br />
<br />
/* scale back down to default */<br />
#globalWrapper {<br />
position: relative;<br />
font-size: 100%;<br />
width: 100%;<br />
margin: auto;<br />
padding: 0;<br />
padding-bottom: 10px;<br />
}<br />
.visualClear {<br />
clear: both;<br />
}<br />
<br />
/* The top section contains the banner, the search box,<br />
** and the left and right menus. We are not changing that.<br />
** so it is neglected here */<br />
<br />
<br />
/* Footer remains unchanged */<br />
<br />
<br />
/* Sponsors box remains unchanged */<br />
<br />
/* Pulldown menu boxes remains unchanged */<br />
<br />
/* IGEM RIGHT SIDEBAR STYLING remains unchanged */<br />
<br />
<br />
/*****************************************************************************************************<br />
* The content div contains all of the contents of the page - provided by mediawiki<br />
****************************************************************************************************/<br />
#content {<br />
position: relative;<br />
width: 965px;<br />
# margin-left: 10px;<br />
margin: 0 auto;<br />
padding: 5px 5px 5px 5px;<br />
background: none;<br />
color: black;<br />
border-left: 1px solid #444444;<br />
border-right: 1px solid #444444;<br />
line-height: inherit;<br />
z-index: 2;<br />
}<br />
<br />
/* the left column width is specified in class .portlet <br />
** remains unchanged */<br />
back<br />
/* general styles */<br />
<br />
table {<br />
font-size: default;<br />
background-color: transparent;<br />
color: black;<br />
}<br />
a {<br />
text-decoration: none;<br />
color: #0000DD;<br />
background: none;<br />
}<br />
a:visited {<br />
color: #0000DD;<br />
}<br />
a:active {<br />
color: #0000DD;<br />
}<br />
a:hover {<br />
color: #0000FF;<br />
}<br />
a.stub {<br />
color: inherit;<br />
}<br />
/* a.new, #p-personal a.new { - rdr */<br />
a.new {<br />
color: inherit;<br />
}<br />
a.new:visited, #p-personal a.new:visited {<br />
color: inherit;<br />
}<br />
<br />
img {<br />
border: none;<br />
vertical-align: middle;<br />
}<br />
p {<br />
margin: default;<br />
line-height: inherit;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
<br />
hr {<br />
height: default;<br />
color: inherit;<br />
background-color: default;<br />
border: default;<br />
margin: default;<br />
}<br />
<br />
h1, h2, h3, h4, h5, h6 {<br />
color: inherit;<br />
background: none;<br />
font-weight: inherit;<br />
margin: default;<br />
padding-top: default;<br />
padding-bottom: default;<br />
border-bottom: none;<br />
}<br />
h1 { font-size: default; }<br />
h2 { font-size: default; }<br />
h3, h4, h5, h6 {<br />
border-bottom: none;<br />
font-weight: inherit;<br />
}<br />
h3 { font-size: default; }<br />
h4 { font-size: default; }<br />
h5 { font-size: default; }<br />
h6 { font-size: default; }<br />
<br />
ul ol{<br />
line-height: default;<br />
list-style-type: default;<br />
margin: default;<br />
padding: default;<br />
list-style-image: default;<br />
}<br />
<br />
li {<br />
margin-bottom: inherit;<br />
}<br />
dt {<br />
font-weight: inherit;<br />
margin-bottom: default;<br />
}<br />
dl {<br />
margin-top: default;<br />
margin-bottom: default;<br />
}<br />
dd {<br />
line-height: inherit;<br />
margin-left: default;<br />
margin-bottom: default;<br />
}<br />
<br />
fieldset {<br />
border: default;<br />
margin: default;<br />
padding: default;<br />
line-height: inherit;<br />
}<br />
legend {<br />
background: inherit;<br />
padding: default;<br />
font-size: default;<br />
}<br />
form {<br />
border: none;<br />
margin: 0;<br />
}<br />
<br />
textarea {<br />
width: 100%;<br />
padding: .1em;<br />
}<br />
<br />
q {<br />
font-family: Times, "Times New Roman", serif;<br />
font-style: italic;<br />
}<br />
<br />
/* Some space under the headers in the content area */<br />
#bodyContent h1, #bodyContent h2 {<br />
margin-bottom: defult;<br />
}<br />
#bodyContent h3, #bodyContent h4, #bodyContent h5 {<br />
margin-bottom: default;<br />
}<br />
.firstHeading {<br />
margin-bottom: default;<br />
}<br />
<br />
<br />
/*<br />
** Hiding some wiki elements<br />
*/<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .firstHeading,.visualClear {<br />
display: none;<br />
} /*-- hides default wiki settings --*/<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, <br />
<br />
history, etc.) --*/<br />
background-color:black;<br />
border: 0 none;<br />
height: 20px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 100%; <br />
left: 0; <br />
margin-left: 0;<br />
}<br />
<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings <br />
<br />
--*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
margin: auto;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper, #globalWrapper, #content{ /*-- changes default wiki settings --<br />
<br />
*/<br />
background-color:#FCEBb7;<br />
}<br />
<br />
/*Changing default wiki setting. By Guillaume*/<br />
<br />
.left-menu:hover, .right-menu:hover{<br />
background-color: #555555;<br />
}<br />
.left-menu:hover a, .right-menu:hover a{<br />
color: white;<br />
}<br />
.left-menu li a, .right-menu li a{<br />
color:gray;<br />
background-color:transparent;<br />
}<br />
.left-menu li a:hover, .right-menu li a:hover{<br />
color:white;<br />
text-decoration:underline;<br />
}<br />
<br />
#menubar{<br />
width:auto;<br />
}<br />
<br />
/*End of changing default wiki setting.*/</div>
Hyht2011
http://2014.igem.org/Template:Team:Hong_Kong_HKUST/anti-main.css
Template:Team:Hong Kong HKUST/anti-main.css
2014-10-17T21:53:57Z
<p>Hyht2011: </p>
<hr />
<div>/* <br />
** This CSS file is intended to <br />
** To cancel the effect of main.css<br />
** Imposed by default on the iGEM server<br />
*/<br />
<br />
body {<br />
font: inherit;<br />
color: inherit;<br />
margin: auto;<br />
padding: 0;visited<br />
background-color: none;<br />
}<br />
<br />
/* scale back down to default */<br />
#globalWrapper {<br />
position: relative;<br />
font-size: 100%;<br />
width: 100%;<br />
margin: auto;<br />
padding: 0;<br />
padding-bottom: 10px;<br />
}<br />
.visualClear {<br />
clear: both;<br />
}<br />
<br />
/* The top section contains the banner, the search box,<br />
** and the left and right menus. We are not changing that.<br />
** so it is neglected here */<br />
<br />
<br />
/* Footer remains unchanged */<br />
<br />
<br />
/* Sponsors box remains unchanged */<br />
<br />
/* Pulldown menu boxes remains unchanged */<br />
<br />
/* IGEM RIGHT SIDEBAR STYLING remains unchanged */<br />
<br />
<br />
/*****************************************************************************************************<br />
* The content div contains all of the contents of the page - provided by mediawiki<br />
****************************************************************************************************/<br />
#content {<br />
position: relative;<br />
width: 965px;<br />
# margin-left: 10px;<br />
margin: 0 auto;<br />
padding: 5px 5px 5px 5px;<br />
background: none;<br />
color: black;<br />
border-left: 1px solid #444444;<br />
border-right: 1px solid #444444;<br />
line-height: inherit;<br />
z-index: 2;<br />
}<br />
<br />
/* the left column width is specified in class .portlet <br />
** remains unchanged */<br />
back<br />
/* general styles */<br />
<br />
table {<br />
font-size: default;<br />
background-color: transparent;<br />
color: black;<br />
}<br />
a {<br />
text-decoration: none;<br />
color: #0000DD;<br />
background: none;<br />
}<br />
a:visited {<br />
color: inherit;<br />
}<br />
a:active {<br />
color: inherit;<br />
}<br />
a:hover {<br />
color: inherit;<br />
}<br />
a.stub {<br />
color: inherit;<br />
}<br />
/* a.new, #p-personal a.new { - rdr */<br />
a.new {<br />
color: inherit;<br />
}<br />
a.new:visited, #p-personal a.new:visited {<br />
color: inherit;<br />
}<br />
<br />
img {<br />
border: none;<br />
vertical-align: middle;<br />
}<br />
p {<br />
margin: default;<br />
line-height: inherit;<br />
}<br />
p img {<br />
margin: 0;<br />
}<br />
<br />
hr {<br />
height: default;<br />
color: inherit;<br />
background-color: default;<br />
border: default;<br />
margin: default;<br />
}<br />
<br />
h1, h2, h3, h4, h5, h6 {<br />
color: inherit;<br />
background: none;<br />
font-weight: inherit;<br />
margin: default;<br />
padding-top: default;<br />
padding-bottom: default;<br />
border-bottom: none;<br />
}<br />
h1 { font-size: default; }<br />
h2 { font-size: default; }<br />
h3, h4, h5, h6 {<br />
border-bottom: none;<br />
font-weight: inherit;<br />
}<br />
h3 { font-size: default; }<br />
h4 { font-size: default; }<br />
h5 { font-size: default; }<br />
h6 { font-size: default; }<br />
<br />
ul ol{<br />
line-height: default;<br />
list-style-type: default;<br />
margin: default;<br />
padding: default;<br />
list-style-image: default;<br />
}<br />
<br />
li {<br />
margin-bottom: inherit;<br />
}<br />
dt {<br />
font-weight: inherit;<br />
margin-bottom: default;<br />
}<br />
dl {<br />
margin-top: default;<br />
margin-bottom: default;<br />
}<br />
dd {<br />
line-height: inherit;<br />
margin-left: default;<br />
margin-bottom: default;<br />
}<br />
<br />
fieldset {<br />
border: default;<br />
margin: default;<br />
padding: default;<br />
line-height: inherit;<br />
}<br />
legend {<br />
background: inherit;<br />
padding: default;<br />
font-size: default;<br />
}<br />
form {<br />
border: none;<br />
margin: 0;<br />
}<br />
<br />
textarea {<br />
width: 100%;<br />
padding: .1em;<br />
}<br />
<br />
q {<br />
font-family: Times, "Times New Roman", serif;<br />
font-style: italic;<br />
}<br />
<br />
/* Some space under the headers in the content area */<br />
#bodyContent h1, #bodyContent h2 {<br />
margin-bottom: defult;<br />
}<br />
#bodyContent h3, #bodyContent h4, #bodyContent h5 {<br />
margin-bottom: default;<br />
}<br />
.firstHeading {<br />
margin-bottom: default;<br />
}<br />
<br />
<br />
/*<br />
** Hiding some wiki elements<br />
*/<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .firstHeading,.visualClear {<br />
display: none;<br />
} /*-- hides default wiki settings --*/<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, <br />
<br />
history, etc.) --*/<br />
background-color:black;<br />
border: 0 none;<br />
height: 20px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 100%; <br />
left: 0; <br />
margin-left: 0;<br />
}<br />
<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings <br />
<br />
--*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
margin: auto;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper, #globalWrapper, #content{ /*-- changes default wiki settings --<br />
<br />
*/<br />
background-color:#FCEBb7;<br />
}<br />
<br />
/*Changing default wiki setting. By Guillaume*/<br />
<br />
.left-menu:hover, .right-menu:hover{<br />
background-color: #555555;<br />
}<br />
.left-menu:hover a, .right-menu:hover a{<br />
color: white;<br />
}<br />
.left-menu li a, .right-menu li a{<br />
color:gray;<br />
background-color:transparent;<br />
}<br />
.left-menu li a:hover, .right-menu li a:hover{<br />
color:white;<br />
text-decoration:underline;<br />
}<br />
<br />
#menubar{<br />
width:auto;<br />
}<br />
<br />
/*End of changing default wiki setting.*/</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/protocols
Team:Hong Kong HKUST/wetlab/protocols
2014-10-17T10:20:51Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell | <br />
<html><br />
<head><br />
<br />
<br />
<br />
<br />
<br />
</head><br />
</html>| <br />
<html><br />
<br />
<body><br />
<br />
<div id="content_container"><br />
<div class='content_1'><br />
<h3 style="text-align:center">Protocols</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>We have a variety of protocols that we followed for working on our project. The step-by-step procedures of each technique<br />
can be found here!<br />
</p><br />
</div><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<div id= 'project_buttons'><br />
<table id = "project_buttons_table" align= "center"><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="http://www.bdbiosciences.com/documents/BD_FACSAria_III_User_Guide.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>BD FACSAriaIII User Guide</b></h4><br />
</div></a><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/1/19/Dephosphorylation.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>Dephosphorylation</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/2/25/19._Ethanol_Precipitation.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<br><br />
<h4> <b>Ethanol Precipitation</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/6/64/Gibson_assembly_master_mix-_assembly.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>Gibson Assembly</b> </h4><br />
</div><br />
</td><br />
</tr><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/e/e9/10._Ligation.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>Ligation</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/f/f3/Liquid_mediums_and_Agarose_and_Plates.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Liquid Mediums and Agarose Plates</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/8/8b/M9_Minimal_medium_protocol.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<br><br />
<h4> <b>M9 Minimal Medium</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/2/2a/Mutagenesis_protocol_1_%28multiple_sites%29.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Mutagenesis 1 <br>(Multiple Sites)</b></h4><br />
</div><br />
</td><br />
</tr><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/1/1f/Mutagenesis_protocol_2_%28single_site%29.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Mutagenesis 2 <br>(Single Sites)</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/4/42/Mutagenesis_protocol_3_%28single_site%29.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Mutagenesis 3 <br>(Single Sites)</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="http://j5.jbei.org/j5manual/pages/104.html"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<h4> <b>Oligonucleotide Phosphorylation and Annealing</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/d/d0/Protocol_for_a_routine_Taq_PCR.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>PCR (routine <i>Taq</i>)</b></h4><br />
</div><br />
</td><br />
</tr><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/0/03/Protocol_for_Phusion_PCR.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>PCR (Phusion)</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/c/c5/Protocol_for_Vent_PCR.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>PCR (Vent)</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/7/76/RPU_Measurement_Method_.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<br><br />
<h4> <b>RPU Measurement</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://www.princeton.edu/genomics/mcclean/protocols/Inoue-Method-for-Preparation-of-Competent-E-Coli.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<h4> <b>The Inoue Method for Preparation and Transformation of Competent E. Coli: "Ultra-Competent" Cells</b></h4><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<hr><br />
</div><br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/protocols
Team:Hong Kong HKUST/wetlab/protocols
2014-10-17T10:20:35Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell | <br />
<html><br />
<head><br />
<br />
<br />
<br />
<br />
<br />
</head><br />
</html>| <br />
<html><br />
<br />
<body><br />
<br />
<div id="content_container"><br />
<div class='content_1'><br />
<h3 style="text-align:center">Protocols</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>We have a variety of protocols that we followed for working on our project. The step-by-step procedures of each technique<br />
can be found here!<br />
</p><br />
</div><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<div id= 'project_buttons'><br />
<table id = "project_buttons_table" align= "center"><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="http://www.bdbiosciences.com/documents/BD_FACSAria_III_User_Guide.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>BD FACSAriaIII User Guide</b></h4><br />
</div></a><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/1/19/Dephosphorylation.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>Dephosphorylation</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/2/25/19._Ethanol_Precipitation.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<br><br />
<h4> <b>Ethanol Precipitation</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/6/64/Gibson_assembly_master_mix-_assembly.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>Gibson Assembly</b> </h4><br />
</div><br />
</td><br />
</tr><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/e/e9/10._Ligation.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>Ligation</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/f/f3/Liquid_mediums_and_Agarose_and_Plates.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Liquid Mediums and Agarose Plates</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/8/8b/M9_Minimal_medium_protocol.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<br><br />
<h4> <b>M9 Minimal Medium</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/2/2a/Mutagenesis_protocol_1_%28multiple_sites%29.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Mutagenesis 1 <br>(Multiple Sites)</b></h4><br />
</div><br />
</td><br />
</tr><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/1/1f/Mutagenesis_protocol_2_%28single_site%29.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Mutagenesis 2 <br>(Single Sites)</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/4/42/Mutagenesis_protocol_3_%28single_site%29.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Mutagenesis 3 <br>(Single Sites)</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="http://www.google.com.hk/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&ved=0CB0QFjAA&url=http%3A%2F%2Fj5.jbei.org%2Fj5manual%2Fpages%2F104.html&ei=LO1AVKi-CeLUmAWVnYKwCQ&usg=AFQjCNFpgehwWpB2XuZeJ5GbTAx5fR-UCA&sig2=nkcrSYHQ4AhQie9ytYuC-A"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<h4> <b>Oligonucleotide Phosphorylation and Annealing</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/d/d0/Protocol_for_a_routine_Taq_PCR.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>PCR (routine <i>Taq</i>)</b></h4><br />
</div><br />
</td><br />
</tr><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/0/03/Protocol_for_Phusion_PCR.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>PCR (Phusion)</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/c/c5/Protocol_for_Vent_PCR.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>PCR (Vent)</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/7/76/RPU_Measurement_Method_.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<br><br />
<h4> <b>RPU Measurement</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://www.princeton.edu/genomics/mcclean/protocols/Inoue-Method-for-Preparation-of-Competent-E-Coli.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<h4> <b>The Inoue Method for Preparation and Transformation of Competent E. Coli: "Ultra-Competent" Cells</b></h4><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<hr><br />
</div><br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/protocols
Team:Hong Kong HKUST/wetlab/protocols
2014-10-17T10:19:18Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell | <br />
<html><br />
<head><br />
<br />
<br />
<br />
<br />
<br />
</head><br />
</html>| <br />
<html><br />
<br />
<body><br />
<br />
<div id="content_container"><br />
<div class='content_1'><br />
<h3 style="text-align:center">Protocols</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>We have a variety of protocols that we followed for working on our project. The step-by-step procedures of each technique<br />
can be found here!<br />
</p><br />
</div><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<div id= 'project_buttons'><br />
<table id = "project_buttons_table" align= "center"><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="http://www.bdbiosciences.com/documents/BD_FACSAria_III_User_Guide.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>BD FACSAriaIII User Guide</b></h4><br />
</div></a><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/1/19/Dephosphorylation.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>Dephosphorylation</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/2/25/19._Ethanol_Precipitation.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<br><br />
<h4> <b>Ethanol Precipitation</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/6/64/Gibson_assembly_master_mix-_assembly.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>Gibson Assembly</b> </h4><br />
</div><br />
</td><br />
</tr><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/e/e9/10._Ligation.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>Ligation</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/f/f3/Liquid_mediums_and_Agarose_and_Plates.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Liquid Mediums and Agarose Plates</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/8/8b/M9_Minimal_medium_protocol.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<br><br />
<h4> <b>M9 Minimal Medium</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/2/2a/Mutagenesis_protocol_1_%28multiple_sites%29.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Mutagenesis 1 <br>(Multiple Sites)</b></h4><br />
</div><br />
</td><br />
</tr><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/1/1f/Mutagenesis_protocol_2_%28single_site%29.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Mutagenesis 2 <br>(Single Sites)</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/4/42/Mutagenesis_protocol_3_%28single_site%29.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<h4> <b>Mutagenesis 3 <br>(Single Sites)</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/a/ad/Oligonucleotide_phosoporilation_and_annealing.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<h4> <b>Oligonucleotide Phosphorylation and Annealing</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/d/d0/Protocol_for_a_routine_Taq_PCR.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>PCR (routine <i>Taq</i>)</b></h4><br />
</div><br />
</td><br />
</tr><br />
<tr class= "start_up_link_row"><br />
<br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/0/03/Protocol_for_Phusion_PCR.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>PCR (Phusion)</b> </h4><br />
</div><br />
</td><br />
<br />
<td class= "start_up_link_button" style="height:150px"> <br />
<a href="https://static.igem.org/mediawiki/2014/c/c5/Protocol_for_Vent_PCR.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<br><br />
<br><br />
<h4> <b>PCR (Vent)</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://static.igem.org/mediawiki/2014/7/76/RPU_Measurement_Method_.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"><br />
<br><br />
<br><br />
<br><br />
<h4> <b>RPU Measurement</b> </h4><br />
</div><br />
</td><br />
<td class= "start_up_link_button" style="height:150px"><br />
<a href="https://www.princeton.edu/genomics/mcclean/protocols/Inoue-Method-for-Preparation-of-Competent-E-Coli.pdf"><br />
<div class= "start_up_link_container" style="height:150px;text-align:center"> <br />
<br><br />
<h4> <b>The Inoue Method for Preparation and Transformation of Competent E. Coli: "Ultra-Competent" Cells</b></h4><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<hr><br />
</div><br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/modules
Team:Hong Kong HKUST/pneumosensor/modules
2014-10-17T10:00:48Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div id="description_area"><br />
<h2>Pneumosensor Module Description</h2><br />
<p style= "font-size:30px; text-align:center"><u><br>Overview</u></p><br />
<p> Pneumosensor primarily adopts the quorum sensing pathway components in <i>Streptococcus pneumoniae</i> to detect populations of <i>S. pneumoniae</i>. The main <br />
advantage of this system is its detection specificity- the Gram-positive quorum sensing mechanism is incorporated into the Gram-negative bacteria <i>E. coli</i> to <br />
eliminate possible cross-talk of the autoinducer molecule, competence-stimulating peptide (CSP) with native <i>E. coli</i> molecules. <br />
<br><br><br />
There are two modules to our Pneumosensor- the Detection Module and the <i>S. pneumoniae</i> σ<sup>x</sup> Promoters Module. The Detection Module comprises of the CSP <br />
receptor ComD, its response regulator ComE and the promoter P<sub>comCDE</sub> which is induced by phosphorylated ComE. The σ<sup>x</sup> Promoters Module involves a <br />
highly specific reporting system, whereby σ<sup>x</sup> is associated with RNA polymerase and binds to promoters P<sub>celA</sub> and P<sub>comFA</sub> which <br />
are specific to σ<sup>x</sup> for activation. These promoters then drive the expression of GFP as a reporting system. Another protein, ComW, is expressed alongside the <br />
σ<sup>x</sup> as its stabilizer against proteolysis. </p><br><br><br />
</div><br />
<br />
<br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div> <br />
<br />
<a class="quick_link_sub" href="#1"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/5/56/Module1.HKUST.png/610px-Module1.HKUST.png"/><p><br>Detection Module<br></p><br />
<br />
</a><br />
</div><br />
<br />
<div><br />
<a class="quick_link_sub" href="#2"><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/thumb/5/5d/Module_2HKUST.png/610px-Module_2HKUST.png"/> <p><i>S. pneumoniae</i> &sigma;<sup>x</sup> promoters Module</p><br />
<br />
</a> <br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1' id="1"><h3>Detection Module Description </h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row" ><br />
<br />
<br><br />
<br><br />
<div class= "embedded_image_left"><br />
<div class="content_image"><br />
<img src= "https://static.igem.org/mediawiki/2014/thumb/e/e8/HKUST_iGEM_2014_M1des.png/600px-HKUST_iGEM_2014_M1des.png"/><br />
<h6><b>Figure 1. Detection Module Diagram</h6></b><br><br />
<h7>CSP released by <i>S. pneumoniae</i> is detected by its receptor ComD, which autophosphorylates at the expenditure of ATP. ComD~P then phosphorylates <br />
ComE. ComE~P then induces the promoter P<sub>comCDE</sub>, which drives the expression of GFP.</h7><br />
</div><br />
</div><br />
<p class="first_letter_enhanced">Transformation in <i>Streptococcus pneumoniae</i>, like many other species, depends on specialized state called competence. <br />
Competence is achieved during the exponential growth stage of pneumococcal culture by the secretion of competence-stimulating peptide (CSP), which is a 17-<br />
residue long pheromone that is species-specific. Our team aims to adopt the specific CSP sensing mechanism of <i>S. pneumoniae</i> to detect its populations.<br />
</p><br />
<br><br />
<p>The mechanism we adopted is controlled by a two-component regulatory system (TCS), which consists of the histidine kinase (HK) ComD and its <br />
cognate response regulator (RR) ComE. When CSP binds to it, ComD autophosphorylates to become phospho-ComD, ComD~P; at the expenditure of ATP. <br />
The cytosolic protein ComE is then phosphorylated by ComD~P through transphosphorylation reactions, producing ComE~P. Genes coding for ComD and ComE are constitutively <br />
expressed in our Pneumosensor.<br />
</p><br />
<br><br />
<p>ComE~P binds to repeat sites adjacent to the <i>comCDE</i> and <i>comAB</i> operons (Ween et al., 1999), creating a positive <br />
feedback loop, producing both pre-CSP and its required machinery for maturation and transport. The signal is thus amplified and competence is <br />
coordinated throughout the population. <br />
</p><br />
<br><br />
<p>As part of our detection circuit design, we make use of the inducible promoter from the <i>comCDE</i> operon, P<sub>comCDE</sub>. We obtain the sequence by oligos, <br />
and will characterize it using green fluorescence protein (GFP) that we constructed the downstream of the promoter by BioBrick RFC10. Rather than using ComE~P that has to<br />
be phosphorylated by ComD~P, which involves a chain of reactions, we use a phosphorylmimetic ComE mutant, ComE<sup>D58E</sup>, kindly<br />
shared with us by Bernard Martin et al. After characterization of P<sub>comCDE</sub>, we hope to put P<sub>comCDE</sub> together with the <i>S. pneumoniae</i> σ<sup>x</sup> <br />
promoters module, for the ultimate goal of creating a tightly regulated automatic detection of <i>S. pneumoniae</i>.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</div><br />
</table><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<br />
<div class='content_1' id="2"><h3><i>S. pneumoniae</i> σ<sup>x</sup> promoters Module Description</h3><br />
<br />
<h2><center><b><u>&sigma;<sup>x</sup> - Com-Box mechanism</u></b></center></h2><br />
<br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image"><br />
<img src= "https://static.igem.org/mediawiki/2014/d/d0/Sigmax_combox_final.png"/><br />
<h6><b>Figure 1. &sigma;<sup>x</sup>-Com-Box promoter mechanism</h6></b><br><br />
<h7> The reporter system contains a constitutive promoter <a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a>, which continuously expresses &sigma;<sup>x</sup> required for Com-Box promoter induction. &sigma;<sup>x</sup> will then bind to Com-Box promoter and express green fluorescence protein. The whole construct was built in <i>E. coli</i> DH10B strain. </h7><br />
</div><br />
</div><br />
