http://2014.igem.org/wiki/index.php?title=Special:Contributions/Gwen_Eleven&feed=atom&limit=50&target=Gwen_Eleven&year=&month=
2014.igem.org - User contributions [en]
2024-03-28T10:21:15Z
From 2014.igem.org
MediaWiki 1.16.5
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T01:17:52Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
<br />
<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_pre:hover{<br />
color:white;<br />
background-color:#FFB573;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_next:hover{<br />
color:white;<br />
background-color:#FFB573;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T01:17:26Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
<br />
<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_pre:hover{<br />
color:white;<br />
background-color:#FFB573;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_next:hover{<br />
color:white;<br />
background-color:#FFB573;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.trans_zh:hover{<br />
color:white;<br />
background-color:#FFB573;<br />
}<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T01:16:19Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
<br />
<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_pre:hover{<br />
color:white;<br />
background-color:#FFB573;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_next:hover{<br />
color:white;<br />
background-color:#FFB573;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T01:15:36Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
<br />
<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_pre:hover{<br />
color:white;<br />
background-color:#FFB573;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T01:14:29Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
<br />
<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_pre:hover{<br />
color:white;<br />
background-color:#e98f00;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T01:12:36Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
<br />
<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_pre:hover{<br />
color:white;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen
Team:Goettingen
2014-10-18T01:10:48Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<br />
<html><br />
<body><br />
<br />
<script src="https://2014.igem.org/Team:Goettingen/jquery_cycle?action=raw&type=text/js" type="text/javascript"></script><br />
<br />
<!-- end of main box--><br />
<br />
<!-- this is for the slider--><br />
<script type="text/javascript"><br />
$('#slider').cycle({ <br />
fx: 'scrollHorz', <br />
speed: 'slow', <br />
next: '#next', <br />
prev: '#prev' <br />
});<br />
</script><br />
<!--<br />
<div id="supportBox"><br />
<iframe frameborder="0" height="260" marginheight="0" marginwidth="0" src="https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget" style="border: 0; padding:0; margin:0;" width="160">Informieren und spenden: <a href='https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget' target='_blank'>„Internationales Forscherteam kämpft gegen Pilzinfektionen - iGEM 2014“</a> auf betterplace.org öffnen.</iframe><br />
</div> <br />
--><br />
<!-- main box --><br />
<div id="main"><br />
<div id="wrapper"><br />
<div id="container"><br />
<div class="controller" id="prev"></div><br />
<div id="slider"><br />
<a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/6/6a/Goettingen-Header-blackbg.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_overview"><img src="https://static.igem.org/mediawiki/2014/6/6b/Goettingen-SLIDER1_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_sponsors" ><img src="https://static.igem.org/mediawiki/2014/d/d4/Goettingen-SLIDER2_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/notebook_overview"> <img src="https://static.igem.org/mediawiki/2014/c/cb/Goettingen-Slider3_reduced-banner.jpg" width="1002" height="360" /></a><br />
</div><br />
<div class="controller" id="next"></div><br />
</div><br />
</div><br />
<br />
<div id="fourParts"><br />
<br />
<div class="four"><br />
<h1>Project</h1><br />
<div class="pictures" id="Pic1"><img src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen_project_ico.png" alt="" height="125" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">We intend to develop a fast screening technique for invasive fungi, such as <i>Aspergillus</i> spp. and <i>Candida</i> spp. The idea is to tag invasive fungal cells with a special peptide marker. By further modifying this protein marker with a signal molecule, the resulting construct has applications in both diagnostics and therapeutics.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
<div class="four"><br />
<h1>Notebook</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_notebook_ico.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%">Follow our steps and see how our wet-lab and dry-lab teams operated each day over the last 7 months; this part includes the experimental objectives of the aforementioned teams and their current status, methods used and last but not the least, the results.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/notebook_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Team</h1><br />
<div class="pictures" id="Pic3"><img src="https://static.igem.org/mediawiki/2014/8/89/Goettingen_team_ico.png" alt="" height="85" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">Our team consists of 12 ambitious and dedicated master students of Microbiology and Biochemistry from the Georg-August University of Göttingen. We love the quest for answers and are supporting each other to the fullest in order to accomplish our objectives! Go through the link for more information on the team.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/team_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Outreach</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_outreach_icon.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%"> Here, you can find the literature relevant to our project such as, the booklet for fundraising, the slides of our presentations, our progress reports, posters and flyers which we made as part of the human practice segment. Spread the word on synthetic biology and let us expand this ever-growing community!</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/outreach_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
</div> <!--Close the fourParts div--><br />
<br />
<br /><br /><br />
<div id="FinalVideo" style="text-align:center"><video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video></div><br />
<br /><br /><br />
</div><br />
<br />
<br />
<br />
<!-- Start of StatCounter Code for Default Guide --><br />
<b>Number of visits:<br />
<script type="text/javascript"><br />
var sc_project=10035522; <br />
var sc_invisible=0; <br />
var sc_security="11ff3436"; <br />
var sc_text=2; <br />
var scJsHost = (("https:" == document.location.protocol) ?"https://secure." : "http://www.");<br />
document.write("<sc"+"ript type='text/javascript' src='" + scJsHost + "statcounter.com/counter/counter.js'></"+"script>");<br />
</script><br />
<noscript><div class="statcounter"><a title="shopify stats" href="http://statcounter.com/shopify/" target="_blank"><img class="statcounter" src="http://c.statcounter.com/10035522/0/11ff3436/0/" alt="shopify stats"></a></div></noscript><br />
