http://2014.igem.org/wiki/index.php?title=Special:Contributions/HorizonP&feed=atom&limit=50&target=HorizonP&year=&month=2014.igem.org - User contributions [en]2024-03-28T21:07:14ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T23:57:21Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 75%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
overflow: hidden;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
ol.ref li {<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
article<br />
{<br />
list-style-position: inside;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-17T23:52:57Z<p>HorizonP: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
</style><br />
<div class="content"><br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Modeling&ensp;and&ensp;Simulation</h2></br></center><br />
<center><p>"All models are wrong, but some are useful."<br />
When we decided to use TAL effectors building CROWN, our project, there were three main challenges concerning the efficiency of this system.<br />
First, allowing some DNA mutations, can the CROWN be as efficient as before?<br />
Second, given that CROWN can be successfully distributed on certain area of single cell, can it make sense?<br />
Third, how to design the sequence of Golden Gate?<br />
The following three parts focus on the three questions. </p><br />
</center><br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Part I Single Cell"><br />
<center><h2>Part I Single Cell</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="Part II Docking"><br />
<center> <h2>Part II Docking</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="Part III K-clique Problem"><br />
<center><h2>Part III K-clique Problem</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#Discussion" title="Reference"><br />
<center><h2>Reference</h2></center></a><br />
</div><br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<article class="post__article"><br />
<!-- <h2 id="partisinglecell">Overview&ensp;of&ensp;Modeling&ensp;and&ensp;Simulation</h2><br />
<p>"All models are wrong, but some are useful."</p><br />
<p>When we decide to use TAL effectors building CROWN, our project, there are three main challenges concerning the efficiencies of this system.</p><br />
<p>First, allowing some DNA mutations, whether the CROWN can be efficient as before?</p><br />
<p>Second, given that CROWN can be successfully distributed on certain area of single cell, can it make sense?</p><br />
<p>Third, how to design the sequence of Golden Gate?</p><br />
<p>The following three parts focus on the three questions. </p><br />
--><br />
<br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly on the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
Certain enzymes are polymerized on the cell membrane.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Polymerization</strong><br />
The polymerization of certain enzymes is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<h4>1. Metabolism</h4><br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png" width=800px></img></center><br />
<center><small>Figure2.2.1 the process of the metabolism: s0, s1, s2, s3 are the substrates and E0, E1,E2 are the enzymes </small></center><br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/0/01/SJTU14_animation-synthesis.gif"width=800x></img></center><br />
<center><small>Figure2.2.2 the simulation of the CROWN</small></center><br />
<h4>2. Initial Distribution of Substrates</h4><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<h4>3. Movement of Substrates</h4><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<h4>4. Catalytic reaction</h4><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<h4>5. Other Hypothesis</h4><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<h4>All Results</h4><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<center><a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html"> Click to watch the video</a></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/de/SJTU14-All_Results.JPG" width=700x></img></center><br />
<center><small>Figure2.2.3 All the results of the four types.</small></center><br />
<br />
<h4 >Type 1</h4> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/b/ba/SJTU14-Membrane_%26_Random.JPG" width=700x></img></center><br />
<h4>Type 2</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ad/SJTU14-Membrane_%26_Polymerization.JPG" width=700x></img></center><br />
<h4>Type 3</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0b/SJTU14-Matrix_%26_Random.JPG" width=700px></img></center><br />
<h4>Type 4</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7a/SJTU14-Matrix_%26_Polymerization.JPG" width=700x ></img></center><p id="dianweidian9"></br></br></br></br></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg" width=800px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p>[The highlighted Letters represent the mutation site.]</p><br />
<p>[The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.]</p><br />
<br />
<ul style="padding-left:5%;"><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<br />
<br />
<br/><br/> <br />
<br />
<li ><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<br />
<br />
</ul><br />
<h3 id="Analysis">Analysis</h3><br />
<center><p><strong>Table</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<center><p><strong>Scatter Diagram</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p id="dianweidian10">From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<h2>Part Ⅲ K-clique Problem</h2><br />
<h3 id="Problem Identification">Problem Identification</h3><br />
<p>Before designing the TAL sequence, what we need to do first is to design a set of sequences, which are consist of seven fragments containing four nucleotides. In order to accomplish this, we offer a new sequence alignment algorithm for these fragmental sequences comparison. By using Loose Algorithm and Strict Algorithm, two fragmental sequences can be scored, and when the score is less than or equal to a specific value (eg 2), we can accept that they are a valid combination.</p><br />
<p>As we can see, the sequence database contains a total of 4 * 4 * 4 * 4 = 256 kinds of fragmental sequences. Now, what we should do is to find out some seven sequences whose each two fragments can be a valid combination, based on a large (256*256) score table.</p><br />
<h3 id="Assumption and Model Formulation">Assumption and Model Formulation</h3><br />
<p>We try to solve this problem by making full use of graph theory. In our model, each fragmental sequence can be treated as a node, and two “node” is connected, if they are a valid combination (the score less than or equal to 2). After doing that, we just need to find such seven nodes which are consist of a complete graph from a graph with 256 nodes. (Note: not every two nodes in original graph is connected)</p><br />
<h3 id="Brief introduction to graph theory">Brief introduction to graph theory</h3><br />
<p>For an undirected graph G = (V, E),if U⊆V, and for any u, v ⊆ U, (u, v) ⊆ E, U is called complete subgraph of G.</p><br />
<p>A clique in an undirected graph G = (V, E) is a subset of the vertex set C ⊆ V, such that for every two vertices in C, there exists an edge connecting the two. A maximal clique is a clique that cannot be extended by including one more adjacent vertex, that is, a clique which does not exist exclusively within the vertex set of a larger clique.</p><br />
<p>U is the maximal complete subgraph of G, if and only if U is a clique of U and U is not contained in a larger subgraph.</p><br />
<p>The k-clique problem is to find the complete graph with k nodes in a specific graph. What’s more, k-clique algorithm is defined in the paper "Uncovering the overlapping community structure of complex networks in nature and society" - G. Palla, I. Derényi, I. Farkas, and T. Vicsek - Nature 435, 814–818 (2005).</p><br />
<p>Although a deterministic algorithm for this problem with an O(n*2^n) algorithm time complexity, fortunately, in our experiment, the problem we should solve is just with 256 nodes, so a non-deterministic algorithm can be applied.</p><br />
<h3 id="Solution">Solution</h3><br />
<p>Early in 2005, a scientist have tried to use some kinds of Backtracking Algorithm to solve this problem, which have published in Science. Based on this excellent work, we have gone further to offer two more efficient algorithms.</p><br />
<h3 id="Algorithm 1">Algorithm 1</h3><br />
<p>In the solution space tree containing all available solutions, we search the solution space tree from the root according to the depth-first strategy. When reaching a node, we always firstly determine whether the node include any solutions or not. If not, we don't need to search the subtree whose root is such node, and then backtrack the ancestor nodes step-by-step; otherwise, we should continue our depth-first search.</p><br />
<h3 id="Algorithm 2">Algorithm 2</h3> <br />
<p>1.Sort the degree of each node.</p><br />
<p>2.In the current data set, from the first degree to the last, we remain the nodes which is relative to such degree, and delete the unconnected one.</p><br />
<p>3.In the set, containing the nodes connected to the previous one, for each node, determine whether it is connected to others, and then sort the nodes based on their degree.</p><br />
<p>4.Divide the problem into some much smaller size problems, repeat above method.</p><br />
<h3 id="Result">Result</h3><br />
<p>Based on our efficient algorithm, we have found a possible solution:</p><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/SJTU14-model_table.png" width=700x></img><br />
<h3 id="Discussion">Discussion</h3> <br />
<p>Clique problem play an important role in graph theory as well as is quite complex. However, we have provided some valid combinations for the TAL users here.</p> <br />
<h2 id="Reference">Reference</h2><br />
<ol style="font-style: italic;"><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part2_ExtensionTeam:SJTU-BioX-Shanghai/Part2 Extension2014-10-17T23:51:54Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/5/54/SJTU14_Maxmize.png");}<br />
#alignright{border:0;}<br />
<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
#subtitleyjn1{<br />
margin-left:20%;}<br />
<br />
#subtitleyjn2{<br />
margin-left:50%;}<br />
</style><br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<h2 id="subtitleyjn1">More than One Jewel on the Crown</h2></br><br />
<h2 id="subtitleyjn2">——Booster and Gearbox</h2> <br />
<center><p>The <strong><em>Crown</strong></em> will help us achieve the goal of selective enzyme polymerization. For polymerization, we introduce the <strong><em>Booster</strong></em>, which is an accelerator with enzymes collecting on it. For selectivity, we introduce the <strong><em>Gearbox</strong></em>, which offers users the right to make use of different sets of enzymes.</p></center><br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Booster"><br />
<center><h2>Booster</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dingweidian16" title="Gearbox"><br />
<center> <h2>Gearbox</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dingweidian3" title="How to be a Craftsman"><br />
<center><h2>How to be a Craftsman</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#Testmethods" title="Application"><br />
<center><h2>Application</h2></center></a><br />
</div><br />
<div class="projtile"><br />
<a href="#Application" title="What’s more ?"><br />
<center><h2>What’s more ?</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#What'smore" title="Reference"><br />
<center><h2>Reference</h2></center></a><br />
</div><br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<br />
<br />
<br />
<article class="post__article"><br />
<!-- this part has been put up <h2 id="alignright" align="center">More than One Jewel on the Crown</h2><br />
<br />
<h2 id="alignright" align="center">——Booster and Gearbox</h2> --><br />
<br />
<br/><br />
<br />
<h2 id="Booster">Booster</h2><br />
<p><strong><em>Booster</strong></em> is the model of polymerization and maximization. Polymerized enzymes, different from normal scattered ones, have much more opportunities to contact with the substrates. Therefore, our project aims to increase as well as to control the efficiency of complex reactions. We have built a framework that makes multi-enzyme complex easy to form, which we call a <strong><em>Crown</strong></em>.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2e/SJTU14_Part2%281-3%29.jpg"></img></center><br />
<p id="dingweidian16">And based on the success of the individual fusion protein(The first jewel) expression, we tried to add more jewels on the <strong><em>Crown</strong></em>.</p><br />
<p>In order to build a polymerization system, we made more fusion proteins bind to the same <strong><em>Connector</strong></em>. Then with more enzymes added, it has the practical effect of accelerating the reactions and enhancing the production efficiency. So far, the <strong><em>Crown</strong></em> is built with more than one jewel shining on it.</p><br />
<br />
<br/><br />
<br />
<br />
<h2 id="Gearbox">Gearbox</h2><br />
<br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_Gearbox.jpg"></img></center><br />
<br/><br />
<p><strong>Gearbox</strong></em> is the model of selectivity. Our fusion protein can not only be used to polymerize enzymes but also be used to control selective combinations. We can control the direction of pathway by simply transforming different <strong><em>Connector</strong></em> plasmids. </p><br />
<br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/75/SJTU14_Selectivity.jpg"></img></center><br />
</br><center><small><strong>Figure 1.3.1 Principle of selectivity</strong></small></center></br><br />
<br/><br />
<p>All the three enzymes involved are expressed in the bacteria. Each fusion protein contains ssDsbA, Lgt, FL3, enzyme, HL and TAL; different TAL parts can recognize different sites. <strong><em>Connector</strong></em> is originally designed with three recognition sequences(RS), which are combined to form two different connectors, one with RSⅠ and RSⅡ while the other one with RSⅠ and RSⅢ (shown in the figure below). <strong><em>Connector</strong></em> with RSⅠand RSⅡ can bind to Connectee-enzymeⅠ and Connectee-enzymeⅡ then get production A in the end, while <strong><em>Connector</strong></em> with RSⅠ and RSⅢ can bind to Connectee-enzymeⅠ and Connectee-enzymeⅢ then get production B.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/0/08/SJTU14_pBdeletion.jpg" id="dingweidian3"></img></center><br />
</br><center><small><strong>Figure 1.3.2 pBluescript II KS(+) ScaI/EcoRV deletion</strong></small></center></br><br />
<br/><br />
<br />
<br />
<h2 id="HowtobeaCraftsman">How to be a Craftsman</h2><br />
<br/><br />
<p>A compact machine requires bold ideas and careful practicing. Here comes how we built our <strong><em>Crown</strong></em>.</p><br />
<br />
<br />
<h3 id="ConstructionMethod">Construction Method</h3><br />
<br />
<p>Above all, we used 3 sets of <strong><em>Connectee1</strong></em> to build polymerization system. There are four main parts in a <strong><em>Connectee1</strong></em> for testing.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/1/1a/SJTU14_3_fusion_proteins.jpg"></img></center><br />
</br><center><small><strong>Figure 1.3.3 ssDsbA-FP-Lgt-TAL-His Tag</strong></small></center></br><br />
<br />
<p><strong><em>ssDsbA</em></strong>: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of <i>E.coli</i>.</p><br />
<br />