<p class="first_letter_enhanced">In order to achieve the functionality of pneumosensor, we must have a highly specific reporting system which will only give fluorescent signal under the presence of <i>S. pneumoniae</i>. In search for the suitable gene circuit, the discovery by Prof. Morrison on the competence for genetic transformation in <i>S. pneumoniae</i> which depends on quorum-sensing system to control many competence-specific genes acting in DNA uptake, processing, and integration has provided the ideal framework for this module. (Lee and Morrison, 1999) There is a link between this quorum-sensing system and the competence-specific genes, which is an alternative &sigma;<sup>x</sup> (ComX protein) that serves as a competence-specific global transcription modulator. (Luo and Morrison, 2003) In <i>S. pneumoniae</i>, competence (a state capable of being genetic transformed) happens transiently during the log phase growth, and is regulated by a quorum sensing system utilizing the Competence Signal Peptide (CSP). Upon stimulation by CSP, &sigma;<sup>x</sup> will be expressed and associated with RNA polymerase apoenzyme. The resulting holoenzyme will then be guided by &sigma;<sup>x</sup> to initiate transcription of a set of “late” genes enabling genetic transformation and other unknown functions. Characterized genes regulated by &sigma;<sup>x</sup> were found to contain an 8 base pairs consensus sequence TACGAATA known as the Cin-Box or the Com-Box. (Piotrowski, Luo, & Morrison, 2009). Taking advantage of this competence-specific mechanism, it is now able to produce the <i>S. pneumoniae</i> sensing device of high specificity by incorporating this system into <i>E. coli</i>. <br><br />
<br />
</p><br />
<br><br />
<p><br />
iGEM 2014 Hong_Kong_HKUST Team has cloned &sigma;<sup>x</sup> from <i>S. pneumoniae</i> strain NCTC7465 and characterized its ability to initiate transcription of two downstream promoters with different lengths: P<sub>celA</sub> (<a href= "http://parts.igem.org/Part:BBa_K1379000">BBa_K1379000</a>) and P<sub>comFA</sub> (<a href= "http://parts.igem.org/Part:BBa_K1379001">BBa_K1379001</a>), which have the consensus Com-Box sequence. Though much information about the promoters is readily available nowadays, its characterization of promoter activity, specificity, sequence, as well as the biomolecular mechanism can be greatly enhanced with further investigations and experiments. Hence, we were interested in reproducing this gene circuit with all the associated genes and promoters to be combined into a single transcriptional unit. Despite the suggested susceptibility to leakage and other factors that may hinder or interrupt the mechanism, researches have reported that the pathway was highly specific to certain environmental conditions and stress, suggesting minimal or no leakage in the entire process. <br><br />
<br><br />
<p><br />
P<sub>celA</sub> and P<sub>comFA</sub> promoters have high specificity to &sigma;<sup>x</sup> for activation, so genes downstream the promoters will be translated only if &sigma;<sup>x</sup> is present. Hence, by using fluorescence protein as a reporting mechanism, this &sigma;<sup>x</sup>, P<sub>celA</sub> and P<sub>comFA</sub> promoters system could be further utilized as a specific reporter device in <i>E. coli</i> DH10B strain that could be used by iGEM communities.<br />
</p> <br />
<br />
</div><br />
</td><br />
</tr><br />
</div><br />
</table><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<br />
<!-- one row of content , one column one picture right--><br />
<div class='content_1'><h2><center><b><u>&sigma;<sup>x</sup>-ComW mechanism</u></b></center></h2><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<div class= "embedded_image_right"><br />
<div class="content_image"><br />
<img src= "https://static.igem.org/mediawiki/2014/archive/7/73/20141008143022!Diagram_text_2_edited_without_text.png"/><br />
<h6><b>Figure 2. &sigma;<sup>x</sup> - <i>comW</i> Interaction Diagram</h6></b><br><br />
<h7>&sigma;<sup>x</sup> and ComW protein are both produced by a constitutive promoter <a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a>, which continuously expresses &sigma;<sup>x</sup> required for P<i><sub>celA</sub></i> and P<i><sub>comFA</sub></i> promoters induction, and ComW protein is required for &sigma;<sup>x</sup> stabilization. ComW protein acts as a barrier that protects &sigma;<sup>x</sup> from being degraded by ClpXP degradation enzyme, hence it increases the production of &sigma;<sup>x</sup>. The increase in &sigma;<sup>x</sup> production will increase the expression of green fluorescence protein by P<i><sub>celA</sub></i> and P<i><sub>comFA</sub></i> promoters.</h7><br />
</div><br />
</div><br />
<p class="first_letter_enhanced">To complete the story of competence regulation mechanism from <i>S. Pneumoniae</i>, we would also like to integrate another positive factor involved in competence regulation which was later found out to be ComW. Prof. Morrison's lab released another research paper on the identification of a new component in the regulation of genetic transformation in <i>S. Pneumoniae</i>. The gene <i>comW</i> (SP0018) was found to be <br />
regulated by the quorum-sensing system and is required for a high-level of competence (Luo, Li, and Morrison, 2004). Coexpression of ComW with &sigma;<sup>x</sup> restores the accumulation of &sigma;<sup>x</sup> and the expression of late genes as ComW contributes to the stabilization of the alternative sigma factor X against proteolysis by ClpXP and is required for full activity of &sigma;<sup>x</sup> in directing transcription of late competence genes (Piotrowski, Luo, and Morrison, 2009). <br />
</p><br />
<br><br />
<p><br />
Based on these findings, we tried to integrate this ComW into the mechanism to see whether and how the presence of ComW affects &sigma;<sup>x</sup>. We firstly cloned out the <i>comX</i> gene expressing &sigma;<sup>x</sup>, and <i>comW</i> genes from the genomic DNA of <i>S. pneumoniae</i> NCTC 7465 strain. We then used <a href= "http://parts.igem.org/Part:BBa_K880005">BBa_K880005</a> (consisting of constitutive promoter <a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_J23100">BBa_J23100</a> and strong RBS <a href= "http://parts.igem.org/wiki/index.php?title=Part:BBa_B0034">BBa_B0034</a>) from the BioBricks to express those genes.<br><br><br />
</p><br />
<br />
<br />
<br />
</div><br />
</td><br />
</tr><br />
</div><br />
</table><br />
</div><br />
<!-- one row of content , one column one picture right--><br />
<br />
<br />
<br />
<div class='content_1'><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" ><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_two_row"><br />
<p><br />
<u>References</u><br />
<br><br />
<br><br />
B. Martin et al &quot;ComE/ComE~P interplay dictates activation or extinction status of pneumococcal X-state (competence) &quot; 2012<br />
<br><br />
<br><br />
B. Martin et al &quot;Cross-regulation of competence pheromone production and export in the early control of transformation in <i>Streptococcus pneumoniae</i> &quot; 2000<br />
<br><br />
<br><br />
B. Martin et al &quot;Expression and maintenance of ComD–ComE, the two-component signal-transduction system that controls competence of <i>Streptococcus pneumoniae</i> mmi_7071 1513..1528 &quot; <br />
<br><br />
<br><br />
Cheng, Q., Campbell, E.A., Naughton, A.M., Johnson, S., and Masure, H.R. (1997) The com locus controls genetic transformation in <i>Streptococcus pneumoniae</i>. Mol Micro-biol 23: 683±692.<br />
<br><br />
<br><br />
Pestova, E.V., and Morrison, D.A. (1998) Isolation and characterization of three <i>Streptococcus pneumoniae</i> transformation-specific loci by use of a lacZ reporter insertion vector. J Bacteriol 180: 2701±2710.<br />
<br><br />
<br><br />
Ween, O., Gaustad, P., and Havarstein, L.S. (1999) Identification of DNA binding sites for ComE, a key regulator of natural competence in <i>Streptococcus pneumoniae</i>. Mol Microbiol 33: 817±827.<br />
<br><br />
<br><br />
A. Piotrowski, P. Luo, & D. A. Morrison. (2009). Competence for Genetic Transformation in <i>Streptococcus pneumoniae</i>: Termination of Activity of the Alternative Sigma Factor ComX Is Independent of Proteolysis of ComX and ComW. <i>Journal of Bacteriology</i>, 191(10), 3359-3366. doi:10.1128/JB.01750-08<br />
<br><br />
<br><br />
P. Luo & D. A. Morisson. (2003). Transient Association of an Alternative Sigma Factor, ComX, with RNA Polymerase during the Period of Competence for Genetic Transformation in <i>Streptococcus pneumoniae</i>. <i>Journal of Bacteriology</i>, 185(1), 349-358. doi: 10.1128/JB.185.1.349-358.2003<br />
<br><br />
<br><br />
C. K. Sung & D. A. Morrison. (2005). Two Distinct Functions of ComW in Stabilization and Activation of the Alternative Sigma Factor ComX in <i>Streptococcus pneumoniae</i>. <i>Journal of Bacteriology</i>, 185(9), 3052-3061. doi: 10.1128/JB.187.9.3052-3061.2005<br />
<br><br />
<br><br />
P. Luo, H. Li, & D. A. Morrison. (2004). Identification of ComW as a new component in the regulation of genetic transformation in <i>Streptococcus pneumoniae</i>. <i>Molecular Microbiology</i>, 54(1), 172-183. doi: 10.1111/j.1365-2958.2004.04254.x<br />
<br><br />
<br><br />
M. S. Lee & D. A . Morrison. (1999). Identification of a New Regulator in <i>Streptococcus pneumoniae</i> Linking Quorum Sensing to Competence for Genetic Transformation. <i>Journal of Bacteriology</i>, 181(16), 5004-5016.<br />
</p> <br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div style= "text-align:center" class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T09:48:41Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
In light of this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
<br><br><br />
Given its size, "Project Riboregulator" is expected to take more than just a summer to complete. Thus at the moment of wiki freeze, information available here is bound to be limited. However, the project will continue on well after the Giant Jamboree. Information will be continuously and regularly updated, and because of its nature, <u>"Project Riboregulator" is not part of our work for competing awards of any kind or in any year</u>, but rather, a tribute to the Part Registry and iGEM community alone.</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in <i>trans</i>) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T09:48:07Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
In light of this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
<br><br><br />
Given its size, "Project Riboregulator" is expected to take more than just a summer to complete. Thus at the moment of wiki freeze, information available here is bound to be limited. However, the project will continue on well after the Giant Jamboree. Information will be continuously and regularly updated, and because of its nature, <u>"Project Riboregulator" is not part of our work for competing awards of any kind or in any year</u>, but rather, a tribute to the Part Registry alone and iGEM community.</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in <i>trans</i>) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T09:25:45Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>Catalog for regulatory RNAs</h2><br />
<p><font color="white">(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the &lt;parttable&gt; function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is far from complete and is expected to take shape by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</font></p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
siRNAs usually involved in RNA interference pathway. <br />
siRNA s are produced by &quot;dicing&quot; long double stranded RNA into 21-nucleotides<br />
small fragments. The siRNAs will then bind to a protein and one strand of siRNA is removed. Then siRNA, <br />
which have complementary base pairs with its target mRNA, will binds to target mRNA. The binding of siRNA usually causes the degradation of target<br />
mRNA, <br />
result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/Achievements/medal_requirement
Team:Hong Kong HKUST/Achievements/medal requirement
2014-10-17T08:54:42Z
<p>Hyht2011: Undo revision 310621 by Hyht2011 (talk)</p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
<br />
<br />
<style type="text/css"><br />
div#medal_reqire_container{<br />
display:flex;<br />
justify-content: center;<br />
}<br />
h3.What_medal{<br />
font-size: large;<br />
font-weight: 200;<br />
text-transform: uppercase;<br />
text-align: center;<br />
border-bottom: 2px solid black;<br />
}<br />
div.each_medal{<br />
background: tomato;<br />
padding: 10px;<br />
margin:10px;<br />
max-width:300px;<br />
}<br />
div.img_container img{<br />
max-height: 150px;<br />
<br />
<br />
}<br />
div.img_container{<br />
text-align:center;<br />
}<br />
<br />
<br />
<br />
</style><br />
<br />
</head></html><br />
|<br />
<html><br />
<body><br />
<div id="content_container"><br />
<div class="content_1"><br />
<br />
<h3> Medal requirement</h3><br />
</div><br />
<div id="medal_reqire_container" ><br />
<div class= "each_medal" style="background-color:#bbab8c"><br />
<div class= "img_container" ><img src="https://static.igem.org/mediawiki/2014/b/be/HKUST_Bronze_medal.png" ></div><br />
<br />
<br />
<div class= "medal_text"><br />
<h3 class= "What_medal"> Bronze Medal</h3><br />
<ul><br />
<li>Team registered</li><br />
<li>Completed Judging form</li><br />
<li>We have documented more than one new BioBrick Parts that we used in our project. This part is submitted to iGEM registry. Check out the <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data page</a> for more exciting details.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class= "each_medal" style="background-color:#c0c0c0"><br />
<div class= "img_container"><img src="https://static.igem.org/mediawiki/2014/f/f8/HKUST_Silver_medal.png" ></div><br />
<div class= "medal_text "><br />
<h3 class= "What_medal"> Silver Medal</h3><br />
<ul><br />
<li>We have characterized <a href="http://parts.igem.org/Part:BBa_K1379004">BBa_K1379004</a>, <a href="http://parts.igem.org/Part:BBa_K1379000">BBa_K1379000</a> and <a href="http://parts.igem.org/Part:BBa_K1379001">BBa_K1379001</a> and they function as expected. Check out <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/characterization">CHARACTERIZATION</a> for more exciting details.</li><br />
<br />
<li>We also submit new parts to the iGEM part Registry. They are listed in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Part page for Pneumosensor</a> as well as in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts">Part page for Riboregulator</a> </li><br />
<li>We also consider the safety issues that we concern about our project. We interviewed expert, Read teh transcript of the interview <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">HERE</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class= "each_medal" style="background-color:#ffeb7f"><br />
<div class= "img_container"><img src="https://static.igem.org/mediawiki/2014/f/fe/HKUST_Gold_medal.png" ></div><br />
<div class= "medal_text "><br />
<h3 class= "What_medal"> Gold Medal</h3><br />
<ul><br />
<li>We found out <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a> Pbad promoter has inconsistent sequence. We send another functional Pbad promoter to Part registry; We also measure <a href ="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">the RPU of Pbad across different strain of <i>E. coli</i></a></li><br />
<br />
</ul><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/Achievements/medal_requirement
Team:Hong Kong HKUST/Achievements/medal requirement
2014-10-17T08:53:14Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
<br />
<br />
<style type="text/css"><br />
div#medal_reqire_container{<br />
display:flex;<br />
justify-content: center;<br />
}<br />
h3.What_medal{<br />
font-size: large;<br />
font-weight: 200;<br />
text-transform: uppercase;<br />
text-align: center;<br />
border-bottom: 2px solid black;<br />
}<br />
div.each_medal{<br />
background: tomato;<br />
padding: 10px;<br />
margin:10px;<br />
max-width:300px;<br />
}<br />
div.img_container img{<br />
max-height: 150px;<br />
<br />
<br />
}<br />
div.img_container{<br />
text-align:center;<br />
}<br />
<br />
<br />
<br />
</style><br />
<br />
</head></html><br />
|<br />
<html><br />
<body><br />
<div id="content_container"><br />
<div class="content_1"><br />
<br />
<h3> Medal requirement</h3><br />
</div><br />
<div id="medal_reqire_container" ><br />
<div class= "each_medal" style="background-color:#bbab8c"><br />
<div class= "img_container" ><img src="https://static.igem.org/mediawiki/2014/b/be/HKUST_Bronze_medal.png" ></div><br />
<br />
<br />
<div class= "medal_text"><br />
<h3 class= "What_medal"> Bronze Medal</h3><br />
<ul><br />
<li>Team registered</li><br />
<li>Completed Judging form</li><br />
<li>We have documented more than one new BioBrick Parts that we used in our project. This part is submitted to iGEM registry. Check out the <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data page</a> for more exciting details.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class= "each_medal" style="background-color:#c0c0c0"><br />
<div class= "img_container"><img src="https://static.igem.org/mediawiki/2014/f/f8/HKUST_Silver_medal.png" ></div><br />
<div class= "medal_text "><br />
<h3 class= "What_medal"> Silver Medal</h3><br />
<ul><br />
<li>We have characterized <a href="http://parts.igem.org/Part:BBa_K1379004">BBa_K1379004</a>, <a href="http://parts.igem.org/Part:BBa_K1379000">BBa_K1379000</a> and <a href="http://parts.igem.org/Part:BBa_K1379001">BBa_K1379001</a> and they function as expected. Check out <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/characterization">CHARACTERIZATION</a> for more exciting details.</li><br />
<br />
<li>We also submit new parts to the iGEM part Registry. They are listed in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Part page for Pneumosensor</a> as well as in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts">Part page for Riboregulator</a> </li><br />
<li>We also consider the safety issues that we concern about our project. We interviewed expert, Read teh transcript of the interview <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">HERE</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class= "each_medal" style="background-color:#ffeb7f"><br />
<div class= "img_container"><img src="https://static.igem.org/mediawiki/2014/f/fe/HKUST_Gold_medal.png" ></div><br />
<div class= "medal_text "><br />
<h3 class= "What_medal"> Gold Medal</h3><br />
<ul><br />
<li>We found out <a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a> P<sub>bad</sub> promoter has inconsistent sequence. We send another functional Pbad promoter to Part registry; We also measure <a href ="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">the RPU of Pbad across different strain of <i>E. coli</i></a></li><br />
<br />
</ul><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/notebook
Team:Hong Kong HKUST/wetlab/notebook
2014-10-17T08:52:37Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell | <br />
<html><br />
<head><br />
<br />
<br />
<br />
<br />
<br />
</head><br />
</html>| <br />
<html><br />
<br />
<body><br />
<br />
<div id="content_container"><br />
<div class='content_1'><br />
<h3 style="text-align:center">Notebook</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><br />
Throughout the course of our project, we have continuously recorded our daily work, such as wetlab activities and<br />
research findings. The notebook for Project Pneuumonsensor and Project Riboregulator are displayed separately. <br />
</p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<h3>Pneumosensor</h3><br />
<script src="http://ajax.googleapis.com/ajax/libs/jquery/1.7.1/jquery.min.js"></script><br />
<script><br />
$(document).ready(function(){<br />
$('.head').each(function(){<br />
var $content = $(this).closest('div').find('.content');<br />
$(this).click(function(e){<br />
e.preventDefault();<br />
$content.not(':animated').slideToggle();<br />
});<br />
});<br />
});<br />
</script><br />
<style><br />
* { margin:0; padding:0; } /* a simple reset */<br />
<br />
<br />
<br />
.head { <br />
display:block;<br />
background:#FF9900;<br />
border-radius:2px;<br />
margin-bottom:5px;<br />
align:left;<br />
width:600px;<br />
height: 40px;<br />
z-index:-3;<br />
font-family:"Trebuchet MS", Helvetica, sans-serif;<br />
font-size: 35px;<br />
text-align: left;<br />
}<br />
<br />
.content { <br />
display:none;<br />
background:#8FF5D5;<br />
border-radius:10px;<br />
width:60%;<br />
margin-bottom:5px;<br />
align:center;<br />
z-index:-3;<br />
padding-left:100px;<br />
padding-right:100px;<br />
font-family:"Trebuchet MS", Helvetica, sans-serif<br />
}<br />
<br />
<br />
<br />
</style><br />
<br />
<div id="flight"><br />
<!-- J U U N N EEEEEEEEEE 2 0 1 3----------------><br />
<!-- J U U NN N E 2 0 1 3----------------><br />
<!-- J U U N N N E 2 0 1 3----------------><br />
<!-- J U U N N N E 2 0 1 3----------------><br />
<!-- J U U N N N E 2 0 1 3----------------><br />
<!-- J U U N N N EEEEEEEEEE 2 0 1 3----------------><br />
<!-- J U U N N N E 2 0 1 3----------------><br />
<!-- J J U U N N N E 2 0 1 3----------------><br />
<!-- J J U U N N N E 2 0 1 3----------------><br />
<!-- J J U U N N N E 2 0 1 3----------------><br />
<!-- JJJJJJJJJJJJ UUUUUUUUUUUU N N EEEEEEEEEEE 2 0 1 3----------------><br />
<br />
<div id="satu" align="center"> <h2>June 2014</h2><br />
<br />
<div><br />
<a href="#" class="head">Week 1</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>June 2</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br><br />
<br><b>June 3</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br><b>June 4</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 5</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br><b>June 6</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 2</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>June 9</b> <br><br />
Wet lab<br><br />
· Transformation of pSB1C3-BBa_E0240, pSB1C3-BBa_B0032 and pSB1C3-BBa_K20600<br><br />
· Transformation of BBa_B0034 and BBa_E0040 into DH10B<br><br />
· <br><br />
· <br><br />
<br><b>June 10</b> <br><br />
Wet lab<br><br />
· Found reference promoter J23101 in BBa_I20260 from part registry<br><br />
· Looked for Pcombox gene sequence from the genomic DNA<br><br />
· Bacterial inoculation of BBa_B0034 and BBa_E0040<br><br />
· <br><br />
<br><b>June 11</b> <br><br />
Wet lab<br><br />
· Looked for Pcombox gene sequence from the genomic DNA<br><br />
· Studied the Characteristic, function and mechnism of how promoters work<br><br />
· Miniprep of BBa_B0034 and BBa_E0040<br><br />
· <br><br />
<br><b>June 12</b> <br><br />
Wet lab<br><br />
· Looked for Pcombox gene sequence from the genomic DNA<br><br />
· research on gene sequence of PcomX, how to quantify p~comE, range of concentration of p~comE to use for characterization<br><br />
· explain of scar<br><br />
· <br><br />
<br><b>June 13</b> <br><br />
Wet lab<br><br />
· Looked for Pcombox gene sequence from the genomic DNA<br><br />
· research on gene sequence of PcomX, how to quantify p~comE, range of concentration of p~comE to use for characterization<br><br />
· <br><br />
· <br><br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 3</a><br />
<div class="content" align="left" style="display: none;"><br />
<br />
<br><b>June 16</b> <br><br />
Wet lab<br><br />
· Blast the gDNA of NCTC7465 strain with various strain of S. pneumoniae to look for Pcombox gene sequence<br><br />
· Found a possible Pcombox<br><br />
· Transformation of BBa_J04450 and BBa_I20260 into DH10B<br><br />
· Bacterial inoculation of BBa_E0240<br><br />
· <br><br />
<br><b>June 17</b> <br><br />
Wet lab<br><br />
· Blast the gDNA of NCTC7465 strain with various strain of S. pneumoniae to look for Pcombox gene sequence<br><br />
· Found a possible Pcombox<br><br />
· Searched for other possible Pcombox sequences<br><br />
· Miniprep of BBa_E0240<br><br />
· Bacterial inoculation of BBa_J04450(CHL) and BBa_I20260<br><br />
· <br><br />
<br><b>June 18</b> <br><br />
Wet lab<br><br />
· Designed primers for the Pcombox sequences<br><br />
· Received a Pcombox sequence from Wellcome Trust Sanger Institute<br><br />
· Miniprep of BBa_J04450(CHL) and BBa_I20260<br><br />
· Bacterial inoculation of BBa_J04450(CHL) and BBa_I20260<br><br />
· Digestion of BBa_J04450(CHL) and BBa_I20260<br><br />
· Gel electrophoresis of digested products<br><br />
· <br><br />
<br><b>June 19</b> <br><br />
· Digestion of pSB1C3-BBa_E0240 at EcoRI and SpeI<br><br />
· Miniprep of BBa_J04450(CHL) and BBa_I20260<br><br />
· Digestion of BBa_J04450(CHL)<br><br />
· Gel electrophoresis of digested product<br><br />
· Bacterial inoculation of BBa_J04450(CHL)<br><br />
· <br><br />
<br><b>June 20</b> <br><br />
· Amended primers of Pcombox sequences<br><br />
· Miniprep of BBa_J04450(CHL)<br><br />
· Digestion of BBa_J04450(CHL)<br><br />
· Gel electrophoresis of digested product<br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 4</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>June 23</b> <br><br />
Wet lab<br><br />
· Transformation of BBa_B0015 from iGEM Kit Plate 2011 and BBa_K880005<br><br />
· Primer design for PCR of comX-myc and comW-FLAG from genomic DNA of S. Pneumoniae NCTC 7465 strain<br><br />
· Designed plasmid construct for Pcombox<br><br />
· Bacterial inoculation of BBa_J04450(CHL)<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 24</b> <br><br />
Wet lab<br><br />
· Inoculation of BBa_B0015<br><br />
· Designed new reverse primer for 100bp, 150bp, 160bp, 180bp and 249bp Pcombox<br><br />
· Designed forward and reverse oligos of 67bp Pcombox<br><br />
· Transformation of pSB1C3-BBa_I13504<br><br />
· Miniprep of BBa_J04450(CHL)<br><br />
· Transformation of BBa_J04450(KAN)<br><br />
· Bacterial inoculation of BBa_E0240<br><br />
· <br><br />
<br><b>June 25</b> <br><br />
Wet lab<br><br />
· Digestion of BBa_B0015 plasmid extraction product with XbaI and PstI, gel extraction and gel purification<br><br />
· Inoculation of BBa_K880005<br><br />
· Inoculation of pSB1C3-BBa_E0240<br><br />
· Miniprep of BBa_E0240<br><br />
· Digestion of BBa_E0240<br><br />
· Transformation of BBa_J04450(KAN)<br><br />
· Bacterial inoculation of BBa_J04450(CHL)<br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 26</b> <br><br />
Wet lab<br><br />
· Digestion of BBa_K880005 plasmid extraction product with SpeI and PstI, gel extraction and gel purification<br><br />
· Digestion of pSB1C3-BBa_E0240 at XbaI and PstI<br><br />
· Gel electrophoresis of digested BBa_E0240<br><br />
· Gel extraction and purification of digested BBa_E0240 to obtain the insert<br><br />
· Miniprep of BBa_J04450(CHL)<br><br />
· Digestion of BBa_J04450(CHL)<br><br />
· Gel electrophoresis of digested BBa_J04450(CHL)<br><br />
· Gel extraction and purification of digested BBa_J04450(CHL) to obtain pSB1C3<br><br />
· Bacterial inoculation of BBa_K880005<br><br />
· <br><br />
<br><b>June 27</b> <br><br />
Wet lab<br><br />
· Ligation of BBa_B0015 insert cut with XbaI and PstI into pSB1C3-K880005 backbone cut with SpeI and PstI as negative control<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· Gel purification of pSB1C3-BBa_E0240<br><br />
· Miniprep of BBa_K880005<br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 5</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>June 30</b> <br><br />
Wet lab<br><br />
· Digestion of BBa_B0015 plasmid extraction product with XbaI and PstI, gel extraction and gel purification<br><br />
· Gel check of purified BBa_B0015 insert<br><br />
· Transformation of ligated pSB1C3-K880005.B0015<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y 2 0 1 3--------><br />
<!-- J J U U L Y 2 0 1 3--------><br />
<!-- J J U U L Y 2 0 1 3--------><br />
<!-- J J U U L Y 2 0 1 3--------><br />
<!-- JJJJJJJJJJJJ UUUUUUUUUUUU LLLLLLLLLLLL Y 2 0 1 3--------><br />
<br />
<br />
<br />
<div id="satu" align="center"> <h2><center>July 2014</center></h2><br />
<br />
<div><br />
<a href="#" class="head">Week 1</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 2</b> <br><br />
Wet lab<br><br />
· Arrival of primers order for comX-myc and comW-FLAG<br><br />
· Dilution of primers and design of experiment for both comX-myc and comW-FLAG<br><br />
· Inoculation of ligated pSB1C3-K880005.B0015<br><br />
· Inoculation of pSB3K3-BBa_J04450 and pSB1C3-BBa_E0240<br><br />
· Oligo annealing for PcomX<br><br />
· Bacterial inoculation of BBa_J04450 (KAN) (6 tubes), BBa_E0240 (CAM) (6 tubes), BBa_B0015 (KAN) (3 tubes)<br><br />
· <br><br />
<br />
<br> <b> July 3</b> <br><br />
Wet lab<br><br />
· PCR of comX-myc using Taq DNA Polymerase with ThermoPol Buffer to check whether primers are functional<br><br />
· Gel check for comX-myc PCR product<br><br />
· PCR of comX-myc using Phusion High-Fidelity PCR Master Mix with HF Buffer<br><br />
· Gel check for comX-myc PCR product<br><br />
· Restriction digestion check on some candidate colonies of ligated pSB1C3-K880005.B0015 with XbaI and PstI<br><br />
· Received and stored the new common reverse primers for Pcombox and sense oligo and anti-sense oligo of 67bp Pcombox<br><br />
· Digestion of pSB1C30-BBa_E0240 and pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· Gel purification of digested BBa_E0240 and BBa_J04450<br><br />
· Inoculation of pSB3K3-BBa_J04450<br><br />
· PcomX Transformation<br><br />
· PcomCDE Oligo annealing, ligation, transformation<br><br />
· J04450 Plasmid Extraction<br><br />
· E0240:Plasmid extraction ; Nanodrop; Digestion by XbaI and SpeI, CutSmart as Buffer (only do 3 tubes); Gel electrophoresis; Gel extraction ; Gel purification<br><br />
· B0015: Plasmid extraction ; Nanodrop<br><br />
· comED58E: PCR<br><br />
· <br><br />
<br />