</b><br />
<!-- End of StatCounter Code for Default Guide --><br />
<br /><br /><br />
<hr><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</div><br />
<br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen
Team:Goettingen
2014-10-18T01:08:36Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<br />
<html><br />
<body><br />
<br />
<script src="https://2014.igem.org/Team:Goettingen/jquery_cycle?action=raw&type=text/js" type="text/javascript"></script><br />
<br />
<!-- end of main box--><br />
<br />
<!-- this is for the slider--><br />
<script type="text/javascript"><br />
$('#slider').cycle({ <br />
fx: 'scrollHorz', <br />
speed: 'slow', <br />
next: '#next', <br />
prev: '#prev' <br />
});<br />
</script><br />
<!--<br />
<div id="supportBox"><br />
<iframe frameborder="0" height="260" marginheight="0" marginwidth="0" src="https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget" style="border: 0; padding:0; margin:0;" width="160">Informieren und spenden: <a href='https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget' target='_blank'>„Internationales Forscherteam kämpft gegen Pilzinfektionen - iGEM 2014“</a> auf betterplace.org öffnen.</iframe><br />
</div> <br />
--><br />
<!-- main box --><br />
<div id="main"><br />
<div id="wrapper"><br />
<div id="container"><br />
<div class="controller" id="prev"></div><br />
<div id="slider"><br />
<a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/6/6a/Goettingen-Header-blackbg.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_overview"><img src="https://static.igem.org/mediawiki/2014/6/6b/Goettingen-SLIDER1_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_sponsors" ><img src="https://static.igem.org/mediawiki/2014/d/d4/Goettingen-SLIDER2_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/notebook_overview"> <img src="https://static.igem.org/mediawiki/2014/c/cb/Goettingen-Slider3_reduced-banner.jpg" width="1002" height="360" /></a><br />
</div><br />
<div class="controller" id="next"></div><br />
</div><br />
</div><br />
<br />
<div id="fourParts"><br />
<br />
<div class="four"><br />
<h1>Project</h1><br />
<div class="pictures" id="Pic1"><img src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen_project_ico.png" alt="" height="125" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">We intend to develop a fast screening technique for invasive fungi, such as <i>Aspergillus</i> spp. and <i>Candida</i> spp. The idea is to tag invasive fungal cells with a special peptide marker. By further modifying this protein marker with a signal molecule, the resulting construct has applications in both diagnostics and therapeutics.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
<div class="four"><br />
<h1>Notebook</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_notebook_ico.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%">Follow our steps and see how our wet-lab and dry-lab teams operated each day over the last 7 months; this part includes the experimental objectives of the aforementioned teams and their current status, methods used and last but not the least, the results.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/notebook_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Team</h1><br />
<div class="pictures" id="Pic3"><img src="https://static.igem.org/mediawiki/2014/8/89/Goettingen_team_ico.png" alt="" height="85" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">Our team consists of 12 ambitious and dedicated master students of Microbiology and Biochemistry from the Georg-August University of Göttingen. We love the quest for answers and are supporting each other to the fullest in order to accomplish our objectives! Go through the link for more information on the team.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/team_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Outreach</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_outreach_icon.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%"> Here, you can find the literature relevant to our project such as, the booklet for fundraising, the slides of our presentations, our progress reports, posters and flyers which we made as part of the human practice segment. Spread the word on synthetic biology and let us expand this ever-growing community!</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/outreach_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
</div> <!--Close the fourParts div--><br />
<br />
<br /><br /><br />
<div id="FinalVideo" style="text-align:center"><video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video></div><br />
<br /><br /><br />
</div><br />
<br />
<br />
<br />
<!-- Start of StatCounter Code for Default Guide --><br />
<b>Number of visits:<br />
<script type="text/javascript"><br />
var sc_project=10035522; <br />
var sc_invisible=0; <br />
var sc_security="11ff3436"; <br />
var sc_text=2; <br />
var scJsHost = (("https:" == document.location.protocol) ?<br />
"https://secure." : "http://www.");<br />
document.write("<sc"+"ript type='text/javascript' src='" +<br />
scJsHost+<br />
"statcounter.com/counter/counter.js'></"+"script>");<br />
</script><br />
<noscript><div class="statcounter"><a title="shopify stats"<br />
href="http://statcounter.com/shopify/" target="_blank"><img<br />
class="statcounter"<br />
src="http://c.statcounter.com/10035522/0/11ff3436/0/"<br />
alt="shopify stats"></a></div></noscript><br />
</b><br />
<!-- End of StatCounter Code for Default Guide --><br />
<br /><br />
<hr><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</div><br />
<br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen
Team:Goettingen
2014-10-18T01:08:15Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<br />
<html><br />
<body><br />
<br />
<script src="https://2014.igem.org/Team:Goettingen/jquery_cycle?action=raw&type=text/js" type="text/javascript"></script><br />
<br />
<!-- end of main box--><br />
<br />
<!-- this is for the slider--><br />
<script type="text/javascript"><br />
$('#slider').cycle({ <br />
fx: 'scrollHorz', <br />
speed: 'slow', <br />
next: '#next', <br />
prev: '#prev' <br />
});<br />
</script><br />
<!--<br />
<div id="supportBox"><br />
<iframe frameborder="0" height="260" marginheight="0" marginwidth="0" src="https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget" style="border: 0; padding:0; margin:0;" width="160">Informieren und spenden: <a href='https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget' target='_blank'>„Internationales Forscherteam kämpft gegen Pilzinfektionen - iGEM 2014“</a> auf betterplace.org öffnen.</iframe><br />
</div> <br />
--><br />
<!-- main box --><br />
<div id="main"><br />
<div id="wrapper"><br />
<div id="container"><br />
<div class="controller" id="prev"></div><br />
<div id="slider"><br />
<a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/6/6a/Goettingen-Header-blackbg.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_overview"><img src="https://static.igem.org/mediawiki/2014/6/6b/Goettingen-SLIDER1_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_sponsors" ><img src="https://static.igem.org/mediawiki/2014/d/d4/Goettingen-SLIDER2_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/notebook_overview"> <img src="https://static.igem.org/mediawiki/2014/c/cb/Goettingen-Slider3_reduced-banner.jpg" width="1002" height="360" /></a><br />