<p><strong><em>FP</em></strong>: To visualize the localization of fusion protein with fluorescence test , we added FP in the <strong><em>Connectee1</strong></em> and placed it just after the ssDsbA. We chose mRFP, CFP and YFP in our system.</p><br />
<br />
<p><strong><em>Lgt</em></strong>: Phosphatidylglycerol prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein that acts as a membrane anchor of <i>E.coli</i> with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.</p><br />
<br />
<p><strong><em>TAL effectors</em></strong>:As mentioned earlier, we chose three kinds of combinations to build three different TAL proteins, based on the parts that 2012 Freiburg iGEM team offered. These three TAL proteins can identify three different 14bp nucleotide sequences on a <strong><em>Connector</strong></em>. Note that we added a His Tag at the end of TAL protein to facilitate separation and purification.</p><br />
<br />
<p>For the three kinds of corresponding <strong><em>Connectee2</strong></em>, we did not introduce ssDsbA-Lgt section to keep them in a free intracellular state.</p><br />
<br />
<p>In the final production of our construction, we added an easy-to-hand interface sequence between the Lgt and TAL protein in <strong><em>Connectee1</strong></em> or just before the TAL protein in <strong><em>Connectee2</strong></em>, as sites to adding enzymes.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/d/dd/SJTU14_EnzymeUCB%2BTAL_USB.jpg"></img></center><br />
</br><center><small><strong>Figure 1.3.4 ssDsbA-Lgt-Enzyme USB(AarI/BsmAI)-TAL USB-His Tag</strong></small></center></br><br />
<br />
<br />
<h3 id="Co-Transformation&InducedExpression">Co-Transformation & Induced Expression</h3><br />
<p>Expression vectors used in the project for membrane protein expression are modified versions of pRSFDuet-1, pETDuet-1,pACYCDuet-1(NOVAGEN), which are originally regulated by T7 promoter. These plasmids can coexist in one cell.</p><br />
<br />
<p>The <strong><em>Connector</strong></em> is pBluescript II KS(+) .</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center><br />
</br><center><small><strong>Figure 1.3.5 pBluescript II KS(+)</strong></small></center></br><br />
<p>We used the four reformed plasmids to co-transform and induced the <strong><em>Connectors</strong></em> to express. Now the structure of the crown appears in the <i>E.coli</i> cell membrane or cytoplasm. Here we used the fusion proteins with two kinds of enzymes and TAL1 as examples. </p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_Enzyme%2BTAL1.jpg"></img></center><br />
</br><center><small><strong>Figure 1.3.6 ssDsbA-Lgt-pykF/poxB-TAL1-His Tag</strong></small></center></br><br />
<br />
<h3 id="Testmethods">Test Methods</h3><br />
<p>We used formaldehyde to stabilize the connected fusion proteins and <strong><em>Connector</strong></em>, then separated the protein-Connector complexes and digested the protein. Finally we used PCR to detect the three sequences of the <strong><em>Connector</strong></em> which TAL proteins were designed to bind to.</p><br />
<br />
<p>Then, we were able to test the yield of different products to determine the efficiency of selective combination.</p><br />
<br />
<br/><br />
<br />
<br />
<h2 id="Application">Application</h2><br />
<br/><br />
<p>Based on our design, our project has many application prospects. In prokaryotic systems, enzyme polymerization can be used to regulate various metabolic pathways, such as the example we mentioned above. pykF and poxB are two enzymes involved in pyruvate metabolism. By binding them to the connector, we can improve the reaction efficiency to a great extent. Besides, our project can also be applied in eukaryotic systems, including gene therapy and regulation of stem cell differentiation.</p><br />
<br />
<br><br />
<br />
<br />
<h2 id="What'smore">What’s more ?</h2><br />
<br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/a/a5/SJTU14_Part2%281-3-5%29.jpg"></img></center><br />
<br/><br />
<p>We are trying to put more enzymes into the polymerization system, which makes the <strong><em>Crown</strong></em> more practical and brilliant. And with more enzymes on the <strong><em>Crown</strong></em>, there will be more possible choices for selective combination.</p><br />
<br />
<br/><br />
<br/><br />
<br />
<h2 id=References>References</h2><br />
<br/><br />
<ol style="font-style: italic;"><br />
<li>Pailler, Jérémy, et al. "Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane." Journal of bacteriology 194.9 (2012): 2142-2151.</li><br />
<li>Schierle, Clark F., et al. "The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway." Journal of bacteriology 185.19 (2003): 5706-5713.</li><br />
<li>Katsuyama, Tomonori, et al. "An efficient strategy for TALEN-mediated genome engineering in Drosophila." Nucleic acids research 41.17 (2013): e163-e163.</li><br />
<li>Bogdanove, Adam J., Sebastian Schornack, and Thomas Lahaye. "TAL effectors: finding plant genes for disease and defense." Current opinion in plant biology 13.4 (2010): 394-401.</li><br />
</ol><br />
<br />
<br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T23:51:27Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
#subtitleyjn1{<br />
margin-left:30%;}<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<h2 id="subtitleyjn1">Basic Test</h2></br><br />
<h2 id="subtitleyjn2">——One Connectee Binds Connector</h2> <br />
<center><p>At first, tests should be taken to check whether TAL can bind to plasmid DNA in prokaryotic system. Here we used <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid(the connector), we have designed two kinds of delicate fusion proteins(the connectee). One is anchored to the cell membrane, the other is free in the cytoplasm.</p></center><br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Connectee"><br />
<center><h2>Connectee</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#connectee2:" title="Connector"><br />
<center> <h2>Connector</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#connector:" title="Test Method"><br />
<center><h2>Test Method</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dingweidian" title="Two Convenient Parts"><br />
<center><h2>Two Convenient Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dingweidian12" title="Reference"><br />
<center><h2>References</h2></center></a><br />
</div><br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<br />
<br />
<article class="post__article"><br />
<!-- <h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
--> <br />
<br />
<!-- Luo! This part has been moved up --><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2 id="connectee:">Connectee:</h2><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br />
<p> <!-- Luo rewrite the part --> <br />
<br />
<!-- At first, tests should be taken to check whether TAL can bind to plasmid DNA in prokaryotic system. Here we used <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. --><br />
<br />
The <strong><em>connectee</em></strong> consists of linkers and various sections, which are shown in the schematic diagrams below.</p><br />
<br />
<br />
<br />
<h4>1. TAL effector: A transcription activator-like protein</h4><br />
<p><strong>TAL effector</strong> can bind to a target sequence on DNA. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein is able to identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymine, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
</br><center><small><strong>Figure 1.2.1 TAL Golden gate</strong></small></center></br><br />
<br />
<br />
<br />
<h4>2. Membrane anchor system: ssDsbA-Lgt</h4><br />
<p><strong>ssDsbA</strong>, the signal sequence of DsbA, directs the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.</p><br />
<p>The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </p><br />
<br />
<h4>3. Fluorescent protein</h4><br />
<p><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.</p><br />
<p><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.</p><br />
<p><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</p><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which consists of three major domains: membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reasons why we chose a membrane anchor are as follows.</p><br />
<br />
<p>1. TAL could bind nucleoid which may bring some negative effect on bacteria growth.</p><br />
<p>2. Membrane scaffold is a natural scaffold.</p><br />
<p>3. Exogenous proteins often form inactive inclusion bodies when expressed in the prokaryotic system.</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
</br><center><small><strong>Figure1.2.2 Connectee 1</strong></small></center></br><br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We used Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds to plasmid DNA, we chose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.3 Connectee 2</strong></small></center></br><br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a TAL protein to recognize a 14-nucleotide-long sequence, TXXXXXXXXXXXXT, on the plasmid DNA.<br />
The plasmid here is called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector.</p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong>.</p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<br />
<p>1. pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> in our test for several reasons: </p><br />
<br />
<br />
<p>I. High copy number;</p><br />
<p>II.Medium length—2961bp;</p><br />
<p>III. Easy to detect whether binding a TAL may affect gene expression — through lacI &amp; blue-white spot screening.</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.4 pBluescript II KS(+)</strong></small></center></br><br />
<p>2. After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.</p><br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:</p><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.5 ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.6 TAL1-His Tag</strong></small></center></br><br />
<br />
<p>3. Considering our multiple-enzyme system might be applied in the following experiment, we chose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</p><br />
<br />
<p id="dingweidian"><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.7 Expression</strong></small></center></br><br />
<p>4. Similar to the cross-linked ChIP, we used formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p><br />
<p>5. After that we did immunoprecipitation to obtain the protein-plasmid complex and digestd protein.</p><br />
<p>6. Finally, we used PCR to check whether there was any existing plasmid DNA.</p><br />
<br />
<br />
<h2 id="aconvenientpart:">Two Convenient Parts:</h2><br />
<p>In order to integrate TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) properly into our system, we also designed two corresponding parts; one is ssDsbA-mRFP-Lgt-TAL USB-His Tag (BBa_K1453000), the other is Lgt-TAL USB-His Tag (BBa_K1453006). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p></br><br />
</br><center><small><strong>Figure 1.2.8 ssDsbA-mRFP-Lgt-TAL USB-His Tag</strong></small></center></br><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.9 TAL USB-His Tag</strong></small></center></br><br />
<p>The TAL USB of these parts all consist of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, these parts produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (BBa_K747000 to BBa_K747015) at 5&#8217;of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (BBa_K747080 to BBa_K747095) at 3&#8217;. </p><br />
<br />
<p id="dingweidian12">With the rest of TAL-Protein DiRepeats (BBa_K747016 to BBa_K747079), users can synthesize a specific TAL protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p > For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<br />
<h2 id="reference">References:</h2><br />
<ol style="font-style: italic;"><br />
<li>Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</li><br />
<li>Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</li><br />
<li>Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</li><br />
<li>Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</li><br />
<li>Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </li><br />
<li>Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</li><br />
<li>Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</li><br />
<li>Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</li><br />
</ol><br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T23:41:46Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 75%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
ol.ref li {<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
article<br />
{<br />
list-style-position: inside;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T23:37:31Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
#subtitleyjn1{<br />
margin-left:30%;}<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<h2 id="subtitleyjn1">Basic Test</h2></br><br />
<h2 id="subtitleyjn2">——One Connectee Binds Connector</h2> <br />
<center><p>At first, tests should be taken to check whether TAL can bind to plasmid DNA in prokaryotic system. Here we used <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid(the connector), we have designed two kinds of delicate fusion proteins(the connectee). One is anchored to the cell membrane, the other is free in the cytoplasm.</p></center><br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Connectee"><br />
<center><h2>Connectee</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#connectee2:" title="Connector"><br />
<center> <h2>Connector</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#connector:" title="Test Method"><br />
<center><h2>Test Method</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dingweidian" title="Two Convenient Parts"><br />
<center><h2>Two Convenient Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dingweidian12" title="Reference"><br />
<center><h2>References</h2></center></a><br />
</div><br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<br />
<br />
<article class="post__article"><br />
<!-- <h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
--> <br />
<br />
<!-- Luo! This part has been moved up --><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2 id="connectee:">Connectee:</h2><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br />
<p> <!-- Luo rewrite the part --> <br />
<br />
<!-- At first, tests should be taken to check whether TAL can bind to plasmid DNA in prokaryotic system. Here we used <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. --><br />
<br />
The <strong><em>connectee</em></strong> consists of linkers and various sections, which are shown in the schematic diagrams below.</p><br />
<br />
<br />
<br />
<h4>1. TAL effector: A transcription activator-like protein</h4><br />
<p><strong>TAL effector</strong> can bind to a target sequence on DNA. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein is able to identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymine, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
</br><center><small><strong>Figure 1.2.1 TAL Golden gate</strong></small></center></br><br />
<br />
<br />
<br />
<h4>2. Membrane anchor system: ssDsbA-Lgt</h4><br />
<p><strong>ssDsbA</strong>, the signal sequence of DsbA, directs the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.</p><br />
<p>The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </p><br />
<br />
<h4>3. Fluorescent protein</h4><br />