<br> <b> July 4</b> <br><br />
Wet lab<br><br />
· PCR of comX-myc using Vent DNA Polymerase, PCR clean up<br><br />
· Digestion of pSB1C30-BBa_E0240 and pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· comED58E :Phusion PCR<br><br />
· E0240: Gel purification<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
</div><br />
</div><br />
<br />
<div><br />
<a href="#" class="head">Week 2</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 7</b> <br><br />
Wet lab<br><br />
· Digestion of comX-myc with XbaI and PstI<br><br />
· Gel check of digested comX-myc, digestion clean up<br><br />
· PCR of comW-FLAG using Vent DNA Polymerase<br><br />
· Gel check for comW-FLAG PCR product, PCR clean up<br><br />
· Dephosporylation of digested pSB1C3-K880005 backbone cut with SpeI and PstI<br><br />
· Gel purification of digested BBa_E0240 and BBa_J04450<br><br />
· Submitted primers for Gibson assembly of pSB3K3-100bpPcombox<br><br />
· Inoculation of pSB3K3-BBa_J04450<br><br />
· E0240 - Bacterial inoculation<br><br />
· pSB1C3-PcomX: Bacterial inoculation<br><br />
· pSB1C3- PcomCDE: Bacterial inoculation, Streaking<br><br />
· comED58E :PCR cleanup; Digestion with EcoRI and PstI; Ligation with pSB1C3; Transformation<br><br />
· <br><br />
<br />
<br> <b> July 8</b> <br><br />
Wet lab<br><br />
· Ligation of comX-myc cut with XbaI and PstI into pSB1C3-K880005 backbone cut with SpeI and PstI<br><br />
· 2nd attempt of ligation of BBa_B0015 insert cut with XbaI and PstI into dephosporylated pSB1C3-K880005 backbone cut with SpeI and PstI as negative control<br><br />
· Transformation of ligation products<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· Gel purification of digested BBa_J04450<br><br />
· Received pCEPcin from Universite de Toulouse, France<br><br />
· J04450 (KAN): Digestion by EcoRI and PstI; Gel electrophoresis; Gel extraction<br><br />
· E0240: Plasmid extraction<br><br />
· pSB1C3-PcomX: Plasmid extraction<br><br />
· pSB1C3- PcomCDE: Plasmid extraction<br><br />
· comED58E: Bacterial inoculation; Ligation (redo); Transformation (redo)<br><br />
· <br><br />
<br />
<br> <b> July 9</b> <br><br />
Wet lab<br><br />
· Inoculation of ligated pSB1C3-K880005.B0015 (2nd attempt) and ligated pSB1C3-K880005.comX-myc<br><br />
· Ethanol precipitation of pCEPcin<br><br />
· Gel purification of digested BBa_E0240<br><br />
· Gel check for BBa_E0240 insert and pSB3K3 backbone<br><br />
· PCR of 100bp Pcombox using Phusion polymerase<br><br />
· Inoculation of pCEPcin<br><br />
· E0240-PcomX & PcomCDE: Digestion w/ EcoRI and PstI; Gel electrophoresis<br><br />
· J04450 (KAN): Gel purification; NanoDrop (low conc)<br><br />
· comED58E:Plasmid extraction; NanoDrop; Gel electrophoresis (not comE); Bacterial inoculation (redo)July<br><br />
· <br><br />
· <br> <br />
· <br><br />
<br />
<br />
<br> <b> July 10</b> <br><br />
Wet lab<br><br />
· Another PCR of comW-FLAG using Vent DNA Polymerase<br><br />
· Gel check for comW-FLAG PCR product, PCR clean up<br><br />
· Restriction digestion check on some candidate colonies of ligated pSB1C3-K880005.B0015 (2nd attempt) and ligated pSB1C3-K880005.comX-myc<br><br />
· Gel check and insert wanted present in several candidate colonies of ligated pSB1C3-K880005.B0015 (2nd attempt), but no insert wanted present in any candidate colonies of ligated pSB1C3-K880005.comX-myc<br><br />
· Digestion of pCEPcin at EcoRI and SpeI, Xho and BamHI<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· PCR of 100bp Pcombox using Phusion polymerase<br><br />
· Ethanol precipitation of BBa_E0240 insert<br><br />
· Ligate E0240-PcomX & PcomCDE <br><br />
· Extract J04450 (KAN)<br><br />
· Restrict check & run mutagenesis comED58E<br><br />
· <br> <br />
· <br><br />
<br />
<br> <b> July 11</b> <br><br />
Wet lab<br><br />
· Digestion of comW-FLAG with XbaI and PstI, digestion clean up<br><br />
· Gel check for the PCR product obtained on July 10<br><br />
· Digestion of pCEPcin at NcoI and XhoI<br><br />
· Ethanol precipitation of pCEPcin<br><br />
· Extract J04450 (KAN)<br><br />
· Ligate pSB1C3 with comED58E <br><br />
· TransformPcomCDE<br><br />
· <br><br />
</div><br />
</div><br />
<br />
<div><br />
<a href="#" class="head">Week 3</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 14</b> <br><br />
Wet lab<br><br />
· Ligation of comW-FLAG cut on XbaI and PstI into dephosporylated pSB1C3-K880005 backbone cut on SpeI and PstI<br><br />
· Transformation of ligation products<br><br />
· Inoculation of ligated dephosporylated pSB1C3-K880005.comX-myc<br><br />
· Digestion of pCEPcin at NcoI and XhoI<br><br />
· PCR of 100bp Pcombox using Phusion polymerase<br><br />
· Gel purification of digested BBa_J04450<br><br />
· Inoculation of pCEPcin<br><br />
· PCR of comED58E with only 1 primer → check whether the primers are working or not<br><br />
· Ligation of pSB1C3-PcomX<br><br />
· Inoculation of pSB1C3-PcomCDE<br><br />
· Digest B0015 w/ NotI and SpeI stick ends<br><br />
· Digest comED58E w/ XbaI and NotI sticky ends:<br><br />
· <br><br />
<br />
<br> <b> July 15</b> <br><br />
Wet lab<br><br />
· Digestion check of ligated pSB1C3-K880005.comX-myc<br><br />
· Digestion of pSB1C3-K880005.comX-myc on SpeI and PstI, but no insert wanted present<br><br />
· PCR of comX using Vent DNA Polymerase, PCR clean-up<br><br />
· Colony PCR of pSB1C3-K880005.comX-myc using Taq DNA Polymerase<br><br />
· Gel check of pSB1C3-K880005.comX-myc PCR product (no PCR product present)<br><br />
· Inoculation of dephosporylated pSB1C3-K880005.comX-myc, dephosporylated pSB1C3-K880005.comW-FLAG<br><br />
· Ethanol precipitation of pCEPcin<br><br />
· Gel check of the PCR product obtained on July 14<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· PCR of 150bp, 160bp, 180bp, 249bp and 300bp Pcombox using Phusion polymerase<br><br />
· Plasmid extraction of pSB1C3-PcomCDE<br><br />
· Bacterial inoculation (5 for PcomCDE, 4 for PcomX)<br><br />
· Bacterial inoculation of B0015 (6 tubes)<br><br />
· Extract gel B0015 & comED58E<br><br />
· K880005 dephosphorylation; Digestion with SpeI<br><br />
· <br><br />
<br />
<br> <b> July 16</b> <br><br />
Wet lab<br><br />
· Digestion check of ligated pSB1C3-K880005.comW-FLAG<br><br />
· Colony PCR of pSB1C3-K880005.comW-FLAG<br><br />
· Gel check of pSB1C3-K880005.comW-FLAG PCR product (no PCR product present)<br><br />
· PCR of comW using Vent DNA Polymerase (no PCR product present)<br><br />
· Digestion of comX on XbaI and PstI<br><br />
· Gel check of the PCR product obtained on July 15<br><br />
· Gel purification of digested pSB3K3 backbone<br><br />
· Digestion of pCEPcin2 at XhoI and SalI<br><br />
· PCR of 150bp, 160bp, 180bp, 249bp and 300bp Pcombox using Phusion polymerase<br><br />
· Inoculation of pCEPcin2 and pSB3K3-BBa_I20260<br><br />
· Plasmid extraction of Promoters and B0015<br><br />
· Colony PCR<br><br />
· Extract gel B0015 & comED58E by XbaI (comE) and SpeI (B0015)<br><br />
· <br><br />
<br />
<br> <b> July 17</b> <br><br />
Wet lab<br><br />
· PCR of comX-myc and comX using Vent DNA Polymerase<br><br />
· Gel check of comX-myc and comX PCR product, PCR clean-up<br><br />
· PCR of comW using Vent DNA Polymerase<br><br />
· Gel extraction and gel purification of comW PCR product<br><br />
· Dephosporylation of BBa_K880005<br><br />
· Gel check of the PCR product obtained on July 16, all types of Pcombox shown positive result<br><br />
· PCR clean-up of Pcombox<br><br />
· PCR product ligation with pSB1C3<br><br />
· Bacterial inoculation of B0015, comED58E<br><br />
· Extract gel B0015 & comED58E - Digestion by XbaI (comED58E) and SpeI (B0015)<br><br />
· Overnight Ligation<br><br />
· <br><br />
<br> <b> July 18</b> <br><br />
Wet lab<br><br />
· PCR of comX using Vent DNA Polymerase<br><br />
· Gel check of comX PCR product, PCR clean-up<br><br />
· Digestion of comX PCR product on XbaI and PstI, digestion clean-up<br><br />
· Digestion of comX-myc and comW PCR products, digestion clean-up<br><br />
· Gel extraction and gel purification of digested comX and comX-myc<br><br />
· Digestion of pCEPcin2 (at XhoI and SalI) and pSB3K3-BBa_I20260 (at XbaI and PstI)<br><br />
· Digestion of pCEPcin2 (at BamHI and NcoI)<br><br />
· PCR of 100bp Pcombox using Phusion polymerase<br><br />
· Gel check of the purified Pcombox obtained July 17<br><br />
· Gel check of the 100bp Pcombox (PCR product)<br><br />
· Gel purification of digested pSB3K3 backbone<br><br />
· Ligation of comED58E<br><br />
· Gel extract comED58E<br><br />
· B0015 Gel purification<br><br />
· <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<br />
<div><br />
<a href="#" class="head">Week 4</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 21</b> <br><br />
Wet lab<br><br />
· Gel purification of comX and comX-myc<br><br />
· Ligation of comX-myc into dephosporylated pSB1C3-K880005 backbone with 1:4, 1:7, 1:10 ratio<br><br />
· Ligation of comW-FLAG into dephosporylated pSB1C3-K880005 backbone with 1:4, 1:7, 1:10 ratio<br><br />
· Ligation of comX into dephosporylated pSB1C3-K880005 backbone with 1:3 and 1:5 ratio<br><br />
· Ligation of comW into dephosporylated pSB1C3-K880005 backbone with 1:4, 1:7, 1:10 ratio<br><br />
· Colony PCR of pSB1C3-K880005.comW-FLAG using Taq DNA Polymerase<br><br />
· PCR of 100bp and 150bp Pcombox using Phusion polymerase<br><br />
· Gel purification of digested pSB3K3 backbone<br><br />
· Colony PCR of Promoters<br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br />
<br> <b> July 22</b> <br><br />
Wet lab<br><br />
· Colony PCR of comX, comW, comX-myc, comW-FLAG and use BBa_J04450 as the positive control using Taq DNA Polymerase (no PCR product present)<br><br />
· Inoculation of comX, comW, comX-myc, comW-FLAG<br><br />
· Gel check of the PCR product obtained on July 21<br><br />
· Oligo annealing of 67bp Pcombox<br><br />
· Digestion of pSB3K3-BBa_I20260 at XbaI and PstI<br><br />
· PCR of 100bp,150bp and 160bp Pcombox using Phusion polymerase<br><br />
· Gel electrophoresis of colony PCR results<br><br />
· Mutagenesis of comED58E<br><br />
· <br><br />
<br />
<br> <b> July 23</b> <br><br />
Wet lab<br><br />
· Digestion check of comX, comW, comX-myc, comW-FLAG colony PCR products on XbaI and SpeI<br><br />
· Inoculation of comW-FLAG<br><br />
· Gel check of PCR product obtained on July 22<br><br />
· Gel purification of digested pSB3K3 backbone<br><br />
· PCR of 100bp,150bp and 160bp Pcombox using Phusion polymerase<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· Gel purification of digested pSB3K3 backbone<br><br />
· Gel electrophoresis of colony PCR results<br><br />
· Mutagenesis of comED58E<br><br />
· <br><br />
· <br><br />
<br />
<br> <b> July 24</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG on XbaI and SpeI-HF<br><br />
· Ligation of comW-FLAG into dephosporylated pSB1C3-K880005 backbone<br><br />
· Ligation of comX-myc into dephosporylated pSB1C3-K880005 backbone<br><br />
· PCR of comX-myc and comX using Vent DNA Polymerase, gel extraction and gel purification<br><br />
· Digestion of comX-myc and comX on XbaI and PstI-HF<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· Gel Check of PCR product obtained on July 23<br><br />
· Received pCEPcin2<br><br />
· Gel electrophoresis of colony PCR and mutagenesis results<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br> <b> July 25</b> <br><br />
Wet lab<br><br />
· Colony PCR of comX-myc using Taq DNA Polymerase<br><br />
· Gel check of comX-myc PCR product (no PCR product present)<br><br />
· Gel purification of digested pSB3K3 backbone<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· Gel check on K880005<br><br />
· Transformation of ligated product (promoters+pSB1C3)<br><br />
· <br><br />
· <br><br />
· <br><br />
</div><br />
</div> <br />
<br />
<div><br />
<a href="#" class="head">Week 5</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 28</b> <br><br />
Wet lab<br><br />
· Colony PCR of comX-myc using Taq DNA Polymerase<br><br />
· Colony PCR of comw-FLAG using Taq DNA Polymerase<br><br />
· Inoculation of comX-myc and comW-FLAG<br><br />
· Digestion of pCEPcin2 at EcoRI and PstI, EcoRI and SpeI, NcoI and XhoI<br><br />
· Colony PCR of promoters-pSB1C3<br><br />
· Bacterial inoculation of K880005, comED58E <br><br />
· <br><br />
· <br><br />
<br />
<br> <b> July 29</b> <br><br />
Wet lab<br><br />
· Digestion check of comX-myc and comW-FLAG on XbaI and PstI-HF<br><br />
· Transformation of comX-myc and comW-FLAG<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· Digestion of pCEPcin2 at EcoRI and PstI<br><br />
· Inoculation of pSB3K3-BBa_J04450<br><br />
· PCR of 100bp,150bp and 160bp Pcombox using Vent polymerase<br><br />
· Restrict check K880005 <br><br />
· Promoters colony PCR <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br> <b> July 30</b> <br><br />
Wet lab<br><br />
· Digestion check of comX-myc and comW-FLAG<br><br />
· Inoculation of comX-myc and comW-FLAG <br><br />
· Streaking plates of comX-myc and comW-FLAG<br><br />
· PCR clean-up of 100bp,150bp and 160bp Pcombox<br><br />
· Digestion of pCEPcin2 at EcoRI and PstI<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· Restrict check K880005 <br><br />
<br> <b> July 31</b> <br><br />
Wet lab<br><br />
· Digestion check of comX-myc and comW-FLAG on XbaI and PstI-HF<br><br />
· Redigest comW-FLAG on XmnI and NcoI<br><br />
· PCR sequencing for comW and comX<br><br />
· Ethanol precipitation for comW and comX<br><br />
· Digestion of pSB3K3-BBa_J04450 at XbaI and PstI<br><br />
· K880005 dephosphorylation & ligation<br><br />
· Promoters Colony PCR + Sequencing reaction <br><br />
<br />
</div><br />
</div><br />
</div><br />
<!------ AAAAAAAAAAAA U U GGGGGGGGGGGG U U SSSSSSSSSSSSS TTTTTTTTTTTTTT 2 0 1 3----------------><br />
<!------ A A U U G U U S T 2 0 1 3----------------><br />
<!------ A A U U G U U S T 2 0 1 3----------------><br />
<!------ A A U U G U U S T 2 0 1 3----------------><br />
<!------ A A U U G U U S T 2 0 1 3----------------><br />
<!------ AAAAAAAAAAAA U U G U U SSSSSSSSSSSSS T 2 0 1 3----------------><br />
<!------ A A U U G GGGGGGG U U S T 2 0 1 3----------------><br />
<!------ A A U U G G G U U S T 2 0 1 3----------------><br />
<!------ A A U U G G G U U S T 2 0 1 3----------------><br />
<!------ A A U U G G U U S T 2 0 1 3----------------><br />
<!------ A A UUUUUUUUUUU GGGGGGGGGGGG UUUUUUUUUUUUU SSSSSSSSSSSSS T 2 0 1 3----------------><br />
<br />
<br />
<div id="satu" align="center"> <h2>August 2014</h2><br />
<div><br />
<a href="#" class="head">Week 1</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 1</b> <br><br />
Wet lab<br><br />
· Digestion of pSB1C3-BBa_J04450<br><br />
· Restrict check Promoters & Sequencing reaction<br><br />
· Transform K880005<br><br />
· <br><br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 2</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 4</b> <br><br />
Wet lab<br><br />
· Digestion of comX-myc on EcoRI-HF and SpeI, gel extraction and gel purification<br><br />
· Ligation of BBa_B0015 cut on XbaI and PstI into pSB1C3-comX-myc backbone cut on SpeI and PstI<br><br />
· Transformation of pSB1C3-comX-myc.B0015 ligation product<br><br />
· Ligation of comX-myc cut on EcoRI-HF and SpeI into pSB1C3-B0015 backbone cut on EcoRI-HF and XbaI<br><br />
· Transformation of pSB1C3-B0015.comX-myc ligation product<br><br />
· Sequencing of comX-myc and comW-FLAG<br><br />
· Inoculation of comX-myc<br><br />
· Digestion of 100bp, 150bp, 160bp and 180bp Pcombox at XbaI and PstI<br><br />
· Ligation of 100bp and 160bp Pcombox with pSB1C3<br><br />
· Digestion of pCEPcin2 at EcoRI and PstI<br><br />
· PcomCDE Precipitation<br><br />
· PcomX Sequencing reaction & precipitation<br><br />
· Transform comED58E <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br><b>Aug 5</b> <br><br />
Wet lab<br><br />
· Sequencing result failed<br><br />
· Transformation of pSB1C3-B0015.comX-myc ligation product failed<br><br />
· Digestion check of comX-myc on StyI<br><br />
· Colony PCR of comX-myc<br><br />
· Inoculation of comX-myc<br><br />
· Digestion of pSB1C3-BBa_J04450 at XbaI and PstI<br><br />
· Ligation of 150bp, 180bp and 249bp Pcombox with pSB1C3<br><br />
· Transformation of pSB1C3-150bp Pcombox , pSB1C3-180bp Pcombox and pSB1C3-249bp Pcombox<br><br />
· Gel purification of digested pSB1C3 backbone<br><br />
· Inoculation of pCEPcin2<br><br />
· Send to sequencing: PcomCDE and PcomX<br><br />
· Bacterial inoculation of comED58E <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br><b>Aug 6</b> <br><br />
Wet lab<br><br />
· Digestion check of comX-myc on XbaI and PstI<br><br />
· Gel check of comX-myc PCR product (no PCR product present)<br><br />
· Sequencing of comW-FLAG using VF2 and VR<br><br />
· Digestion of comX-myc on StyI<br><br />
· Digestion of pCEPcin2 at EcoRI and EcoRV, EcoRI and PstI, EcoRI and SpeI, XhoI and NcoI<br><br />
· Gel purification of digested pSB1C3 backbone<br><br />
· Digestion of pSB1C3-BBa_J04450 at XbaI and PstI<br><br />
· Phosphorylation of 67bp Pcombox oligos<br><br />
· Oligo annealing for 67bp Pcombox<br><br />
· <br><br />
· Align sequence with expected: PcomCDE and Pcom<br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br><b>Aug 7</b> <br><br />
Wet lab<br><br />
· Digestion of comX-myc on StyI<br><br />
· Digestion check of comX on SphI and NcoI<br><br />
· Digestion check of comW on XmnI and NcoI<br><br />
· Digestion of pSB1C3-BBa_J04450 at XbaI and PstI<br><br />
· Colony PCR of 100bp, 150bp, 160bp, 180bp and 249bp Pcombox<br><br />
· Gel purification of digested pSB1C3 backbone<br><br />
· Precipitate after sequencing reaction PcomCDE<br><br />
· Make glycerol stock for PcomX<br><br />
· Run colony PCR for comED58E<br><br />
· <br><br />
<br><b>Aug 8</b> <br><br />
Wet lab<br><br />
· Digestion of comW-FLAG on EcoRI-HF and SpeI, gel extraction and gel purification<br><br />
· Digestion of comW-FLAG on SpeI and PstI-HF, digestion clean-up<br><br />
· Sequencing of comX-myc succeeded but mutation at EcoRI site<br><br />
· Digestion check of comX-myc at EcoRI-HF and PstI-HF<br><br />
· Ligation of comX and comW into dephosporylated pSB1C3-K880005<br><br />
· Transformation of comX and comW ligation product<br><br />
· Digestion of comX-myc at EcoRI-HF and SpeI-HF<br><br />
· Digestion of pCEPcin2 at EcoRI and EcoRV, XhoI and NcoI<br><br />
· Ligation of 67bp, 100bp, 150bp, 160bp, 180bp, 249bp and 300bp Pcombox with pSB1C3 backbone<br><br />
· Ligate with E0240 PcomX <br><br />
· Colony PCR for comE mutant<br><br />
· Check sequence PcomCDE<br><br />
· <br><br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 3</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 11</b> <br><br />
Wet lab<br><br />
· Digestion check of comX-myc and comW-FLAG on XbaI and PstI-HF<br><br />
· Gel purification of comX-myc digested on EcoRI-HF and SpeI<br><br />
· Ligation of comX-myc cut on EcoRI-HF and SpeI into pSB1C3-B0015 cut on EcoRI-HF and XbaI<br><br />
· Restriction check of pSB1C3-Pcombox (100bp, 180bp and 249bp) at XbaI and PstI<br><br />
· Colony PCR of pSB1C3-Pcombox (67bp, 100bp, 150bp, 160bp, 180bp, 249bp and 300bp)<br><br />
· Gel purification of digested pSB1C3 backbone<br><br />
· Digestion of pSB1C3-BBa_J04450 at XbaI and PstI<br><br />
· Extract pSB1C3 from J04450<br><br />
· Redo ligation part 1<br><br />
· Gibson assembly of comED58E<br><br />
· <br><br />
<br><b>Aug 12</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comX and pSB1C3-K880005.comW-FLAG on XbaI and PstI-HF<br><br />
· Dilution of comW-FLAG<br><br />
· Re-digestion of BBa_B0015 on EcoRI-HF and XbaI, digestion clean-up<br><br />
· Re-ligation of pSB1C3-B0015.comX-myc<br><br />
· Transformation of pSB1C3-B0015.comX-myc ligation product<br><br />
· Inoculation of pSB1C3-K880005.comX-myc.B0015 and pSB1C3-K880005.comX-myc<br><br />
· Digestion of pCEPcin2 at EcoRI and EcoRV<br><br />
· Restriction check of pSB1C3-Pcombox (100bp, 150bp, 160bp, 180bp and 249bp) at XmnI, NcoI and SpeI<br><br />
· Ligate K880005 and comE(D58E)<br><br />
· Inoculate for glycerol stock (PcomX)<br><br />
· <br><br />
<br><b>Aug 13</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-B0015.comX-myc and pSB1C3-K880005.comX-myc.B0015 on XbaI and PstI-HF<br><br />
· Inoculation of pSB1C3-Pcombox (100bp, 150bp, 160bp, 180bp and 249bp)<br><br />
· Restriction check of pSB1C3-Pcombox (100bp, 150bp, 160bp, 180bp and 249bp) at XmnI, NcoI and SpeI<br><br />
· Colony PCR of pSB1C3-Pcombox (67bp, 100bp, 150bp, 160bp, 180bp and 249bp)<br><br />
· Check new dNTP<br><br />
· Restrict check of ligation product part 1<br><br />
· Colony PCR for checking part 2 ligation product and gibson assembly<br><br />
· Inoculation of PcomX for glycerol stock<br><br />
· <br><br />
· <br><br />
<br><b>Aug 14</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comX-myc.B0015 on XbaI and PstI-HF<br><br />
· Transformation of ligated product pSB1C3-K880005.comX-myc.B0015<br><br />
· Dilution of comW-FLAG<br><br />
· Digestion of comW-FLAG on EcoRI-HF and SpeI-HF<br><br />
· Ligation of comW-FLAG into pSB1C3-B0015 backbone<br><br />
· Re-digestion of comW-FLAG on EcoRI-HF and SpeI-HF<br><br />
· Gel check of the digested pSB1C3-Pcombox (100bp, 150bp, 160bp, 180bp and 249bp) obtained on July 13<br><br />
· Colony PCR of Colony PCR of pSB1C3-Pcombox (67bp, 100bp, 150bp, 160bp, 180bp and 249bp)<br><br />
· glycerol stock for PcomX<br><br />
· colony PCR ligation product part 1<br><br />
· colony PCR gibson assembly<br><br />
· Run gel for PCR products<br><br />
· Inoculation of comED58E<br><br />
· <br><br />
<br><b>Aug 15</b> <br><br />
Wet lab<br><br />
· Digestion of pSB1C3-K880005 on SpeI-HF and PstI-HF, digestion clean-up<br><br />
· Colony PCR of comW-FLAG using Taq DNA Polymerase<br><br />
· Digestion of pSB1C3-B0015 on EcoRI-HF and XbaI<br><br />
· Digestion of pSB1C3-K880005.comX-myc on EcoRI-HF and SpeI-HF<br><br />
· Digestion of pSB1C3-B0015 on EcoRI-HF and XbaI, digestion clean-up<br><br />
· Digestion of pSB1C3-K880005.comX-myc on EcoRI-HF and SpeI-HF, gel extraction and gel purification<br><br />
· Overnight ligation of BBa_B0015 into pSB1C3-K880005.comX-myc backbone at 16°C<br><br />
· Transformation of pSB1C3-K880005.comX-myc.B0015 ligation product<br><br />
· Ligation of comX-myc into pSB1C3-B0015 backbone<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG and pSB1C3-K880005.comX-myc.B0015<br><br />
· Preparation for submittion of samples to be sequenced<br><br />
· Inoculation of pSB1C3-Pcombox (100bp, 150bp, 160bp, 180bp and 249bp)<br><br />
· colony PCR for ligation product part 1<br><br />
· colony PCR for ligation product part 2<br><br />
· colony PCR for gibson assembly<br><br />
· Run gel for PCR products<br><br />
· comE-D58E plasmid extraction<br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 4</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 18</b> <br><br />
Wet lab<br><br />
· Transformation of ligated pSB1C3-K880005.comX-myc<br><br />
· Ligation of comW-FLAG into pSB1C3-K880005 backbone, comX-myc into pSB1C3-K880005 backbone, BBa_B0015 into pSB1C3-K880005.comX-myc backbone<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG on EcoRI-HF and SpeI-HF<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG on SpeI-HF and PstI-HF<br><br />
· Digestion of pSB1C3-K880005.comX-myc on EcoRI-HF and SpeI-HF, gel extraction and gel purification<br><br />
· Inoculation of pSB1C3-K880005.comX-myc and pSB1C3-B0015<br><br />
· Digestion of pSB1C3-K880005.comX-myc on SpeI-HF and PstI-HF, digestion clean-up<br><br />
· Digestion check of pSB1C3-K880005.comX-myc.B0015 on XbaI and PstI-HF<br><br />
· Digestion of pSB1C3-K880005 on SpeI-HF and PstI-HF, digestion clean-up<br><br />
· Sent out pSB1C3-Pcombox (100bp, 150bp and 180bp) samples for commercial sequencing<br><br />
· Digestion of pSB1C3-Pcombox (100bp, 150bp, 160bp, 180bp and 249bp) at SpeI and PstI<br><br />
· Gel purification of digested pSB1C3-Pcombox (150bp, 160bp, 180bp and 249bp)<br><br />
· Inoculation of pSB1C3-BBa_E0240<br><br />
· Gel extraction and purification of E0240<br><br />
· Bacterial inoculation of PcomX (PcomCDE(3))<br><br />
· Gel extraction and purification of comE mutant<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>Aug 19</b> <br><br />
Wet lab<br><br />
· Digestion of pSB1C3-B0015 on EcoRI-HF and XbaI, digestion clean-up<br><br />
· Digestion check of comX-myc on XbaI and PstI-HF<br><br />
· Ligation of pSB1C3-K880005.comX-myc cut on EcoRI-HF and SpeI-HF iinto pSB1C3-B0015 backbone cut on EcoRI-HF and XbaI<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG and pSB1C3-K880005.comX-myc.B0015<br><br />
· Gel purification of digested pSB1C3-Pcombox (100bp)<br><br />
· Ligation of pSB1C3-Pcombox (100bp, 150bp, 160bp, 180bp and 249bp) with BBa_E0240 insert<br><br />
· Transformation of pSB1C3-Pcombox-BBa_E0240 (160bp and 249bp)<br><br />
· Digestion of pSB1C3-BBa_E0240 at XbaI and PstI<br><br />
· Gel purification of E0240 insert<br><br />
· Digest PcomX(PcomCDE(3))-pSB1C3 w/ SpeI and PstI<br><br />
· Make aliquotes for oligo - PcomCDE<br><br />
· PcomCDE Oligo annealing<br><br />
· Ligation of comE mutant insert with K880005<br><br />
· Ligation of comE insert with K880005<br><br />
· Gel electrophoresis of Gibson assembly mastermix checking<br><br />
· Plasmid extraction of J04450(CHL), PcomX(PcomCDE(3)) <br><br />
· Bacterial inoculation of comE WT, J04450 (CHL)<br><br />
· <br><br />
<br><b>Aug 20</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG on EcoRI-HF and SpeI-HF, gel extraction and gel purification<br><br />
· Digestion check of pSB1C3-K880005.comX-myc.B0015 on XbaI and PstI-HF<br><br />
· Digestion check of pSB1C3-K880005.comX-myc.B0015 on SphI and SpeI-HF<br><br />
· Digestion check of pSB1C3-K880005.comX-myc on XbaI and PstI<br><br />
· Inoculation of pSB1C3-K880005.comX-myc.B0015 and pSB1C3-K880005.comW-FLAG<br><br />
· Gel purification of digested pSB1C3-BBa_E0240<br><br />
· Digestion of pSB1C3-180bp Pcombox at SpeI and PstI<br><br />
· Digestion clean-up of pSB1C3-180bp Pcombox<br><br />
· Ligation of pSB1C3-180bp Pcombox with BBa_E0240 insert<br><br />
· Transformation of pSB1C3-Pcombox-BBa_E0240 (100bp, 150bp and 180bp)<br><br />
· Colony PCR for ligated pSB1C3-Pcombox-BBa_E0240 (160bp and 249bp)<br><br />
· Inoculation of pSB1C3-Pcombox-BBa_E0240 (160bp and 249bp)<br><br />
· Ligation of E0240 insert with PcomX<br><br />
· Transformation [E0240-PcomCDE exp+ -ve, pSB1C3-PcomCDE exp+ -ve]<br><br />
· Ligation of comED58E insert with K880005<br><br />
· Gel extract comE WT<br><br />
· PCR check for comED58E-myc<br><br />
· Digest J04450(CHL) w/ EcoRI, SpeI, Gel extraction<br><br />
· Plasmid extraction of comE WT, J04450 (CHL)<br><br />
· <br><br />
<br><b>Aug 21</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG on EcoRI-HF and SpeI-HF<br><br />
· Digestion check of pSB1C3-K880005.comX-myc.B0015 on XbaI and PstI-HF<br><br />
· Ligation of pSB1C3-K880005.comW-FLAG cut on EcoRI-HF and SpeI-HF into pSB1C3-B0015 backbone cut on EcoRI-HF and XbaI<br><br />
· Colony PCR of pSB1C3-B0015 and reverse comX-myc using Taq DNA Polymerase<br><br />
· Digestion of comW-FLAG on NotI-HF<br><br />
· Digestion of comW-FLAG on EcoRI-HF and SpeI-HF<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG<br><br />
· Transformation pSB1C3-K880005.comW-FLAG ligation product and pSB1C3-K880005.comX-myc.B0015<br><br />
· Restriction check of pSB1C3-Pcombox-BBa_E0240 (160bp and 249bp) at NcoI<br><br />
· Colony PCR for ligated pSB1C3-Pcombox-BBa_E0240 (100bp, 150bp and 180bp)<br><br />
· Inoculation of pSB1C3-Pcombox-BBa_E0240 (100bp, 150bp and 180bp)<br><br />
· Received sequencing result of pSB1C3-Pcombox (100bp, 150bp and 180bp)<br><br />
· Ligate PcomX with E0240 insert<br><br />
· PCR, Restrict check Part I (PcomCDE)<br><br />
· O/N Ligation w/ PcomCDE<br><br />
· Extract comE WT-pSB1C3<br><br />
· PCR and restrict check comED58E-myc<br><br />
· Glycerol stock for PcomX <br><br />
· <br><br />
<br><b>Aug 22</b> <br><br />
Wet lab<br><br />
· Digestion check of comW-FLAG on EcoRI-HF and SpeI-HF<br><br />
· Digestion of pSB1C3-K880005.comX-myc.B0015 on EcoRI-HF and SpeI-HF<br><br />
· Inoculation pSB1C3-K880005.comX-myc.B0015<br><br />
· Restriction check of pSB1C3-Pcombox-BBa_E0240 (100bp, 150bp and 180bp) at NcoI and XmnI<br><br />
· PCR of pSB1C3-Pcombox-BBa_E0240 (160bp and 249bp) using Vent polymerase <br><br />
· Sent out pSB1C3-Pcombox-BBa_E0240 (160bp and 249bp) for commercial sequencing<br><br />
· Transformation of newly ligated (E0240)<br><br />
· Bacterial inoculation of checked colony (E0240)<br><br />
· O/N ligation w/ pSB1C3<br><br />
· Ligation comE WT-pSB1C3<br><br />
· Ligate comED58E-myc w/ K880005<br><br />
· <br><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 5</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 25</b> <br><br />
Wet lab<br><br />
· Ligation of pSB1C3-K880005.comW-FLAG cut on EcoRI-HF and SpeI-HF into pSB1C3-B0015 backbone cut on EcoRI-HF and XbaI<br />
Digestion check of pSB1C3-K880005.comX-myc.B0015 on XbaI and PstI-HF<br />
Transformation of pSB1C3-K880005.comW-FLAG<br />
Digestion of pSB1C3-K880005.comX-myc.B0015 on SpeI-HF and PstI-HF, gel extraction and gel purification<br />
Inoculation of pSB1C3-K880005.comX-myc.B0015 for glycerol stock<br><br />
· Received sequencing result of pSB1C3-Pcombox (160bp and 249bp)<br><br />
· Restriction check of pSB1C3-Pcombox-BBa_E0240 (100bp, 150bp and 180bp) at NcoI and XmnI<br><br />
· Digestion of pSB1C3-Pcombox (100bp, 150bp and 160bp, 180bp and 249bp) at XbaI and PstI<br><br />
· Gel purification of digested Pcombox-BBa_E0240 (100bp, 150bp and 180bp) insert<br><br />
· Ligation of PcomX-E0240<br><br />
· Digestion of PcomCDE-E0240<br><br />
· Colony PCR pSB1C3-PcomCDE, K880005-comE WT, K880005-comED58E-myc<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>Aug 26</b> <br><br />