</div><br />
<div class="controller" id="next"></div><br />
</div><br />
</div><br />
<br />
<div id="fourParts"><br />
<br />
<div class="four"><br />
<h1>Project</h1><br />
<div class="pictures" id="Pic1"><img src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen_project_ico.png" alt="" height="125" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">We intend to develop a fast screening technique for invasive fungi, such as <i>Aspergillus</i> spp. and <i>Candida</i> spp. The idea is to tag invasive fungal cells with a special peptide marker. By further modifying this protein marker with a signal molecule, the resulting construct has applications in both diagnostics and therapeutics.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
<div class="four"><br />
<h1>Notebook</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_notebook_ico.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%">Follow our steps and see how our wet-lab and dry-lab teams operated each day over the last 7 months; this part includes the experimental objectives of the aforementioned teams and their current status, methods used and last but not the least, the results.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/notebook_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Team</h1><br />
<div class="pictures" id="Pic3"><img src="https://static.igem.org/mediawiki/2014/8/89/Goettingen_team_ico.png" alt="" height="85" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">Our team consists of 12 ambitious and dedicated master students of Microbiology and Biochemistry from the Georg-August University of Göttingen. We love the quest for answers and are supporting each other to the fullest in order to accomplish our objectives! Go through the link for more information on the team.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/team_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Outreach</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_outreach_icon.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%"> Here, you can find the literature relevant to our project such as, the booklet for fundraising, the slides of our presentations, our progress reports, posters and flyers which we made as part of the human practice segment. Spread the word on synthetic biology and let us expand this ever-growing community!</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/outreach_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
</div> <!--Close the fourParts div--><br />
<br />
<br /><br /><br />
<div id="FinalVideo" style="text-align:center"><video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video></div><br />
<br /><br /><br />
</div><br />
<br />
<br />
<br />
<!-- Start of StatCounter Code for Default Guide --><br />
<b>Number of visits:<br />
<script type="text/javascript"><br />
var sc_project=10035522; <br />
var sc_invisible=0; <br />
var sc_security="11ff3436"; <br />
var sc_text=2; <br />
var scJsHost = (("https:" == document.location.protocol) ?<br />
"https://secure." : "http://www.");<br />
document.write("<sc"+"ript type='text/javascript' src='" +<br />
scJsHost+<br />
"statcounter.com/counter/counter.js'></"+"script>");<br />
</script><br />
<noscript><div class="statcounter"><a title="shopify stats"<br />
href="http://statcounter.com/shopify/" target="_blank"><img<br />
class="statcounter"<br />
src="http://c.statcounter.com/10035522/0/11ff3436/0/"<br />
alt="shopify stats"></a></div></noscript><br />
</b><br />
<!-- End of StatCounter Code for Default Guide --><br />
<br />
<hr><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</div><br />
<br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T01:07:21Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
<br />
<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T01:06:39Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
<br />
#FinalVideo{<br />
padding:10px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T01:05:44Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
<br />
#FinalVideo{<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen
Team:Goettingen
2014-10-18T01:04:31Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<br />
<html><br />
<body><br />
<br />
<script src="https://2014.igem.org/Team:Goettingen/jquery_cycle?action=raw&type=text/js" type="text/javascript"></script><br />
<br />
<!-- end of main box--><br />
<br />
<!-- this is for the slider--><br />
<script type="text/javascript"><br />
$('#slider').cycle({ <br />
fx: 'scrollHorz', <br />
speed: 'slow', <br />
next: '#next', <br />
prev: '#prev' <br />
});<br />
</script><br />
<!--<br />
<div id="supportBox"><br />
<iframe frameborder="0" height="260" marginheight="0" marginwidth="0" src="https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget" style="border: 0; padding:0; margin:0;" width="160">Informieren und spenden: <a href='https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget' target='_blank'>„Internationales Forscherteam kämpft gegen Pilzinfektionen - iGEM 2014“</a> auf betterplace.org öffnen.</iframe><br />
</div> <br />
--><br />
<!-- main box --><br />
<div id="main"><br />
<div id="wrapper"><br />
<div id="container"><br />
<div class="controller" id="prev"></div><br />
<div id="slider"><br />
<a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/6/6a/Goettingen-Header-blackbg.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_overview"><img src="https://static.igem.org/mediawiki/2014/6/6b/Goettingen-SLIDER1_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_sponsors" ><img src="https://static.igem.org/mediawiki/2014/d/d4/Goettingen-SLIDER2_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/notebook_overview"> <img src="https://static.igem.org/mediawiki/2014/c/cb/Goettingen-Slider3_reduced-banner.jpg" width="1002" height="360" /></a><br />
</div><br />
<div class="controller" id="next"></div><br />
</div><br />
</div><br />
<br />
<div id="fourParts"><br />
<br />
<div class="four"><br />
<h1>Project</h1><br />
<div class="pictures" id="Pic1"><img src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen_project_ico.png" alt="" height="125" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">We intend to develop a fast screening technique for invasive fungi, such as <i>Aspergillus</i> spp. and <i>Candida</i> spp. The idea is to tag invasive fungal cells with a special peptide marker. By further modifying this protein marker with a signal molecule, the resulting construct has applications in both diagnostics and therapeutics.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
<div class="four"><br />
<h1>Notebook</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_notebook_ico.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%">Follow our steps and see how our wet-lab and dry-lab teams operated each day over the last 7 months; this part includes the experimental objectives of the aforementioned teams and their current status, methods used and last but not the least, the results.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/notebook_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Team</h1><br />