<p><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.</p><br />
<p><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.</p><br />
<p><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</p><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which consists of three major domains: membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reasons why we chose a membrane anchor are as follows.</p><br />
<br />
<p>1. TAL could bind nucleoid which may bring some negative effect on bacteria growth.</p><br />
<p>2. Membrane scaffold is a natural scaffold.</p><br />
<p>3. Exogenous proteins often form inactive inclusion bodies when expressed in the prokaryotic system.</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
</br><center><small><strong>Figure1.2.2 Connectee 1</strong></small></center></br><br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We used Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds to plasmid DNA, we chose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.3 Connectee 2</strong></small></center></br><br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a TAL protein to recognize a 14-nucleotide-long sequence, TXXXXXXXXXXXXT, on the plasmid DNA.<br />
The plasmid here is called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector.</p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong>.</p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<br />
<p>1. pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> in our test for several reasons: </p><br />
<br />
<br />
<p>I. High copy number;</p><br />
<p>II.Medium length—2961bp;</p><br />
<p>III. Easy to detect whether binding a TAL may affect gene expression — through lacI &amp; blue-white spot screening.</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.4 pBluescript II KS(+)</strong></small></center></br><br />
<p>2. After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.</p><br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:</p><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.5 ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.6 TAL1-His Tag</strong></small></center></br><br />
<br />
<p>3. Considering our multiple-enzyme system might be applied in the following experiment, we chose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</p><br />
<br />
<p id="dingweidian"><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.7 Expression</strong></small></center></br><br />
<p>4. Similar to the cross-linked ChIP, we used formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p><br />
<p>5. After that we did immunoprecipitation to obtain the protein-plasmid complex and digestd protein.</p><br />
<p>6. Finally, we used PCR to check whether there was any existing plasmid DNA.</p><br />
<br />
<br />
<h2 id="aconvenientpart:">Two Convenient Parts:</h2><br />
<p>In order to integrate TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) properly into our system, we also designed two corresponding parts; one is ssDsbA-mRFP-Lgt-TAL USB-His Tag (BBa_K1453000), the other is Lgt-TAL USB-His Tag (BBa_K1453006). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p></br><br />
</br><center><small><strong>Figure 1.2.8 ssDsbA-mRFP-Lgt-TAL USB-His Tag</strong></small></center></br><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png"></img></center></p><br />
</br><center><small><strong>Figure 1.2.9 TAL USB-His Tag</strong></small></center></br><br />
<p>The TAL USB of these parts all consist of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, these parts produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (BBa_K747000 to BBa_K747015) at 5&#8217;of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (BBa_K747080 to BBa_K747095) at 3&#8217;. </p><br />
<br />
<p id="dingweidian12">With the rest of TAL-Protein DiRepeats (BBa_K747016 to BBa_K747079), users can synthesize a specific TAL protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p > For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<br />
<h2 id="reference">References:</h2><br />
<ol class='ref'><br />
<li>Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</li><br />
<li>Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</li><br />
<li>Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</li><br />
<li>Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</li><br />
<li>Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </li><br />
<li>Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</li><br />
<li>Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</li><br />
<li>Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</li><br />
</ol><br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T23:36:23Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 75%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
ol.ref {<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
article<br />
{<br />
list-style-position: inside;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T23:30:14Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 75%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#Reference + ol > li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
article<br />
{<br />
list-style-position: inside;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ResultsTeam:SJTU-BioX-Shanghai/Results2014-10-17T23:24:16Z<p>HorizonP: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/8/84/SJTU14_Results.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2>Wet Lab Results</h2><br />
<br />
<br />
<h3>Reformed Plasmid Result</h3><br />
<p>We designed four reformed plasmids, pBluescript II KS(+) ScaI deletion, pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy.<br />
And we tested their co-transformation ability and got the result picture. All of these plasmids have Amp antibiotic resistance. </p><br />
<p><br />
We co-transformed pRSFDuet-1 and two plasmids, pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion, respectively. So the plate has two antibiotic resistance, Kan and Amp. We cultured two different strains on the plate and got the result picture.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/5/5f/123123123.jpg" width=55% style='max-width=600px'></img></center><br />
<br />
<center><small><strong>Figure 2.1.1 Two plates of Co-transfected bacteria (pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion)</small></strong></center><br />
<br />
<p>Moreover, we verified our pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy part through lacl & blue-white spot screening.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c6/212121.jpg" width=55% style='max-width=600px'></img></center><br />
<br />
<center><small><strong>Figure 2.1.2 Two plates of lacl & blue-white spot screening</strong></small></center><br />
<br />
<p>So we have experimentally validated that our reformed plasmids perform as expected. </p><br />
<br />
<h3>Function Identification of TAL USB</h3><br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from iGEM12_SJTU-BioX-Shanghai BBa_K771000.<br />
In order to connect TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width=55% style='max-width=600px'></img></center><br />
<center><small><strong>Figure 2.1.3 The structure of TAL USB</strong></small></center><br />
<p><br />
When digested with BsmBI, this part produces two sticky-ends that can bind TAL-Protein (BBa_K747000 to BBa_K747095)<br />
After doing ligation with T4 ligase, we experimentally validated this part's function.</p><br />
<p><br />
Sequencing result is followed:</p><br />
<pre><center><br />
GGAATTCCATATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCGATGGCTTCC<br />
TCCGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGTTCCGTTAACGGTCACGAGTTCGAAA<br />
TCGAAGGTGAAGGTGAAGGTCGTCCGTACGAAGGTACCCAGACCGCTAAACTGAAAGTTACCAAAGGTGGTCCGCT<br />
GCCGTTCGCTTGGGACATCCTGTCCCCGCAGTTCCAGTACGGTTCCAAAGCTTACGTTAAACACCCGGCTGACATC<br />
CCGGACTACCTGAAACTGTCCTTCCCGGAAGGTTTCAAATGGGAACGTGTTATGAACTTCGAAGACGGTGGTGTTG<br />
TTACCGTTACCCAGGACTCCTCCCTGCAAGACGGTGAGTTCATCTACAAAGTTAAACTGCGTGGTACCAACTTCCC<br />
GTCCGACGGTCCGGTTATGCAGAAAAAAACCATGGGTTGGGAAGCTTCCACCGAACGTATGTACCCGGAAGACGGT<br />
GCTCTGAAAGGTGAAATCAAAATGCGTCTGAAACTGAAAGACGGTGGTCACTACGACGCTGAAGTTAAAACCACCT<br />
ACATGGCTAAAAAACCGGTTCAGCTGCCGGGTGCTTACAAAACCGACATCAAACTGGACATCACCTCCCACAACGA<br />
AGACTACACCATCGTTGAACAGTACGAACGTGCTGAAGGTCGTCACTCCACCGGTGCTGCTGAGGCCGCCGCAAAA<br />
GAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGACCAGTAGCTATCTGCATTTTCCGGAGTTTGATCCGGTCATTT<br />
TCTCAATAGGACCCGTGGCGCTTCACTGGTACGGCCTGATGTATCTGGTGGGTTTCATTTTTGCAATGTGGCTGGC<br />
AACACGACGGGCGAATCGTCCGGGCAGCGGCTGGACCAAAAATGAAGTTGAAAACTTACTCTATGCGGGCTTCCTC<br />
GGCGTCTTCCTCGGGGGACGTATTGGTTATGTTCTGTTCTACAATTTCCCGCAGTTTATGGCCGATCCGCTGTATC<br />
TGTTCCGTGTCTGGGACGGCGGCATGTCTTTCCACGGCGGCCTGATTGGCGTTATCGTGGTGATGATTATCTTCGC<br />
CCGCCGTACTAAACGTTCCTTCTTCCAGGTCTCTGATTTTATCGCACCACTCATTCCGTTTGGTCTTGGTGCCGGG<br />
CGTCTGGGCAACTTTATTAACGGTGAATTGTGGGGCCGCGTTGACCCGAACTTCCCGTTTGCCATGCTGTTCCCTG<br />
GCTCCCGTACAGAAGATATTTTGCTGCTGCAAACCAACCCGCAGTGGCAATCCATTTTCGACACTTACGGTGTGCT<br />
GCCGCGCCACCCATCACAGCTTTACGAGCTGCTGCTGGAAGGTGTGGTGCTGTTTATTATCCTCAACCTGTATATT<br />
CGTAAACCACGCCCAATGGGAGCTGTCTCAGGTTTGTTCCTGATTGGTTACGGCGCGTTTCGCATCATTGTTGAGT<br />
TTTTCCGCCAGCCCGACGCGCAGTTTACCGGTGCCTGGGTGCAGTACATCAGCATGGGGCAAATTCTTTCCATCCC<br />
GATGATTGTCGCGGGTGTGATCATGATGGTCTGGGCATATCGTCGCAGCCCACAGCAACACGTTTCCTTAGGAGGT<br />
GGAGGTAGTGGTGGAGGTGGAAGTGGTGGAGGTGGTAGTGCTGCAGCTCTGGACACGGGCCAGTTGCTGAAGATCG<br />
CGAAGCGGGGAGGAGTCACGGCGGTCGAGGCGGTGCACGCGTGGCGCAATGCGCTCACGGGAGCACCCCTCAACCT<br />
GACCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTT<br />
CCGGTTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCACGATGGCGGTAAACAAG<br />
CCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAGGCCCACGGGCTCACGCCTGAGCAGGTAGTGGCTAT<br />
TGCATCCAACGGAGGGGGCAGACCCGCACTGGAGTCAATCGTGGCCCAGCTTTCGAGGCCGGACCCCGCGCTGGCC<br />
CACCACCACCACCACCACTAACTCGAGCGG <br />
</center></pre><br />
<br />
<p>Furthermore, we found some mismatch cases in our sequencing result. Here are a typical mismatch result.</p><br />
<p>There is the partial sequencing result.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/f5/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%881.26.07.png" width=62% style='max-width=700px'></img><center><br />
<br />
<center><strong><small>Figure 2.1.4 Partial sequencing result of mismatch</strong></small></center><br />
<br />
<p>We tried to understand why we got this wrong sequence. We checked our part and 2012 Freiburg's project. And we found that the the mismatch sticky ends appearing in original sequence are <b>GCTC</b> and <b>ACTC</b>. What similar sticky ends! Here are the two components in the mismatch sequence. </p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/d/dd/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%882.40.42.png" width=72% style='max-width=800px'></img></center><br />
<br />
<center><strong><small>Figure 2.1.5 The process of generating mismatch</small></strong></center><br />
<br />
<p>So the sequencing result proves that similar sticky ends can mismatch when T4 ligase exists. This result enlightens us on improving TALE construction parts.</p><br />
<br />
<br />
<p>2012 Freiburg's parts have seven sticky ends:</p><br />
<p><center>TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC</center></p><br />
<p>Inpired by BLAST algorithm, we calculated the similarity of each other sticky ends. </p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/TAL%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF%E8%A1%A8%E6%A0%BC.png" width=37% style='max-width=400px'></img></center><br />
<center><strong><small>Figure 2.1.6 Strict rules score table</small></strong></center><br />
<p id="dianweidian5">The higher score, the higher similarity, and the higher possibility of mismatch. <br />
The table shows that more than 30% of pairs’ score is equal to 3, which means that the possibility of mismatch cannot be neglected.<br />
<br />
Even if we employed the relatively loose rule to calculate the similarity, we still found that error rates cannot be neglected.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Tal_%E8%A1%A8%E6%A0%BC%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF2.png" width=37% style='max-width=400px'></img></center><br />
<br />
<center><strong><small>Figure 2.1.7 Loose rules score table</small></strong></center><br />
<br />
<p>So how to solve this problem?</p><br />
<p>Our team designed seven new sticky ends which are theoretically better than original version. For more information please go to <a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >TAL Improvement </a>page!</p><br />
<br />
</article><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ResultsTeam:SJTU-BioX-Shanghai/Results2014-10-17T23:16:38Z<p>HorizonP: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/8/84/SJTU14_Results.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2>Wet Lab Results</h2><br />
<br />
<br />
<h3>Reformed Plasmid Result</h3><br />
<p>We designed four reformed plasmids, pBluescript II KS(+) ScaI deletion, pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy.<br />
And we tested their co-transformation ability and got the result picture. All of these plasmids have Amp antibiotic resistance. </p><br />
<p><br />
We co-transformed pRSFDuet-1 and two plasmids, pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion, respectively. So the plate has two antibiotic resistance, Kan and Amp. We cultured two different strains on the plate and got the result picture.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/5/5f/123123123.jpg" width=55%></img></center><br />
<br />
<center><small><strong>Figure 2.1.1 Two plates of Co-transfected bacteria (pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion)</small></strong></center><br />
<br />
<p>Moreover, we verified our pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy part through lacl & blue-white spot screening.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c6/212121.jpg" width=600px></img></center><br />
<br />
<center><small><strong>Figure 2.1.2 Two plates of lacl & blue-white spot screening</strong></small></center><br />
<br />
<p>So we have experimentally validated that our reformed plasmids perform as expected. </p><br />
<br />
<h3>Function Identification of TAL USB</h3><br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from iGEM12_SJTU-BioX-Shanghai BBa_K771000.<br />
In order to connect TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width=600px></img></center><br />
<center><small><strong>Figure 2.1.3 The structure of TAL USB</strong></small></center><br />
<p><br />
When digested with BsmBI, this part produces two sticky-ends that can bind TAL-Protein (BBa_K747000 to BBa_K747095)<br />
After doing ligation with T4 ligase, we experimentally validated this part's function.</p><br />
<p><br />
Sequencing result is followed:</p><br />
<pre><center><br />
GGAATTCCATATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCGATGGCTTCC<br />
TCCGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGTTCCGTTAACGGTCACGAGTTCGAAA<br />
TCGAAGGTGAAGGTGAAGGTCGTCCGTACGAAGGTACCCAGACCGCTAAACTGAAAGTTACCAAAGGTGGTCCGCT<br />
GCCGTTCGCTTGGGACATCCTGTCCCCGCAGTTCCAGTACGGTTCCAAAGCTTACGTTAAACACCCGGCTGACATC<br />
CCGGACTACCTGAAACTGTCCTTCCCGGAAGGTTTCAAATGGGAACGTGTTATGAACTTCGAAGACGGTGGTGTTG<br />
TTACCGTTACCCAGGACTCCTCCCTGCAAGACGGTGAGTTCATCTACAAAGTTAAACTGCGTGGTACCAACTTCCC<br />
GTCCGACGGTCCGGTTATGCAGAAAAAAACCATGGGTTGGGAAGCTTCCACCGAACGTATGTACCCGGAAGACGGT<br />
GCTCTGAAAGGTGAAATCAAAATGCGTCTGAAACTGAAAGACGGTGGTCACTACGACGCTGAAGTTAAAACCACCT<br />