Wet lab<br><br />
· Digestion of pSB1C3-K880005.comX-myc.B0015 on SpeI-HF and PstI-HF, digestion clean-up<br><br />
· Ligation of Combox + GFP cut on XbaI and PstI-HF into pSB1C3-K880005.comX-myc.B0015 backbone cut on SpeI-HF and PstI-HF<br><br />
· Digestion of BBa_E0240 100 bp on XbaI and PstI-HF, gel extraction and gel purification<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG.B0015<br><br />
· Transformation of pSB1C3-K880005.comW-FLAG<br><br />
· Ligation of comX, 100bp Pcombox-BBa_E0240 and pSB3K3 backbone<br><br />
· Gel pSB1C3-PcomCDE<br><br />
· PcomX-E0240 Colony PCR check<br><br />
· PcomCDE glycerol stock <br><br />
· Restrict check K880005-comE WT<br><br />
· Ligation w/ comE WT<br><br />
· Restrict check K880005-comED58E-myc<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>Aug 27</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG on XbaI and PstI-HF, gel extraction and gel purification<br><br />
· Sequencing of pSB1C3-K880005.comW-FLAG.B0015<br><br />
· Ligation of pSB1C3-K880005.comW-FLAG into pSB1C3-B0015 backbone and Combox + GFP into pSB1C3-K880005.comX-myc.B0015 backbone <br><br />
· Transformation of pSB1C3-K880005.comW-FLAG<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG.B0015 and pSB1C3-K880005.comW-FLAG<br><br />
· Colony PCR of pSB1C3-Pcombox-BBa_E0240 (180bp and 249bp)<br><br />
· Ligation of comX, 100bp Pcombox-BBa_E0240 and pSB3K3 backbone<br><br />
· Inoculation of pSB1C3-Pcombox-BBa_E0240 (100bp, 180bp and 249bp), pSB1C3-Pcombox (160bp)<br><br />
· pSB1C3-PcomCDE<br><br />
· PcomCDE sequencing <br><br />
· PCR check K880005-comE WT<br><br />
· PCR check K880005-comED58E-myc<br><br />
· Ligate K880005-comE-myc<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>Aug 28</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG.B0015 on XbaI and PstI-HF, gel extraction and gel purification<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG on EcoRI-HF and SpeI-HF, gel extraction and gel purification<br><br />
· Ligation of Combox + GFP into pSB1C3-K880005.comX-myc.B0015 backbone<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG.B0015 and pSB1C3-K880005.comW-FLAG<br><br />
· Ligation of pSB1C3-K880005.comW-FLAG into pSB1C3-B0015 backbone<br><br />
· Restriction check of pSB1C3-Pcombox-BBa_E0240 (180bp and 249bp)<br><br />
· Colony PCR of pSB3K3-comX-100bp Pcombox-BBa_E0240<br><br />
· pSB1C3-PcomCDE overnight ligation<br><br />
· PcomX-E0240 ligation<br><br />
· Gel extract I20260 and E0240<br><br />
· Glycerol stock for K880005-comE WT<br><br />
· Colony PCR for K880005-comED58E-myc <br><br />
· Ligate K880005-comE-myc <br><br />
· PCR comED58E-myc<br><br />
· Ligation of Part 1 and Part 2<br><br />
<br />
· <br><br />
<br><b>Aug 29</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG.B0015 on XbaI and PstI-HF<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG on EcoRI-HF and SpeI-HF<br><br />
· Sent out pSB1C3-160bp Pcombox for commercial sequencing<br><br />
· Digestion of pSB1C3-160bp Pcombox at SpeI and PstI<br><br />
· Colony PCR for pSB3K3-comX-100bp Pcombox-BBa_E0240<br><br />
· Ligation of pSB1C3-160bp Pcombox with BBa_E0240 insert<br><br />
· Transform pSB1C3-PcomCDE <br><br />
· Transform PcomX-E0240 <br><br />
· Ligate I20260 and E0240 <br><br />
· Ligate K880005-comE WT <br><br />
· Ligate K880005-comE-myc<br><br />
· Ligate K880005-comED58E-myc <br><br />
· Gel check comED58E-myc <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<!---- SSSSSSSS EEEEEEEE PPPPPPPP TTTTTTTTTTTT EEEEEEEE M M BBBBBBBB EEEEEEEEE RRRRRRRR 2 0 1 3--------><br />
<!---- S E P P T E MM MM B B E R R 2 0 1 3--------><br />
<!---- S E P P T E M M M M B B E R R 2 0 1 3--------><br />
<!---- S E P P T E M M M M B B E R R 2 0 1 3--------><br />
<!---- S E P P T E M M M M B B E R R 2 0 1 3--------><br />
<!---- SSSSSSSS EEEEEEEE PPPPPPPP T EEEEEEEE M M M BBBBBBBB EEEEEEEEE RRRRRRRR 2 0 1 3--------><br />
<!---- S E P T E M M B B E R R 2 0 1 3--------><br />
<!---- S E P T E M M B B E R R 2 0 1 3--------><br />
<!---- S E P T E M M B B E R R 2 0 1 3--------><br />
<!---- S E p T E M M B B E R R 2 0 1 3--------><br />
<!---- SSSSSSSS EEEEEEEE P T EEEEEEEE M M BBBBBBBB EEEEEEEEE R R 2 0 1 3--------><br />
<br />
<div id="satu" align="center"> <h2>September 2014</h2><br />
<br />
<div><br />
<a href="#" class="head">Week 1</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 1</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG.B0015 on XbaI and PstI-HF<br><br />
· Digestion check of pSB1C3-K880005.comX-myc.B0015.Combox.GFP on XmnI<br><br />
· Inoculation of pSB1C3-K880005.comX-myc.B0015.Combox.GFP<br><br />
· Received the sequencing result of pSB1C3-160bp Pcombox<br><br />
· Colony PCR: pSB1C3-PcomCDE, PcomX-E0240, I20260+Part2, E0240+Part2, E0240+Part2, K880005-comE WT, K990005-comE-myc, K990005-comEd58E-myc<br><br />
· <br><br />
<br />
<br><b>Sept 2</b> <br><br />
Wet lab<br><br />
· Ligation of pSB1C3-K880005.comX-myc.B0015.Combox.GFP cut on EcoRI-HF and PstI-HF into pSB3K3 cut on EcoRI-HF and PstI-HF<br><br />
· Re-digestion of pSB1C3-K880005.comX-myc.B0015.Combox.GFP on EcoRI-HF and PstI-HF, gel extraction and gel purification<br><br />
· Restriction check of pSB1C3-160bp Pcombox-BBa_E0240 at XmnI and NcoI<br><br />
· Whole construct gel check <br><br />
· Restrict check PcomX-E0240<br><br />
· Restrict check Part 1 + Part 2<br><br />
· Restrict check I20260 and E0240 <br><br />
· Restrict check K880005-comE WT<br><br />
· Restrict check K880005-comE-myc<br><br />
· Restrict check K880005-comED58E-myc (XbaI & PstI)<br><br />
· <br><br />
<br />
<br><b>Sept 3</b> <br><br />
Wet lab<br><br />
· Streak plate for pSB1C3-K880005.comX-myc.B0015.Combox.GFP<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG.B0015<br><br />
· Restriction check of pSB1C3-160bp Pcombox-BBa_E0240 at NcoI and NotI<br><br />
· Restrict check I20260-Part 2 (3 tubes) (XbaI & PstI)<br><br />
· Restrict check E0240-Part 2 (2 tubes)<br><br />
· Restrict check Whole construct (1 tubes)<br><br />
· Restrict check -ve of whole construct ligation (5 tubes) <br><br />
· Restrict check pSB1C3-PcomCDE (3 tubes) (NcoI & PstI)<br><br />
· <br><br />
<br />
<br><b>Sept 4</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG on XbaI and PstI-HF, gel extraction and gel purification<br><br />
· Restriction of Combox + GFP on EcoRI-HF and PstI-HF, gel extraction and gel purification<br><br />
· Ligation of Combox + GFP into pSB3K3 backbone cut on EcoRI-HF and PstI-HF<br><br />
· Transformation of pSB3K3-Combox.GFP ligation product<br><br />
· Digestion of pSB1C3-160bp Pcombox-BBa_E0240 at XbaI and PstI<br><br />
· Ligation of 160bp Pcombox-BBa_E0240,comX and pSB3K3<br><br />
· Restrict check I20260-Part 2, E0240-Part 2, I20260-Part 2, whole construct, -ve of whole construct ligation XP<br><br />
· Restrict check PcomCDE-E0240<br><br />
· Restrict check I20260, E0240, Whole construct 3, 4,5 NcoI lambda ladder<br><br />
· Restrict check and colony PCR for pSB1C3-PcomCDE NcoI<br><br />
· Restrict check K880005+comED58E-N-myc<br><br />
· Restrict check K880005+comE-C-myc<br><br />
· <br><br />
<br />
<br><b>Sept 5</b> <br><br />
Wet lab<br><br />
· Inoculation of pSB3K3-Combox.GFP<br><br />
· Sequencing for pSB1C3-PcomCDE<br><br />
· <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 2</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 8</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB3K3-Combox.GFP on XmnI<br><br />
· Restrict check and plasmid PCR for PcomCDE-E0240<br><br />
· Obtain sequencing results for PcomCDE-pSB1C3<br><br />
· Whole construct (PcomX)<br><br />
· K880005-comE/comED58E-myc digest w/ EcoRI and XbaI<br><br />
· Ligation of Part 1 and 2 (also I20260, E0240) (1200)<br><br />
· Transformation (1400)<br><br />
<br />
· <br><br />
<br />
<br />
<br><b>Sept 9</b> <br><br />
Wet lab<br><br />
· <br><br />
<br />
<br><b>Sept 10</b> <br><br />
Wet lab<br><br />
· Streak plate for pSB3K3-Combox.GFP<br><br />
· Restrict check PcomCDE-E0240<br><br />
· Obtain sequencing results for PcomCDE-pSB1C3<br><br />
· Whole construct (PcomX)<br><br />
· K880005-comE/comED58E-myc send to sequencing<br><br />
· Ligation and transformation of Part 1 and 2 (also I20260, E0240)<br><br />
· <br><br />
<br />
<br><b>Sept 11</b> <br><br />
Wet lab<br><br />
· Restriction check of pSB3K3-comX-160bp Pcombox-BBa_E0240 at EcoRI and PstI<br><br />
· Obtain sequencing results PcomCDE-pSB1C3<br><br />
· Gel electrophoresis of colony PCR product from 10/9 PcomCDE-E0240<br><br />
· Bacterial inoculation of checked products (for sequencing) and streak plates<br><br />
· Check colony fluorescene for whole construct (PcomX)<br><br />
· Gel extraction and purification of E0240 and I20260<br><br />
· Gel extraction and purification of PcomCDE-E0240 (EcoRI and SpeI)<br><br />
· Streak plate for K880005-comE-C-myc<br><br />
<br />
· <br><br />
<br />
<br><b>Sept 12</b> <br><br />
Wet lab<br><br />
· Restriction check of pSB3K3-160bp Pcombox-BBa_E0240 at EcoRI and PstI<br><br />
· Transformation of pSB3K3-160bp Pcombox-BBa_E0240<br><br />
· Make glycerol stock for PcomCDE-pSB1C3<br><br />
· Gel electrophoresis of colony PCR product of PcomCDE-E0240 from 10/9; Bacterial inoculation of checked products (for sequencing); Streak plate<br><br />
· Check colony and fluorescence for whole construct (PcomX)<br><br />
· Streak plate for K880005-comE-C-myc<br><br />
· <br><br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 3</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 15</b> <br><br />
Wet lab<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG<br><br />
· PCR check and inoculation of colonies of I20260/E0240-K880005-comE-C-myc, I20260/E0240-K880005-comED58E-N-myc<br><br />
· Restrict check, Gel extraction and Gel purification of pSB3K3 J04450 (CHL)<br><br />
· <br><br />
<br />
<br />
<br><b>Sept 16</b> <br><br />
Wet lab<br><br />
· Digestion of pSB1C3-K880005.comW-FLAG on EcoRI-HF and SpeI<br><br />
· <br><br />
<br />
<br><b>Sept 17</b> <br><br />
Wet lab<br><br />
· Digestion of pSB1C3-K880005.comW-FLAG on XbaI and PstI<br><br />
· Ligation of pSB1C3-K880005.comW-FLAG cut on EcoRI-HF and SpeI into pSB1C3-B0015 cut on EcoRI-HF and XbaI<br><br />
· Digestion check of pSB1C3-K880005.comX-myc.B0015 on XbaI and PstI<br><br />
· Digestion check of pSB1C3-K880005.comX-myc.B0015.Combox on XmnI<br><br />
· Digestion check of Combox + GFP on XmnI and PstI<br><br />
· Restriction check of pSB3K3-160bp Pcombox-BBa_E0240 at NotI and PstI<br><br />
· PCR check and inoculation for I20260/E0240-K880005-comE-C-myc, I20260/E0240-K880005-comED58E-N-myc<br><br />
· Restrict check pSB3K3 (already in stock)<br><br />
· Gel extraction and Gel purification of J04450 (CHL) insert X,S<br><br />
· Sequencing reaction for K880005-comED58E-N-myc, K880005-comE-C-myc<br><br />
· <br><br />
<br />
<br><b>Sept 18</b> <br><br />
Wet lab<br><br />
· Ligation of comX-myc into pSB1C3 cut on XbaI and PstI<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG.B0015<br><br />
· Colony PCR and inoculation of correct colonies for I20260/E0240-K880005-comE-C-myc, I20260/E0240-K880005-comED58E-N-myc<br><br />
· Gel extraction and gel purification for J04450 (CHL), J04450 (KAN)<br><br />
· Sequencing reaction and Restrict check for K880005-comED58E-N-myc, K880005-comED58E-N-myc<br><br />
· <br><br />
<br />
<br><b>Sept 19</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comW-FLAG.B0015 on XbaI and PstI<br><br />
· Colony PCR, inoculation for I20260/E0240-K880005-comED58E-N-myc<br><br />
· Miniprep for I20260/E0240-K880005-comE-C-myc<br><br />
· Gel extraction and gel purification J04450 (CHL), J04450 (KAN) XS<br><br />
· Sequencing reaction for K880005-comE-C-myc<br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 4</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 22</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comX-myc.B0015 on XbaI and PstI<br><br />
· Inoculation of pSB1C3-K880005.comW-FLAG.B0015<br><br />
· Ligation of pSB3K3 backbone with 160bp Pcombox-BBa_E0240<br><br />
· Gel extraction and gel purification of I20260/E0240-K880005-comED58E-N-myc EP<br><br />
· Colony PCR and inoculation of I20260/E0240-K880005-comE-C-myc <br><br />
· Gel extraction and gel purification J04450 (CHL) (X&S), J04450 (KAN) (E&P) <br><br />
· Oligo annealing and overnight ligation w/ pSB1C3for PcomCDE<br><br />
· <br><br />
<br />
<br><b>Sept 23</b> <br><br />
Wet lab<br><br />
· Digestion of pSB1C3-K880005.comW-FLAG.B0015 of EcoRI-HF and SpeI-HF<br><br />
· Digestion of pSB1C3-K880005.comX-myc.B0015 and pSB1C3-K880005.comX on EcoRI-HF and SpeI-HF, gel extraction and gel purification<br><br />
· Ligation of pSB1C3-K880005.comX into pSB1C3-B0015 cut on EcoRI-HF and XbaI<br><br />
· Transformation of pSB3K3-160bp Pcombox-BBa_E0240 ligated on Sept 22<br><br />
· Gel check and redo liagtion for I20260-K880005-comED58E-N-myc, E0240-K880005-comED58E-N-myc, I20260-K880005-comE-C-myc, E0240-K880005-comE-C-myc<br><br />
· Gel extraction and purification for I20260-K880005-comED58E-N-myc, E0240-K880005-comED58E-N-myc<br><br />
· Ethanol precipitation for sequencing, restrict check K880005-comED58E-N-myc, K880005-comE-C-myc<br><br />
· Dephosphorylation and gel extraction and gel purification of J04450 (CHL) (X&S)<br><br />
· Gel extraction and Gel purification, dephosphorylation of J04450 (KAN) (E&P)<br><br />
· Oligo annealing, overnight ligation w/ pSB1C3 of PcomCDE<br><br />
· <br><br />
<br />
<br><b>Sept 24</b> <br><br />
Wet lab<br><br />
· Digestion check of pSB1C3-K880005.comX.B0015 on XbaI and PstI, gel extraction and gel purification<br><br />
· Inoculation of bacterial colonies carrying pSB3K3-160bp Pcombox-BBa_E0240<br><br />
· Restrict check, gel extraction and purification, Ligation w/ pSB3K3 I20260-K880005-comED58E-N-myc, E0240-K880005-comED58E-N-myc, I20260-K880005-comE-C-· myc, E0240-K880005-comE-C-myc <br><br />
· Obtain sequencing results for K880005-comED58E-N-myc, K880005-comE-C-myc<br><br />
· Transform pSB1C3-PcomCDE<br><br />
· <br><br />
<br />
<br><b>Sept 25</b> <br><br />
Wet lab<br><br />
· Restrcition digestion of ligated pSB3K3-160Pcombox-BBa_E0240<br><br />
· Restrict check, gel extraction and purification, Ligation w/ pSB3K3, I20260-K880005-comED58E-N-myc, E0240-K880005-comED58E-N-myc, I20260-K880005-comE-C-myc, E0240-K880005-comE-C-myc<br><br />
· Obtain sequencing results for K880005-comED58E-N-myc, K880005-comE-C-myc<br><br />
· Colony PCR w/ ‘NEW FPcomCDE’ and VR, inoculation of pSB1C3-PcomCDE<br><br />
<br />
· <br><br />
<br />
<br><b>Sept 26</b> <br><br />
Wet lab<br><br />
· Transformation of pSB3K3-160Pcombox-BBa_E0240 sample1<br><br />
· Streak plate for pSB3K3-BBa_I20260 and pSB3K3-BBa_E0240<br><br />
· Gel extraction and purificationI and ligation20260-K880005-comED58E-N-myc, E0240-K880005-comED58E-N-myc, I20260-K880005-comE-C-myc, E0240-K880005-comE-C-myc<br><br />
· Restrict check K880005-comED58E-N-myc, K880005-comE-C-myc by XbaI and PstI <br><br />
· Inoculation for sequencing K880005-comED58E-N-myc, K880005-comE-C-myc<br><br />
· Transformation of pSB1C3-PcomCDE<br><br />
<br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 5</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 29</b> <br><br />
Wet lab<br><br />
· <br><br />
<br />
<br />
<br><b>Sept 30</b> <br><br />
Wet lab<br><br />
· Digestion of RBS+comX-myc+B0015 on XbaI and PstI<br><br />
· Ligation of PcomCDE-E0240, both that day and overnight<br><br />
· Transformation<br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<h3>Riboregulator</h3><br />
<script src="http://ajax.googleapis.com/ajax/libs/jquery/1.7.1/jquery.min.js"></script><br />
<script><br />
$(document).ready(function(){<br />
$('.head').each(function(){<br />
var $content = $(this).closest('div').find('.content');<br />
$(this).click(function(e){<br />
e.preventDefault();<br />
$content.not(':animated').slideToggle();<br />
});<br />
});<br />
});<br />
</script><br />
<style><br />
* { margin:0; padding:0; } /* a simple reset */<br />
<br />
<br />
<br />
.head { <br />
display:block;<br />
background:#FF9900;<br />
border-radius:2px;<br />
margin-bottom:5px;<br />
align:left;<br />
width:600px;<br />
height: 40px;<br />
z-index:-3;<br />
font-family:"Trebuchet MS", Helvetica, sans-serif;<br />
font-size: 35px;<br />
text-align: left;<br />
}<br />
<br />
.content { <br />
display:none;<br />
background:#8FF5D5;<br />
border-radius:10px;<br />
width:60%;<br />
margin-bottom:5px;<br />
align:center;<br />
z-index:-3;<br />
padding-left:100px;<br />
padding-right:100px;<br />
font-family:"Trebuchet MS", Helvetica, sans-serif<br />
}<br />
<br />
<br />
<br />
</style><br />
<br />
<div id="flight"><br />
<!-- J U U N N EEEEEEEEEE 2 0 1 3----------------><br />
<!-- J U U NN N E 2 0 1 3----------------><br />
<!-- J U U N N N E 2 0 1 3----------------><br />
<!-- J U U N N N E 2 0 1 3----------------><br />
<!-- J U U N N N E 2 0 1 3----------------><br />
<!-- J U U N N N EEEEEEEEEE 2 0 1 3----------------><br />
<!-- J U U N N N E 2 0 1 3----------------><br />
<!-- J J U U N N N E 2 0 1 3----------------><br />
<!-- J J U U N N N E 2 0 1 3----------------><br />
<!-- J J U U N N N E 2 0 1 3----------------><br />
<!-- JJJJJJJJJJJJ UUUUUUUUUUUU N N EEEEEEEEEEE 2 0 1 3----------------><br />
<br />
<div id="satu" align="center"> <h2>June 2014</h2><br />
<br />
<div><br />
<a href="#" class="head">Week 1</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>June 2</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br><br />
<br><b>June 3</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 4</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 5</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 6</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 2</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>June 9</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 10</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 11</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 12</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 13</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 3</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>June 16</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 17</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 18</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 19</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 20</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 4</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>June 23</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 24</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 25</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 26</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br><b>June 27</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 5</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>June 30</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y Y 2 0 1 3--------><br />
<!-- J U U L Y 2 0 1 3--------><br />
<!-- J J U U L Y 2 0 1 3--------><br />
<!-- J J U U L Y 2 0 1 3--------><br />
<!-- J J U U L Y 2 0 1 3--------><br />
<!-- JJJJJJJJJJJJ UUUUUUUUUUUU LLLLLLLLLLLL Y 2 0 1 3--------><br />
<br />
<br />
<br />
<div id="satu" align="center"> <h2><center>July 2014</center></h2><br />
<br />
<div><br />
<a href="#" class="head">Week 1</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 1 </b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br> <b> July 2 </b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br> <b> July 3</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br> <b> July 4</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<br />
<div><br />
<a href="#" class="head">Week 2</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 7 </b> <br><br />
Wet lab<br><br />
. Oligos phosphorilation <br><br />
. ligation of TAs and CRs <br><br />
. Colony PCR <br><br />
. Digest Receptor Backbone pSB1C3 <br><br />
. Agar-LB plates <br><br />
. Inoculation for transformded BioBricks <br><br />
. Primer Design for TA construct Gibson Assembly <br><br />
. Gel check for the colony PCR <br><br />
. Pbad PCR amplification <br><br />
<br />
<br />
<br> <b> July 8 </b> <br><br />
Wet lab<br><br />
. Transformation of ligated TAs and CRs <br><br />
. Miniprep previous TAs CRs constructs <br><br />
. Restrict check previous TAs CRs constructs <br><br />
. Colony PCR for CRs and TAs <br><br />
. Re-ligation of TAs and CRs <br><br />
. Pbad PCR clean up and Digestion <br><br />
. Ligation of Pbad with pSB1C3 <br><br />
. Sequencing preparation of Pbad <br><br />
<br />
<br />
<br> <b> July 9</b> <br><br />
Wet lab<br><br />
. Transformation of Re-ligated TAs and CRs <br><br />
. Colony PCR <br><br />
. Gibson assembly master mix preparation <br><br />
<br />
<br> <b> July 10</b> <br><br />
Wet lab<br><br />
. Sequencing preparation of Pbad <br><br />
. Miniprep previous TAs CRs constructs <br><br />
. Restrict check previous TAs CRs constructs <br><br />
. Colony PCR <br><br />
. Inoculation for glycerol stocks <br><br />
. Digest Receptor Backbone , digestion of BBa_ E0240 with EcoR1-HF and Xbal and gel purification <br><br />
<br />
<br> <b> July 11</b> <br><br />
Wet lab<br><br />
. Pbad digestion and gel purification, Digestion of PBAD-pSB1C3 with EcoR1-HF and Spe1 and gel purification <br><br />
. Ligation of pBAD and E0240 <br><br />
. Overlaping PCR design <br><br />
. Gibson assembly master mix preparation <br><br />
. Glycerol stock <br><br />
. Competent cells preparations for DH5a and DH10B <br><br />
. Run gel for yesterday's restriction check <br><br />
. Miniprep E0240, mRFP, B0015 <br><br />
. Colony PCR <br><br />
. One full set re-ligation (short time) <br><br />
. Miniprep I13401 and K592009 <br><br />
<br />
</div><br />
</div><br />
<br />
<div><br />
<a href="#" class="head">Week 3</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 14 </b> <br><br />
Wet lab<br><br />
. Gibson assembly master mix preparation <br><br />
. Trevor's PCR <br><br />
. Ligation of pBAD an E0240 <br><br />
. Competent cells preparations for DH5a and DH10B <br><br />
. Prepare receptor backbone for oligo anealing, pSB1C3-J04450 (EcoRI, SpeI) <br><br />
. One full set of re-ligation (short time) <br><br />
. One full set of re-ligation (O/N) <br><br />
. Preparations for Pbad re-Characterization <br><br />
<br />
<br />
<br> <b> July 15 </b> <br><br />
Wet lab<br><br />
. Inoculation for pBAD-GFP-TT <br><br />
. (2nd time) Colony PCR usning VF2 and VR <br><br />
. Design primer for pBAD promoter sequencing <br><br />
. Gibson assembly master mix preparation <br><br />
. Preparations for Pbad re-characterization <br><br />
. Competent cells preparations for DH5a and DH10B <br><br />
. One full set re-ligation (O/N) <br><br />
. Prepare receptor backbone for oligo anealing <br><br />
<br />
<br />
<br> <b> July 16</b> <br><br />
Wet lab<br><br />
. Gibson assembly master mix preparation <br><br />
. Preparations for Pbad re-characterization <br><br />
. Competent cells preparations for DH5a and DH10B <br><br />
. Prepare receptor backbone for oligo anealing <br><br />
. Innoculate succesful oligo annealing colonies <br><br />
. Oligo annealing products C. PCR? <br><br />
<br />
<br> <b> July 17</b> <br><br />
Wet lab<br><br />
. Gibson assembly master mix preparation <br><br />
. Pbad re-characterization <br><br />
. Miniprep CRs TAs <br><br />
. Restric check CRs,TAs <br><br />
. Oligo annealing products C. PCR <br><br />
. Prepare receptor backbone for oligo anealing <br><br />
. Restrict CRs plasmids for GFP.dTT <br><br />
. Restrict TAs plasmids for dTT <br><br />
. Restrict GFP.dTT for CRs <br><br />
. Restrict dTT for TAs <br><br />
. Ligate CR.GFP.dTT <br><br />
. Ligate TA.dTT <br><br />
. Transform Ligated CR.GFP.dTT <br><br />
. Transform Ligated TA.dTT <br><br />
. Transform-Ligate Annealed oligos <br><br />
<br />
<br> <b> July 18</b> <br><br />
Wet lab<br><br />
. Gibson assembly for amilCP <br><br />
. Pbad re-characterization <br><br />
. Colony PCR <br><br />
. Prepare receptor backbone for oligo anealing <br><br />
. Restrict GFP.dTT for CRs <br><br />
. Restrict dTT for TAs <br><br />
. M9 mininaml medium preparation <br><br />
. Colony PCR <br><br />
. plate streaking for pBAD-E0240 <br><br />
. inoculation of TAs and CRs <br><br />
<br />
<br> <b> July 19</b> <br><br />
Wet lab<br><br />
. Pbad re-characterization <br><br />
<br />
<br />
</div><br />
</div><br />
<br />
<div><br />
<a href="#" class="head">Week 4</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 21 </b> <br><br />
Wet lab<br><br />
. Gibson assembly for amilCP <br><br />
. Miniprep CRs TAs <br><br />
. Restrict check pSB1C3-TAs/CRs constructs <br><br />
. Restrict GFP.dTT for CRs <br><br />
. Restrict Pbad for TAs <br><br />
. Restrict B0015 EcoR1 and XbaI <br><br />
. J04450 backbone extraction <br><br />
. Colony PCR <br><br />
. inoculation of TAs and CRs <br><br />
. prepare Pbad L(+) A. concentration gradients for charac <br><br />
. Restrict CRs <br><br />
. Restrict TAs-Version1 <br><br />
. Restrict TAs-Version2 <br><br />
. Ligate CR.GFP.dTT <br><br />
. Ligate TA.dTT <br><br />
. Transform Pbad.TA <br><br />
. Transform CR.GFP.dTT <br><br />
. Transform Gibson assembly <br><br />
<br />
<br />
<br> <b> July 22 </b> <br><br />
Wet lab<br><br />
. Colony PCR <br><br />
. Miniprep CRs TAs <br><br />
. Restrict check pSB1C3-TAs/CRs constructs <br><br />
. Restrict B0015-Version2 <br><br />
<br />
<br />
<br> <b> July 23</b> <br><br />
Wet lab<br><br />
. Inoculation candidate colony or construct <br><br />
. Miniprep and restrict check innoculations <br><br />
. Gibson assembly check <br><br />
. Gibson PCR <br><br />
. Teach inoue competent cells to main project <br><br />
. Miniprep of B0015, pBAD-E0240 <br><br />
. glycerol stock (pBAD-E0240) <br><br />
. Re-Re-ligation of oligo annealing O/N <br><br />
<br />
<br> <b> July 24</b> <br><br />
Wet lab<br><br />
. miniprep candidate colony or construct <br><br />
. Restrict check pSB1C3-TAs/CRs constructs <br><br />
. Re-Re-ligation trasnformation <br><br />
. Re-Re-ligation trasnformation V.X <br><br />
. Gibson assembly check <br><br />
<br />
<br> <b> July 25</b> <br><br />
Wet lab<br><br />
. Certification day (safety evaluation) <br><br />
<br />
</div><br />
</div> <br />
<br />
<div><br />
<a href="#" class="head">Week 5</a><br />
<div class="content" align="left" style="display: none;"><br />
<br> <b> July 28 </b> <br><br />
Wet lab<br><br />
. oligo phosphorilation <br><br />
. oligo annealing <br><br />
. ligation of annealed oligos O/N <br><br />
. gel for C. PCR <br><br />
. receptor backbone for annealed oligos <br><br />
. innoculate last ligation <br><br />
. Check past locks/keys status <br><br />
. Pbad sequencing <br><br />
. transformation of some of the existing riboregulator biobricks <br><br />
. Benchling Check <br><br />
<br />
<br />
<br> <b> July 29 </b> <br><br />
Wet lab<br><br />
. Miniprep and restrict check innoculations <br><br />
. Restrict check pSB1C3-TAs/CRs constructs <br><br />
. Inoculation of CR and TA from distribution kit <br><br />
. prepare I20260 in PSB1C3 <br><br />
. prepare Side project Buffer <br><br />
. prepare side project gel red 200:1 <br><br />
. Check digested GFP <br><br />
. Check digested B0015 <br><br />
. ligate oligos into GFP <br><br />
. ligate oligos itno B0015 <br><br />
. prepare M9 for characterization <br><br />
. transform our pbad into DH5alpha <br><br />
. prepare M9 medium <br><br />
. transformation of Clon001-010 in pSB1C3 ( with a control) <br><br />
<br />
<br />
<br> <b> July 30</b> <br><br />
Wet lab<br><br />
. transformation of CLON001-010 in pSB1C3 (B0015, I13401) <br><br />
. C. PCR for yesterday transfomations (CLON001-010) <br><br />
. If construct after gel check inoculation, restriction, ligation <br><br />
. prepare I20260 in PSB1C3 <br><br />
. transform our pbad into DH5alpha <br><br />
. prepare M9 for characterization <br><br />
. Teach inoue competent cells to main project <br><br />
<br />
<br> <b> July 31</b> <br><br />
Wet lab<br><br />
. Try Gibson assembly mastermix <br><br />
. Digest Biobrick TA and CR <br><br />
. PCR clean up? for existing CR and TA biobricks <br><br />
. run gel for yesterday's colony PCR <br><br />
. check dNTPs <br><br />
. Sequencing preparation for posible construct <br><br />
. colony PCR for 5th <br><br />
. inoculate candidates <br><br />
. prepare i20260in psb1c3 <br><br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<!------ AAAAAAAAAAAA U U GGGGGGGGGGGG U U SSSSSSSSSSSSS TTTTTTTTTTTTTT 2 0 1 3----------------><br />
<!------ A A U U G U U S T 2 0 1 3----------------><br />
<!------ A A U U G U U S T 2 0 1 3----------------><br />
<!------ A A U U G U U S T 2 0 1 3----------------><br />
<!------ A A U U G U U S T 2 0 1 3----------------><br />
<!------ AAAAAAAAAAAA U U G U U SSSSSSSSSSSSS T 2 0 1 3----------------><br />
<!------ A A U U G GGGGGGG U U S T 2 0 1 3----------------><br />
<!------ A A U U G G G U U S T 2 0 1 3----------------><br />
<!------ A A U U G G G U U S T 2 0 1 3----------------><br />
<!------ A A U U G G U U S T 2 0 1 3----------------><br />
<!------ A A UUUUUUUUUUU GGGGGGGGGGGG UUUUUUUUUUUUU SSSSSSSSSSSSS T 2 0 1 3----------------><br />
<br />
<br />
<div id="satu" align="center"> <h2>August 2014</h2><br />
<br />
<div><br />
<a href="#" class="head">Week 1</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 1</b> <br><br />
Wet lab<br><br />
. colony PCR for 5th <br><br />
. Digest Biobrick TA and CR <br><br />
. short ligation for TAs CRs <br><br />
. Transform TAs, CRs <br><br />
. inoue Buffer <br><br />
. inoculations if possible <br><br />
. miniprep CLON005 <br><br />
. Digest 005 Spe1 and Pst1 <br><br />
. ligate CLON 005 with B0015 <br><br />