<div class="pictures" id="Pic3"><img src="https://static.igem.org/mediawiki/2014/8/89/Goettingen_team_ico.png" alt="" height="85" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">Our team consists of 12 ambitious and dedicated master students of Microbiology and Biochemistry from the Georg-August University of Göttingen. We love the quest for answers and are supporting each other to the fullest in order to accomplish our objectives! Go through the link for more information on the team.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/team_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Outreach</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_outreach_icon.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%"> Here, you can find the literature relevant to our project such as, the booklet for fundraising, the slides of our presentations, our progress reports, posters and flyers which we made as part of the human practice segment. Spread the word on synthetic biology and let us expand this ever-growing community!</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/outreach_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
</div> <!--Close the fourParts div--><br />
<br />
<br /><br /><br />
<div id="FinalVideo" style="text-align:center"><video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video></div><br />
<br /><br /><br />
</div><br />
<br />
<br />
<br />
<!-- Start of StatCounter Code for Default Guide --><br />
<b>Number of visits:<br />
<script type="text/javascript"><br />
var sc_project=10035522; <br />
var sc_invisible=0; <br />
var sc_security="11ff3436"; <br />
var sc_text=2; <br />
var scJsHost = (("https:" == document.location.protocol) ?<br />
"https://secure." : "http://www.");<br />
document.write("<sc"+"ript type='text/javascript' src='" +<br />
scJsHost+<br />
"statcounter.com/counter/counter.js'></"+"script>");<br />
</script><br />
<noscript><div class="statcounter"><a title="shopify stats"<br />
href="http://statcounter.com/shopify/" target="_blank"><img<br />
class="statcounter"<br />
src="http://c.statcounter.com/10035522/0/11ff3436/0/"<br />
alt="shopify stats"></a></div></noscript><br />
</b><br />
<!-- End of StatCounter Code for Default Guide --><br />
<br />
<!-- This is supposed to be a date-counter --><br />
<?php<br />
$d1=strtotime("October 30");<br />
$d2=ceil(($d1-time())/60/60/24);<br />
echo "The Gaint Jamboree is in :" . $d2 ." days";<br />
?><br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</div><br />
<br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen
Team:Goettingen
2014-10-18T01:02:58Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<br />
<html><br />
<body><br />
<br />
<script src="https://2014.igem.org/Team:Goettingen/jquery_cycle?action=raw&type=text/js" type="text/javascript"></script><br />
<br />
<!-- end of main box--><br />
<br />
<!-- this is for the slider--><br />
<script type="text/javascript"><br />
$('#slider').cycle({ <br />
fx: 'scrollHorz', <br />
speed: 'slow', <br />
next: '#next', <br />
prev: '#prev' <br />
});<br />
</script><br />
<!--<br />
<div id="supportBox"><br />
<iframe frameborder="0" height="260" marginheight="0" marginwidth="0" src="https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget" style="border: 0; padding:0; margin:0;" width="160">Informieren und spenden: <a href='https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget' target='_blank'>„Internationales Forscherteam kämpft gegen Pilzinfektionen - iGEM 2014“</a> auf betterplace.org öffnen.</iframe><br />
</div> <br />
--><br />
<!-- main box --><br />
<div id="main"><br />
<div id="wrapper"><br />
<div id="container"><br />
<div class="controller" id="prev"></div><br />
<div id="slider"><br />
<a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/6/6a/Goettingen-Header-blackbg.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_overview"><img src="https://static.igem.org/mediawiki/2014/6/6b/Goettingen-SLIDER1_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_sponsors" ><img src="https://static.igem.org/mediawiki/2014/d/d4/Goettingen-SLIDER2_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/notebook_overview"> <img src="https://static.igem.org/mediawiki/2014/c/cb/Goettingen-Slider3_reduced-banner.jpg" width="1002" height="360" /></a><br />
</div><br />
<div class="controller" id="next"></div><br />
</div><br />
</div><br />
<br /><br /><br />
<div id="FinalVideo" style="text-align:center"><video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video></div><br />
<br /><br /><br />
<div id="fourParts"><br />
<br />
<div class="four"><br />
<h1>Project</h1><br />
<div class="pictures" id="Pic1"><img src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen_project_ico.png" alt="" height="125" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">We intend to develop a fast screening technique for invasive fungi, such as <i>Aspergillus</i> spp. and <i>Candida</i> spp. The idea is to tag invasive fungal cells with a special peptide marker. By further modifying this protein marker with a signal molecule, the resulting construct has applications in both diagnostics and therapeutics.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
<div class="four"><br />
<h1>Notebook</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_notebook_ico.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%">Follow our steps and see how our wet-lab and dry-lab teams operated each day over the last 7 months; this part includes the experimental objectives of the aforementioned teams and their current status, methods used and last but not the least, the results.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/notebook_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Team</h1><br />
<div class="pictures" id="Pic3"><img src="https://static.igem.org/mediawiki/2014/8/89/Goettingen_team_ico.png" alt="" height="85" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">Our team consists of 12 ambitious and dedicated master students of Microbiology and Biochemistry from the Georg-August University of Göttingen. We love the quest for answers and are supporting each other to the fullest in order to accomplish our objectives! Go through the link for more information on the team.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/team_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Outreach</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_outreach_icon.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%"> Here, you can find the literature relevant to our project such as, the booklet for fundraising, the slides of our presentations, our progress reports, posters and flyers which we made as part of the human practice segment. Spread the word on synthetic biology and let us expand this ever-growing community!</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/outreach_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
</div> <!--Close the fourParts div--><br />
</div><br />
<br />
<br />
<br />
<!-- Start of StatCounter Code for Default Guide --><br />
<b>Number of visits:<br />
<script type="text/javascript"><br />
var sc_project=10035522; <br />
var sc_invisible=0; <br />
var sc_security="11ff3436"; <br />
var sc_text=2; <br />
var scJsHost = (("https:" == document.location.protocol) ?<br />
"https://secure." : "http://www.");<br />
document.write("<sc"+"ript type='text/javascript' src='" +<br />
scJsHost+<br />