ACATGGCTAAAAAACCGGTTCAGCTGCCGGGTGCTTACAAAACCGACATCAAACTGGACATCACCTCCCACAACGA<br />
AGACTACACCATCGTTGAACAGTACGAACGTGCTGAAGGTCGTCACTCCACCGGTGCTGCTGAGGCCGCCGCAAAA<br />
GAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGACCAGTAGCTATCTGCATTTTCCGGAGTTTGATCCGGTCATTT<br />
TCTCAATAGGACCCGTGGCGCTTCACTGGTACGGCCTGATGTATCTGGTGGGTTTCATTTTTGCAATGTGGCTGGC<br />
AACACGACGGGCGAATCGTCCGGGCAGCGGCTGGACCAAAAATGAAGTTGAAAACTTACTCTATGCGGGCTTCCTC<br />
GGCGTCTTCCTCGGGGGACGTATTGGTTATGTTCTGTTCTACAATTTCCCGCAGTTTATGGCCGATCCGCTGTATC<br />
TGTTCCGTGTCTGGGACGGCGGCATGTCTTTCCACGGCGGCCTGATTGGCGTTATCGTGGTGATGATTATCTTCGC<br />
CCGCCGTACTAAACGTTCCTTCTTCCAGGTCTCTGATTTTATCGCACCACTCATTCCGTTTGGTCTTGGTGCCGGG<br />
CGTCTGGGCAACTTTATTAACGGTGAATTGTGGGGCCGCGTTGACCCGAACTTCCCGTTTGCCATGCTGTTCCCTG<br />
GCTCCCGTACAGAAGATATTTTGCTGCTGCAAACCAACCCGCAGTGGCAATCCATTTTCGACACTTACGGTGTGCT<br />
GCCGCGCCACCCATCACAGCTTTACGAGCTGCTGCTGGAAGGTGTGGTGCTGTTTATTATCCTCAACCTGTATATT<br />
CGTAAACCACGCCCAATGGGAGCTGTCTCAGGTTTGTTCCTGATTGGTTACGGCGCGTTTCGCATCATTGTTGAGT<br />
TTTTCCGCCAGCCCGACGCGCAGTTTACCGGTGCCTGGGTGCAGTACATCAGCATGGGGCAAATTCTTTCCATCCC<br />
GATGATTGTCGCGGGTGTGATCATGATGGTCTGGGCATATCGTCGCAGCCCACAGCAACACGTTTCCTTAGGAGGT<br />
GGAGGTAGTGGTGGAGGTGGAAGTGGTGGAGGTGGTAGTGCTGCAGCTCTGGACACGGGCCAGTTGCTGAAGATCG<br />
CGAAGCGGGGAGGAGTCACGGCGGTCGAGGCGGTGCACGCGTGGCGCAATGCGCTCACGGGAGCACCCCTCAACCT<br />
GACCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTT<br />
CCGGTTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCACGATGGCGGTAAACAAG<br />
CCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAGGCCCACGGGCTCACGCCTGAGCAGGTAGTGGCTAT<br />
TGCATCCAACGGAGGGGGCAGACCCGCACTGGAGTCAATCGTGGCCCAGCTTTCGAGGCCGGACCCCGCGCTGGCC<br />
CACCACCACCACCACCACTAACTCGAGCGG <br />
</center></pre><br />
<br />
<p>Furthermore, we found some mismatch cases in our sequencing result. Here are a typical mismatch result.</p><br />
<p>There is the partial sequencing result.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/f5/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%881.26.07.png" width=700px></img><center><br />
<br />
<center><strong><small>Figure 2.1.4 Partial sequencing result of mismatch</strong></small></center><br />
<br />
<p>We tried to understand why we got this wrong sequence. We checked our part and 2012 Freiburg's project. And we found that the the mismatch sticky ends appearing in original sequence are <b>GCTC</b> and <b>ACTC</b>. What similar sticky ends! Here are the two components in the mismatch sequence. </p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/d/dd/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%882.40.42.png" width=800px></img></center><br />
<br />
<center><strong><small>Figure 2.1.5 The process of generating mismatch</small></strong></center><br />
<br />
<p>So the sequencing result proves that similar sticky ends can mismatch when T4 ligase exists. This result enlightens us on improving TALE construction parts.</p><br />
<br />
<br />
<p>2012 Freiburg's parts have seven sticky ends:</p><br />
<p><center>TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC</center></p><br />
<p>Inpired by BLAST algorithm, we calculated the similarity of each other sticky ends. </p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/TAL%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF%E8%A1%A8%E6%A0%BC.png" width=400px></img></center><br />
<center><strong><small>Figure 2.1.6 Strict rules score table</small></strong></center><br />
<p id="dianweidian5">The higher score, the higher similarity, and the higher possibility of mismatch. <br />
The table shows that more than 30% of pairs’ score is equal to 3, which means that the possibility of mismatch cannot be neglected.<br />
<br />
Even if we employed the relatively loose rule to calculate the similarity, we still found that error rates cannot be neglected.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Tal_%E8%A1%A8%E6%A0%BC%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF2.png" width=400px></img></center><br />
<br />
<center><strong><small>Figure 2.1.7 Loose rules score table</small></strong></center><br />
<br />
<p>So how to solve this problem?</p><br />
<p>Our team designed seven new sticky ends which are theoretically better than original version. For more information please go to <a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >TAL Improvement </a>page!</p><br />
<br />
</article><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T21:01:33Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 75%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference + ol > li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
article<br />
{<br />
list-style-position: inside;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T20:52:32Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 75%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference + li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
article<br />
{<br />
list-style-position: inside;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T20:48:00Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 75%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference + li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T20:39:15Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 75%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference + ol{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T19:17:08Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2>Overview</h2><br />
<p>We have characterized and submitted 42 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
Those BioBricks could be divided into four groups.<br><br />
<br />
1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.<br><br />
<br />
2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.<br><br />
<br />
3.BioBricks in application is our complete part. <br><br />
<br />
4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/a/a9/Plasmid.png" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<br><br />
<p><br />
<br><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br><br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<p><br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB</h3><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a><br><br />
</p><br />
<br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</article><br />
</div><br />
</html><br />
<br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/index.cssTeam:SJTU-BioX-Shanghai/index.css2014-10-17T19:11:00Z<p>HorizonP: </p>
<hr />
<div>html, body, div, span, applet, object, iframe,<br />
h1, h2, h3, h4, h5, h6, p, blockquote, pre,<br />
a, abbr, acronym, address, big, cite, code,<br />
del, dfn, em, img, ins, kbd, q, s, samp,<br />
small, strike, strong, sub, sup, tt, var,<br />
b, u, i, center,<br />
dl, dt, dd, ol, ul, li,<br />
fieldset, form, label, legend,<br />
table, caption, tbody, tfoot, thead, tr, th, td,<br />
article, aside, canvas, details, embed,<br />
figure, figcaption, footer, header, hgroup,<br />
menu, nav, output, ruby, section, summary,<br />
time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
#wrap {<br />
border-top-width:1px;<br />
padding-top: 0;<br />
min-width: 100%;<br />
/*position: relative;*/<br />
}<br />
<br />
.content {<br />
width: 100%;<br />
}<br />
<br />
a {<br />
-webkit-transition: all 0.3s ease-in-out;<br />
-moz-transition: all 0.3s ease-in-out;<br />
-o-transition: all 0.3s ease-in-out;<br />
-ms-transition: all 0.3s ease-in-out;<br />
transition: all 0.3s ease-in-out;<br />
text-decoration: none;<br />
color:#68afbc;<br />
}<br />
a:visited {color:#f2ce3a;<br />
}<br />
<br />
a.alt {<br />
color: #111111;<br />
}<br />
<br />
a:hover, a:focus, a:active {<br />
color: #111111;<br />
text-decoration: none;<br />
}<br />
<br />
.ir {<br />
font-size: 0;<br />
color: transparent;<br />
display: block;<br />
background-repeat: no-repeat;<br />
background-position: left top;<br />
}<br />
<br />
.flex {<br />
clear: both;<br />
padding: 5px 10px;<br />
display: block;<br />
max-width: 100%;<br />
margin:0 auto;}<br />
<br />
.flex:after {<br />
content: "";<br />
display: table;<br />
clear: both;<br />
}<br />
<br />
#bodycContent div.flex h1 {<br />
border-bottom: 1px solid #2d3e58;}<br />
<br />
ul {<br />
list-style-type: none;<br />
}<br />
<br />
[role="banner"] {<br />
background-color: #2d3e58;<br />
-webkit-transition: all 0.3s ease-in-out;<br />
-moz-transition: all 0.3s ease-in-out;<br />
-o-transition: all 0.3s ease-in-out;<br />
-ms-transition: all 0.3s ease-in-out;<br />
transition: all 0.3s ease-in-out;<br />
}<br />
<br />
[role="banner"]:after {<br />
content: "";<br />
display: table;<br />
clear: both;<br />
}<br />
<br />
[role="banner"] > .flex {<br />
padding-top: 0;<br />
padding-bottom: 0;<br />
}<br />
<br />
[role="banner"] h1 {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
<br />
[role="banner"].sticky {<br />
position: fixed;<br />
overflow: visible;<br />
top: 0;<br />
left: 0;<br />
width: 100%;<br />
z-index: 10;<br />
}<br />
<br />
/*[role="banner"].sticky .site-title {<br />
position: relative;<br />
opacity: 1;<br />
-webkit-transform: scale(1, 1);<br />
-moz-transform: scale(1, 1);<br />
-ms-transform: scale(1, 1);<br />
-o-transform: scale(1, 1);<br />
transform: scale(1, 1);<br />
height: 52px;<br />
}<br />
<br />
[role="banner"].sticky .site-title:before {<br />
opacity: 1;<br />
-webkit-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-moz-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-ms-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-o-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
}<br />
<br />
[role="banner"].sticky .site-title:after {<br />
display: none;<br />
}*/<br />
<br />
[role="banner"].sticky [role="navigation"] ul li:nth-of-type(1) {<br />
padding: 0 10px 0 0;<br />
}<br />
<br />
[role="banner"].sticky [role="navigation"] ul li:nth-of-type(2) {<br />
padding: 0 5% 0 0;<br />
}<br />
<br />
[role="banner"].sticky [role="navigation"] ul li:nth-of-type(3) {<br />
padding: 0 0 0 5%;<br />
}<br />
<br />
[role="banner"].sticky [role="navigation"] ul li:nth-of-type(4) {<br />
padding: 0 0 0 10px;<br />
}<br />
<br />
[role="banner"].sticky .site-title {<br />
position: absolute;<br />
opacity: 1;<br />
-webkit-transform: scale(1, 1);<br />
-moz-transform: scale(1, 1);<br />
-ms-transform: scale(1, 1);<br />
-o-transform: scale(1, 1);<br />
transform: scale(1, 1);<br />
}<br />
<br />
[role="banner"].sticky .site-title:before {<br />
-webkit-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-moz-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-ms-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-o-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
<br />
}<br />
<br />
[role="banner"].sticky .site-title:after {<br />
display: block;<br />
}<br />
<br />
[role="banner"].sticky .site-title:hover {<br />
-webkit-transform: translate(0, -35px);<br />
-moz-transform: translate(0, -35px);<br />
-ms-transform: translate(0, -35px);<br />
-o-transform: translate(0, -35px);<br />
transform: translate(0, -35px);<br />
}<br />
<br />
[role="banner"].sticky .site-title:hover:before {<br />
-webkit-transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
-moz-transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
-ms-transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
-o-transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
}<br />
<br />
[role="banner"].sticky .site-title:hover:after {<br />
opacity: 1;<br />
}<br />
<br />
[role="navigation"] {<br />
-webkit-transition: opacity 1s ease-in-out;<br />
-moz-transition: opacity 1s ease-in-out;<br />
-o-transition: opacity 1s ease-in-out;<br />
-ms-transition: opacity 1s ease-in-out;<br />
transition: opacity 1s ease-in-out;<br />
display: block;<br />
z-index: 2;<br />
overflow: visible;<br />
width: 100%;<br />
padding: 18px 10px 10px 10px;<br />
<br />
}<br />
<br />
[role="navigation"]:after {<br />
content: "";<br />
display: table;<br />
clear: both;<br />
}<br />
<br />
[role="navigation"] ul {<br />
list-style-type: none;<br />
display: inline-block;<br />
text-align: center;<br />
display: block;<br />
}<br />
<br />
[role="navigation"] ul:after {<br />
content: "";<br />
display: table;<br />
clear: both;<br />
}<br />
<br />
[role="navigation"] ul li {<br />
display: inline-block;<br />
text-align: center;<br />
margin: 0;<br />
width: 20%;<br />
padding: 5px 0;<br />
-webkit-transition: all 0.3s ease-in-out;<br />
-moz-transition: all 0.3s ease-in-out;<br />
-o-transition: all 0.3s ease-in-out;<br />
-ms-transition: all 0.3s ease-in-out;<br />
transition: all 0.3s ease-in-out;<br />
}<br />
<br />
[role="navigation"] ul li a {<br />
font-family: 'OpenSans','Trebuchet MS', Helvetica, sans-serif;<br />
font-weight: 800;<br />
text-transform: uppercase;<br />
letter-spacing: 1px;<br />
display: block;<br />
background: none;<br />
color: #f2ce3a;<br />
padding: 4px 10px;<br />
line-height: 1 !important;<br />
}<br />
<br />
[role="navigation"] ul li a:hover, [role="navigation"] ul li a:focus, [role="navigation"] ul li a:active {<br />
color: #efe771;<br />
}<br />
<br />
.epsilon {<br />
font-size: 1.2em;<br />
}<br />
<br />
.site-title {<br />
-webkit-transition: all 0.3s ease-in-out;<br />
-moz-transition: all 0.3s ease-in-out;<br />
-o-transition: all 0.3s ease-in-out;<br />
-ms-transition: all 0.3s ease-in-out;<br />
transition: all 0.3s ease-in-out;<br />
-webkit-transform: scale(0.5, 0.5);<br />
-moz-transform: scale(0.5, 0.5);<br />
-ms-transform: scale(0.5, 0.5);<br />
-o-transform: scale(0.5, 0.5);<br />
transform: scale(0.5, 0.5);<br />
position: absolute;<br />
z-index: 10;<br />
left: 50%;<br />
top: 8px;<br />
margin-left: -26px;<br />
background-image: url("https://static.igem.org/mediawiki/2014/e/ee/SJTU14_logoyellow.png");<br />
background-position: center center;<br />
width: 52px;<br />
height: 52px;<br />
background-size: 52px 52px;<br />
opacity: 0;<br />
}<br />
<br />
.site-title:before {<br />
-webkit-transition: all 0.6s ease-in-out;<br />
-moz-transition: all 0.6s ease-in-out;<br />
-o-transition: all 0.6s ease-in-out;<br />
-ms-transition: all 0.6s ease-in-out;<br />
transition: all 0.6s ease-in-out;<br />
content: '';<br />
position: absolute;<br />
display: block;<br />
/*background-image: url("https://static.igem.org/mediawiki/2014/e/ec/SJTU14_home.png");*/<br />
background-position: center center;<br />
width: 52px;<br />
height: 52px;<br />
background-size: 52px 52px;<br />
-webkit-transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
-moz-transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
-ms-transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
-o-transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
}<br />
<br />
.site-title:after {<br />
-webkit-transition: all 0.5s ease-in-out;<br />
-moz-transition: all 0.5s ease-in-out;<br />
-o-transition: all 0.5s ease-in-out;<br />
-ms-transition: all 0.5s ease-in-out;<br />
transition: all 0.5s ease-in-out;<br />
content: '';<br />
position: absolute;<br />
top: 42px;<br />
padding-top: 10px;<br />
padding-bottom: 20px;<br />
left: -12px;<br />
display: block;<br />
background-image: url("https://static.igem.org/mediawiki/2014/e/ec/SJTU14_home.png");<br />
background-position: center center;<br />
background-repeat: no-repeat;<br />
width: 75px;<br />
height: 13px;<br />
background-size: 75px 13px;<br />
opacity: 0;<br />