. prepare backbone : B0015 E, X /// I13401 E,X /// J23102 X, P <br><br />
. Ligate PBad with Key1 dTT <br><br />
. digest ptet lock 1 with S and P <br><br />
<br />
<br><b>Aug 2</b> <br><br />
Wet lab<br><br />
. Devise a general blue print for the catalog and feature page <br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 2</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 4</b> <br><br />
Wet lab<br><br />
. Mini prep 001-010 <br><br />
. Restrict TAs <br><br />
. restrict CRs <br><br />
. Restrict pBAD for TAs <br><br />
. Restrict GFP.dTT for CRs <br><br />
. Restrict B0015 <br><br />
. Ligate Pbad.TA <br><br />
. liagte CR.GFP.dTT <br><br />
. Ligate Pbad.dTT <br><br />
. Transform TAs, CRs <br><br />
. inoculate 001-010 <br><br />
. Sequence 001-010 <br><br />
. inoculate B0015 <br><br />
. inoculate constitutive promoter <br><br />
. Innoculate Pbad with key 1 dTT <br><br />
. Competent cells preparations DH10B <br><br />
. Prepare for functional assay of Pbad promoter <br><br />
. Prepare M9 minimal Medium <br><br />
. make a second list of oligos to be sent out <br><br />
. Test out GA mastermix efficiency <br><br />
. Ligate TAs oligo with B0015 <br><br />
. inoue Buffer <br><br />
. Sequence 001-010 <br><br />
<br />
<br><b>Aug 5</b> <br><br />
Wet lab<br><br />
. Colony PCR for TA.dTTs <br><br />
. inoculate TA.dTT <br><br />
. ligation of pBAD and key3 <br><br />
. Restrict TAs <br><br />
. restrict CRs <br><br />
. Restrict pBAD for TAs <br><br />
. Restrict GFP.dTT for CRs <br><br />
. Ligate Pbad.TA <br><br />
. liagte CR.GFP.dTT <br><br />
. Ligate Pbad.dTT <br><br />
. Transform TAs, CRs <br><br />
. Prepare M9 medium <br><br />
. Prepare Innoculations for Pbad characteriation <br><br />
. Sequecing preapraion <br><br />
. Digest Ptet lock 1 with S and P <br><br />
. Glycerol stock for 001-010 <br><br />
. Inoue competent cells <br><br />
. "Mini Prep pSB1C3-PCRPbad<br><br />
<br />
<br><b>Aug 6</b> <br><br />
Wet lab<br><br />
. Miniprep TA.dTT <br><br />
. Restriction check for TA.dTT <br><br />
. Miniprep TAs CRs <br><br />
. Restrict TAs <br><br />
. Restrict CRs <br><br />
. Restrict B0015 for TAs <br><br />
. Colony PCR for TA.dTTs <br><br />
. Oligo annealing for TA.dTT <br><br />
. Inoue competent cells <br><br />
. Sequencing results <br><br />
. Ligate PBad with Key1 dTT <br><br />
. Ligate Ptet Lock 1 (GFP dTT) <br><br />
. Send PCR Pbad for sequencing <br><br />
. Assay Pbad promoter <br><br />
<br />
<br><b>Aug 7</b> <br><br />
Wet lab<br><br />
. Gel check for C. PCR <br><br />
. inculate possible TA.dTT <br><br />
. Ligation of TA and dTT (4TAs) <br><br />
. Ligation of pBAD and key dTT <br><br />
. Gel check for TAs CRs <br><br />
. competent cells <br><br />
. miniprep pBAD-dTT <br><br />
. miniprep pBAD-key3 <br><br />
. Colony PCR for pBAD-dTT and pBAD-key3 <br><br />
. Restriction of pBAD-dTT and pBAD-key3 <br><br />
. prepare backbone and or insert if any // and restrict check <br><br />
. Preparation for Pbad promoter characterization <br><br />
. Colony PCR for Pbad with Key 1 dTT <br><br />
. Colony PCR for Ptet Lock 1 GFP dTT <br><br />
. Innoculation of ligated DNA <br><br />
<br />
<br><b>Aug 8</b> <br><br />
Wet lab<br><br />
. digestion of pBAD-key3 <br><br />
. Restriction check for pBAD-dTT and pBAD-key3-dtt <br><br />
. ligation of pBAD-key3-dTT <br><br />
. Miniprep for CLON007(J), CLON 010(I) and CLON (G) <br><br />
. Miniprep Pbad Key 1 dTT <br><br />
. Miniprep Ptet Lock 1 GFP dTT <br><br />
. Restriction Check for the key 1 and lock 1 mentioned above <br><br />
. Prepare digestion of key 1 and lock 1 for ligation <br><br />
. Transform BBa_J13002 <br><br />
. Restriction check CLON007(J), CLON 010(I) and CLON (G) <br><br />
. digestion of CLON007(J), CLON 010(I) and CLON (G) <br><br />
. ligation of CLON007(J), CLON 010(I) and CLON (G) with pBAD <br><br />
. C. PCR for CLON 022-025 TAs.dTT <br><br />
. ligation of pBAD and TAs <br><br />
. ligation of GFP and CRs <br><br />
. Inoue competent cells <br><br />
. Pbad promoter characterization <br><br />
<br />
<br><b>Aug 9</b> <br><br />
Wet lab<br><br />
. transformation , all in chl, overnight ligation 16C <br><br />
. Colony PCR gel check <br><br />
. Check competent cells <br><br />
<br />
<br><b>Aug 10</b> <br><br />
Wet lab<br><br />
. Restriction check for TAs.dTT <br><br />
. Gel check for C. PCR TAs.dTT <br><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 3</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 11</b> <br><br />
Wet lab<br><br />
. Restriction check for TAs.dTT <br><br />
. Gel check for C. PCR TAs.dTT <br><br />
. Colony PCR for CR.GFP.dTTs <br><br />
. Colony PCR for Pbad.TAs <br><br />
. Inoculate CR.GFP.dTTs <br><br />
. Inoculate Pbad.TAs <br><br />
. Restrict TA.dTTs <br><br />
. Ligate Pbad.TA.dTTs <br><br />
. Transform Pbad.TA.dTTs <br><br />
. Restriction check for Ptet Lock 1 GFP dTT and Pbad Key 1 dTT <br><br />
. Transform 2014 Kit plate 4 well GF <br><br />
. Transformation of restricted checked DNA <br><br />
. Innoculate BBa_J13002 <br><br />
. Innoculate more Pbad dTTs <br><br />
. sequencing PCR for MCR, MTA <br><br />
. transformation for backbone with KAN resistant <br><br />
. inoculation B0034 from glycerol stock B0034 <br><br />
. restriction check <br><br />
. Ligation of pBAD-key3 into B0015-pSB1AK3 plasmid <br><br />
. inoculation of pBAD-key3 <br><br />
<br />
<br><b>Aug 12</b> <br><br />
Wet lab<br><br />
. transformation pBAD -TA <br><br />
. Gel for TA.dTTs <br><br />
. GEl for C. PCR for CR.GFP.dTT <br><br />
. Digestion of PCR pBAD <br><br />
<br />
<br><b>Aug 13</b> <br><br />
Wet lab<br><br />
. miniprep CR.GFP.dTTs <br><br />
. miniprep Pbad <br><br />
. Restrict check CR.GFP.dTTs <br><br />
. innoculate TA.dTTs <br><br />
. Gel extraction-purification of constitutive promoter <br><br />
. Ligate CR.GFP.dTTs into Cosntritutive promoter <br><br />
. transform, Pbad.Key3 <br><br />
. transform Cosntitutive promoter.CR.GFP.dTTs <br><br />
. Gibson Assembly mastermix <br><br />
. Digest Pbad Key dTT and Ptet Lock 1 GFP dTT for 3A assembly <br><br />
. Miniprep pSB3K3-J04550 for pSB3K3 Backbone <br><br />
. 3A assembly <br><br />
. Plan for Pbad characterization <br><br />
. Prepare stock arabinose solution M9 medium <br><br />
<br />
<br><b>Aug 14</b> <br><br />
Wet lab<br><br />
. Gel check for lock3.GFP.dTT colony PCR I-VI <br><br />
. check dNTPs <br><br />
. miniprep TA.dTTs <br><br />
. Restrict check TA.dTTs <br><br />
. miniprep Lock3.gfp.dTT <br><br />
. colony PCR for PBAD-key3-dTT <br><br />
. Gel extraction-purification of constitutive promoter <br><br />
. Ligate CR.GFP.dTTs into Cosntritutive promoter <br><br />
. ligate TA.dTT with Pbad <br><br />
. transform ligate Pbad.TA.dTTs <br><br />
. transform Cosntitutive promoter.CR.GFP.dTTs <br><br />
<br />
<br><b>Aug 15</b> <br><br />
Wet lab<br><br />
. Gibson Assembly mastermix <br><br />
. purify CR.GFP.dTTs <br><br />
. Ligate CR.GFP.dTTs into Cosntritutive promoter <br><br />
. Digestion of TA-dTT and PCR clean-up <br><br />
. Restriction Check for TA-dTT <br><br />
. transform ligate Pbad.TA.dTTs <br><br />
. transform Cosntitutive promoter.CR.GFP.dTTs <br><br />
. make 10x DNA loading Dye <br><br />
. Order new TA and CR <br><br />
. Gibson Assembly mastermix <br><br />
<br />
<br />
<br><b>Aug 16</b> <br><br />
Wet lab<br><br />
. Miniprep <br><br />
. Colony PCR for final constructs <br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 4</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 18</b> <br><br />
Wet lab<br><br />
. Restriction check for Pbad.TA.dTTs <br><br />
. Restriction check for constitutive promoter.CR.GFP.dTT <br><br />
. Restriction check for constitutive promoter.RBS.GFP.dTT <br><br />
. PCR for CR.GFP.dTT <br><br />
. PCR for RBS.GFP.dTT <br><br />
. PCR check for constitutive promoter.CR.GFP.dTT <br><br />
. PCR check for constitutive promoter.RBS.GFP.dTT <br><br />
. PCR check for Pbad.TA.dTT <br><br />
. Restrict check TA.dTTs <br><br />
. Prepare functional assay for RBS, CRs <br><br />
. Inoculate candidates <br><br />
. Prepare pSB3K3 <br><br />
. Prepare pSB1C3 for oligo ligation <br><br />
. Prepare I13401 for oligo ligation <br><br />
. Prepare B0015 for oligo ligation <br><br />
. Inoue competent cells <br><br />
. Prepare for Pbad characterization <br><br />
. Take over the tank B and C arround 1pm-5;30 <br><br />
<br />
<br><b>Aug 19</b> <br><br />
Wet lab<br><br />
. Gel check for O/NPCR products <br><br />
. Gel check for PCR products (18/08) <br><br />
. miniprep c.Promoter.Lock 1RBS.GFP.dTT <br><br />
. miniprep possible candidates <br><br />
. Restrict TA.dTT <br><br />
. pSB1C3-I13401 for oligo ligation <br><br />
. B0015 for oligo ligation <br><br />
. pSB1C3-J04450 for oligo ligation <br><br />
. Inoue competent cells <br><br />
. pBAD-key3-dTT restriction check <br><br />
<br />
<br><b>Aug 20</b> <br><br />
Wet lab<br><br />
. Gel check for Pbad.TA.dTTs <br><br />
. purification for B0015, I13401 <br><br />
. pSB1C3-J04450 for oligo ligation <br><br />
. Gel check for PCR products (19/08) <br><br />
. PCR check for J23102, LOCK 3 GFP dtt <br><br />
. restrcition check for key1 dtt <br><br />
<br />
<br><b>Aug 21</b> <br><br />
Wet lab<br><br />
. Colony PCR for final constructs <br><br />
. Ligate UST lock <br><br />
. restriction check for key1.dTT <br><br />
. ligate pbad.key1.dTT <br><br />
. ligate lock 3.GFP.dTT with C. promoter <br><br />
. Colony PCR for c. promoter.MCR.GFP.dTT <br><br />
. competent cells <br><br />
. Glycerol stocks <br><br />
. transform HKUSTlock.GFP.dTT <br><br />
. Transform pSB1C3-HKUSTlock <br><br />
· <br><br />
<br />
<br><b>Aug 22</b> <br><br />
Wet lab<br><br />
. competent cells <br><br />
. Colony PCR for pSB1C3-HKUSTlock1 <br><br />
. Colony PCR for HKUSTlock1.GFP.dTT <br><br />
. miniprep PSB3K3-J04550 for pSB3K3 Backbone <br><br />
. restrict pSB3K3 for 3 pieces assemblage <br><br />
. ligate TA-CR into pSB3K3 <br><br />
. Transform TA-CR <br><br />
. colony PCR for PBAD-key3-dTT <br><br />
. inoculate Pbad.key1.dTT <br><br />
. gel check for C. PCR on 21/08 <br><br />
. extraction of pSB3K3 <br><br />
. inoculate HKUSTlock1.GFP.dTT <br><br />
. inoculate pSB1C3-HKUSTlock1 <br><br />
· <br><br />
<br />
<br><b>Aug 23</b> <br><br />
Wet lab<br><br />
. Gel check for TAs <br><br />
. colony PCR for UST lock in I13401 and pSB1C3 <br><br />
. transform ust key <br><br />
. Check competent cells <br><br />
· <br><br />
<br />
<br />
<br><b>Aug 24</b> <br><br />
Wet lab<br><br />
. Colony PCR for Pbad.Key1.dTT <br><br />
. Gel check for Pbad.Key1.dTT <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 5</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Aug 25</b> <br><br />
Wet lab<br><br />
. Colony PCR for Pbad.Key1.dTT <br><br />
. PCR check for CR.GFP.dTT <br><br />
. PCR check for Cons. prom.CR.GFP.dTT <br><br />
. anneal and ligate ust lock <br><br />
. anneal and ligate ust key <br><br />
. transform ust lock1 <br><br />
. transform ust key <br><br />
. ligation again key 1 into B0015 <br><br />
· <br><br />
<br />
<br><b>Aug 26</b> <br><br />
Wet lab<br><br />
. Colony PCR for "un-named lock" <br><br />
. inoculate ones which SEEMS like it contains lock <br><br />
. Colony PCR for "un-named key" <br><br />
. inoculate ones which SEEMS like it contains key <br><br />
. colony pcr for Key1.dtt <br><br />
. Gel check for O/NPCR products <br><br />
. pcr check for CR.GFP.dTTs <br><br />
. Inoculate all possible candidates <br><br />
. Feeling paranoic? Prepare I13401 for CRs <br><br />
. Streak posible c.p.CR/RBS.GFP.dTT <br><br />
. make SOC <br><br />
. single cut check for TAs <br><br />
. make 5 alpha cell <br><br />
· <br><br />
<br />
<br />
<br><b>Aug 27</b> <br><br />
Wet lab<br><br />
. miniprerp candidates <br><br />
. pcr check for candidates <br><br />
. gel check for o/n pcr <br><br />
. restrict check for ust key 1 <br><br />
. restrick check for key 1 <br><br />
. Pbad for ust key 1 <br><br />
. extract ust lock 1 for j23102 <br><br />
. ligate ust lock and key <br><br />
. transform ust lock and key <br><br />
. prepare plates for macroscope <br><br />
. prepare dna for sequencing <br><br />
. SOB <br><br />
. SOC <br><br />
. oligo annealing <br><br />
. plasmid PCR for HKUSt lock and key <br><br />
. overnight digestion of B0034 for control construct <br><br />
. Digestion of HKUST key-B0015 <br><br />
· <br><br />
<br />
<br />
<br><b>Aug 28</b> <br><br />
Wet lab<br><br />
. miniprep locks <br><br />
. glycerol stocks for locks <br><br />
. minipreps for B0015 and B0034 <br><br />
. ligation of pBAD-Hkust key-B0015 <br><br />
. digestion of HKUST lock <br><br />
. ligation of HKUST lock with GFP <br><br />
. ligation of HKUST key and lock (4th) <br><br />
. ligation of B0034 with GFP <br><br />
. colony PCR of HKUST key and lock <br><br />
. inoculation of key and lock <br><br />
. miniprep <br><br />
. Key one restrict check <br><br />
. key one restriction for inserting pBAD <br><br />
. Restrict and exytact lock3c rbs and ligate into c.promoter <br><br />
. ligate lock 3c.GFP.dTT with C. promoter <br><br />
. transform c. promoterlock 3c rbs.gfp.dtt <br><br />
. Extract mcr/mta <br><br />
. ligate MCR and MTA into 3K3 <br><br />
. transform MCR/MTA <br><br />
. Glycerol stock for locks <br><br />
. E0240 ligate with C. Promoter <br><br />
. TB <br><br />
. parallel ligation and aneling for key 1 <br><br />
. Sequencing preparations <br><br />
· <br><br />
<br />
<br />
<br><b>Aug 29</b> <br><br />
Wet lab<br><br />
. minipreps <br><br />
. Gel extraction, purification for O/N digestions <br><br />
. competent cells <br><br />
. Extract mcr/mta <br><br />
. ligate MCR and MTA into 3K3 <br><br />
. transform MCR/MTA <br><br />
. Glycerol stock for locks <br><br />
. PCR check for biobrick key1 <br><br />
· <br><br />
<br />
<br />
<br><b>Aug 30</b> <br><br />
Wet lab<br><br />
. inoculation of 12 falcons <br><br />
. Colony PCR for pSB3K3 constructs <br><br />
. Transform key1 O/N <br><br />
. miniprep <br><br />
. Competent cells <br><br />
. AseI check Key 1 Dtt <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<!---- SSSSSSSS EEEEEEEE PPPPPPPP TTTTTTTTTTTT EEEEEEEE M M BBBBBBBB EEEEEEEEE RRRRRRRR 2 0 1 3--------><br />
<!---- S E P P T E MM MM B B E R R 2 0 1 3--------><br />
<!---- S E P P T E M M M M B B E R R 2 0 1 3--------><br />
<!---- S E P P T E M M M M B B E R R 2 0 1 3--------><br />
<!---- S E P P T E M M M M B B E R R 2 0 1 3--------><br />
<!---- SSSSSSSS EEEEEEEE PPPPPPPP T EEEEEEEE M M M BBBBBBBB EEEEEEEEE RRRRRRRR 2 0 1 3--------><br />
<!---- S E P T E M M B B E R R 2 0 1 3--------><br />
<!---- S E P T E M M B B E R R 2 0 1 3--------><br />
<!---- S E P T E M M B B E R R 2 0 1 3--------><br />
<!---- S E p T E M M B B E R R 2 0 1 3--------><br />
<!---- SSSSSSSS EEEEEEEE P T EEEEEEEE M M BBBBBBBB EEEEEEEEE R R 2 0 1 3--------><br />
<br />
<div id="satu" align="center"> <h2>September 2014</h2><br />
<br />
<div><br />
<a href="#" class="head">Week 1</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 1</b> <br><br />
Wet lab<br><br />
. restrict check pBAD- Lost your key-dtt <br><br />
. restrict check pBAD-Lost your key-dtt <br><br />
. colony PCR for CR.TAs (orthogonality) <br><br />
. colony PCR for Key1,dtt <br><br />
. ligate lock3c.GFP.dTT into c.p plasmid <br><br />
. transform lock3.gfp.dtt <br><br />
. Colony PCR for CR.TAs (orthogonality) <br><br />
. Colony PCR for sherLock-GFP-dtt <br><br />
. restriciton check for Lost Your Key in PSB1C3 <br><br />
. transform pbad.lost your key.dtt <br><br />
. inoculate orthogonality candidates <br><br />
. Prepara midi-prep for 3k3 <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 2</b> <br><br />
Wet lab<br><br />
. Gel check for O/N colony pcr for key1 and 3k3 <br><br />
. massive prep <br><br />
. PCR check sense reverse <br><br />
. colony pcr for orthogonality <br><br />
. colony pcr for cons. pro. lock3crbs.gfp.dtt <br><br />
. migrate cpromoter E0240 to psb3k3 with mta key <br><br />
. inoculation of B0034-GFP-dtt <br><br />
. inoculation of Sherlock-GFP-dtt <br><br />
. sequencing for sherlock in pSB1C3 <br><br />
. digestion of B0034-GFP-dtt <br><br />
. digestion of sherlock-GFP-dtt <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 3</b> <br><br />
Wet lab<br><br />
. digestion of Pbad MTA dTT <br><br />
. digestion of Pbad dTT <br><br />
. digestion of J23102 MCR GFP dTT <br><br />
. digestion of J23102 E0240(B0032 GFP dTT) <br><br />
. digestion of pSB3K3 backbone (from pSB3K3-BBa_J04450) <br><br />
. Ligation of J23102 MCR GFP dTT with Pbad dTT <br><br />
. Ligation of J23102 E0240 with Pbad MTA dTT <br><br />
. Ligation of J23102 E0240 with Pbad dTT <br><br />
. Plasmid PCR for SherLock-GFP-dtt <br><br />
. ligation of B0034-GFP-dtt <br><br />
. ligation of SherLock-GFP-dtt <br><br />
. sequencing <br><br />
. check plate for arabinose induced mcr mta while singing <br><br />
. extraction of key and lock <br><br />
. restriction check for key with lock <br><br />
. extration of key1 dtt <br><br />
. ligation of key1 dtt with pBAD <br><br />
. Gel check for O/N colonyPCR <br><br />
. Crazy PCR check <br><br />
. Check 031 <br><br />
. ligate lock3c RBS.GFP.dTT into c.p plasmid <br><br />
. transform lock3c RBS.GFP.dTT <br><br />
. Midi prep preparations <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 4</b> <br><br />
Wet lab<br><br />
. Gel purification of digested insert and backbone <br><br />
. Ligation of J23102 MCR GFP dTT with Pbad dTT <br><br />
. Ligation of J23102 E0240 with Pbad MTA dTT <br><br />
. digestion of J23102 E0240(B0032 GFP dTT) <br><br />
. Transformation of ligated projects mentioned above <br><br />
. Colony PCR for sherLock-GFP-dtt <br><br />
. Colony PCR for B0034-GFP-dtt <br><br />
. Inoculation of successful colonies <br><br />
. Gel check for O/N Colony PCR <br><br />
. Gel check for O/N crazy PCR <br><br />
. Gel check for Erics restriction check <br><br />
. Inoculation of successful colonies <br><br />
. Midi-prep preparations <br><br />
. Gel purification <br><br />
· <br><br />
<br />
<br />
<br><b>Sept 5</b> <br><br />
Wet lab<br><br />
. miniprep/glycerol stocck <br><br />
. Transform Pbad dTT <br><br />
. Transform ligated produce of J23102 MCR GFP dTT with Pbad dTT <br><br />
· <br><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 2</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 8</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 9</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br><b>Sept 10</b> <br><br />
Wet lab<br><br />
. colony pcr <br><br />
. ligations for final constructs <br><br />
. inoculations <br><br />
. Pbad.lost your key.dtt <br><br />
. sherlock <br><br />
. gel check for colony pcr <br><br />
. colony pcr <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 11</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br><b>Sept 12</b> <br><br />
Wet lab<br><br />
. colony pcr <br><br />
. restrict key1.dtt for Pbad insertion <br><br />
. ligate Pbad with key1.dtt <br><br />
. transform key1.dTT <br><br />
. extract pSB3K3 <br><br />
. Prepare TB <br><br />
. Prepare dextrose for SOC <br><br />
. check sequencing results <br><br />
. Digestion of CLON041 for constructs <br><br />
. ligation <br><br />
. inoculation <br><br />
. Digestion of CLON 036 <br><br />
. colony pcr mcr mta <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 3</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 15</b> <br><br />
Wet lab<br><br />
· <br><br />
· <br><br />
· <br><br />
· <br><br />
<br />
<br />
<br><b>Sept 16</b> <br><br />
Wet lab<br><br />
. mini prep Pbad.key1.dtt <br><br />
. restrict check pbad.key1.dtt <br><br />
. gel check for O/N c.pcr <br><br />
. extract pbad.key1 <br><br />
. inoculate every CR.TA construct <br><br />
. ligate transform key 1 with locks <br><br />
. miniprep (B1, B2, and B3) <br><br />
. plasmid PCR B1, B2 and B3 using sense oligo and VR <br><br />
. Overnight digestion for ones which give positive results <br><br />
· <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 17</b> <br><br />
Wet lab<br><br />
. purify pbad.key1 <br><br />
. ligate pbad key1 dtt with locks <br><br />
. transform locks.Pbad.key1.dtt <br><br />
. 2xYT (agar) AMP <br><br />
. transform all <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 18</b> <br><br />
Wet lab<br><br />
. Spread a plate <br><br />
. miniprep for 3 inoculations <br><br />
. Sense oligo and VR PCR for HKUST Lock-dtt construct <br><br />
. Overnight digestion of plasmid which gives a band around 1300bp <br><br />
. EtoHpp for sequencing <br><br />
. Miniprep construtcs for submission <br><br />
. innoculation <br><br />
. transform 031, 034 <br><br />
. Check "Diagonal constructs" and controls <br><br />
. migrate CR crontruts into 3K3 <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 19</b> <br><br />
Wet lab<br><br />
. miniprep lock.key candidate <br><br />
. ligate problematic cr.key <br><br />
. restrick check sherlock <br><br />
. extrations.... madness <br><br />
· <br><br />
<br />
<br />
<br><b>Sept 20</b> <br><br />
Wet lab<br><br />
. miniprep CR.TA <br><br />
. Colony PCR for CR.TA <br><br />
. Colony PCR for CR.TA orthogonality <br><br />
· <br><br />
<br />
<br />
<br><b>Sept 21</b> <br><br />
Wet lab<br><br />
. miniprep martching CR.TA <br><br />
. Restriction check by EcoR1 and Pst1 <br><br />
· <br><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 4</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 22</b> <br><br />
Wet lab<br><br />
. Run Gel check for matching set of CR.TA <br><br />
. ligate problrmatic sets <br><br />
. transform rpoblematic sets <br><br />
. prepare DNA for submission <br><br />
. Gel purfication for Doyle <br><br />
. Ligation lock-dtt with cons. promoter <br><br />
. transformation <br><br />
. pSB3K3- CRs ligation <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 23</b> <br><br />
Wet lab<br><br />
. pSB3K3- CRs transformation <br><br />
. Gel extractions <br><br />
. Gel purifications <br><br />
. TB <br><br />
. Agar L (+) plates <br><br />
. Send DNA to BGI for sequencing <br><br />
. C. PCR? <br><br />
. Inoculate possible candidates <br><br />
. ligate problematic sets <br><br />
. transform confirmed constructs <br><br />
. inoculation for HKUST lock Construct <br><br />
. colony PCR For lock <br><br />
· <br><br />
<br />
<br />
<br><b>Sept 24</b> <br><br />
Wet lab<br><br />
. Competent cells preparations! <br><br />
. minipreps <br><br />
. colony PCR <br><br />
. miniprep for biobrick submission <br><br />
. send plamsid for sequencing <br><br />
· <br><br />
<br />
<br />
<br><b>Sept 25</b> <br><br />
Wet lab<br><br />
. insane prep <br><br />
. restriction check <br><br />
. Gel check for previous PvuII digestions <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 26</b> <br><br />
Wet lab<br><br />
. Gel check PvuII digestions <br><br />
. Gel check AseI digestions <br><br />
. 3A assembly for non pSB1C3 <br><br />
. final batch of ligation for all missing component <br><br />
. prepare DNA for submission <br><br />
. Extraction for ligation <br><br />
. Checking constructs-3 constructs using digestion check <br><br />
. transformation for LOCK-8 <br><br />
. Restriction check for controls for MCR/MTA <br><br />
. Transformation of confirmed plasmid <br><br />
· <br><br />
<br />
<br><b>Sept 27</b> <br><br />
Wet lab<br><br />
. C. PCR for H series... <br><br />
. inoculate possible candidates <br><br />
. check self ligated 3K3 <br><br />
. Gel check for possible candidates AseI <br><br />
. Gel check for possible candidates PvuII <br><br />
. Ligated H6 H7 <br><br />
. transformed H6 H7 <br><br />
. O/N innoculation of MCR/MTA for characterization <br><br />
· <br><br />
<br />
<br />
<br><b>Sept 28</b> <br><br />
Wet lab<br><br />
. Extract pSB1C3 <br><br />
. Etract 036 <br><br />
. miniprep "H" series candidates <br><br />
. Repeat CHL restrictions <br><br />
. Repeat CHL ligattions <br><br />
. Repeat CHL transformations <br><br />
. Gel check for "7" series using NcoI <br><br />
. Restrict check AseI <br><br />
. Restrict check NcoI <br><br />
. Fluorescence measurement of MCR/MTA for characterization. <br><br />
. Pick a colony dilute and spread MCR/MTA (we don't want bacteria lawn) <br><br />
· <br><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<div><br />
<a href="#" class="head">Week 5</a><br />
<div class="content" align="left" style="display: none;"><br />
<br><b>Sept 29</b> <br><br />
Wet lab<br><br />
. Restrict check AseI <br><br />
. Restrict check NcoI <br><br />
. mini prep 6 + MCR/MTA (thanks from doyle) <br><br />
. Restriction check for MCR/MTA in pSB3K3. <br><br />
. restrict 036 <br><br />
. purify 036 <br><br />
. ligate monkey with sherlock <br><br />
. Gel check for NcoI and AseI <br><br />
. Get pSB1C3 bacbone EcoRI and PstI <br><br />
. Fluorescence measurement of MCR/MTA for characterization (second trial) <br><br />
. Innoculate Lock and Keys for crude functional assay. <br><br />
· <br><br />
<br />
<br />
<br />
<br><b>Sept 30</b> <br><br />
Wet lab<br><br />
. miniprep 11 tubes in shaker c <br><br />
. Restrict check H" series with NcoI <br><br />
. Restrict inoculated colonies wiht AseI <br><br />
. Restrict inoculated colonies wiht NcoI <br><br />
. Gel purifications <br><br />
. ligation of H series and some from other series... <br><br />
. transformtation of 16 confirmed constructs <br><br />
· <br><br />
<br />
<br><b>Oct 1</b> <br><br />
Wet lab<br><br />
. digestion of key3,HKUSTkey? <br><br />
. miniprep- final constructs <br><br />
· <br><br />
<br />
<br />
</div><br />
</div><br />
<hr><br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<style type= "text/css"><br />
.scrollToTop{<br />
width:50px; <br />
height:50px;<br />
border: solid 2px;<br />
border-radius:100%;<br />
text-align:center; <br />
font-weight: bold;<br />
position:fixed;<br />
top:550px;<br />
right:50px;<br />
display: none;<br />
color:#383838;<br />
background-color:#C8C8C8;<br />
}<br />
.scrollToTop:hover{<br />
text-decoration:none;<br />
}<br />
</style><br />
<a href="#" class="scrollToTop"><br />
<div class="scrollToTop"><br />
<br><br />
TOP<br />
</div><br />
</a><br />
</footer><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/team/attribution
Team:Hong Kong HKUST/team/attribution
2014-10-17T08:50:53Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<br />
<br />
<style type="text/css"><br />
.start_up_link_button .start_up_link_container{<br />
height: 330px;<br />
}<br />
#slide{width:96%;height:auto;background-color:#F4DFC0;margin-top:-20px;border:2px solid;<br />
border-radius:15px;padding-right:10px;margin-left:15px;}<br />
</style><br />
<br />
</head><br />
</html><br />
|<br />
<html><br />
<body><br />
<div id="content" style="font-size:15px;font-weight:bold;"><br />
<p><br />
<br><br><br><div id="slide"><center><h3 class="title">Attribution</h3></center><br><br />
<ul><br />
All manifested work for our project, including submission and characterization of BioBricks, Human Practice, graphic design and team wiki, was done by HKUST iGEM 2014 team members. The search engine for Human Practice Database is an exception, who was provided by Mr. Kevin Wongso (Graduate Student from HKUST).<br><br><br />
<br />
<h3>Laboratory Work</h3><br />
<b>Team Leader:</b> Haemin CHO and Minjung JOO<br><br><br />
<b>Detection Module:</b><br><br />
Jacqueline Theeng Mei AW, Chloe TANG, Haemin CHO, James HAN, Rinaldi GOTAMA, Alfie Yuk Pui CHAN, Albert MAHANADI, Hye ji KIM, Guillaume TONG<br><br><br />
<b><i>S. pneumoniae</i> σ<sup>x</sup> promoters Module :</b><br><br />
Jordy Evan SULAIMAN, Nadia Benedicta BONGSO, Joseph SUH, Angeline WIDJAJA, Jason Sang Jin JANG , Edward Siu Wang NG, Minjung JOO<br><br><br />
<b>Riboregulator:</b><br> <br />
Raul MEDINA CUELLAR, Doyle Jihwan LEE, Bonnie Hojeong PARK, Eric Ming Fung CHEUNG<br><br> <br />
<br />
<h3>Human Practice Team</h3> <br />
Joseph SUH, Albert MAHANADI, Nadia Benedicta BONGSO, Jordy Evan SULAIMAN, Angeline WIDJAJA, Minjung JOO, Haemin CHO, James HAN, Edward Siu Wang NG, Hye ji KIM</p><br><br />
<h3>Wiki Team</h3><br />
Guillaume TONG, Eric Ming Fung CHEUNG, Jacqueline Theeng Mei AW, Jason JANG, Alfie Yuk Pui CHAN </p><br><br />
<h3>Graphic Design Team</h3><br />
Rinaldi GOTAMA, Chloe TANG, Bonnie Hojeong PARK </p><br><br />
<h3>Others</h3><br />
<strong>Secretary:</strong><br><br />
Jacqueline Theeng Mei AW</p><br />
<strong>Team Manager:</strong><br><br />
Alfie Yuk Pui CHAN</p><br />
<br><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/team/attribution
Team:Hong Kong HKUST/team/attribution
2014-10-17T08:42:34Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<br />
<br />
<style type="text/css"><br />
.start_up_link_button .start_up_link_container{<br />
height: 330px;<br />
}<br />
#slide{width:96%;height:auto;background-color:#F4DFC0;margin-top:-20px;border:2px solid;<br />
border-radius:15px;padding-right:10px;margin-left:15px;}<br />
</style><br />
<br />
</head><br />
</html><br />
|<br />
<html><br />
<body><br />
<div id="content" style="font-size:15px;font-weight:bold;"><br />
<p><br />
<br><br><br><div id="slide"><center><h3 class="title">Attribution</h3></center><br><br />
<ul><br />
All manifested work for our project, including submission and characterization of BioBricks, Human Practice, graphic design and team wiki, was done by HKUST iGEM 2014 team members. The <a herf="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/search_engine">search engine</a> for Human Practice Database is an exception, who was provided by Mr. Kevin Wongso (Graduate Student from HKUST).<br><br><br />
<br />
<h3>Laboratory Work</h3><br />
<b>Team Leader:</b> Haemin CHO and Minjung JOO<br><br><br />
<b>Detection Module:</b><br><br />