"statcounter.com/counter/counter.js'></"+"script>");<br />
</script><br />
<noscript><div class="statcounter"><a title="shopify stats"<br />
href="http://statcounter.com/shopify/" target="_blank"><img<br />
class="statcounter"<br />
src="http://c.statcounter.com/10035522/0/11ff3436/0/"<br />
alt="shopify stats"></a></div></noscript><br />
</b><br />
<!-- End of StatCounter Code for Default Guide --><br />
<br />
<!-- This is supposed to be a date-counter --><br />
<?php<br />
$d1=strtotime("October 30");<br />
$d2=ceil(($d1-time())/60/60/24);<br />
echo "The Gaint Jamboree is in :" . $d2 ." days";<br />
?><br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</div><br />
<br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen
Team:Goettingen
2014-10-18T01:02:06Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<br />
<html><br />
<body><br />
<br />
<script src="https://2014.igem.org/Team:Goettingen/jquery_cycle?action=raw&type=text/js" type="text/javascript"></script><br />
<br />
<!-- end of main box--><br />
<br />
<!-- this is for the slider--><br />
<script type="text/javascript"><br />
$('#slider').cycle({ <br />
fx: 'scrollHorz', <br />
speed: 'slow', <br />
next: '#next', <br />
prev: '#prev' <br />
});<br />
</script><br />
<!--<br />
<div id="supportBox"><br />
<iframe frameborder="0" height="260" marginheight="0" marginwidth="0" src="https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget" style="border: 0; padding:0; margin:0;" width="160">Informieren und spenden: <a href='https://www.betterplace.org/de/projects/21161-internationales-forscherteam-kampft-gegen-pilzinfektionen-igem-2014/widget' target='_blank'>„Internationales Forscherteam kämpft gegen Pilzinfektionen - iGEM 2014“</a> auf betterplace.org öffnen.</iframe><br />
</div> <br />
--><br />
<!-- main box --><br />
<div id="main"><br />
<div id="wrapper"><br />
<div id="container"><br />
<div class="controller" id="prev"></div><br />
<div id="slider"><br />
<a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/6/6a/Goettingen-Header-blackbg.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_overview"><img src="https://static.igem.org/mediawiki/2014/6/6b/Goettingen-SLIDER1_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/team_sponsors" ><img src="https://static.igem.org/mediawiki/2014/d/d4/Goettingen-SLIDER2_reduced-banner.jpg" width="1002" height="360" /></a><br />
<a href="https://2014.igem.org/Team:Goettingen/notebook_overview"> <img src="https://static.igem.org/mediawiki/2014/c/cb/Goettingen-Slider3_reduced-banner.jpg" width="1002" height="360" /></a><br />
</div><br />
<div class="controller" id="next"></div><br />
</div><br />
</div><br />
<br /><br /<br />
<div id="FinalVideo" style="text-align:center"><video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video></div><br />
<br /><br /><br />
<div id="fourParts"><br />
<br />
<div class="four"><br />
<h1>Project</h1><br />
<div class="pictures" id="Pic1"><img src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen_project_ico.png" alt="" height="125" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">We intend to develop a fast screening technique for invasive fungi, such as <i>Aspergillus</i> spp. and <i>Candida</i> spp. The idea is to tag invasive fungal cells with a special peptide marker. By further modifying this protein marker with a signal molecule, the resulting construct has applications in both diagnostics and therapeutics.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/project_overview_navi" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
<div class="four"><br />
<h1>Notebook</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_notebook_ico.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%">Follow our steps and see how our wet-lab and dry-lab teams operated each day over the last 7 months; this part includes the experimental objectives of the aforementioned teams and their current status, methods used and last but not the least, the results.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/notebook_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Team</h1><br />
<div class="pictures" id="Pic3"><img src="https://static.igem.org/mediawiki/2014/8/89/Goettingen_team_ico.png" alt="" height="85" width="180" /></div><br />
<div class="paragraph"><p style="font-size:110%">Our team consists of 12 ambitious and dedicated master students of Microbiology and Biochemistry from the Georg-August University of Göttingen. We love the quest for answers and are supporting each other to the fullest in order to accomplish our objectives! Go through the link for more information on the team.</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/team_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40" /></a></div><br />
</div><br />
<div class="four"><br />
<h1>Outreach</h1><br />
<div class="pictures"><img src="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_outreach_icon.png" alt="" height="170" width="180"/></div><br />
<div class="paragraph"><p style="font-size:110%"> Here, you can find the literature relevant to our project such as, the booklet for fundraising, the slides of our presentations, our progress reports, posters and flyers which we made as part of the human practice segment. Spread the word on synthetic biology and let us expand this ever-growing community!</p></div><br />
<div class="buttonGreen"><a href="https://2014.igem.org/Team:Goettingen/outreach_overview" ><img src="https://static.igem.org/mediawiki/2014/1/13/GreenGoettingen_click.png" width="40"/></a></div><br />
</div><br />
</div> <!--Close the fourParts div--><br />
<div id="FinalVideo" style="text-align:center"><video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video></div><br />
<br /><br /><br />
</div><br />
<br />
<br />
<br />
<!-- Start of StatCounter Code for Default Guide --><br />
<b>Number of visits:<br />
<script type="text/javascript"><br />
var sc_project=10035522; <br />
var sc_invisible=0; <br />
var sc_security="11ff3436"; <br />
var sc_text=2; <br />
var scJsHost = (("https:" == document.location.protocol) ?<br />
"https://secure." : "http://www.");<br />
document.write("<sc"+"ript type='text/javascript' src='" +<br />
scJsHost+<br />
"statcounter.com/counter/counter.js'></"+"script>");<br />
</script><br />
<noscript><div class="statcounter"><a title="shopify stats"<br />
href="http://statcounter.com/shopify/" target="_blank"><img<br />
class="statcounter"<br />
src="http://c.statcounter.com/10035522/0/11ff3436/0/"<br />
alt="shopify stats"></a></div></noscript><br />
</b><br />
<!-- End of StatCounter Code for Default Guide --><br />
<br />
<!-- This is supposed to be a date-counter --><br />
<?php<br />
$d1=strtotime("October 30");<br />
$d2=ceil(($d1-time())/60/60/24);<br />
echo "The Gaint Jamboree is in :" . $d2 ." days";<br />
?><br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</div><br />
<br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/project_overview/project_wetlab
Team:Goettingen/project overview/project wetlab
2014-10-18T00:58:14Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/projectLP}}<br />
<html><br />
<body><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery-1-11-1?action=raw&type=text/js" type="text/javascript"></script><br />
<!-- main part of the subpage --><br />
<div id="subpage"> <br />
<br />