}</div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T19:00:48Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 75%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference ol{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T18:59:16Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 80%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference ol{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T18:57:40Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 85%;<br />
margin: 3% auto;<br />
padding: 5%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference ol{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T18:57:09Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 85%;<br />
margin: 3% auto;<br />
padding: 2%;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference ol{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/index.cssTeam:SJTU-BioX-Shanghai/index.css2014-10-17T18:56:10Z<p>HorizonP: </p>
<hr />
<div>html, body, div, span, applet, object, iframe,<br />
h1, h2, h3, h4, h5, h6, p, blockquote, pre,<br />
a, abbr, acronym, address, big, cite, code,<br />
del, dfn, em, img, ins, kbd, q, s, samp,<br />
small, strike, strong, sub, sup, tt, var,<br />
b, u, i, center,<br />
dl, dt, dd, ol, ul, li,<br />
fieldset, form, label, legend,<br />
table, caption, tbody, tfoot, thead, tr, th, td,<br />
article, aside, canvas, details, embed,<br />
figure, figcaption, footer, header, hgroup,<br />
menu, nav, output, ruby, section, summary,<br />
time, mark, audio, video {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
#wrap {<br />
border-top-width:1px;<br />
padding-top: 0;<br />
min-width: 100%;<br />
/*position: relative;*/<br />
}<br />
<br />
.content {<br />
width: 100%;<br />
}<br />
<br />
a {<br />
-webkit-transition: all 0.3s ease-in-out;<br />
-moz-transition: all 0.3s ease-in-out;<br />
-o-transition: all 0.3s ease-in-out;<br />
-ms-transition: all 0.3s ease-in-out;<br />
transition: all 0.3s ease-in-out;<br />
text-decoration: none;<br />
color:#68afbc;<br />
}<br />
a:visited {color:#f2ce3a;<br />
}<br />
<br />
a.alt {<br />
color: #111111;<br />
}<br />
<br />
a:hover, a:focus, a:active {<br />
color: #111111;<br />
}<br />
<br />
.ir {<br />
font-size: 0;<br />
color: transparent;<br />
display: block;<br />
background-repeat: no-repeat;<br />
background-position: left top;<br />
}<br />
<br />
.flex {<br />
clear: both;<br />
padding: 5px 10px;<br />
display: block;<br />
max-width: 100%;<br />
margin:0 auto;}<br />
<br />
.flex:after {<br />
content: "";<br />
display: table;<br />
clear: both;<br />
}<br />
<br />
#bodycContent div.flex h1 {<br />
border-bottom: 1px solid #2d3e58;}<br />
<br />
ul {<br />
list-style-type: none;<br />
}<br />
<br />
[role="banner"] {<br />
background-color: #2d3e58;<br />
-webkit-transition: all 0.3s ease-in-out;<br />
-moz-transition: all 0.3s ease-in-out;<br />
-o-transition: all 0.3s ease-in-out;<br />
-ms-transition: all 0.3s ease-in-out;<br />
transition: all 0.3s ease-in-out;<br />
}<br />
<br />
[role="banner"]:after {<br />
content: "";<br />
display: table;<br />
clear: both;<br />
}<br />
<br />
[role="banner"] > .flex {<br />
padding-top: 0;<br />
padding-bottom: 0;<br />
}<br />
<br />
[role="banner"] h1 {<br />
padding: 0;<br />
margin: 0;<br />
}<br />
<br />
[role="banner"].sticky {<br />
position: fixed;<br />
overflow: visible;<br />
top: 0;<br />
left: 0;<br />
width: 100%;<br />
z-index: 10;<br />
}<br />
<br />
/*[role="banner"].sticky .site-title {<br />
position: relative;<br />
opacity: 1;<br />
-webkit-transform: scale(1, 1);<br />
-moz-transform: scale(1, 1);<br />
-ms-transform: scale(1, 1);<br />
-o-transform: scale(1, 1);<br />
transform: scale(1, 1);<br />
height: 52px;<br />
}<br />
<br />
[role="banner"].sticky .site-title:before {<br />
opacity: 1;<br />
-webkit-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-moz-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-ms-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-o-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
}<br />
<br />
[role="banner"].sticky .site-title:after {<br />
display: none;<br />
}*/<br />
<br />
[role="banner"].sticky [role="navigation"] ul li:nth-of-type(1) {<br />
padding: 0 10px 0 0;<br />
}<br />
<br />
[role="banner"].sticky [role="navigation"] ul li:nth-of-type(2) {<br />
padding: 0 5% 0 0;<br />
}<br />
<br />
[role="banner"].sticky [role="navigation"] ul li:nth-of-type(3) {<br />
padding: 0 0 0 5%;<br />
}<br />
<br />
[role="banner"].sticky [role="navigation"] ul li:nth-of-type(4) {<br />
padding: 0 0 0 10px;<br />
}<br />
<br />
[role="banner"].sticky .site-title {<br />
position: absolute;<br />
opacity: 1;<br />
-webkit-transform: scale(1, 1);<br />
-moz-transform: scale(1, 1);<br />
-ms-transform: scale(1, 1);<br />
-o-transform: scale(1, 1);<br />
transform: scale(1, 1);<br />
}<br />
<br />
[role="banner"].sticky .site-title:before {<br />
-webkit-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-moz-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-ms-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
-o-transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
transform: rotate(360deg) rotateX(0deg) rotateY(0deg);<br />
<br />
}<br />
<br />
[role="banner"].sticky .site-title:after {<br />
display: block;<br />
}<br />
<br />
[role="banner"].sticky .site-title:hover {<br />
-webkit-transform: translate(0, -35px);<br />
-moz-transform: translate(0, -35px);<br />
-ms-transform: translate(0, -35px);<br />
-o-transform: translate(0, -35px);<br />
transform: translate(0, -35px);<br />
}<br />
<br />
[role="banner"].sticky .site-title:hover:before {<br />
-webkit-transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
-moz-transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
-ms-transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
-o-transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
transform: rotate(-180deg) rotateX(0deg) rotateY(0deg);<br />
}<br />
<br />
[role="banner"].sticky .site-title:hover:after {<br />
opacity: 1;<br />
}<br />
<br />
[role="navigation"] {<br />
-webkit-transition: opacity 1s ease-in-out;<br />
-moz-transition: opacity 1s ease-in-out;<br />
-o-transition: opacity 1s ease-in-out;<br />
-ms-transition: opacity 1s ease-in-out;<br />
transition: opacity 1s ease-in-out;<br />
display: block;<br />
z-index: 2;<br />
overflow: visible;<br />
width: 100%;<br />
padding: 18px 10px 10px 10px;<br />
<br />
}<br />
<br />
[role="navigation"]:after {<br />
content: "";<br />
display: table;<br />
clear: both;<br />
}<br />
<br />
[role="navigation"] ul {<br />
list-style-type: none;<br />
display: inline-block;<br />
text-align: center;<br />
display: block;<br />
}<br />
<br />
[role="navigation"] ul:after {<br />
content: "";<br />
display: table;<br />
clear: both;<br />
}<br />
<br />
[role="navigation"] ul li {<br />
display: inline-block;<br />
text-align: center;<br />
margin: 0;<br />
width: 20%;<br />
padding: 5px 0;<br />
-webkit-transition: all 0.3s ease-in-out;<br />
-moz-transition: all 0.3s ease-in-out;<br />
-o-transition: all 0.3s ease-in-out;<br />
-ms-transition: all 0.3s ease-in-out;<br />
transition: all 0.3s ease-in-out;<br />
}<br />
<br />
[role="navigation"] ul li a {<br />
font-family: 'OpenSans','Trebuchet MS', Helvetica, sans-serif;<br />
font-weight: 800;<br />
text-transform: uppercase;<br />
letter-spacing: 1px;<br />
display: block;<br />
background: none;<br />
color: #f2ce3a;<br />
padding: 4px 10px;<br />
line-height: 1 !important;<br />
}<br />
<br />
[role="navigation"] ul li a:hover, [role="navigation"] ul li a:focus, [role="navigation"] ul li a:active {<br />
color: #efe771;<br />
}<br />
<br />
.epsilon {<br />
font-size: 1.2em;<br />
}<br />
<br />
.site-title {<br />
-webkit-transition: all 0.3s ease-in-out;<br />
-moz-transition: all 0.3s ease-in-out;<br />
-o-transition: all 0.3s ease-in-out;<br />
-ms-transition: all 0.3s ease-in-out;<br />
transition: all 0.3s ease-in-out;<br />
-webkit-transform: scale(0.5, 0.5);<br />
-moz-transform: scale(0.5, 0.5);<br />
-ms-transform: scale(0.5, 0.5);<br />
-o-transform: scale(0.5, 0.5);<br />
transform: scale(0.5, 0.5);<br />
position: absolute;<br />
z-index: 10;<br />
left: 50%;<br />
top: 8px;<br />
margin-left: -26px;<br />
background-image: url("https://static.igem.org/mediawiki/2014/e/ee/SJTU14_logoyellow.png");<br />
background-position: center center;<br />
width: 52px;<br />
height: 52px;<br />
background-size: 52px 52px;<br />
opacity: 0;<br />
}<br />
<br />
.site-title:before {<br />
-webkit-transition: all 0.6s ease-in-out;<br />
-moz-transition: all 0.6s ease-in-out;<br />
-o-transition: all 0.6s ease-in-out;<br />
-ms-transition: all 0.6s ease-in-out;<br />
transition: all 0.6s ease-in-out;<br />
content: '';<br />
position: absolute;<br />
display: block;<br />
/*background-image: url("https://static.igem.org/mediawiki/2014/e/ec/SJTU14_home.png");*/<br />
background-position: center center;<br />
width: 52px;<br />
height: 52px;<br />
background-size: 52px 52px;<br />
-webkit-transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
-moz-transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
-ms-transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
-o-transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
transform: rotate(0deg) rotateX(0deg) rotateY(0deg);<br />
}<br />
<br />
.site-title:after {<br />
-webkit-transition: all 0.5s ease-in-out;<br />
-moz-transition: all 0.5s ease-in-out;<br />
-o-transition: all 0.5s ease-in-out;<br />
-ms-transition: all 0.5s ease-in-out;<br />
transition: all 0.5s ease-in-out;<br />
content: '';<br />
position: absolute;<br />
top: 42px;<br />
padding-top: 10px;<br />
padding-bottom: 20px;<br />
left: -12px;<br />
display: block;<br />
background-image: url("https://static.igem.org/mediawiki/2014/e/ec/SJTU14_home.png");<br />
background-position: center center;<br />
background-repeat: no-repeat;<br />
width: 75px;<br />
height: 13px;<br />
background-size: 75px 13px;<br />
opacity: 0;<br />
}</div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T18:45:02Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 85%;<br />
margin: 3% auto;<br />
padding: 30px;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference ol{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T18:42:56Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
width: 85%;<br />
margin: 3% auto;<br />
padding: 20px;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
#reference ol{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T18:35:46Z<p>HorizonP: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
#bodyContent<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
article<br />
{ <br />
margin: 3% 10%;<br />
padding: 15px;<br />
font-size:1.3em;<br />
box-shadow: 0 0 5px #2b3770;<br />
background-color: #FFF;<br />
}<br />
article p<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
h2#reference>ol>li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
</style><br />
</html></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-17T18:20:55Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
#bodyContent<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
#AllMembers<br />
{<br />
width: 85%;<br />
margin: 10px auto;<br />
padding: 0;<br />
box-shadow: 0 0 5px #000000;<br />
}<br />
div.memberProfile<br />
{<br />
margin: 100px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
.memberProfile h2<br />
{<br />
font-family: 'Open Sans', 'Times New Roman', Times, serif;<br />
font-size: 24px;<br />
margin: 30px 0 20px 0;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="AllMembers"><br />
<img src="https://static.igem.org/mediawiki/2014/9/93/SJTU14Team_members.jpeg" width="100%" alt="" /><br />
</div><br />
<div id="Students" class="memberProfile"><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:kangrenology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/25/Xuemin_Pan.jpg" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c6/Renhe_Luo.png" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Karin Yaragi</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member15" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
<div id="member16" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/71/Yitian_Yang.jpg" alt="" /></div><br />
<section id="" class="introduction">This guy served food for our meetings and was too lazy to have done one piece of our experiments.</section><br />
<section class="name">Yitian Yao</section><br />
</div><br />
<div id="member17" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/61/Yan_Jiang.JPG" alt="" /></div><br />
<section id="" class="introduction">Yan is a senior student majoring in Computer Science, who's also interested in designing work. She works for HP department in IGEM. Mostly in charge of the designing of promotion items.</section><br />
<section class="name">Yan Jiang</section><br />
</div><br />
<div id="member18" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e3/Yue_Shen.JPG" alt="" /></div><br />
<section id="" class="introduction">Hello everyone! I'm a 4th year Biotechnology major and I enjoy working in the lab. Motivated by the infinite possibility of synthetic biology, I joined SJTU-BioX-Shanghai to begin my own iGEM career. Since I previous involved in scientific research and social activities, I'm sure that this summer will be a fantastic journey of iGEM.</section><br />
<section class="name">Yue Shen</section><br />
</div><br />
<div id="member19" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Mingzhao_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">Hello, I am Chen Mingzhao. I am a hard working student especially do the thing I am interested in. Furthermore, I am a person with great perseverance. I did some help for the team.</section><br />
<section class="name">Mingzhao Chen</section><br />
</div><br />
<div id="member20" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/9/95/Jianye_Shi.jpeg" alt="" /></div><br />
<section id="" class="introduction">Male, occupied but available. Love reading novels. </section><br />
<section class="name">Jianye Shi</section><br />
</div><br />
</div><br />
<div id="teamRoster" class="memberProfile"><br />
<h2>Instructor</h2><br />
<div id="member21" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/59/Lin_He.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D., Professor, DirectorGenetic biologist, Fellow of Chinese Academy of Sciences, Fellow of TWAS. Professor and Director of Bio-X Institutes, Shanghai Jiao Tong University. Professor and Director of Institutes of Biomedical Scieces, Fudan University. Professor and PI of Shanghai Institute for Nutritional Sciences, SIBS, Chinese Academy of Sciences.</section><br />
<section class="name">Lin He</section><br />
</div><br />
<div id="member22" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/63/Gang_Ma.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D, Associate Professor, Co-Principal Investigator. He has won two golden medals of International Genetic Engineering Machine Competition as an instructor of SJTU-BIOX-SHANGHAI team in 2009 and 2010. Dr.Ma provided us the basic facilities and reagents for our experiment and gave us advice in system construction as well as in our experimental process.</section><br />
<section class="name">Gang Ma</section><br />
</div><br />
</div><br />
<div id="Advisior" class="memberProfile"><br />
<h2>Advisors</h2><br />