Jacqueline Theeng Mei AW, Chloe TANG, Haemin CHO, James HAN, Rinaldi GOTAMA, Alfie Yuk Pui CHAN, Albert MAHANADI, Hye ji KIM, Guillaume TONG<br><br><br />
<b><i>S. pneumoniae</i> σ<sup>x</sup> promoters Module :</b><br><br />
Jordy Evan SULAIMAN, Nadia Benedicta BONGSO, Joseph SUH, Angeline WIDJAJA, Jason Sang Jin JANG , Edward Siu Wang NG, Minjung JOO<br><br><br />
<b>Riboregulator:</b><br> <br />
Raul MEDINA CUELLAR, Doyle Jihwan LEE, Bonnie Hojeong PARK, Eric Ming Fung CHEUNG<br><br> <br />
<br />
<h3>Human Practice Team</h3> <br />
Joseph SUH, Albert MAHANADI, Nadia Benedicta BONGSO, Jordy Evan SULAIMAN, Angeline WIDJAJA, Minjung JOO, Haemin CHO, James HAN, Edward Siu Wang NG, Hye ji KIM</p><br><br />
<h3>Wiki Team</h3><br />
Guillaume TONG, Eric Ming Fung CHEUNG, Jacqueline Theeng Mei AW, Jason JANG, Alfie Yuk Pui CHAN </p><br><br />
<h3>Graphic Design Team</h3><br />
Rinaldi GOTAMA, Chloe TANG, Bonnie Hojeong PARK </p><br><br />
<h3>Others</h3><br />
<strong>Secretary:</strong><br><br />
Jacqueline Theeng Mei AW</p><br />
<strong>Team Manager:</strong><br><br />
Alfie Yuk Pui CHAN</p><br />
<br><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/team/attribution
Team:Hong Kong HKUST/team/attribution
2014-10-17T08:40:33Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<br />
<br />
<style type="text/css"><br />
.start_up_link_button .start_up_link_container{<br />
height: 330px;<br />
}<br />
#slide{width:96%;height:auto;background-color:#F4DFC0;margin-top:-20px;border:2px solid;<br />
border-radius:15px;padding-right:10px;margin-left:15px;}<br />
</style><br />
<br />
</head><br />
</html><br />
|<br />
<html><br />
<body><br />
<div id="content" style="font-size:15px;font-weight:bold;"><br />
<p><br />
<br><br><br><div id="slide"><center><h3 class="title">Attribution</h3></center><br><br />
<ul><br />
All manifested work for our project, including submission and characterization of BioBricks, Human Practice, graphic design and team wiki, was done by HKUST iGEM 2014 team members. The search engine for Human Practice Database is an exception, who was provided by Mr. Kevin Wongso (Graduate Student from HKUST).<br><br><br />
<br />
<h3>Laboratory Work</h3><br />
<b>Team Leader:</b> Haemin CHO and Minjung JOO<br><br><br />
<b>Detection Module:</b><br><br />
Jacqueline Theeng Mei AW, Chloe TANG, Haemin CHO, James HAN, Rinaldi GOTAMA, Alfie Yuk Pui CHAN, Albert MAHANADI, Hye ji KIM, Guillaume TONG<br><br><br />
<b><i>S. pneumoniae</i> σ<sup>x</sup> promoters Module :</b><br><br />
Jordy Evan SULAIMAN, Nadia Benedicta BONGSO, Joseph SUH, Angeline WIDJAJA, Jason Sang Jin JANG , Edward Siu Wang NG, Minjung JOO<br><br><br />
<b>Riboregulator:</b><br> <br />
Raul MEDINA CUELLAR, Doyle Jihwan LEE, Bonnie Hojeong PARK, Eric Ming Fung CHEUNG<br><br> <br />
<br />
<h3>Human Practice Team</h3> <br />
Joseph SUH, Albert MAHANADI, Nadia Benedicta BONGSO, Jordy Evan SULAIMAN, Angeline WIDJAJA, Minjung JOO, Haemin CHO, James HAN, Edward Siu Wang NG, Hye ji KIM</p><br><br />
<h3>Wiki Team</h3><br />
Guillaume TONG, Eric Ming Fung CHEUNG, Jacqueline Theeng Mei AW, Jason JANG, Alfie Yuk Pui CHAN </p><br><br />
<h3>Graphic Design Team</h3><br />
Rinaldi GOTAMA, Chloe TANG, Bonnie Hojeong PARK </p><br><br />
<h3>Others</h3><br />
<strong>Secretary:</strong><br><br />
Jacqueline Theeng Mei AW</p><br />
<strong>Team Manager:</strong><br><br />
Alfie Yuk Pui CHAN</p><br />
<br><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T08:39:57Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>Catalog for regulatory RNAs</h2><br />
<p><font color="white">(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the &lt;parttable&gt; function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is far from complete and is expected to take shape by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</font></p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
siRNAs usually involved in RNA interference pathway. <br />
siRNA s are produced by &quot;dicing&quot; long double stranded RNA into 21-nucleotides<br />
small fragments. The siRNAs will then bind to a protein and one strand of siRNA is removed. Then siRNA, <br />
which have complementary base pairs with its target mRNA, will binds to target mRNA. The binding of siRNA usually causes the degradation of target<br />
mRNA, <br />
result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/team/acknowledgement
Team:Hong Kong HKUST/team/acknowledgement
2014-10-17T08:37:06Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<br />
<br />
<style type="text/css"><br />
.start_up_link_button .start_up_link_container{<br />
height: 330px;<br />
}<br />
#flip_book{<br />
height:600px;<br />
width:900px;<br />
}<br />
#slide{<br />
width:90%;height:auto;background-color:#F4DFC0;margin-top:-5px;border:2px solid;<br />
border-radius:15px;padding:15px;margin-left:35px;<br />
}<br />
</style><br />
<br />
</head><br />
</html><br />
|<br />
<html><br />
<body><br />
<div id="content" style="font-size:14px;"><br />
<br><br><br><div id="slide"><center><h2 class="title"><b>Acknowledgement</b></h2></center> <br />
<br><br />
<p align="left">Our deepest thanks to the following parties, who generously sponsored and supported our cause:</p><br />
<ul><b><br />
<li>Office of the Provost, HKUST</li><br />
<li>Office of the Dean of Science, HKUST</li><br />
</ul></b><br />
<br><br />
<br><br />
<p>iGEM teams from the following institutions kindly exchanged information with us and has greatly helped with us our human practice project:</p><br />
<ul><b><br />
<li>South University of Science and Technology of China (2014 iGEM team)</li><br />
<li>Tec Monterrey (2013 iGEM team)</li><br />
<li>Manchester (2013 iGEM team)</li><br />
<li>Cornell (2013 iGEM team)</li></b><br />
<br />
</ul><br />
<br><br />
<br><br />
<p>We would very much like to thank the following parties for generously sharing their plasmids and gDNA with us. Without their help, we would not be able to complete our devices. </p><br />
<ul><b><br />
<li>Professor Patrick Chiu Yat Woo at Hong Kong University (Department of Microbiology), who provided us with the gDNA of Streptococcus Pneumoniae NCTC 7465 strain.</li><br />
<li>Dr. Don Morrison and all his staffs (Université de Toulouse, UPS, Laboratoire de Microbiologie et Génétique Moléculaires), who provided us with pCEPcin, pKHS-<i>comE</i>, pKHS-<i>comE<sup>R120S</sup></i>, pKHS-<i>comE<sup>D58E</sup></i> and pXPL16.</li><br />
</ul></b><br />
<br><br />
<br><br />
<p>The individuals below participated in our Human Practice Interview and offered much insight for promoting our project beyond academia. We would like to express our great gratitude to:</p><br />
<ul><b><br />
<li>Prof. Lam Hon Ming (Chinese University of Hong Kong)</li><br />
<li>Prof. Tom Richard (Penn State University)</li><br />
<li>Dr. Samuel Yu (Health, Safety and Environment Office of the Hong Kong University of Science and Technology)</li><br />
<li>Ms. Christine Chiu Health, Safety and Environment Office of the Hong Kong University of Science and Technology)</li><br />
</ul></b><br />
<br><br />
<br><br />
<p>We would like to greatly thank below organization for cooperating with us in our Human Practice:</p><br />
<ul><b><br />
<li>Independent Schools Foundation Academy (ISF Academy)</li><br />
</ul></b><br />
<br><br />
<br><br />
<p>Finally, special thanks to the individual below, who built the database search engine for our Human Practice project:</p><br />
<ul><b><br />
<li>Mr. Kevin Wongso (Graduate student from Hong Kong University of Science and Technology)</li><br />
</ul></b><br />
<br><br />
<br><br />
<p>We would also like to thank the following individuals from Division of Life Science at our home institute:</p><br />
<ul><b><br />
<li>Prof. Siu Chun HUNG, who advised on the feasibility of the project as well as various techniques.</li><br />
<li>Jack ZHU for training and advice</li><br />
<li>And all other members at Professor King L. CHOW's laboratory.</li><br />
</ul></b><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results
Team:Hong Kong HKUST/riboregulator/results
2014-10-17T08:32:24Z
<p>Hyht2011: Undo revision 309836 by Hyht2011 (talk)</p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
</head></html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<hr><br />
<br />
<br />
<!-- one row of content , two column--><br />
<div class='content_1'><h3>Overview</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>Although there is a significant number of regulatory RNAs available in the registry, a comprehensive characterization information that the iGEM community can <br />
use to compare and contrast different regulatory RNAs (especially CR-TA riboregulators) is missing.Therefore we wanted to provide characterization information of<br />
regulatory RNAs so teams and labs will be confident in using these devices. </p><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<!-- end of one row of content , two column--><br />
<br />
<!-- one row of content , two column one picture right--><br />
<div class='content_1'><h3>Construct</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>In order to provide reliable characterisation data which will help iGEM teams to identify which CR-TA riboregulator works best for their projects. We have built <br />
constructs like the diagram provided below:<br />
(provide diagram)<br />
<p>Cis-repressing part which was generated by using the Lock and Key algorithm generator from TU Delft 2009 iGEM team and followed by de novo synthesis from oligo <br />
annealing. After annealing, these dsDNA was directly inserted into the vector containing <a href="http://parts.igem.org/Part:BBa_I13401">BBa_I13401</a> ( GFP reporter for RHS of library test constructs). A promoter, <br />
<a href="http://parts.igem.org/Part:BBa_J23102">BBa_J23102</a> was placed upstream by the scar formation of cis-repressing part therefore cis-repressing part can be <br />
constitutively transcribed.Trans-activating part was produced by the same method as cis-repressing part but an inducible promoter, P<sub>bad</sub>, <a href="http://parts.igem.org/Part:BBa_I13401">BBa_I0500 </a>and double terminator, <br />
<a href="http://parts.igem.org/Part:BBa_BBa_B0015">BBa_B0015 </a>were used to replace <a href="http://parts.igem.org/Part:BBa_I13401">BBa_J23102 </a>and <br />
<a href="http://parts.igem.org/Part:BBa_I13401">BBa_I13401 </a>respectively. A low copy plasmid, pSB3K3 was used for GFP expression measurements. For the control of our characterisation, construct containing only RBS, <br />
instead of CR and another construct missing TA were built. To obtain the fluorescence level, autofluorescence had to be subtracted so bacteria containing pSB3K3-E0240<br />
plasmid were used. We have submitted Cis-repressing and Trans-activating parts as well as some of intermediary parts. </p><br />
</div><br />
</td><br />
<br />
</tr><br />
</table><br />
</div><br />
<!-- end of one row of content , two column--><br />
</div><br />
<br><br><br />
<div id="content_container"><br />
<br />
<br />
</div><br />
<br />
<!-- one row of content , two column one picture left--><br />
<div class='content_1'><h3> Results</h3><br />
<table class="content_table" align= "center" ><br />
<br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<div class="content_image"><br />
<br />
</div><br />
<p><br />
<img style= "width:50%" src= "#"/><br />
<br><br />
The above bar graphs represents the level of fluorescence measured by ? and it was plotted as fluorescence/OD600 on y-axis. Culture containing bacteria was <br />
incubated for X hours. (From left to right) For controls of each set of an experiment, (1) a construct without trans-activating part (2) a construct without<br />
cis-repressing part but with a ribosomal binding site (3) a construct without both cis-repressing and trans-activating parts. For our experiment, a construct <br />
containing both cis-repressing and trans-activating parts was used. arabinose concentration of 0%, 1% and 2.5% were used to induce the inducible promoter, P<sub>bad</sub><br />
(<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">P<sub>bad</sub> characterisation</a>). </p><br />
<br />
<br><br><br />
<img style= "width:50%" src= "#"/><br />
<br><br />
<p>Furthermore the orthogonality of five different sets of riboregulators were tested in parallel to the repression and activation strength of riboregulators. <br />
The increase in fluorescence level was calculated using the fluorescence level obtained by plate reader at 0% and 2.5% of arabinose concentrations.</p><br />
</div><br />
</td><br />
<br />
<br />
</tr><br />
</div><br />
</table><br />
</div><br />
<br />
<div class='content_1'><h3> Discussion</h3><br />
<table class="content_table" align= "center" ><br />
<br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<br />
<div class= "content_area_one_row"><br />
<br />
<p><br />
</p><br />
</div><br />
</td><br />
<br />
<br />
</tr><br />
</table><br />
</div><br />
</div><br />
<br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div style= "text-align:center" class="scrollToTop"><br />
<br><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body></html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results
Team:Hong Kong HKUST/riboregulator/results
2014-10-17T08:32:03Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
</head></html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<hr><br />
<br />
<br />
<!-- one row of content , two column--><br />
<div class='content_1'><h3>Overview</h3><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>Although there is a significant number of regulatory RNAs available in the registry, a comprehensive characterization information that the iGEM community can <br />
use to compare and contrast different regulatory RNAs (especially CR-TA riboregulators) is missing.Therefore we wanted to provide characterization information of<br />
regulatory RNAs so teams and labs will be confident in using these devices. </p><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<!-- end of one row of content , two column--><br />
<br />
<!-- one row of content , two column one picture right--><br />
<div class='content_1'><h3>Construct</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p>In order to provide reliable characterisation data which will help iGEM teams to identify which CR-TA riboregulator works best for their projects. We have built <br />
constructs like the diagram provided below:<br />
(provide diagram)<br />
<p>Cis-repressing part which was generated by using the Lock and Key algorithm generator from TU Delft 2009 iGEM team and followed by de novo synthesis from oligo <br />
annealing. After annealing, these dsDNA was directly inserted into the vector containing <a href="http://parts.igem.org/Part:BBa_I13401">BBa_I13401</a> ( GFP reporter for RHS of library test constructs). A promoter, <br />
<a href="http://parts.igem.org/Part:BBa_J23102">BBa_J23102</a> was placed upstream by the scar formation of cis-repressing part therefore cis-repressing part can be <br />
constitutively transcribed.Trans-activating part was produced by the same method as cis-repressing part but an inducible promoter, P<sub>bad</sub>, <a href="http://parts.igem.org/Part:BBa_I13401">BBa_I0500 </a>and double terminator, <br />
<a href="http://parts.igem.org/Part:BBa_BBa_B0015">BBa_B0015 </a>were used to replace <a href="http://parts.igem.org/Part:BBa_I13401">BBa_J23102 </a>and <br />
<a href="http://parts.igem.org/Part:BBa_I13401">BBa_I13401 </a>respectively. A low copy plasmid, pSB3K3 was used for GFP expression measurements. For the control of our characterisation, construct containing only RBS, <br />
instead of CR and another construct missing TA were built. To obtain the fluorescence level, autofluorescence had to be subtracted so bacteria containing pSB3K3-E0240<br />
plasmid were used. We have submitted Cis-repressing and Trans-activating parts as well as some of intermediary parts. </p><br />
</div><br />
</td><br />
<br />
</tr><br />
</table><br />
</div><br />
<!-- end of one row of content , two column--><br />
</div><br />
<br><br><br />
<div id="content_container"><br />
<br />
<br />
</div><br />
<br />
<!-- one row of content , two column one picture left--><br />
<div class='content_1'><h3> Results</h3><br />
<table class="content_table" align= "center" ><br />
<br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<div class="content_image"><br />
<br />
</div><br />
<p><br />
<img style= "width:50%" src= "#"/><br />
<br><br />
The above bar graphs represents the level of fluorescence measured by ? and it was plotted as fluorescence/OD600 on y-axis. Culture containing bacteria was <br />
incubated for X hours. (From left to right) For controls of each set of an experiment, (1) a construct without trans-activating part (2) a construct without<br />
cis-repressing part but with a ribosomal binding site (3) a construct without both cis-repressing and trans-activating parts. For our experiment, a construct <br />
containing both cis-repressing and trans-activating parts was used. arabinose concentration of 0%, 1% and 2.5% were used to induce the inducible promoter, P<sub>bad</sub><br />
(<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">P<sub>bad</sub> characterisation</a>). </p><br />
<br />
<br><br><br />
<img style= "width:50%" src= "#"/><br />
<br><br />
<p>Furthermore the orthogonality of five different sets of riboregulators were tested in parallel to the repression and activation strength of riboregulators. <br />
The increase in fluorescence level was calculated using the fluorescence level obtained by plate reader at 0% and 2.5% of arabinose concentrations.</p><br />
</div><br />
</td><br />
<br />
<br />
</tr><br />
</div><br />
</table><br />
</div><br />
<br />
<div class='content_1'><h3> Discussion</h3><br />
<table class="content_table" align= "center" ><br />
<br />
<tr class= "content_row"><br />
<td class= "content_cell"><br />
<br />
<div class= "content_area_one_row"><br />
<br />
<p><br />
</p><br />
</div><br />
</td><br />
<br />
<br />
</tr><br />
</table><br />
</div><br />
</div><br />
<br />
<footer><br />
<script><br />
$(document).ready(function(){<br />
<br />
//Check to see if the window is top if not then display button<br />
$(window).scroll(function(){<br />
if ($(this).scrollTop() > 100) {<br />
$('.scrollToTop').fadeIn();<br />
} else {<br />
$('.scrollToTop').fadeOut();<br />
}<br />
});<br />
<br />
//Click event to scroll to top<br />
$('.scrollToTop').click(function(){<br />
$('html, body').animate({scrollTop : 0},800);<br />
return false;<br />
});<br />
<br />
});<br />
</script><br />
<a href="#" class="scrollToTop"><br />
<div style= "text-align:center" class="scrollToTop"><br />
Back to top<br />
</div><br />
</a><br />
</footer> <br />
</body></html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts
Team:Hong Kong HKUST/riboregulator/parts
2014-10-17T08:31:34Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
</head></html><br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<br />
<div id="content_container"><br />
<div id="description_area"><br />
<h2>Riboregulator Parts</h2><br />
<br />
<div class = "catalog_table_area"><br />
<div class='content_2'><h3><font color="white">Parts that we submitted</font></h3></div><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Name</th><br />
<th scope="col">Type</th><br />
<th scope="col">Description</th><br />
<th scope="col">Length</th><br />
</tr><br />
</thead><br />
<tbody><br />
<br />
<br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379015">BBa_K1379015</a></td> <br />
<td>Lock 3C RBS</td> <br />
<td>B0032 derivate for Lock 3C</td> <br />
<td>12</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379018">BBa_K1379018</a></td> <br />
<td>HKUST Lock 1</td> <br />
<td>Cis-Repressor HKUST Lock 1</td> <br />
<td>45</td><br />
</tr> <br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379019">BBa_K1379019</a></td> <br />
<td>HKUST Key 1</td> <br />
<td>Trans-Activator for HKUST Key 1</td> <br />
<td>82</td><br />
</tr> <br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379020">BBa_K1379020</a></td> <br />
<td>Cis-repressed GFP Lock 1</td> <br />
<td>Cis-repressed GFP Generator Lock 1</td> <br />
<td>903</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379022">BBa_K1379022</a></td> <br />
<td>Cis-repressed GFP Generator Lock 3</td> <br />
<td>Cis-repressed GFP Generator Lock 3 </td> <br />
<td>905</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379024">BBa_K1379024</a></td> <br />
<td>Cis-repressed GFP Lock 3C</td> <br />
<td>Cis-repressed GFP Generator Lock 3C</td> <br />
<td>905</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379026">BBa_K1379026</a></td> <br />
<td>Cis-repressed GFP Lock MCR</td> <br />
<td>Cis-repressed GFP Generator MCR</td> <br />
<td>910</td><br />
</tr> <br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379028">BBa_K1379028</a></td> <br />
<td>Cis-repressed GFP HKUST Lock 1</td> <br />
<td>Cis-repressed GFP Generator HKUST Lock 1</td> <br />
<td>908</td><br />
</tr> <br />
<br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379046">BBa_K1379046</a></td> <br />
<td>Lock 1 RBS GFP generator</td> <br />
<td>GFP generator using a Lock 1 modified RBS</td> <br />
<td>873</td><br />
</tr> <br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379047">BBa_K1379047</a></td> <br />
<td>Lock 3C RBS GFP generator</td> <br />
<td>GFP generator using a Lock 3C modified RBS</td> <br />
<td>875</td><br />
</tr> <br />
<br />
</table><br />
<br />
<br><br><br />
<div class='content_2'><h3><font color="white">Parts that we are also characterizing</font></h3></div><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Name</th><br />
<th scope="col">Type</th><br />
<th scope="col">Description</th><br />
<th scope="col">Length</th><br />
</tr><br />
</thead><br />
<tbody><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a></td> <br />
<td>Inducible pBad/araC promoter</td> <br />
<td>Inducible pBad/araC promoter</td> <br />
<td>1210</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_J01010">BBa_J01010</a></td> <br />
<td>Riboregulator Lock 1</td> <br />
<td>Biobrick version of Isaacs' riboregulator cis repressed lock, crR12.</td> <br />
<td>40</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K175031">BBa_K175031</a></td> <br />
<td>Lock for medium RBS (B0032) from the lock/key library TUD09</td> <br />
<td>This biobrick generates a mRNA which forms a secondary structure blocking the (medium) RBS.</td> <br />
<td>47</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K175032">BBa_K175032</a></td> <br />
<td>Key for lock of medium (K175031) RBS (B0032) from the lock/key library TUD09</td> <br />
<td>This biobrick generates a mRNA which forms a secondary structure that opens LMR (K175031).</td> <br />
<td>84</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_J23080">BBa_J23080</a></td> <br />
<td>B0034 derived RBS to match spacing of J01122</td> <br />
<td>RBS spacing modification to [RBS] such that the spacing between the shine-delgarno and the ORF is the same as it is in J01122.</td> <br />
<td>10</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379048">BBa_K1379048</a></td> <br />
<td>Cis repressed GFP, with Trans-activator</td> <br />
<td>Repression measurement device 1 with trans activator</td> <br />
<td>2403</td><br />
</tr> <br />
<br />
</tbody><br />
</table><br />
<br />
<br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts
Team:Hong Kong HKUST/riboregulator/parts
2014-10-17T08:24:01Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><head><br />
<br />
</head></html><br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<br />
<div id="content_container"><br />
<div id="description_area"><br />
<h2>Riboregulator Parts</h2><br />
<br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Name</th><br />
<th scope="col">Type</th><br />
<th scope="col">Description</th><br />
<th scope="col">Length</th><br />
</tr><br />
</thead><br />
<tbody><br />
<br />
<br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379015">BBa_K1379015</a></td> <br />
<td>Lock 3C RBS</td> <br />
<td>B0032 derivate for Lock 3C</td> <br />
<td>12</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379018">BBa_K1379018</a></td> <br />
<td>HKUST Lock 1</td> <br />
<td>Cis-Repressor HKUST Lock 1</td> <br />
<td>45</td><br />
</tr> <br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379019">BBa_K1379019</a></td> <br />
<td>HKUST Key 1</td> <br />
<td>Trans-Activator for HKUST Key 1</td> <br />
<td>82</td><br />
</tr> <br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379020">BBa_K1379020</a></td> <br />
<td>Cis-repressed GFP Lock 1</td> <br />
<td>Cis-repressed GFP Generator Lock 1</td> <br />
<td>903</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379022">BBa_K1379022</a></td> <br />
<td>Cis-repressed GFP Generator Lock 3</td> <br />
<td>Cis-repressed GFP Generator Lock 3 </td> <br />
<td>905</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379024">BBa_K1379024</a></td> <br />
<td>Cis-repressed GFP Lock 3C</td> <br />
<td>Cis-repressed GFP Generator Lock 3C</td> <br />
<td>905</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379026">BBa_K1379026</a></td> <br />
<td>Cis-repressed GFP Lock MCR</td> <br />
<td>Cis-repressed GFP Generator MCR</td> <br />
<td>910</td><br />
</tr> <br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379028">BBa_K1379028</a></td> <br />
<td>Cis-repressed GFP HKUST Lock 1</td> <br />
<td>Cis-repressed GFP Generator HKUST Lock 1</td> <br />
<td>908</td><br />
</tr> <br />
<br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379046">BBa_K1379046</a></td> <br />
<td>Lock 1 RBS GFP generator</td> <br />
<td>GFP generator using a Lock 1 modified RBS</td> <br />
<td>873</td><br />
</tr> <br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379047">BBa_K1379047</a></td> <br />
<td>Lock 3C RBS GFP generator</td> <br />
<td>GFP generator using a Lock 3C modified RBS</td> <br />
<td>875</td><br />
</tr> <br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_I0500">BBa_I0500</a></td> <br />
<td>Inducible pBad/araC promoter</td> <br />
<td>Inducible pBad/araC promoter</td> <br />
<td>1210</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_J01010">BBa_J01010</a></td> <br />
<td>Riboregulator Lock 1</td> <br />
<td>Biobrick version of Isaacs' riboregulator cis repressed lock, crR12.</td> <br />
<td>40</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K175031">BBa_K175031</a></td> <br />
<td>Lock for medium RBS (B0032) from the lock/key library TUD09</td> <br />
<td>This biobrick generates a mRNA which forms a secondary structure blocking the (medium) RBS.</td> <br />
<td>47</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K175032">BBa_K175032</a></td> <br />
<td>Key for lock of medium (K175031) RBS (B0032) from the lock/key library TUD09</td> <br />
<td>This biobrick generates a mRNA which forms a secondary structure that opens LMR (K175031).</td> <br />
<td>84</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_J23080">BBa_J23080</a></td> <br />
<td>B0034 derived RBS to match spacing of J01122</td> <br />
<td>RBS spacing modification to [RBS] such that the spacing between the shine-delgarno and the ORF is the same as it is in J01122.</td> <br />
<td>10</td><br />
</tr><br />
<br />
<tr><br />
<td scope="row"><a href="http://parts.igem.org/Part:BBa_K1379048">BBa_K1379048</a></td> <br />
<td>Cis repressed GFP, with Trans-activator</td> <br />
<td>Repression measurement device 1 with trans activator</td> <br />
<td>2403</td><br />
</tr> <br />
<br />
</tbody><br />
</table><br />
<br />
<br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T08:20:17Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>Catalog for regulatory RNAs</h2><br />
<p><font color="white">(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the &lt;parttable&gt; function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is expected to be completed by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</font></p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
siRNAs usually involved in RNA interference pathway. <br />
siRNA s are produced by &quot;dicing&quot; long double stranded RNA into 21-nucleotides<br />
small fragments. The siRNAs will then bind to a protein and one strand of siRNA is removed. Then siRNA, <br />
which have complementary base pairs with its target mRNA, will binds to target mRNA. The binding of siRNA usually causes the degradation of target<br />
mRNA, <br />
result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog
Team:Hong Kong HKUST/riboregulator/RNA devices catalog
2014-10-17T08:16:53Z
<p>Hyht2011: moved Team:Hong Kong HKUST/riboregulator/RNA devices catalog to Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog: rename to fit new title</p>
<hr />
<div>#REDIRECT [[Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog]]</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T08:16:53Z
<p>Hyht2011: moved Team:Hong Kong HKUST/riboregulator/RNA devices catalog to Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog: rename to fit new title</p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>Catalog for regulatory RNAs</h2><br />
<p>(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the &lt;parttable&gt; function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is expected to be completed by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
siRNAs usually involved in RNA interference pathway. <br />
siRNA s are produced by &quot;dicing&quot; long double stranded RNA into 21-nucleotides<br />
small fragments. The siRNAs will then bind to a protein and one strand of siRNA is removed. Then siRNA, <br />
which have complementary base pairs with its target mRNA, will binds to target mRNA. The binding of siRNA usually causes the degradation of target<br />