<br />
<!-- right column--><br />
<div class="proRP" id="rpart1"><br />
<div class="trans_zh"><a href="https://2014.igem.org/Team:Goettingen/project_overview/project_wetlab_ZH"><b>中文</b></a></div><br />
<h1 id="wetlab">Results: Wetlab</h1><br />
<br />
<br />
<h2 id="approach">Approach</h2><br />
<p>Our experimental approach can be summarized as follows:</p><br /><br />
<br />
<ol><br />
<li><p>1. Organisms and surface proteins selection</p></li><br />
<li><p>2. Surface protein amplification and cloning</p></li><br />
<li><p>3. Yeast two-hybrid assay with an existing peptide library</p></li><br />
<li><p>4. Peptide functionalization</p></li><br />
</ol><br />
<br />
<br /><br /><br />
<a href="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" target="1"><img id="graphic" src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" width="700" data-zoom-image="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" /></a><caption><br /><br /><br />
<br />
<h2 id="wlresults">Results summary</h2><br />
<br />
<p>We chose the five fungi <i>Aspergillus fumigatus</i>, <i>A. nidulans</i>, <i>Candida glabrata</i>, <i>C. albicans</i> and <i>Saccharomyces cerevisiae</i> as well as the parasite <i>Toxoplasma gondii</i> for our project. In the first step, we amplified all in all 35 different genes encoding surface proteins of the mentioned organisms in a standard PCR reaction (compare table 1). We were able to transform 20 of our 35 genes into a so called bait vector (contains a DNA-binding domain) and performed the Yeast-Two-Hybrid (Y2H) screening with them. Thereby, we accomplished to find more than 3000 probable interaction partners for our surface proteins. </p><br /><br /><br />
<br />
<p><b>Table 1| Selected surface proteins and the corresponding organism.</b></p></br></br><br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th>Gene</td><br />
<th>Organism</td><br />
</tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AJ010064.1" target="1"><i>mp65</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_716672.1" target="1"><i>tos1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NW_139623.1" target="1"><i>sim1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_712917.1" target="1"><i>als1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/U87956.1" target="1"><i>als3</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0H06413g" target="1"><i>ssr1</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr class="con"><td colspan="3">Click to expand</td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0I06160g " target="1"><i>pir4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0G00308g " target="1"><i>scw4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0M08492g " target="1"><i>pir3</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0C02211g " target="1"><i>utr2</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI45" target="1"><i>crf2full</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI46" target="1"><i>crf2act</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleno</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WNS8" target="1"><i>ecm33</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WGL5" target="1"><i>sun1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/P41746" target="1"><i>roda</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleex</i></a></td><td><i>A. fumigatus</i></td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WQ14" target="1"><i>prm1 b</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q8J0P4 " target="1"><i>crf1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB243112.1" target="1"><i>roda</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Z49892" target="1"><i>xlna</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_658391.1" target="1"><i>npc2</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_675875.1" target="1"><i>sho1</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/50952829" target="1"><i>eglc</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WG16" target="1"><i>eglc</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/D37975.1" target="1"><i>CWP1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001180025.1" target="1"><i>CWP2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001183428.1" target="1"><i>TIR4</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001178902.1" target="1"><i>TIR1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001182221.1" target="1"><i>MID2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB530985.1" target="1"><i>SED1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/FJ593880.1" target="1"><i>ama1</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY587208.1" target="1"><i>rom5</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY704175.1" target="1"><i>rom4</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr class="con"><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/DQ459452.2" target="1"><i>gra7</i></a></td><td><i>T. gondii</i></td></tr> <br />
<br />
</table></center><br /><br />
<br />
<script><br />
$('.con').click(function () {<br />
var $this = $(this);<br />
$(this).nextUntil('tr.con').slideToggle(100).promise().done(function () {<br />
$this.find('span').text(function (_, value) {<br />
return value == '-' ? '+' : '-'<br />
});<br />
});<br />
});</script><br />
<script><br />
$(document).ready(function(){$('.con').trigger('click');});</script><br />
<p>The results for all the genes we selected are summarized in this <a href="https://static.igem.org/mediawiki/2014/6/60/Goettingen2014-NumberS.pdf" target="1">file.</a></p><br />
<br />
<br />
<br /><br /><br />
<br />
<p>To exclude “false positive” interaction partners (e.g. caused by a very weak interaction) we picked grown colonies and transferred them onto plates with a selection medium that allows only yeast cells containing peptides with a strong affinity to our surface proteins to grow. After this procedure and several previous selection steps, we still had around 70% of our interaction partners from the first screening. </p><br /><br /><br />
<p>To have a manageable amount of samples, we chose 10 of the interaction partners (peptides) which we found in the Y2H screen for each of our 20 surface proteins and used them for further analysis. The cells containing the plasmids were plated on selection plates and the Y2H screen was repeated to finally confirm the interaction between one of our surface proteins and a specific peptide. This time, we used a robot to fasten up the screen and to be able to analyze a large number of possible interactions at the same time. <br /><br /><br />
<br />
<b>Interactions could be verified in 70% of all tested interaction partners! </b><br /><br /><br />
In the last step, we tested the interaction of our surface proteins and the peptides in <i>in vivo</i> experiments. Previously, we chose some of the peptides and sequenced them to get to know the sequence and to exclude the possibility that we isolated the same peptides in different samples. The sequences encoding the peptides were introduced into an over-expression vector for <i>E. coli</i>; thereby, we were able to get large amounts of our peptides which we called <i>PepTags</i> from then on. In the last step for the time being, we tested the fungi <i>A. fumigatus</i>, <i>A. nidulans</i> and <i>C. glabrata</i> with peptides, which are supposed to interact specific with one of their surface proteins<i> in vivo </i>using fluorescence microscopy. <br /><br /><br />