<div id="member23" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/49/Yushu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">Viola Wang, the research assistant in Synthetic Biology Lab of Bio-X Institute. Focusing on the gene circuit regulating device development and biofuel biosynthesis pathway modification. </section><br />
<section class="name">Viola Wang</section><br />
</div><br />
<div id="member24" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e2/ManXi_Zhu.jpg" alt="" /></div><br />
<section id="" class="introduction">Head of Strategic Business Development, Merck Millipore Greater China,joined Merck in 2006 right after she got her Ph.D of Physical Chemistry from Max Planck Institute for Solid State Research Stuttgart in Germany.</section><br />
<section class="name">Manxi Zhu</section><br />
</div><br />
<div id="member25" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8d/Yifan_Wu.jpg" alt="" /></div><br />
<section id="" class="introduction">A member from last year's SJTU-biox-Shanghai team. He gave us essential help during brainstorming.</section><br />
<section class="name">Yifan Wu</section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-17T18:19:55Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
body<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
#AllMembers<br />
{<br />
width: 85%;<br />
margin: 10px auto;<br />
padding: 0;<br />
box-shadow: 0 0 5px #000000;<br />
}<br />
div.memberProfile<br />
{<br />
margin: 100px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
.memberProfile h2<br />
{<br />
font-family: 'Open Sans', 'Times New Roman', Times, serif;<br />
font-size: 24px;<br />
margin: 30px 0 20px 0;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="AllMembers"><br />
<img src="https://static.igem.org/mediawiki/2014/9/93/SJTU14Team_members.jpeg" width="100%" alt="" /><br />
</div><br />
<div id="Students" class="memberProfile"><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:kangrenology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/25/Xuemin_Pan.jpg" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c6/Renhe_Luo.png" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Karin Yaragi</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member15" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
<div id="member16" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/71/Yitian_Yang.jpg" alt="" /></div><br />
<section id="" class="introduction">This guy served food for our meetings and was too lazy to have done one piece of our experiments.</section><br />
<section class="name">Yitian Yao</section><br />
</div><br />
<div id="member17" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/61/Yan_Jiang.JPG" alt="" /></div><br />
<section id="" class="introduction">Yan is a senior student majoring in Computer Science, who's also interested in designing work. She works for HP department in IGEM. Mostly in charge of the designing of promotion items.</section><br />
<section class="name">Yan Jiang</section><br />
</div><br />
<div id="member18" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e3/Yue_Shen.JPG" alt="" /></div><br />
<section id="" class="introduction">Hello everyone! I'm a 4th year Biotechnology major and I enjoy working in the lab. Motivated by the infinite possibility of synthetic biology, I joined SJTU-BioX-Shanghai to begin my own iGEM career. Since I previous involved in scientific research and social activities, I'm sure that this summer will be a fantastic journey of iGEM.</section><br />
<section class="name">Yue Shen</section><br />
</div><br />
<div id="member19" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Mingzhao_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">Hello, I am Chen Mingzhao. I am a hard working student especially do the thing I am interested in. Furthermore, I am a person with great perseverance. I did some help for the team.</section><br />
<section class="name">Mingzhao Chen</section><br />
</div><br />
<div id="member20" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/9/95/Jianye_Shi.jpeg" alt="" /></div><br />
<section id="" class="introduction">Male, occupied but available. Love reading novels. </section><br />
<section class="name">Jianye Shi</section><br />
</div><br />
</div><br />
<div id="teamRoster" class="memberProfile"><br />
<h2>Instructor</h2><br />
<div id="member21" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/59/Lin_He.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D., Professor, DirectorGenetic biologist, Fellow of Chinese Academy of Sciences, Fellow of TWAS. Professor and Director of Bio-X Institutes, Shanghai Jiao Tong University. Professor and Director of Institutes of Biomedical Scieces, Fudan University. Professor and PI of Shanghai Institute for Nutritional Sciences, SIBS, Chinese Academy of Sciences.</section><br />
<section class="name">Lin He</section><br />
</div><br />
<div id="member22" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/63/Gang_Ma.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D, Associate Professor, Co-Principal Investigator. He has won two golden medals of International Genetic Engineering Machine Competition as an instructor of SJTU-BIOX-SHANGHAI team in 2009 and 2010. Dr.Ma provided us the basic facilities and reagents for our experiment and gave us advice in system construction as well as in our experimental process.</section><br />
<section class="name">Gang Ma</section><br />
</div><br />
</div><br />
<div id="Advisior" class="memberProfile"><br />
<h2>Advisors</h2><br />
<div id="member23" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/49/Yushu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">Viola Wang, the research assistant in Synthetic Biology Lab of Bio-X Institute. Focusing on the gene circuit regulating device development and biofuel biosynthesis pathway modification. </section><br />
<section class="name">Viola Wang</section><br />
</div><br />
<div id="member24" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e2/ManXi_Zhu.jpg" alt="" /></div><br />
<section id="" class="introduction">Head of Strategic Business Development, Merck Millipore Greater China,joined Merck in 2006 right after she got her Ph.D of Physical Chemistry from Max Planck Institute for Solid State Research Stuttgart in Germany.</section><br />
<section class="name">Manxi Zhu</section><br />
</div><br />
<div id="member25" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8d/Yifan_Wu.jpg" alt="" /></div><br />
<section id="" class="introduction">A member from last year's SJTU-biox-Shanghai team. He gave us essential help during brainstorming.</section><br />
<section class="name">Yifan Wu</section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-17T18:08:57Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
#AllMembers<br />
{<br />
width: 85%;<br />
margin: 10px auto;<br />
padding: 0;<br />
box-shadow: 0 0 5px #000000;<br />
}<br />
div.memberProfile<br />
{<br />
margin: 100px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
.memberProfile h2<br />
{<br />
font-family: 'Open Sans', 'Times New Roman', Times, serif;<br />
font-size: 24px;<br />
margin: 30px 0 20px 0;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="AllMembers"><br />
<img src="https://static.igem.org/mediawiki/2014/9/93/SJTU14Team_members.jpeg" width="100%" alt="" /><br />
</div><br />
<div id="Students" class="memberProfile"><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:kangrenology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/25/Xuemin_Pan.jpg" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c6/Renhe_Luo.png" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Karin Yaragi</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member15" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
<div id="member16" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/71/Yitian_Yang.jpg" alt="" /></div><br />
<section id="" class="introduction">This guy served food for our meetings and was too lazy to have done one piece of our experiments.</section><br />
<section class="name">Yitian Yao</section><br />
</div><br />
<div id="member17" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/61/Yan_Jiang.JPG" alt="" /></div><br />
<section id="" class="introduction">Yan is a senior student majoring in Computer Science, who's also interested in designing work. She works for HP department in IGEM. Mostly in charge of the designing of promotion items.</section><br />
<section class="name">Yan Jiang</section><br />
</div><br />
<div id="member18" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e3/Yue_Shen.JPG" alt="" /></div><br />
<section id="" class="introduction">Hello everyone! I'm a 4th year Biotechnology major and I enjoy working in the lab. Motivated by the infinite possibility of synthetic biology, I joined SJTU-BioX-Shanghai to begin my own iGEM career. Since I previous involved in scientific research and social activities, I'm sure that this summer will be a fantastic journey of iGEM.</section><br />
<section class="name">Yue Shen</section><br />
</div><br />
<div id="member19" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Mingzhao_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">Hello, I am Chen Mingzhao. I am a hard working student especially do the thing I am interested in. Furthermore, I am a person with great perseverance. I did some help for the team.</section><br />
<section class="name">Mingzhao Chen</section><br />
</div><br />
<div id="member20" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/9/95/Jianye_Shi.jpeg" alt="" /></div><br />
<section id="" class="introduction">Male, occupied but available. Love reading novels. </section><br />
<section class="name">Jianye Shi</section><br />
</div><br />
</div><br />
<div id="teamRoster" class="memberProfile"><br />
<h2>Instructor</h2><br />
<div id="member21" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/59/Lin_He.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D., Professor, DirectorGenetic biologist, Fellow of Chinese Academy of Sciences, Fellow of TWAS. Professor and Director of Bio-X Institutes, Shanghai Jiao Tong University. Professor and Director of Institutes of Biomedical Scieces, Fudan University. Professor and PI of Shanghai Institute for Nutritional Sciences, SIBS, Chinese Academy of Sciences.</section><br />
<section class="name">Lin He</section><br />
</div><br />
<div id="member22" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/63/Gang_Ma.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D, Associate Professor, Co-Principal Investigator. He has won two golden medals of International Genetic Engineering Machine Competition as an instructor of SJTU-BIOX-SHANGHAI team in 2009 and 2010. Dr.Ma provided us the basic facilities and reagents for our experiment and gave us advice in system construction as well as in our experimental process.</section><br />
<section class="name">Gang Ma</section><br />
</div><br />
</div><br />
<div id="Advisior" class="memberProfile"><br />
<h2>Advisors</h2><br />
<div id="member23" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/49/Yushu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">Viola Wang, the research assistant in Synthetic Biology Lab of Bio-X Institute. Focusing on the gene circuit regulating device development and biofuel biosynthesis pathway modification. </section><br />
<section class="name">Viola Wang</section><br />
</div><br />
<div id="member24" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e2/ManXi_Zhu.jpg" alt="" /></div><br />
<section id="" class="introduction">Head of Strategic Business Development, Merck Millipore Greater China,joined Merck in 2006 right after she got her Ph.D of Physical Chemistry from Max Planck Institute for Solid State Research Stuttgart in Germany.</section><br />
<section class="name">Manxi Zhu</section><br />
</div><br />
<div id="member25" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8d/Yifan_Wu.jpg" alt="" /></div><br />
<section id="" class="introduction">A member from last year's SJTU-biox-Shanghai team. He gave us essential help during brainstorming.</section><br />
<section class="name">Yifan Wu</section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-17T18:06:40Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
#AllMembers<br />
{<br />
width: 85%;<br />
margin: 10px auto;<br />
padding: 0;<br />
box-shadow: 0 0 5px #000000;<br />
}<br />
div.memberProfile<br />
{<br />
margin: 100px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
#memberProfile h2<br />
{<br />
font-family: 'Open Sans', 'Times New Roman', Times, serif;<br />
font-size: 24px;<br />
margin: 30px 0 20px 0;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="AllMembers"><br />
<img src="https://static.igem.org/mediawiki/2014/9/93/SJTU14Team_members.jpeg" width="100%" alt="" /><br />
</div><br />
<div id="Students" class="memberProfile"><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:kangrenology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/25/Xuemin_Pan.jpg" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c6/Renhe_Luo.png" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Karin Yaragi</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member15" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
<div id="member16" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/71/Yitian_Yang.jpg" alt="" /></div><br />
<section id="" class="introduction">This guy served food for our meetings and was too lazy to have done one piece of our experiments.</section><br />
<section class="name">Yitian Yao</section><br />
</div><br />
<div id="member17" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/61/Yan_Jiang.JPG" alt="" /></div><br />
<section id="" class="introduction">Yan is a senior student majoring in Computer Science, who's also interested in designing work. She works for HP department in IGEM. Mostly in charge of the designing of promotion items.</section><br />
<section class="name">Yan Jiang</section><br />
</div><br />
<div id="member18" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e3/Yue_Shen.JPG" alt="" /></div><br />
<section id="" class="introduction">Hello everyone! I'm a 4th year Biotechnology major and I enjoy working in the lab. Motivated by the infinite possibility of synthetic biology, I joined SJTU-BioX-Shanghai to begin my own iGEM career. Since I previous involved in scientific research and social activities, I'm sure that this summer will be a fantastic journey of iGEM.</section><br />
<section class="name">Yue Shen</section><br />
</div><br />
<div id="member19" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Mingzhao_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">Hello, I am Chen Mingzhao. I am a hard working student especially do the thing I am interested in. Furthermore, I am a person with great perseverance. I did some help for the team.</section><br />
<section class="name">Mingzhao Chen</section><br />
</div><br />
<div id="member20" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/9/95/Jianye_Shi.jpeg" alt="" /></div><br />
<section id="" class="introduction">Male, occupied but available. Love reading novels. </section><br />
<section class="name">Jianye Shi</section><br />
</div><br />
</div><br />
<div id="teamRoster" class="memberProfile"><br />
<h2>Instructor</h2><br />
<div id="member21" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/59/Lin_He.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D., Professor, DirectorGenetic biologist, Fellow of Chinese Academy of Sciences, Fellow of TWAS. Professor and Director of Bio-X Institutes, Shanghai Jiao Tong University. Professor and Director of Institutes of Biomedical Scieces, Fudan University. Professor and PI of Shanghai Institute for Nutritional Sciences, SIBS, Chinese Academy of Sciences.</section><br />