mRNA, <br />
result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T08:16:15Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>Catalog for regulatory RNAs</h2><br />
<p>(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the &lt;parttable&gt; function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is expected to be completed by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
siRNAs usually involved in RNA interference pathway. <br />
siRNA s are produced by &quot;dicing&quot; long double stranded RNA into 21-nucleotides<br />
small fragments. The siRNAs will then bind to a protein and one strand of siRNA is removed. Then siRNA, <br />
which have complementary base pairs with its target mRNA, will binds to target mRNA. The binding of siRNA usually causes the degradation of target<br />
mRNA, <br />
result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T08:15:03Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>RNA devices catalog</h2><br />
<p>(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the &lt;parttable&gt; function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is expected to be completed by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
siRNAs usually involved in RNA interference pathway. <br />
siRNA s are produced by &quot;dicing&quot; long double stranded RNA into 21-nucleotides<br />
small fragments. The siRNAs will then bind to a protein and one strand of siRNA is removed. Then siRNA, <br />
which have complementary base pairs with its target mRNA, will binds to target mRNA. The binding of siRNA usually causes the degradation of target<br />
mRNA, <br />
result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T08:04:57Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>RNA devices catalog</h2><br />
<p>(The page was created as part of iGEM 2014 HKUST team's effort in <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">"Project Riboregulator"</a> to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This is not useful for looking up and utilizing them.<br />
<br><br><br />
We would like to solve this problem by designing a list of category tags as well as a guideline, so that automated display of regulatory RNAs by the <parttable> function can be facilitated. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval, we will tag existing regulatory RNAs and complete the page. Being part of the cross-cohort "Project Riboregulator", the page is expected to be completed by Spring 2015. We welcome and encourage constant update and adoption of this page in the future.)</p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
siRNAs usually involved in RNA interference pathway. <br />
siRNA s are produced by &quot;dicing&quot; long double stranded RNA into 21-nucleotides<br />
small fragments. The siRNAs will then bind to a protein and one strand of siRNA is removed. Then siRNA, <br />
which have complementary base pairs with its target mRNA, will binds to target mRNA. The binding of siRNA usually causes the degradation of target<br />
mRNA, <br />
result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T07:58:56Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>RNA devices catalog</h2><br />
<p>(The page was created as part of iGEM 2014 HKUST team's effort in Project Riboregulator to catalog existing regulatory RNAs. Over the years, the number of regulatory RNAs in Part Registry has steadily increased over time and many has been made available to end users. Based on different mode actions and natures of regulatory RNAs, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. Some of them are grouped under type &quot;RNA&quot;, while others are not. This was not useful who looking up and utilizing those regulatory RNAs.<br />
<br><br>We would like to solve this problem by grouping RNA devices according <br />
to the natures and functions. We are designing a list of category tags as well as a guideline for automated display of regulatory RNAs on this page. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval of suggestions, we will continue to tag existing regulatory RNAs and complete the page. We welcome and encourage constant update and adoption of this page in the future.)<br />
<br />
</p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
siRNAs usually involved in RNA interference pathway. <br />
siRNA s are produced by &quot;dicing&quot; long double stranded RNA into 21-nucleotides<br />
small fragments. The siRNAs will then bind to a protein and one strand of siRNA is removed. Then siRNA, <br />
which have complementary base pairs with its target mRNA, will binds to target mRNA. The binding of siRNA usually causes the degradation of target<br />
mRNA, <br />
result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/regulatory_RNAs_catalog
Team:Hong Kong HKUST/riboregulator/regulatory RNAs catalog
2014-10-17T07:51:00Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><body><div id="content_container"><br />
<div id="description_area"><br />
<h2>RNA devices catalog</h2><br />
<p>(The page was created as part of iGEM 2014 HKUST team's effort in Project Riboregulator to catalog existing regulatory RNA. With better understanding of the regulatory ability of RNA devices, more RNA devices were constructed and make available to end users, and the number of RNA devices in part registry have been steadily increasing over time. Based on different mode of<br />
action and natures of regulatory RNA, they can be grouped into different categories. However, the Part Registry currently does not have a catalog page, categorizing methods or guidelines to organize and curate existing regulatory RNAs. For example, some RNA devices are grouped under type &quot;RNA&quot;, while others are under other irrelevant groups. This was not very helpful for teams <br />
in looking up and utilizing those regulatory RNAs.<br />
<br><br>We would like to solve this problem by grouping RNA devices according <br />
to the natures and functions. We are designing a list of category tags as well as a guideline for automated display of regulatory RNAs on this page. By doing so, we hope that we can assist other users to find and use those parts efficiently.<br />
<br><br><br />
This page was written in compliance with Part Registry's format for general Catalog Pages. Currently, the information is uploaded manually because we have yet to submit our suggestions to iGEM HQ. Upon approval of suggestions, we will continue to tag existing regulatory RNAs and complete the page. We welcome and encourage constant update and adoption of this page in the future.)<br />
<br />
</p><br />
<br />
</div><br />
<br />
<!--catalog --><br />
<div class='content_1'><h3>Riboregulator</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
Riboregulators regulate translation by having two elements, a cis-repressive sequence upstream of RBS in mRNA, and a non-coding RNA device, called trans-activating RNA. <br />
The cis-repressive sequence will binds to the 5&#39;UTR, including the RBS by <br />
Watson-Crick base pairing, the sequestration of RBS represses translation. <br />
While trans-activating RNA will form complementary bases to cis-repressive <br />
sequence and exposing RBS for ribosomal binding and allow translation. <br />
<p>Proposed Categories:<br />
/RNA/non_coding/post_transcriptional/Riboregulator</p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759028</a></td> <br />
<td>cis4-repressed, tet-regulated Q</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759014</a></td> <br />
<td>(cis2-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759017</a></td> <br />
<td>cis5-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759018</a></td> <br />
<td>cis6-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759019</a></td> <br />
<td>cis7-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759013</a></td> <br />
<td>cis1-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759032</a></td> <br />
<td>Ptet_cis1_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759034</a></td> <br />
<td>Ptet_cis2_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759036</a></td> <br />
<td>Ptet_cis3_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759038</a></td> <br />
<td>Ptet_cis4_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759040</a></td> <br />
<td>Ptet_cis5_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759042</a></td> <br />
<td>Ptet_cis6_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759044</a></td> <br />
<td>Ptet_cis7_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759046</a></td> <br />
<td>Ptet_cis8_YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759023</a></td> <br />
<td>pBAD-trans2</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759022</a></td> <br />
<td>pBAD-trans1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759024</a></td> <br />
<td>pBAD-trans3</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759025</a></td> <br />
<td>pBAD-trans4</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759026</a></td> <br />
<td>pBAD-trans5</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714070</a></td> <br />
<td>R0040-J23078-pTet-Lock3 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714080</a></td> <br />
<td>[R0040][J23078][E0040][B0015]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714081</a></td> <br />
<td>R0040-J01010-E0040-B0015 </td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714037</a></td> <br />
<td>R751+ C600 E.coli cells with traI-R751 knockout</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Peking 2007</td> <br />
<td><a href="#">BBa_I714074</a></td> <br />
<td>R0010-J23066-pLac-Key3-DblTerm Uses Lock and Key 3 from berkeley</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145215</a></td> <br />
<td>FILTER Key (TetR promoter + key)</td> <br />
</tr><br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol Lock from berkeley </td> <br />
</tr><br />
<br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145217</a></td> <br />
<td>FILTER Complete The two previous together </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145220</a></td> <br />
<td>INVERTED TIMER </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145225</a></td> <br />
<td>RESET lactonase </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145300</a></td> <br />
<td>Lactonase controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145301</a></td> <br />
<td>lacI controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145302</a></td> <br />
<td>luxI generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145303</a></td> <br />
<td>GFP generator controlled by key/lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145003</a></td> <br />
<td>T7 PoPS -> RiboKey 3d</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145004</a></td> <br />
<td>T7 PoPS + RiboLock |> LuxI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145005</a></td> <br />
<td>T7 PoPS + PR -> cI</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145216</a></td> <br />
<td>FILTER T7 RNA pol </td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145251</a></td> <br />
<td>OLD RESET lactonase</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145253</a></td> <br />
<td>OLD INVERTIMER Part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145255</a></td> <br />
<td>NEW INVERTIMER part 1</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145264</a></td> <br />
<td>test FILTER (new)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145265</a></td> <br />
<td>test FILTER (old)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145271</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145272</a></td> <br />
<td>GFP regulated by AND-gate</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145275</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter (filter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145276</a></td> <br />
<td>T7 polymerase generator under TetR repressible promoter</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145277</a></td> <br />
<td>T7 DNA polymerase regulated by lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2008</td> <br />
<td><a href="#">BBa_K145278</a></td> <br />
<td>T7 DNA polymerase regulated by [lock3d]</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238004</a></td> <br />
<td>Vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238006</a></td> <br />
<td>Short version of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">K.U. Leuven 2009</td> <br />
<td><a href="#">BBa_K238012</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607005</a></td> <br />
<td>short version II of vanillin synthesis</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Groningen 2011</td> <br />
<td><a href="#">BBa_K607000</a></td> <br />
<td>PhybB_taRNA</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235010</a></td> <br />
<td>[K145303] (ribokey-controlled GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235000</a></td> <br />
<td>[R0010][J23066] (pLac+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235001</a></td> <br />
<td>[J23102][J23066] (constitutive promoter+ribokey+stop)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235009</a></td> <br />
<td>[J23102][J23032] (constitutive promoter+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235011</a></td> <br />
<td>[K235009][K235005] (ribokey-controlled mCherry generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235013</a></td> <br />
<td>[K145303][K235000] (ribokey-mediated pLac-controlled GFP reporter)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235014</a></td> <br />
<td>[K145303][K235001] (ribokey-mediated GFP generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235016</a></td> <br />
<td>[I0500][J23032] (pAra+ribolocked RBS)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235019</a></td> <br />
<td>[K235016][K235003] (ribokey-mediated pAra-controlled lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235021</a></td> <br />
<td>[K235009][K235003] (ribokey-mediated lambda repressor generator)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235022</a></td> <br />
<td>[K235018][K235019] (mCherry generator, pAra-controlled ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235024</a></td> <br />
<td>[K235018][K235021] (mCherry generator, ribokey-mediated signal inversion)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235025</a></td> <br />
<td>[K235022][K235000] (NAND gate, pAra and pLac input signal control, mCherry output signal)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235026</a></td> <br />
<td>[K235022][K235001] (NAND gate control test, pLac positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235027</a></td> <br />
<td>[K235024][K235000] (NAND gate control test, arabinose positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">VictoriaBC 2009</td> <br />
<td><a href="#">BBa_K235028</a></td> <br />
<td>[K235024][K235001] (NAND gate control test, positive control)</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085000</a></td> <br />
<td>(lacI)promoter->key3c</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Melborne2008</td> <br />
<td><a href="#">BBa_K085002</a></td> <br />
<td>pTet->lock3d->GFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737003</a></td> <br />
<td>OmpF controlled RNA Key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737006</a></td> <br />
<td>Temperature induced repression/activation of an RNA key</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Calgary 2007</td> <br />
<td><a href="#">BBa_I737005</a></td> <br />
<td>AHL and RNA lock controlled AraC</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Riboswitch </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
A riboswitch is a segment on mRNA that have the ability to detect small <br />
molecules or temperature, and regulate gene expression in on or off manner. <br />
Riboswitches usually contain a region for binding of small molecules, as known<br />
as sensor domain, and a region for gene regulation, as known as regulatory domain.In the presence of suitable ligand in the sensor domain, <br />
the structure of riboswitch will change.<br />
This change in conformation of riboswitch may give various action including translation inhibition or mRNA degradation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>RNA-IN-RNA-OUT </h3><br />
<div class= "catalog_description_area"><br />
<p><br />
RNA-OUT is a small non-coding RNA that works at RNA level .<br />
RNA-OUT will bind to 5&#39;UTR, which include RBS, of mRNA and prevents <br />
ribosome from binding to mRNA to inhibit translation of downstream gene. <br />
RNA-IN is also a non-coding RNA that is antisense to RNA-OUT and the binding<br />
of RNA-IN and RNA-OUT will prevent RNA-OUT from binding to mRNA, <br />
thus allowing ribosome to bind to mRNA and initiate translation. </p><br />
</p><br />
<br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --><br />
<!--catalog --><br />
<div class='content_1'><h3>Small interfering RNAs &#40;siRNAs&#41;</h3><br />
<div class= "catalog_description_area"><br />
<p><br />
siRNAs usually involved in RNA interference pathway. <br />
siRNA s are produced by &quot;dicing&quot; long double stranded RNA into 21-nucleotides<br />
small fragments. The siRNAs will then bind to a protein and one strand of siRNA is removed. Then siRNA, <br />
which have complementary base pairs with its target mRNA, will binds to target mRNA. The binding of siRNA usually causes the degradation of target<br />
mRNA, <br />
result in inhibition of gene expression.</p><br />
<br />
</div><br />
<div class = "catalog_table_area"><br />
<table class= "catalog_table"><br />
<thead><br />
<tr><br />
<th scope="col">Part number</th><br />
<th scope="col">Description</th><br />
<th scope="col">Designer</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175029</a></td> <br />
<td>Weak lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for lcok of weak RBS</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175030</a></td> <br />
<td>Key for Medium lock</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>(Constitutive expression of GFP with weak RBS lock and inducible production of key for the lock Composite of K175029 + K175030</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Delft 2009</td> <br />
<td><a href="#">BBa_K175034</a></td> <br />
<td>Constitutive expression of GFP with medium RBS lock and inducible production of key for the lock Composite of K175031 + K175032</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759015</a></td> <br />
<td>cis3-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759016</a></td> <br />
<td>cis4-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759020</a></td> <br />
<td>cis8-repressed, tet-regulated YFP</td> <br />
</tr> <br />
<tr><br />
<td scope="row">Caltech 2007</td> <br />
<td><a href="#">BBa_I759027</a></td> <br />
<td>cis3-repressed, tet-regulated Q</td> <br />
</tr> <br />
</tbody><br />
</table><br />
<br />
</div><br />
</div><br />
<!--end of catalog --> <br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/CR_TA_Feature_Page
Team:Hong Kong HKUST/riboregulator/CR TA Feature Page
2014-10-17T07:34:31Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script><br />
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
</head><br />
</html><br />
|<br />
<html><head><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/catalog_table.css&action=raw&ctype=text/css" type="text/css" ><br />
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Team:Hong_Kong_HKUST/featurepage.css&action=raw&ctype=text/css" type="text/css" /><br />
<br />
</head><body><br />
<div id="content_container"><br />
<br />
<div class="feature_page_content"><br />
<div id="description_area"><br />
<h2>Riboregulator Feature Page</h2><br />
<p><font color="white">(The page was created as part of our effort in Project Riboregulator to summarize identifiable riboregulators in the Part Registry and promote their uses. It was written in compliance with Part Registry's format for Feature Pages. We welcome and encourage constant update and adoption of this page.)</font></p><br />
</div><br />
<h2>Introduction to riboregulators</h2><br />
<br />
<div class = "feature_page_image_container"><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/HKUST_2014_Isaacs_riboregulator_figure.png"><br />
<h3>Figure 1. </h3><br />
<h4> Artificial riboregulator system used to control post-transcriptional regulation (Isaacs et al.,2004). </h4><br />
</div><br />
<p><br />
Regulatory RNAs are small RNA that regulates biological <br />
processes such as transcription or translation. The use of <br />
regulatory RNAs has been a great interest in the field of<br />
synthetic biology because it provides an additional level <br />
of regulation for biological circuits and systems. Regulatory<br />
RNAs have also used by many iGEM teams. We have identified 7 teams<br />
that have used cis-repressing (CR) and trans-activating (TA) <br />
riboregulator system and more teams that have used riboswitches. <br />
For example, Isaacs 2005, UC Berkeley 2006 and Caltech 2007 <br />
contributed many CR and TA devices to the Registry. <br />
</p><br />
<p><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by the UC Berkeley iGEM 2005 team. <br />
The riboregulator system as a whole acts to regulate translation <br />
at the RNA level. One component of the system ,crRNA, which contains<br />
a cis-repressing sequence 5&#39; of the RBS, RBS, and gene of interest. The cis-repressing sequence can form a loop form complementary<br />
base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly described as a &quot;lock&quot; because it &quot;locks&quot; <br />
the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA.<br />
taRNA can interact (in trans) with the cis-repressing sequence to unlock the RBS and therefore to activate translation (Figure 1.). <br />
</p><br />
<p><br />
The benefits of this system, as described in Isaacs et al.&#39;s paper,<br />
are leakage minimization, fast response time, tunability, <br />
independent regulation of multiple genes etc<sup>1</sup>. <br />
</p><br />
<br />
<table id= "team_info_table"><br />
<tr><br />
<th>Team</th><br />
<th>Track</th><br />
<th>Chassis </th><br />
</tr><br />
<tr><br />
<td>Berkeley 2006 </td><br />
<td>This team has not been assigned to a track.</td><br />
<td>E. coli </td><br />
</tr><br />
<tr><br />
<td>Caltech 2007</td><br />
<td>Foundational Research</td><br />
<td>E. coli </td><br />
</tr><br />
<tr><br />
<td>Delft 2009</td><br />
<td>Information Processing</td><br />
<td>E. coli </td><br />
</tr><br />
<tr><br />
<td>Groningen 2011</td><br />
<td>Information Processing</td><br />
<td>E. coli </td><br />
</tr><br />
<tr><br />
<td>K.U. Leuven 2008</td><br />
<td>This team has not been assigned to a track.</td><br />
<td>E. coli </td><br />
</tr><br />
<tr><br />
<td>K.U. Leuven 2009</td><br />
<td>Manufacturing</td><br />
<td>E. coli</td><br />
</tr><br />
<tr><br />
<td>Melbourne 2008</td><br />
<td>This team has not been assigned to a track.</td><br />
<td>E. coli</td><br />
</tr><br />
<tr><br />
<td>Peking 2007</td><br />
<td>Information Processing</td><br />
<td>E. coli</td><br />
</tr><br />
<tr><br />
<td>Victoria BC 2009</td><br />
<td>Manufacturing</td><br />
<td>E. coli</td><br />
</tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
</div><br />
<hr><br />
<br />
<div class="feature_page_content"><br />
<h2>Riboregulator parts in the Registry</h2><br />
<br />
<br />
<table id= "part_info_table"> <br />
<tr><br />
<th>Name</th><br />
<th>Description</th><br />
<th>Length</th><br />
<th>Designed by</th><br />
<th>Group </th><br />
</tr><br />
<br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_J01008">BBa_J01008</a></td><br />
<td>Riboregulator key 1 </td><br />
<td>94</td><br />
<td>Golden Bear</td><br />
<td>iGEM2005 </td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_J01010">BBa_J01010</a></td><br />
<td>Riboregulator Lock 1</td> <br />
<td>40</td><br />
<td>Golden Bear</td><br />
<td>iGEM2005 </td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_J01086">BBa_J01086</a></td><br />
<td>Key3 </td><br />
<td>94</td><br />
<td>Golden Bear</td><br />
<td>iGEM2005 </td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_J01080">BBa_J01080</a></td><br />
<td>Lock3 </td><br />
<td>40</td><br />
<td>Golden Bear</td><br />
<td>iGEM2005 </td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_K175029">BBa_K175029</a></td><br />
<td>Lock for weak RBS (B0031) from the lock/key library TUD09</td><br />
<td>49</td><br />
<td>Daniel Solis Escalante</td><br />
<td>iGEM09_TUDelft </td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_K175030">BBa_K175030</a></td><br />
<td>Key for lock of weak (K175029) RBS (B0031) from the lock/key library TUD09</td><br />
<td>86</td><br />
<td>Daniel Solis Escalante </td><br />
<td>iGEM09_TUDelft </td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_K175031">BBa_K175031</a></td><br />
<td>Lock for medium RBS (B0032) from the lock/key library TUD09</td><br />
<td>47</td><br />
<td>Daniel Solis Escalante </td><br />
<td>iGEM09_TUDelft </td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_K175032">BBa_K175032</a></td><br />
<td>Key for lock of medium (K175031) RBS (B0032) from the lock/key library TUD09</td><br />
<td>84</td><br />
<td>Daniel Solis Escalante </td><br />
<td>iGEM09_TUDelft </td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_I759036">BBa_I759036</a></td><br />
<td>Ptet_cis3_YFP</td><br />
<td>829</td><br />
<td>Kat Pak </td><br />
<td>iGEM07_Caltech</td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_I759022">BBa_I759022</a></td><br />
<td>pBAD-trans1</td><br />
<td>1693</td><br />
<td>Kat Pak </td><br />
<td>iGEM07_Caltech</td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_I759023">BBa_I759023</a></td><br />
<td>pBAD-trans2</td><br />
<td>1706</td><br />
<td>Kat Pak </td><br />
<td>iGEM07_Caltech</td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_J23066">BBa_J23066</a></td><br />
<td>[key3c][key3d][B0015]</td><br />
<td>336</td><br />
<td>Will Bosworth</td><br />
<td>iGEM2006_Berkeley</td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_J23078">BBa_J23078</a></td><br />
<td>lock3i</td><br />
<td>52</td><br />
<td>John Anderson </td><br />
<td>iGEM2006_Berkeley</td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_J23008">BBa_J23008</a></td><br />
<td>key3c</td><br />
<td>94</td><br />
<td>Kaitlin Davis </td><br />
<td>iGEM2006_Berkeley</td><br />
</tr><br />
<tr><br />
<td><a href="http://parts.igem.org/Part:BBa_J23032">BBa_J23032</a></td><br />
<td>lock3d</td><br />
<td>43</td><br />
<td>John Anderson </td><br />
<td>iGEM2006_Berkeley</td><br />
</tr><br />
<br />
</table><br />
<br />
</div><br />
<br />
<div class="feature_page_content"><br />
<h2>Usage of riboregulator by different iGEM teams</h2><br />
<br />
<br />
<p><br />
The usage of the riboregulator system can be versatile; Different <br />
teams utilized the system in different ways. In general, introducing the<br />
riboregulator system to a certain circuit allows another level regulation. The new <br />
level of regulation then can give possible outcomes such as: specific interaction/communication<br />
(UC Berekeley 2006/ Caltech 2007); minimization of leakage by introducing post-transcriptional<br />
repression (Calgary 2007); and modulation of different concentrations of desired outcome (K.U. Leuven 2009). <br />
</p><br />
<br />
</div><br />
<br />
<br />
<div class="feature_page_content"><br />
<h2><a href="https://2006.igem.org/wiki/index.php/University_of_California_Berkeley_2006">UC Berkeley 2006</a></h2><br />
<br />
<h5 class= "page_link"><a href="https://2006.igem.org/wiki/index.php/Berkeley2006-RiboregulatorsMain"> Berkeley riboregulator page </a></h5><br />
<br />
<p><br />
<strong>Abstract: </strong><br />
Networks of interacting cells provide the basis for neural learning. <br />
We have developed the process of addressable conjugation for <br />
communication within a network of E. coli bacteria. Here, bacteria<br />
send messages to one another via conjugation of plasmid DNAs, but<br />
the message is only meaningful to cells with a matching address <br />
sequence. In this way, the Watson Crick base-pairing of addressing <br />
sequences replaces the spatial connectivity present in neural systems.<br />
To construct this system, we have adapted natural conjugation systems<br />
as the communication device. Information contained in the transferred<br />
plasmids is only accessible by "unlocking" the message using RNA based 'keys'. The resulting addressable conjugation process is being adapted to construct a network of NAND logic gates in bacterial cultures. <br />
Ultimately, this will allow us to develop networks of bacteria capable of <br />
trained learning. <br />
</p><br />
<br />
<p>Berkeley Riboregulator Reference :</p><br />
<ol><br />
<br />
<li>Isaacs, Dwyer DJ, Ding C, Pervouchine DD, Cantor CR, Collins JJ. "Engineered riboregulators enable post-transcriptional control of gene expression"</li><br />
<br />
</ol><br />
</div><br />
<br />
<br />
<br />
<div class="feature_page_content"><br />
<h2><a href="https://2007.igem.org/Calgary">Calgary 2007</a></h2><br />
<br />
<h5 class= "page_link"><a href="https://2007.igem.org/Calgary/constructing_wetlab">Calgary riboregulator page </a></h5><br />
<p><br />
<strong>Abstract: </strong><br />
The project we selected was to design and build a biomechanical printer; composed of a two dimensional plotter <br />
equipped with a red laser, software to translate computer images into instructions for the plotter, and E. coli <br />
cells engineered to respond to the laser light. Bacteria are spread in a solid lawn on the plate,<br />