With the<i> in vivo </i>experiments we want to proof that the identified <i>PepTags</i> not only bind to their surface proteins in an Y2H screen, but also to living fungi. To visualize the fungal surface itself, we stained structures containing chitin and cellulose in the fungal cell wall with calcofluor (figure 1C and 2C). The first organism with whom the functionality of our system was tested was A. fumigatus and the <i>PepTag</i> No.13. Binding of this <i>PepTag</i> to the fungi was visualized with an antibody fused to a fluorescent molecule (Chromeo 488, figure 1A and 2A).</p> <br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/0/08/Goettingen2014-fm-fig1.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/9/99/Goettingen2014-fm-fig1.png" width="600"></a></center><br />
<center><p style="font-size=8px;"><b>Figure 1| Fluorescence microscopy of <i>Aspergillus fumigatus</i> hyphae.</b> This figure shows an A. fumigatus hyphae incubated with <i>PepTag</i>13, antibody and stained with calcofluor. Under light with a wavelength of 488 nm, the complexes containing <i>PepTag</i>13 and antibody show fluorescence. The excitation of calcofluor at a wavelength of 358 nm allows the identification of the hyphal surface (blue light). The second picture shows the hyphae in a bright field, while the merged picture demonstrates that the green fluorescence is located in the same area as the blue one.</p></center><br />
<br />
<br /><br />
<p>We were able to show that our peptide binds specifically to the surface of <i>A. fumigatus</i>, which is visualized by the green dots along the outer surface of the fungal cells. We also tested <i>PepTag</i> No.13 with <i>A. nidulans</i> (figure 2) but could not see any fluorescent signal. That means that our <i>PepTag</i> No.13 binds not only specific to the fungal surface, but also specific to the surface protein Sun1 of <i>A. fumigatus</i>. Moreover, we could show that the antibody cannot bind unspecific to the fungal surface when the <i>PepTag</i> is missing . For further information <a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab#week23">have a look at our lab-book.</a></p><br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/6/64/Goettingen2014-fm-fig2.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/f/ff/Goettingen2014-fm-fig2.png" width="600"></a></center><br />
<p><b><p style="font-size=8px;">Figure 2| Fluorescence microscope picture of an <i>Aspergillus nidulans</i> hyphae.</b> This figure shows an <i>A. nidulans</i> hyphae incubated with <i>PepTag</i> No.13, antibody and calcofluor. Upon irradiation with light of 488 nm, no fluorescence occurs (first picture). The excitation of calcofluor at a wavelength of 358 nm allows identification of the surface of the hyphae (blue light). The <i>PepTag</i> cannot bind to the surface of <i>A. nidulans</i> and seems to be specifically to the surface of <i>A. fumigatus.</i></p><br /><br /><br />
<br />
<p>Finally, it was possible to identify a small peptide which binds specific to the surface of fungal hyphae. Moreover this <i>PepTag</i> is specific for the chosen fungus.</p><br />
<br /><br />
<video width="640" height="390" controls autoplay><source src="https://static.igem.org/mediawiki/2014/b/b2/Goettingen2014-fm-3d.mp4" type="video/mp4">Your browser does not support the video tag.</video><br />
<br />
<br /><br /><br />
<!-- wetlab end--><br />
<!-- drylab start--><br />
<br />
<h1 id="drylab">Results: Dry lab</h1><br />
<br />
<h2 id="approach">Homology modelling</h2><br />
<p>We modeled the 3D structure of our peptide-containing scaffolds (domain B1 of protein G from <i>Staphylococcus aureus</i>) by homology modelling. We used the <a href="http://salilab.org/modeller/" target="1">Modeller library</a> to accomplish that; since the peptide is about 20-25 amino acids long, it can be modeled as a loop inside the B1 domain scaffold for which there are already a number of 3D structures available at the Protein Data Bank.</p><br />
<br /><br />
<br />
<br />
<a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" width="700" /></a><center><br /><p align = "justify">This is the general homology modeling procedure we followed. All peptides were cloned inside a scaffold (B1 domain of protein G from <i>Staphylococcus aureus</i>. The peptides were short enough to be modeled as an internal loop by loop refinement; these structures should only be considered as a working model, since we do not have direct crystallographic data. <a href="https://2014.igem.org/Team:Goettingen/notebook_drylab">A detailed procedure can be found in this link.</a></p></center><br /><br /><br />
<br />
<br />
<br /><h2 id="dlresults">Results summary</h2><br />
<h3>Protein G scaffold</h3><br />
<p>The table 2 is a summary of the models we generated for our peptides inside the protein G scaffold. Their main purpose is to give us an idea if the calculated energy profile matches our assumption that the peptide is being exposed to the exterior of the scaffold. These models are in no way definitive, since we lack direct crystalographic data. As can be seen, all the structures show two distinct domains: one for the protein G scaffold and the other for the peptide.</p><br /><br />
<br />
<p><b>Table 2| Homology modeling for the peptides in a protein G scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">Video*</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<td style="font-size:80%;"><br />
<video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen2014-Prey3.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1e/Goettingen-Prey3-input.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.512</td><br />
<td style="font-size:70%;">-7053.966797</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/37/GoettingenPrey3-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f1/Goettingen2014-Prey4.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen-Prey4-1.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.468</td><br />
<td style="font-size:70%;">-7246.956055</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/0b/GoettingenPrey4-1-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f8/Goettingen2014-Prey5.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/86/Goettingen-Prey5.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.495</td><br />
<td style="font-size:70%;">-7501.071777</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/10/GoettingenPrey5-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/2/23/Goettingen2014-Prey13.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Prey13-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">K17-E42</td><br />
<td style="font-size:70%;">0.535</td><br />
<td style="font-size:70%;">-7729.056152</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/eb/GoettingenPrey13-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen2014-Prey15.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/7/77/Goettingen-Prey15-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.441</td><br />
<td style="font-size:70%;">-7685.998535</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/2/20/GoettingenPrey15-profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in blue.</b></p><br />