<section class="name">Lin He</section><br />
</div><br />
<div id="member22" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/63/Gang_Ma.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D, Associate Professor, Co-Principal Investigator. He has won two golden medals of International Genetic Engineering Machine Competition as an instructor of SJTU-BIOX-SHANGHAI team in 2009 and 2010. Dr.Ma provided us the basic facilities and reagents for our experiment and gave us advice in system construction as well as in our experimental process.</section><br />
<section class="name">Gang Ma</section><br />
</div><br />
</div><br />
<div id="Advisior" class="memberProfile"><br />
<h2>Advisors</h2><br />
<div id="member23" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/49/Yushu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">Viola Wang, the research assistant in Synthetic Biology Lab of Bio-X Institute. Focusing on the gene circuit regulating device development and biofuel biosynthesis pathway modification. </section><br />
<section class="name">Viola Wang</section><br />
</div><br />
<div id="member24" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e2/ManXi_Zhu.jpg" alt="" /></div><br />
<section id="" class="introduction">Head of Strategic Business Development, Merck Millipore Greater China,joined Merck in 2006 right after she got her Ph.D of Physical Chemistry from Max Planck Institute for Solid State Research Stuttgart in Germany.</section><br />
<section class="name">Manxi Zhu</section><br />
</div><br />
<div id="member25" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8d/Yifan_Wu.jpg" alt="" /></div><br />
<section id="" class="introduction">A member from last year's SJTU-biox-Shanghai team. He gave us essential help during brainstorming.</section><br />
<section class="name">Yifan Wu</section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-17T17:55:31Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
#AllMembers<br />
{<br />
width: 85%;<br />
margin: 10px auto;<br />
padding: 0;<br />
box-shadow: 0 0 5px #000000;<br />
}<br />
div.memberProfile<br />
{<br />
margin: 100px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="AllMembers"><br />
<img src="https://static.igem.org/mediawiki/2014/9/93/SJTU14Team_members.jpeg" width="100%" alt="" /><br />
</div><br />
<div id="Students" class="memberProfile"><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:kangrenology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/25/Xuemin_Pan.jpg" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c6/Renhe_Luo.png" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Karin Yaragi</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member15" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
<div id="member16" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/71/Yitian_Yang.jpg" alt="" /></div><br />
<section id="" class="introduction">This guy served food for our meetings and was too lazy to have done one piece of our experiments.</section><br />
<section class="name">Yitian Yao</section><br />
</div><br />
<div id="member17" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/61/Yan_Jiang.JPG" alt="" /></div><br />
<section id="" class="introduction">Yan is a senior student majoring in Computer Science, who's also interested in designing work. She works for HP department in IGEM. Mostly in charge of the designing of promotion items.</section><br />
<section class="name">Yan Jiang</section><br />
</div><br />
<div id="member18" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e3/Yue_Shen.JPG" alt="" /></div><br />
<section id="" class="introduction">Hello everyone! I'm a 4th year Biotechnology major and I enjoy working in the lab. Motivated by the infinite possibility of synthetic biology, I joined SJTU-BioX-Shanghai to begin my own iGEM career. Since I previous involved in scientific research and social activities, I'm sure that this summer will be a fantastic journey of iGEM.</section><br />
<section class="name">Yue Shen</section><br />
</div><br />
<div id="member19" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Mingzhao_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">Hello, I am Chen Mingzhao. I am a hard working student especially do the thing I am interested in. Furthermore, I am a person with great perseverance. I did some help for the team.</section><br />
<section class="name">Mingzhao Chen</section><br />
</div><br />
<div id="member20" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/9/95/Jianye_Shi.jpeg" alt="" /></div><br />
<section id="" class="introduction">Male, occupied but available. Love reading novels. </section><br />
<section class="name">Jianye Shi</section><br />
</div><br />
</div><br />
<div id="teamRoster" class="memberProfile"><br />
<h2>Instructor</h2><br />
<div id="member21" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/59/Lin_He.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D., Professor, DirectorGenetic biologist, Fellow of Chinese Academy of Sciences, Fellow of TWAS. Professor and Director of Bio-X Institutes, Shanghai Jiao Tong University. Professor and Director of Institutes of Biomedical Scieces, Fudan University. Professor and PI of Shanghai Institute for Nutritional Sciences, SIBS, Chinese Academy of Sciences.</section><br />
<section class="name">Lin He</section><br />
</div><br />
<div id="member22" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/63/Gang_Ma.JPG" alt="" /></div><br />
<section id="" class="introduction">Ph.D, Associate Professor, Co-Principal Investigator. He has won two golden medals of International Genetic Engineering Machine Competition as an instructor of SJTU-BIOX-SHANGHAI team in 2009 and 2010. Dr.Ma provided us the basic facilities and reagents for our experiment and gave us advice in system construction as well as in our experimental process.</section><br />
<section class="name">Gang Ma</section><br />
</div><br />
</div><br />
<div id="Advisior" class="memberProfile"><br />
<h2>Advisors</h2><br />
<div id="member23" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/49/Yushu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">Viola Wang, the research assistant in Synthetic Biology Lab of Bio-X Institute. Focusing on the gene circuit regulating device development and biofuel biosynthesis pathway modification. </section><br />
<section class="name">Viola Wang</section><br />
</div><br />
<div id="member24" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e2/ManXi_Zhu.jpg" alt="" /></div><br />
<section id="" class="introduction">Head of Strategic Business Development, Merck Millipore Greater China,joined Merck in 2006 right after she got her Ph.D of Physical Chemistry from Max Planck Institute for Solid State Research Stuttgart in Germany.</section><br />
<section class="name">Manxi Zhu</section><br />
</div><br />
<div id="member25" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8d/Yifan_Wu.jpg" alt="" /></div><br />
<section id="" class="introduction">A member from last year's SJTU-biox-Shanghai team. He gave us essential help during brainstorming.</section><br />
<section class="name">Yifan Wu</section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/File:Jianye_Shi.jpegFile:Jianye Shi.jpeg2014-10-17T17:52:10Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:Xuemin_Pan.jpgFile:Xuemin Pan.jpg2014-10-17T16:58:01Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:SJTU14Team_members.jpegFile:SJTU14Team members.jpeg2014-10-17T16:51:54Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-17T15:05:07Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
div.memberProfile<br />
{<br />
margin: 100px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="Students" class="memberProfile"><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:kangrenology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c6/Renhe_Luo.png" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Karin Yaragi</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member15" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/71/Yitian_Yang.jpg" alt="" /></div><br />
<section id="" class="introduction">This guy served food for our meetings and was too lazy to have done one piece of our experiments.</section><br />
<section class="name">Yitian Yao</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/61/Yan_Jiang.JPG" alt="" /></div><br />
<section id="" class="introduction">Yan is a senior student majoring in Computer Science, who's also interested in designing work. She works for HP department in IGEM. Mostly in charge of the designing of promotion items.</section><br />
<section class="name">Yan Jiang</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e3/Yue_Shen.JPG" alt="" /></div><br />
<section id="" class="introduction">Hello everyone! I'm a 4th year Biotechnology major and I enjoy working in the lab. Motivated by the infinite possibility of synthetic biology, I joined SJTU-BioX-Shanghai to begin my own iGEM career. Since I previous involved in scientific research and social activities, I'm sure that this summer will be a fantastic journey of iGEM.</section><br />
<section class="name">Yue Shen</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Mingzhao_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">Hello, I am Chen Mingzhao. I am a hard working student especially do the thing I am interested in. Furthermore, I am a person with great perseverance. I did some help for the team.</section><br />
<section class="name">Mingzhao Chen</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"></div><br />
<section id="" class="introduction"></section><br />
<section class="name">Jianye S</section><br />
</div><br />
</div><br />
<div id="teamRoster" class="memberProfile"><br />
<h2>Instructor</h2><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/59/Lin_He.JPG" alt="" /></div><br />
<section id="" class="introduction"></section><br />
<section class="name">Lin He</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/6/63/Gang_Ma.JPG" alt="" /></div><br />
<section id="" class="introduction"></section><br />
<section class="name">Gang Ma</section><br />
</div><br />
</div><br />
<div id="Advisior" class="memberProfile"><br />
<h2>Advisors</h2><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/49/Yushu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction"></section><br />
<section class="name">Yushu Wang</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/e/e2/ManXi_Zhu.jpg" alt="" /></div><br />
<section id="" class="introduction"></section><br />
<section class="name">Manxi Zhu</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8d/Yifan_Wu.jpg" alt="" /></div><br />
<section id="" class="introduction"></section><br />
<section class="name">Yifan Wu</section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/File:Yifan_Wu.jpgFile:Yifan Wu.jpg2014-10-17T14:54:38Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:ManXi_Zhu.jpgFile:ManXi Zhu.jpg2014-10-17T14:35:05Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:Gang_Ma.JPGFile:Gang Ma.JPG2014-10-17T14:31:27Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:Mingzhao_Chen.jpgFile:Mingzhao Chen.jpg2014-10-17T14:23:12Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:Lin_He.JPGFile:Lin He.JPG2014-10-17T14:19:28Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:Yushu_Wang.jpgFile:Yushu Wang.jpg2014-10-17T14:16:31Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:Yue_Shen.JPGFile:Yue Shen.JPG2014-10-17T14:10:37Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:Yan_Jiang.JPGFile:Yan Jiang.JPG2014-10-17T14:07:34Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/File:Yitian_Yang.jpgFile:Yitian Yang.jpg2014-10-17T14:04:31Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-16T18:30:42Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
div#memberProfile<br />
{<br />
margin: 300px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="memberProfile"><br />
<h2>Team Roster</h2><br />
<div id="member" class="member"><br />
<div id="" class="avatar"></div><br />
<section id="" class="introduction"></section><br />
<section class="name">Lin He</section><br />
<br />
</div><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:renkangology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c6/Renhe_Luo.png" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Karin Yaragi</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member15" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
<h2>Advisors</h2><br />
<div id="member16" class="member"><br />
<div id="" class="avatar"><img src=""></div><br />
<section id="" class="introduction"></section><br />
<section class="name"></section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-16T17:53:53Z<p>HorizonP: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<br />
<br/><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h2 id="fourtypesofdistribution">&ensp;&ensp;&ensp;Four&nbsp;Types&nbsp;of&nbsp;Distribution</h2><br />
<ul><br />
<br/><br />
<li><strong>Type 1: Membrane & Random</strong><br/><br />
The position of enzyme is distributed randomly in the cell membrane.<br/></li><br />
<li><strong>Type 2: Membrane & Polymerization</strong><br/><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</li><br />
<li><strong>Type 3: Matrix & Random</strong><br/><br />
The position of enzyme is distributed randomly inside the cell.</li><br />
<li><strong>Type 4: Matrix & Random</strong><br/><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</li><br />
</ul><br />
<br />
<h2 id="hypothesisofsimulation">&ensp;&ensp;&ensp;Hypothesis of Simulation</h2><br />
<br/><br />
<ol><br />
<li>Metabolism<br/><br />
[图片一]<br/><br />
Enzymes: E0, E1,E2<br/><br />
Substrates:S0,S1,S2,S3</li><br />
<li>Initial Distribution of Substrates<br/><br />
All substrates are randomly distributed OUTSIDE the cell in all four simulations.</li><br />
<li>Movement of Substrates<br/><br />
The motion of molecules is random, including the rate and orientation.</li><br />
<li>Catalytic reaction<br/><br />
The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</li><br />
<li>Other Hypothesis<br/><br />
Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</li><br />
</ol><br />
<br />
<h2 id="results:">&ensp;&ensp;&ensp;Results:</h2><br />
<ul><br />
<br/><br />
<li><strong>All Results</strong></li><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<li><strong>Type 1</strong></li><br />
<li><strong>Type 2</strong></li><br />
<li><strong>Type 3</strong></li><br />
<li><strong>Type 4</strong></li></ul><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br/><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h2 id="WhydoweneedDocking?">&ensp;&ensp;&ensp;Why&nbsp;do&nbsp;we&nbsp;need&nbsp;Docking?</h2><br />
<ul><br />
<br/><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h2 id="Materials">&ensp;&ensp;&ensp;Materials</h2><br />
<ul><br />
<br/><br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<li><strong>PDB:3V6T</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img><br />
<br />
<h2 id="Mutations">&ensp;&ensp;&ensp;Mutations</h2><br />
<ul><br />
<br/><br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<br/><br />
<br/><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br/><br />
<br/><br />
<br />
<h2 id="Analysis">&ensp;&ensp;&ensp;Analysis</h2><br />
<ul><br />
<br/><br />