or mixed in the media before pouring the plate. The response triggered by this biological circuit will produce beta agarase, <br />
an enzyme which degrades the agar polymer that the cells rest on.<br />
</p><br />
<p>The printer can then be used to "draw" high resolution images on the bacteria with the laser. The bacteria will then dissolve the agar where the laser was shone. This results in Bacterial Lithography, where the dissolved agar forms a picture.</p><br />
<p>We also chose a second project to include in our entry to the competition this year. That is an in Silico Biobrick Evolution system. The purpose of this project is to design a system that will accept user entered parameters and use them to search through the registry database. Using the given parameters the system will try to construct circuits (a series of biobricks) that will produce the desired product. More information on this project can be found in our evoGEM sections.</p><br />
</div><br />
<br />
<br />
<div class="feature_page_content"><br />
<h2><a href="https://2007.igem.org/wiki/index.php/Caltech/Highlights">Caltech 2007</a></h2><br />
<br />
<h5 class= "page_link"><a href="http://openwetware.org/wiki/IGEM:Caltech/2007/Project/Riboregulator">Caltech riboregulator page </a></h5><br />
<br />
<img src ="https://static.igem.org/mediawiki/2014/thumb/9/9a/HKUST2014_caltech_2007_riboregulator.png/800px-HKUST2014_caltech_2007_riboregulator.png"><br />
<p><br />
<strong>Abstract: </strong><br />
Our project attacks the following problem: can one engineer viruses to selectively kill or modify specific subpopulations of target cells, based on their RNA or protein expression profiles?<br />
</p><br />
<p><br />
This addresses an important issue in gene therapy, where viruses engineered for fine target discrimination would selectively kill only those cells over- or under-expressing specific disease or cancer associated genes. Alternatively, these viruses could be used to discriminate between strains in a bacterial co-culture, allowing strain-specific modification or lysis.<br />
</p><br />
<p><br />
This is clearly an ambitious goal, so we brainstormed a simple model of this problem suitable for undergraduates working over a summer. The bacteriophage λ is a classic, well studied virus capable of infecting E. coli, another classic model genetic system. We therefore seek to engineer a λ strain targeted to lyse specific subpopulations of E. coli based on their transcriptional profiles. Together, λ and E. coli provide a tractable genetic model for this larger problem, while hopefully providing lessons applicable to more ambitious, future projects.<br />
</p><br />
<p><br />
Caltech Riboregulator references <br />
</p><br />
<br />
<ol><br />
<br />
<li>Isaacs, Dwyer DJ, Ding C, Pervouchine DD, Cantor CR, Collins JJ. "Engineered riboregulators enable post-transcriptional control of gene expression"</li><br />
<br />
</ol><br />
<br />
</div><br />
<br />
<div class="feature_page_content"><br />
<h2><a href="https://2009.igem.org/Team:TUDelft">Delft 2009</a></h2><br />
<br />
<h5 class= "page_link"><a href="https://2009.igem.org/Team:TUDelft/Lock/Key_library">Delft Riboregulator page </a></h5><br />
<br />
<p><br />
<strong>Abstract: </strong><br />
Our project aims to design a genetic device able to count and memorize the occurrences of an input signal. We achieved this by utilization of auto-inducing loops, that act as memory units, and an engineered riboregulator, acting as an AND gate. The design of the device is modular, allowing free change of both input and output signals. Each increase of the counter results in a different output signal. The design allows implementation of any number of memory units, as the AND gate design enables to extend the system in a hassle-free way. In order to tweak bistable autoinducing loops we need a very fast and robust method for characterizing parts. For this we have created a genetic algorithm that will enable us to find parameters of the parts used in the design. It also allows the combination of data from multiple experiments across models with overlapping components <br />
</p><br />
<br />
<p><br />
Delft Riboregulator references <br />
</p><br />
<ol><br />
<br />
<li>Smolke C, 2009, It&#39;s the DNA That Counts, Science, 324:1156-1157.</li><br />
<li>Sprinzak D and Elowitz M, 2005, Reconstruction of genetic circuits, Nature, 438-24:443-448.</li><br />
<li>Isaacs F, Dwyer d and Collins J, 2006, RNA synthetic biology, Nature Biotech., 24:545-554.</li><br />
<li>Anderson C, Voigt C and Arkin A, 2007, Environmental signal integration by a modular AND gate, Molecular systems biology, 3-133:1-8.</li><br />
<li>Isaacs F, Dwyer d and Collins J, 2004, Engineered riboregulators enable post-transcriptional control of gene expression, Nature Biotechnology, 22-7:841-847.</li><br />
</ol><br />
<br />
</div><br />
<div class="feature_page_content"><br />
<h2><a href="https://2011.igem.org/Team:Groningen">Groningen 2011</a></h2><br />
<br />
<h5 class= "page_link"><a href="https://2011.igem.org/Team:Groningen/project_AND_gate">Groningen Riboregulator page </a></h5><br />
<br />
<img src ="https://static.igem.org/mediawiki/2014/8/8c/HKUST2014_groningen_2011.png"><br />
<p><br />
<strong>Abstract: </strong><br />
In our project we aim to create a cell-to-cell communication system that allows the propagation of a multi-task message with the capability of being reset. To achieve this, the system will include a reengineered conjugation system, a time-delay genetic circuit and a self-destructive plasmid. This system could be the basis for creating a long distance biosensor and/or be applied in reducing antibiotic resistance of bacteria. Furthermore, we have done a parallel research on the different perceptions of iGEM participants and supervisors on ethical issues in synthetic biology. We focused on the consequences of the ultimate conditions of the top-down and bottom-up approaches as applied in biology. <br />
</p><br />
<p><br />
Groningen Riboregulator reference<br />
</p><br />
<br />
<ol><br />
<li>Isaacs, Dwyer DJ, Ding C, Pervouchine DD, Cantor CR, Collins JJ. "Engineered riboregulators enable post-transcriptional control of gene expression"</li><br />
</ol><br />
<br />
</div><br />
<div class="feature_page_content"><br />
<h2><a href="https://2008.igem.org/Team:KULeuven">K.U. Leuven 2008 </a></h2><br />
<br />
<h5 class= "page_link"><a href="https://2008.igem.org/Team:KULeuven/Project/Reset">K.U Leuven 2008 Riboregulator page</a></h5><br />
<br />
<p><br />
<strong>Abstract: </strong><br />
Imagine a bacterium that produces a drug when and where it is needed in the human body. It would have several advantages over classical drugs and could have many medical applications. In this framework we proudly present our team's project: Dr. Coli, the bacterial drug delivery system. Dr. Coli senses the disease signal and produces the appropriate amount of drugs to meet the individual patient's needs. And when the patient is cured, Dr. Coli self-destructs. To do this, a molecular timer registers the time since the last disease signal sensed. But when the disease flares up again, this timer is reset and drug production is resumed. Within the time frame of the iGEM competition, we developed a proof of concept of Dr. Coli. The most important assets are massive reuse of standard biobricks, different control mechanisms and extensive modeling.<br />
</p><br />
<br />
</div><br />
<div class="feature_page_content"><br />
<h2><a href="https://2009.igem.org/Team:KULeuven">K.U. Leuven 2009 </a></h2><br />
<br />
<h5 class= "page_link"><a href="https://2009.igem.org/Team:KULeuven/Design/Key_Antikey">K.U Leuven 2009 Riboregulator page</a></h5><br />
<br />
<p><br />
<strong>Abstract: </strong><br />
'Essencia coli' is a vanillin producing bacterium equipped with a control system that keeps the concentration of vanillin at a constant level. The showpiece of the project is the feedback mechanism. Vanillin synthesis is initiated by irradiation with blue light. The preferred concentration can be modulated using the intensity of that light. At the same time the bacterium measures the amount of vanillin outside the cell and controls its production to maintain the set point. The designed system is universal in nature and has therefore potential benefits in different areas. The concept can easily be applied to other flavours and odours. In fact, any application that requires a constant concentration of a molecular substance is possible.<br />
</p><br />
</div><br />
<div class="feature_page_content"><br />
<h2><a href="https://2008.igem.org/Team:Melbourne">Melbourne 2008</a></h2><br />
<br />
<h5 class= "page_link"><a href="https://2009.igem.org/Team:KULeuven/Design/Key_Antikey">Melbourne 2008 Riboregulator page</a></h5><br />
<br />
<p><br />
<strong>Abstract: </strong><br />
This year Melbourne iGEM competition team seeks to build a temporal controller in E. coli. The idea is to build a system, which is modular, has all components in the form of biobricks, and expresses gene(s) at a specific time in a sequential manner. In this study, we show the design, modeling and some experimental results towards a proof of principle of the system. The design uses the leverage of existing biobricks of red light bacterial photography system, positive feedback loops and riboswitches. We propose that the architecture presented should scale well with increasing number of genes to be temporally regulated. It is anticipated that such system will be useful in metabolic engineering because enzymes can be turn on and off in a sequential manner.<br />
</p><br />
<p><br />
Melbourne Riboregulator reference <br />
</p><br />
<ol><br />
<li>Bauer et al. (2006). Engineered riboswitches as novel tools in molecular biology. J Biotechnol vol. 124 (1), 4-11.2.</li><br />
<li>Ray, S.K. (2004). Riboswitch: A new mechanism of gene regulation in bacteria, Current Science, Vol. 87 (No. 9).</li><br />
<li>Isaacs et al. (2004). Engineered riboregulators enable post-transcriptional control of gene expression, Nature Biotechnology, 22 (7), 841-847.</li><br />
</ol><br />
</div><br />
<div class="feature_page_content"><br />
<h2><a href="https://2007.igem.org/Peking">Peking 2007</a></h2><br />
<br />
<h5 class= "page_link"><a href="https://2007.igem.org/wiki/index.php/Peking_Hop-Count">Peking 2007 Riboregulator page</a></h5><br />
<img src ="https://static.igem.org/mediawiki/2014/a/ad/HKUST_2014_peking_2007_riboregulator.png"><br />
<p><br />
<strong>Abstract: </strong><br />
Our projects concern with the ability for bacterial cells to differentiate out of homogeneous conditions into populations with the division of labor. We aim at devices conferring host cells with the ability to form cooperating groups spontaneously and to take consecutive steps sequentially even when the genetic background and environmental inputs are identical. To break the mirror in such homogeneous condition, we need two devices respectively responsible for temporal and spatial differentiation. The implementation and application of such devices will lead to bioengineering where complex programs consisted of sequential steps (structure oriented programs) and cooperating agencies (forked instances of a single class, object and event oriented) can be embedded in a single genome. Although this "differentiation" process resemble the development of multicellular organism, we tend to use a more bioengineering style analogy: assembly line. Or maybe after some years from now, this will not be just an analogy.<br />
</p><br />
</div><br />
<div class="feature_page_content"><br />
<h2><a href="https://2009.igem.org/Team:VictoriaBC">Victoria BC 2009</a></h2><br />
<br />
<p><br />
<strong>Abstract: </strong><br />
This project explores some of the ways that the secondary structure of messenger RNA can be used to control the rate of protein expression. The 32oC ribothermometer made by the 2008 TUDelft team will be coupled to fluorescent proteins to visually confirm temperature-dependent translation. The "ribolock" made by the 2006 Berkeley team will be tested at various temperatures to determine if it could double for use as a ribothermometer. Finally, a proof-of-concept NAND logic gate will be constructed: a ribolock will be used to interpret two concurrent environmental signals into an on/off control for mCherry output.<br />
<br />
</p><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T07:27:39Z
<p>Hyht2011: Undo revision 307670 by Hyht2011 (talk)</p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
In light of this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
<br><br><br />
Given its size, "Project Riboregulator" is expected to take more than just a summer to complete. Thus at the moment of wiki freeze, information available here is bound to be limited. However, the project will continue on well after the Giant Jamboree. Information will be continuously and regularly updated, and because of its nature, <u>"Project Riboregulator" is not part of our work in the iGEM competition</u>, but rather, a tribute to the Part Registry alone and iGEM community.</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in <i>trans</i>) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T07:25:56Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
In light of this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
<br><br><br />
Given its size, "Project Riboregulator" is expected to take more than just a summer to complete. Thus at the moment of wiki freeze, information available here is bound to be limited. However, the project will continue on well after the Giant Jamboree. Information will be continuously and regularly updated, and because of its nature, <u>"Project Riboregulator" is not part of our work in the iGEM competition</u>, but rather, a tribute to the Part Registry alone and iGEM community.</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<!-- test --><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
In light of this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
<br><br><br />
Given its size, "Project Riboregulator" is expected to take more than just a summer to complete. Thus at the moment of wiki freeze, information available here is bound to be limited. However, the project will continue on well after the Giant Jamboree. Information will be continuously and regularly updated, and because of its nature, <u>"Project Riboregulator" is not part of our work in the iGEM competition</u>, but rather, a tribute to the Part Registry alone and iGEM community.</p><br />
<br />
<br />
<!-- test --><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in <i>trans</i>) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T07:20:39Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
In light of this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
<br><br><br />
Given its size, "Project Riboregulator" is expected to take more than just a summer to complete. Thus at the moment of wiki freeze, information available here is bound to be limited. However, the project will continue on well after the Giant Jamboree. Information will be continuously and regularly updated, and because of its nature, <u>"Project Riboregulator" is not part of our work in the iGEM competition</u>, but rather, a tribute to the Part Registry alone and iGEM community.</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in <i>trans</i>) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor
Team:Hong Kong HKUST/pneumosensor
2014-10-17T07:20:01Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
div.quick_link_row div{<br />
width:180px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div> <br />
<a class="quick_link_sub" href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/modules"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/ff/HKUST_Quicklink_Icon_Module.png/610px-HKUST_Quicklink_Icon_Module.png"/><br />
<p>Modules Description</p><br />
</a><br />
</div><br />
<div><br />
<a class="quick_link_sub" href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<p>Parts</p><br />
</a> <br />
</div><br />
<!--<div><br />
<a class="quick_link_sub" href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<p>Data</p><br />
</a><br />
</div><br />
</div><br />
<div class= "quick_link_row">--><br />
<div><br />
<a class="quick_link_sub" href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/characterization"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<p>Characterization</p><br />
<br />
</a><br />
</div><br />
<div><br />
<a class="quick_link_sub" href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/results"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<p>Results</p><br />
</a><br />
</div><br />
<div><br />
<a class="quick_link_sub" href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/future_work"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<p>Future Work</p><br />
<br />
</a><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<br />
<!-- one row of content , two column one picture left--><br />
<div class='content_1'><h3>Project Pneumosensor Abstract </h3><br />
<table class="content_table" align= "center" ><br />
<br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<br />
<div class= "content_area_one_row"><br />
<div class="content_image"><br />
<img src= "https://static.igem.org/mediawiki/2014/b/b6/HKUST_iGEM_2014_M1abstractv2.png"/><br />
<h6><b>Figure 1. Pneumosensor Overview Diagram</h6></b><br><br />
<h7> Quorem-sensing peptide CSP produced by <i>S. pneumoniae</i> is detected by the Detection Module; the response regulator ComE links the Detection Module to the &sigma;<sup>x</sup> Promoters Module which ultimately drives the expression of GFP. </h7><br />
</div><br />
</div><br />
</td><br />
<br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p class="first_letter_enhanced"><i>Streptococcus pneumoniae</i> is responsible for approximately 1.6 million deaths every year mostly in developing countries where vaccination <br />
is unaffordable. Current methods used for diagnosis of pneumococcal diseases include X-ray imaging of chest, PCR assay using blood and Gram stain using sputum. They require sophisticated equipments, help from physicians or laboratory settings, all of which are limited to people in third world countries. To provide an affordable solution to combat pneumococcal diseases, we are engineering an <i>E. coli</i> &quot;Pneumosensor&quot;, that will <br />
work inside as an <i>in vitro</i> diagnostic device. Such a device should provide diagnosis result in absence of laboratories, medical equipments or doctors, making it more accessible for the people. Through this cheaper and easier diagnosis method, people can prepare themselves better against the <br />
transmission and adversity of <i>S. pneumoniae</i>.<br><br><br />
Pneumosensor has a rewired <i>comCDE</i> signal transduction pathway native to <i>S. pneumoniae</i> that detects<br />
autoinducer molecules released specifically by <i>S. pneumoniae</i>. Upon detection of <i>Streptococcus pneumonia</i>, Pneumosensor will produce a fluorescence signal. Apart from that, Pneumosensor is also equipped with a new promoter, Com-Box promoter, for the specific and tight regulation of target gene expression in <i>E. coli</i>. </p><br />
</div><br />
</td><br />
<br />
<br />
</tr><br />
</div><br />
</table><br />
</div><br />
<!-- end of one row of content , two column one picture left--><br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T07:19:34Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
In light of this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
<br><br><br />
Given its size, "Project Riboregulator" is expected to take more than just a summer to complete. Thus at the moment of wiki freeze, information available here is bound to be limited. However, the project will continue on well after the Giant Jamboree. Information will be continuously and regularly updated, and because of its nature, <u>"Project Riboregulator" is not part of our work in the iGEM competition</u>, but rather, a tribute to the Part Registry alone and iGEM community.</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in trans) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T07:19:10Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><b><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
In light of this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
<br><br><br />
Given its size, "Project Riboregulator" is expected to take more than just a summer to complete. Thus at the moment of wiki freeze, information available here is bound to be limited. However, the project will continue on well after the Giant Jamboree. Information will be continuously and regularly updated, and because of its nature, <u>"Project Riboregulator" is not part of our work in the iGEM competition</u>, but rather, a tribute to the Part Registry alone and iGEM community.</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in trans) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T06:21:38Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><b><u>Background</b></u><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
In light of this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
<br><br><br />
Given its size, "Project Riboregulator" is expected to take more than just a summer to complete. Thus at the moment of wiki freeze, information available here is bound to be limited. However, the project will continue on well after the Giant Jamboree. Information will be continuously and regularly updated, and because of its nature, <u>"Project Riboregulator" is not part of our work in the iGEM competition</u>, but rather, a tribute to the Part Registry alone and iGEM community.</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in trans) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T06:12:41Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><b><u>Background</b></u><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
Given this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator", and we aim to:<br />
<br><br />
<ol><br />
<li>Provide <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a> information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>Summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>Create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
Update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>Write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in trans) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T06:07:51Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Project Riboregulator Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><b><u>Background</b></u><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
Given this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator" with the following goals:<br />
<br><br />
<ol><br />
<li>To provide characterization information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>To summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>To create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
To update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>To write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<div class='content_1'><h3>CR and TA riboregulator system</h3><br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<br><br><br />
<p class="first_letter_enhanced"><br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in trans) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011
http://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator
Team:Hong Kong HKUST/riboregulator
2014-10-17T05:56:08Z
<p>Hyht2011: </p>
<hr />
<div>{{Team:Hong_Kong_HKUST/shell|<br />
<html><br />
<head><br />
<style type="text/css"><br />
div.quick_link_container{<br />
width: 134px;<br />
height: 160px;<br />
}<br />
div.quick_link_container img{<br />
width:100%;<br />
}<br />
.quick_link_container > h4 {<br />
font-size: 13px;<br />
}<br />
</style><br />
</head><br />
</html><br />
|<br />
<html><body><br />
<div id="content_container"><br />
<div class="quick_link_area"><br />
<br />
<div class= "quick_link_row"><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/6/68/CATALOG_QUICK_LINK.png"/><br />
<h4>Catalog Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/2/29/Feature_page_3HKUST.png"/><h4>Feature Page</h4><br />
</a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/6/6b/Part_final_final.png/604px-Part_final_final.png"/><br />
<h4>Parts</h4></a><br />
</div><br />
<br />
<!--<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/4/42/HKUST_Quicklink_Icon_Data.png"/><br />
<h4>Data Page</h4></a><br />
</div>--><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/CharacterizationHKUST.png/612px-CharacterizationHKUST.png"/><br />
<h4>Characterization Page</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/2/27/Results.HKUST2014.png/610px-Results.HKUST2014.png"/><br />
<h4>Result</h4></a><br />
</div><br />
<div><br />
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work" class="quick_link_sub"><br />
<img src="https://static.igem.org/mediawiki/2014/thumb/4/49/HKUST_Quicklink_Icon_Future_Work.png/612px-HKUST_Quicklink_Icon_Future_Work.png"/><br />
<h4>Future Work</h4></a><br />
</div><br />
</div><br />
</div><br />
<!-- one row of content , one column one picture left--><br />
<div class='content_1'><h3>Riboregulator Project Abstract</h3><br />
<br />
<!--one row of content no image--><br />
<div class='content_1'><br />
<table class="content_table" align= "center" valign= "top"><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell"><br />
<div class= "content_area_one_row"><br />
<p><b><u>Background</b></u><br />
<br><br><br />
<p class="first_letter_enhanced">Regulatory RNAs are RNAs that regulate biological processes on genetic and metabolic levels, and their importance has been established through the discoveries including those of RNA interference (RNAi) and long noncoding RNAs (lncRNA). The elucidation of their mechanism has enabled their reverse engineering, transforming them into versatile tools in synthetic biology.<br />
<br><br><br />
Riboregulators belong to a class of regulatory RNAs that controls translation by pairs of cis-repressing (CR) and trans-activating (TA) RNAs. They have received attention from at least 7 teams during the early years of iGEM. For example, Farren Isaacs in 2005, iGEM 2006 UC Berkeley team and iGEM 2007 Caltech team contributed many CR and TA devices to the Registry. Though there are more than > 100 riboregulator BioBrick records, comprehensive characterization information is missing. This hinders the iGEM community to compare and contrast different riboregulators pairs and evaluate their performances. For example, if we want to use the CR and TA devices that Berkeley 2006 made, we would not know which one to use and whether the device would work, because documentations then were not put down in the Registry or wiki page and were therefore no longer accessible.<br />
<br><br><br />
Given this situation, iGEM 2014 HKUST team decided to embark on "Project Riboregulator" with the following goals:<br />
<br><br />
<ol><br />
<li>To provide characterization information on riboregulator BioBricks so that teams and labs will be confident in using these devices.</li><br />
<li>To summarize available information of existing riboregulators into a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/riboregulator_Feature_Page">Feature Page</a> and promote their uses.</li><br />
<li>To create a <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a> for all identifiable regulatory RNAs; <br><br />
To update the choice of “Categories” when documenting “hard information” of a BioBrick, and; <br>To write up a guideline for other teams to tag their new regulatory RNAs so they will show up on the catalog page under the relevant sub-category.</li><br />
</ol><br />
</p> <br />
</div><br />
</td><br />
<br />
</tr><br />
<br />
</table><br />
</div><br />
<!--end of one row of content no image--><br />
<br />
<table class="content_table" align= "center" ><br />
<tr class= "content_row" valign= "top"><br />
<td class= "content_cell" colspan= "2"><br />
<div class= "content_area_one_row" ><br />
<div class= "embedded_image_left"><br />
<div class="content_image" align="center"><br />
<img style="width:90%;height:90%"src= "https://static.igem.org/mediawiki/2014/thumb/4/42/HKUST_iGEM_2014_Rabstract.png/430px-HKUST_iGEM_2014_Rabstract.png"/><br />
<h6><b>Figure 1. Riboregulator Overview Diagram</h6></b><br><br />
<h7> </h7><br />
</div><br />
</div><br />
<p><br />
<br><br />
<u>CR and TA riboregulator system</u><br />
<br><br><br />
<br />
Artificial cis-repressing and trans-activating riboregulator system was introduced to the iGEM community by Isaacs in 2005.<br />
The riboregulator system as a whole acts to regulate translation at the RNA level. One component of the system ,crRNA, which <br />
contains a cis-repressing sequence at the 5&#39; of the RBS, RBS, and gene of interest. <br><br>The cis-repressing sequence can form a loop form <br />
complementary base pairs with the RBS to prevent the recognition of RBS by ribosomes. The translation crRNA is also commonly <br />
described as a &quot;lock&quot; because it &quot;locks&quot; the RBS and prevent translation. The &quot;key&quot; to this system is the taRNA. taRNA can interact <br />
(in trans) with the cis-repressing sequence to unlock the RBS and therefore activate translation (Figure 1.).<br />
<br><br><br />
<br />
The benefits of this system, as described in Isaacs et al.&#39;s paper, are leakage minimization, fast response time, tunability, independent<br />
regulation of multiple genes etc.<br />
</p><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
</td><br />
</tr><br />
</table><br />
</div><br />
</div><br />
</body><br />
</html><br />
}}</div>
Hyht2011