<li><strong>Table</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG"></img><br />
<li><strong>Table</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<br />
</ul><br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-16T17:53:01Z<p>HorizonP: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<br />
<br/><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h2 id="fourtypesofdistribution">&ensp;&ensp;&ensp;Four&nbsp;Types&nbsp;of&nbsp;Distribution</h2><br />
<ul><br />
<br/><br />
<li><strong>Type 1: Membrane & Random</strong><br/><br />
The position of enzyme is distributed randomly in the cell membrane.<br/></li><br />
<li><strong>Type 2: Membrane & Polymerization</strong><br/><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</li><br />
<li><strong>Type 3: Matrix & Random</strong><br/><br />
The position of enzyme is distributed randomly inside the cell.</li><br />
<li><strong>Type 4: Matrix & Random</strong><br/><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</li><br />
</ul><br />
<br />
<h2 id="hypothesisofsimulation">&ensp;&ensp;&ensp;Hypothesis of Simulation</h2><br />
<br/><br />
<ol><br />
<li>Metabolism<br/><br />
[图片一]<br/><br />
Enzymes: E0, E1,E2<br/><br />
Substrates:S0,S1,S2,S3</li><br />
<li>Initial Distribution of Substrates<br/><br />
All substrates are randomly distributed OUTSIDE the cell in all four simulations.</li><br />
<li>Movement of Substrates<br/><br />
The motion of molecules is random, including the rate and orientation.</li><br />
<li>Catalytic reaction<br/><br />
The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</li><br />
<li>Other Hypothesis<br/><br />
Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</li><br />
</ol><br />
<br />
<h2 id="results:">&ensp;&ensp;&ensp;Results:</h2><br />
<ul><br />
<br/><br />
<li><strong>All Results</strong></li><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<li><strong>Type 1</strong></li><br />
<li><strong>Type 2</strong></li><br />
<li><strong>Type 3</strong></li><br />
<li><strong>Type 4</strong></li></ul><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br/><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h2 id="WhydoweneedDocking?">&ensp;&ensp;&ensp;Why&nbsp;do&nbsp;we&nbsp;need&nbsp;Docking?</h2><br />
<ul><br />
<br/><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h2 id="Materials">&ensp;&ensp;&ensp;Materials</h2><br />
<ul><br />
<br/><br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<li><strong>PDB:3V6T</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img><br />
<br />
<h2 id="Mutations">&ensp;&ensp;&ensp;Mutations</h2><br />
<ul><br />
<br/><br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<br/><br />
<br/><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br/><br />
<br/><br />
<br />
<h2 id="Analysis">&ensp;&ensp;&ensp;Analysis</h2><br />
<ul><br />
<br/><br />
<li><strong>Table</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG"></img><br />
<li><strong>Table</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="400px"></img><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<br />
</ul><br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-16T17:51:40Z<p>HorizonP: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<br />
<br/><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h2 id="fourtypesofdistribution">&ensp;&ensp;&ensp;Four&nbsp;Types&nbsp;of&nbsp;Distribution</h2><br />
<ul><br />
<br/><br />
<li><strong>Type 1: Membrane & Random</strong><br/><br />
The position of enzyme is distributed randomly in the cell membrane.<br/></li><br />
<li><strong>Type 2: Membrane & Polymerization</strong><br/><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</li><br />
<li><strong>Type 3: Matrix & Random</strong><br/><br />
The position of enzyme is distributed randomly inside the cell.</li><br />
<li><strong>Type 4: Matrix & Random</strong><br/><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</li><br />
</ul><br />
<br />
<h2 id="hypothesisofsimulation">&ensp;&ensp;&ensp;Hypothesis of Simulation</h2><br />
<br/><br />
<ol><br />
<li>Metabolism<br/><br />
[图片一]<br/><br />
Enzymes: E0, E1,E2<br/><br />
Substrates:S0,S1,S2,S3</li><br />
<li>Initial Distribution of Substrates<br/><br />
All substrates are randomly distributed OUTSIDE the cell in all four simulations.</li><br />
<li>Movement of Substrates<br/><br />
The motion of molecules is random, including the rate and orientation.</li><br />
<li>Catalytic reaction<br/><br />
The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</li><br />
<li>Other Hypothesis<br/><br />
Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</li><br />
</ol><br />
<br />
<h2 id="results:">&ensp;&ensp;&ensp;Results:</h2><br />
<ul><br />
<br/><br />
<li><strong>All Results</strong></li><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<li><strong>Type 1</strong></li><br />
<li><strong>Type 2</strong></li><br />
<li><strong>Type 3</strong></li><br />
<li><strong>Type 4</strong></li></ul><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br/><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h2 id="WhydoweneedDocking?">&ensp;&ensp;&ensp;Why&nbsp;do&nbsp;we&nbsp;need&nbsp;Docking?</h2><br />
<ul><br />
<br/><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h2 id="Materials">&ensp;&ensp;&ensp;Materials</h2><br />
<ul><br />
<br/><br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<li><strong>PDB:3V6T</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img><br />
<br />
<h2 id="Mutations">&ensp;&ensp;&ensp;Mutations</h2><br />
<ul><br />
<br/><br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<br/><br />
<br/><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br/><br />
<br/><br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br/><br />
<br/><br />
<br />
<h2 id="Analysis">&ensp;&ensp;&ensp;Analysis</h2><br />
<ul><br />
<br/><br />
<li><strong>Table</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG"></img><br />
<li><strong>Table</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width=400px></img><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<br />
</ul><br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-16T17:31:27Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
div#memberProfile<br />
{<br />
margin: 300px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="memberProfile"><br />
<h2></h2><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:renkangology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c6/Renhe_Luo.png" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Karin Yaragi</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/File:Renhe_Luo.pngFile:Renhe Luo.png2014-10-16T17:30:31Z<p>HorizonP: </p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-16T17:25:06Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
div#memberProfile<br />
{<br />
margin: 300px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="memberProfile"><br />
<h2></h2><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:renkangology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Karin Yaragi</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonPhttp://2014.igem.org/File:SJTU_14M2.gifFile:SJTU 14M2.gif2014-10-16T17:20:04Z<p>HorizonP: uploaded a new version of &quot;File:SJTU 14M2.gif&quot;</p>
<hr />
<div></div>HorizonPhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_MembersTeam:SJTU-BioX-Shanghai/Team Members2014-10-16T17:06:45Z<p>HorizonP: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<link href='http://fonts.googleapis.com/css?family=Open+Sans:400italic,400' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/b/be/SJTU14_Team-Member.png");}<br />
<br />
div#memberProfile<br />
{<br />
margin: 300px 0;<br />
position: relative;<br />
padding: 0 0 0 200px;<br />
overflow: auto;<br />
}<br />
.member<br />
{<br />
position: relative;<br />
float: left;<br />
overflow: hidden;<br />
width: 125px;<br />
height: 160px;<br />
margin: 5px 415px 5px 0px;<br />
padding: 0;<br />
box-sizing: border-box;<br />
<br />
transition:all 0.5s ease;<br />
-moz-transition:all 0.5s ease;<br />
-webkit-transition:all 0.5s ease;<br />
-o-transition:all 0.5s ease;<br />
font-family: 'Open Sans', sans-serif;<br />
}<br />
<br />
.member:hover<br />
{<br />
width: 525px;<br />
margin-right: 15px;<br />
}<br />
<br />
.avatar<br />
{<br />
position: absolute;<br />
padding: 0;<br />
top: 0;<br />
left: 0;<br />
border-style: none;<br />
border-radius: 75px 75px;<br />
width: 120px;<br />
height: 120px;<br />
overflow: hidden;<br />
background-color: teal;<br />
}<br />
.introduction<br />
{<br />
position: absolute;<br />
top: 0;<br />
left: 125px;<br />
margin: 0;<br />
padding: 10px;<br />
border-top: 5px solid #f2ce3a;<br />
background-color: #ececec;<br />
overflow: hidden;<br />
width: 400px;<br />
height: 150px;<br />
box-sizing: border-box;<br />
font-style: italic;<br />
text-align: left;<br />
font-size: 14.5px;<br />
}<br />
.name<br />
{<br />
position: absolute;<br />
top: 130px;<br />
left: 0;<br />
width: 120px;<br />
height: 20px;<br />
margin: 0;<br />
text-align: center;<br />
font-size: 16px;<br />
}<br />
@media screen and (max-width: 1280px) <br />
{<br />
div#memberProfile<br />
{<br />
width: 550px;<br />
padding: 0;<br />
margin: 40px auto;<br />
}<br />
}<br />
<br />
<br />
</style><br />
<div id="memberProfile"><br />
<h2></h2><br />
<h2>Students</h2><br />
<div id="member1" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/2/2b/Yaojin_Sun.jpeg" alt="" /></div><br />
<section class="name">Yaojin Sun</section><br />
<section id="" class="introduction">I am taking responsibility of team management and modeling work. For the past eleven months, We has experienced laugh, argument, enjoy and improvement. One thing that never change is my trust to my teammates, to our project, to our dream. I will always be with my team, moving forward without fear.</section><br />
<br />
</div><br />
<div id="member2" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/7b/Yangyang_Li.JPG" alt="" /></div><br />
<section id="" class="introduction">I come from School of Life Sciences and Biotechnology, majoring in bioengineering. I’m mainly in charge of enzyme polymerization verification and help with TAL construction as well. I love the science lab, because that’s where I get to meet true friends. Hope we can all have a great time in MIT!</section><br />
<section class="name">Yangyang Li</section><br />
</div><br />
<div id="member3" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/3f/Kang_Ren.jpg" alt="" /></div><br />
<section id="" class="introduction">Science aims to discover facts, but leaves us free to find our own values. Welcome to see our crown, and hope you find the one of yours. <br />Email:renkangology@gamil.com</section><br />
<section class="name">Kang Ren</section><br />
</div><br />
<div id="member4" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/4/4e/Qiao_Zhou.jpg" alt="" /></div><br />
<section id="" class="introduction">Zhou Qiao, a junior student in Zhiyuan College, major in Bioscience. Responsible for TAL ligation ,protein expression and inverse PCR. Enjoy and improve! <br />Email:visionve@sjtu.edu.cn<br />
</section><br />
<section class="name">Qiao Zhou</section><br />
</div><br />
<div id="member5" class="member"><br />
<div id="" class="avatar"><img src="" alt="" /></div><br />
<section id="" class="introduction">I am a junior student majoring in biotechnology and I have learned a lot in participating in this challenging competition and our amicable team. I joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</section><br />
<section class="name">Xuemin Pan</section><br />
</div><br />
<div id="member6" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/cd/Xiangdong_Bu.jpg" alt="" /></div><br />
<section id="" class="introduction">Hi,my name is Xiangdong Bu ,a sophomore form Life science and technology school of SJTU. It is my great honor to join the SJTU-BioX-Shanghai iGEM team. I cherish this opportunity and have an attic faith that our team will do the best for this year’s jamboree.</section><br />
<section class="name">Xiangdong Bu</section><br />
</div><br />
<div id="member7" class="member"><br />
<div id="" class="avatar"><img src="" alt="" /></div><br />
<section id="" class="introduction">still young,still naive</section><br />
<section class="name">Renhe Luo</section><br />
</div><br />
<div id="member8" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/55/Ziyang_Tan.jpeg" alt="" /></div><br />
<section id="" class="introduction">“You look like a giraffe!” they said.<br />(╯‵□′)╯︵┻━┻<br />What I have done for our team is to assist in constructing the main part and remould vectors <br />
</section><br />
<section class="name">Ziyang Tan</section><br />
</div><br />
<div id="member9" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/82/Jialin_Liu.png" alt="" /></div><br />
<section id="" class="introduction">mua~</section><br />
<section class="name">Jialin Liu</section><br />
</div><br />
<div id="member10" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/53/Xingyu_Wang.jpg" alt="" /></div><br />
<section id="" class="introduction">I'd like to explore every beautiful star of the science universe and enjoy every charming moment during the journey, with you, my friends!</section><br />
<section class="name">Xingyu Wang</section><br />
</div><br />
<div id="member11" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/5/56/Jiannan_Ye.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a sophomore student majoring in life science. I choosed life science because of the beauty of life. I took part in iGEM because we can take advance of the beauty to make a better world.</section><br />
<section class="name">Jiannan Ye</section><br />
</div><br />
<div id="member12" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/8/8f/Peiyu_Liu.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm a student major in life science. However My interest is not only in life science but also in many other fields. So I participate in wiki construction.</section><br />
<section class="name">PeiYu Liu</section><br />
</div><br />
<div id="member13" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/3/30/Yaan_Ge.jpg" alt="" /></div><br />
<section id="" class="introduction">I'm responsible for wiki design and human practice part. It is iGem that bring me into the amazing new world of web design. Really appreciate this opportunity.</section><br />
<section class="name">Yaan Ge</section><br />
</div><br />
<div id="member14" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/7/72/Binhan_Hao.jpg" alt="" /></div><br />
<section id="" class="introduction">Life is not about finding yourself. It is about creating yourself. <br />
Be critical. Be creative. Be introspective. <br />Email: haobinhan@sjtu.edu.cn</section><br />
<section class="name">Binhan Hao</section><br />
</div><br />
<div id="member" class="member"><br />
<div id="" class="avatar"><img src="https://static.igem.org/mediawiki/2014/c/c3/Ming_Chen.jpg" alt="" /></div><br />
<section id="" class="introduction">I am Chen Ming and you can call me Carina. For most of the time, I took part in the wet lab part of our project and sometimes helped with the dry lab. I am outgoing and humorous so I think I am our team’s delight. What’s more, I like doing thing of challenge and creation, so the iGEM team is a prefect place for me. I love iGEM!</section><br />
<section class="name">Ming Chen</section><br />
</div><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>HorizonP