<br /><br />
<br />
<h3>GFP scaffold</h3><br />
<p>Table 3 shows the structures we generated for our peptides inside a GFP scaffold. In contrast to the models with the protein G scaffold, the GFP-peptide models show discontinuities.</p><br /><br />
<br />
<p><b>Table 3| Homology modeling for the peptides in a GFP scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">PNG*</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" width=100></a></td><br />
<br />
<br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8c/Prey3-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.43</td><br />
<td style="font-size:70%;">-26798.28125</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/4/4a/Prey3-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" target="1"><img src="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/89/Prey4-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.448</td><br />
<td style="font-size:70%;">-27891.212891</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/d/dd/GFP-aSsr1.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" target="1"><img src="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/b/bc/Prey5-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.483</td><br />
<td style="font-size:70%;">-26633.4375</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/3c/Prey5-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/09/Prey13-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">E103-E127</td><br />
<td style="font-size:70%;">0.404</td><br />
<td style="font-size:70%;">-27075.160156</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/a/a6/Prey13-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png"><img src="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png" target="1" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/ed/Prey15-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.413</td><br />
<td style="font-size:70%;">-26713.355469</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/00/Prey15-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in green.</b></p><br />
<br /><br />
<br />
<br />
<br />
<br /><br />
<br />
<br />
<br />
<br />
<hr><br />
<h2>References</h2><br />
<br /><br />
<ol><br />
<li><p>1. N. Eswar, M. A. Marti-Renom, B. Webb, M. S. Madhusudhan,<br />
D. Eramian, M. Shen, U. Pieper, A. Sali. Comparative Protein Structure<br />
Modeling With MODELLER. Current Protocols in Bioinformatics, John Wiley<br />
&amp; Sons, Inc., Supplement 15, 5.6.1-5.6.30, 2006.</p></li><br /><br />
<br />
<li><p>2. M.A. Marti-Renom, A. Stuart, A. Fiser, R. Sánchez,<br />
F. Melo, A. Sali. Comparative protein structure modeling of genes and genomes.<br />
Annu. Rev. Biophys. Biomol. Struct. 29, 291-325, 2000.</p></li><br /><br />
<br />
<li><p>3. A. Sali &amp; T.L. Blundell.<br />
Comparative protein modelling by satisfaction of spatial restraints. J.<br />
Mol. Biol. 234, 779-815, 1993.</p></li><br /><br />
<li><p>4. A. Fiser, R.K. Do, &amp; A. Sali.<br />
Modeling of loops in protein structures, Protein Science 9. 1753-1773,<br />
2000.</p></li><br /><br />
</ol><br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/project_overview/project" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/project_overview/perspectives" class="button_next"><b>Next</b></a></div><br />
<br /><br /><br /><br />
<!-- end of right column--><br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_gallery
Team:Goettingen/outreach gallery
2014-10-18T00:55:29Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/lightbox}}<br />
<br />
<html><br />
<head><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery-1.11.0.min.js?action=raw&type=text/js" type="text/javascript"></script><br />
<script src="https://2014.igem.org/Team:Goettingen/lightbox.min?action=raw&type=text/js" type="text/javascript"></script><br />
</head><br />
<body><br />
<br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2><center>Gallery</center></h2><br />
<!--Meet us in the lab--><br />
<br />
<div class="gallery_single_part" id="in_the_lab"><br />
<h3>Meet us in the lab!</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/4/4c/Goettingen_lab_photo0.jpg" data-lightbox="inTheLab" data-title="First day in the lab. Everything is well organised!" ><img src="https://static.igem.org/mediawiki/2014/b/b4/Goettingen_lab_photo0_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/10/Goettingen_lab_photo2.jpg" data-lightbox="inTheLab" data-title="Be careful of these materials"><img src="https://static.igem.org/mediawiki/2014/4/46/Goettingen_lab_photo2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/5d/Goettingen_lab_photo3.jpg" data-lightbox="inTheLab" data-title="All the buffers and mediums are well prepared."><img src="https://static.igem.org/mediawiki/2014/1/19/Goettingen_lab_photo3_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_lab_Photo15.jpg" data-lightbox="inTheLab" data-title="Fancy experiments"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_lab_Photo15.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/78/Goettingen_lab_photo10.jpg" data-lightbox="inTheLab" data-title="Cedric on the microscope"><img src="https://static.igem.org/mediawiki/2014/7/78/Goettingen_lab_photo10.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/6/6f/Goettingen_lab_photo8.jpg" data-lightbox="inTheLab" data-title="The whole team is working hard"><img src="https://static.igem.org/mediawiki/2014/6/6f/Goettingen_lab_photo8.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/7f/Goettingen_lab_photo9.jpg" data-lightbox="inTheLab" data-title="On the microscope"><img src="https://static.igem.org/mediawiki/2014/7/7f/Goettingen_lab_photo9.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/ff/Goettingen_lab_photo14.jpg" data-lightbox="inTheLab" data-title="Lab without iGEMers"><img src="https://static.igem.org/mediawiki/2014/f/ff/Goettingen_lab_photo14.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/70/Goettingen_lab_Photo16.JPG" data-lightbox="inTheLab" data-title="Shooting videos"><img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_lab_Photo16_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c1/Goettingen_lab_Photo17.JPG" data-lightbox="inTheLab" data-title="Our international marketing guy!"><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo17_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d7/Goettingen_lab_Photo18.JPG" data-lightbox="inTheLab" data-title="Dry lab work"><img src="https://static.igem.org/mediawiki/2014/7/72/Goettingen_lab_Photo18_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/71/Goettingen_lab_Photo19.JPG" data-lightbox="inTheLab" data-title="This is our way to communicate!"><img src="https://static.igem.org/mediawiki/2014/0/09/Goettingen_lab_Photo19_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b5/Goettingen_lab_Photo20.JPG" data-lightbox="inTheLab" data-title="Happy Rayan"><img src="https://static.igem.org/mediawiki/2014/1/17/Goettingen_lab_Photo20_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/eb/Goettingen_lab_Photo21.JPG" data-lightbox="inTheLab" data-title="Kamal is at work"><img src="https://static.igem.org/mediawiki/2014/e/e9/Goettingen_lab_Photo21_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/2d/Goettingen_lab_Photo22.JPG" data-lightbox="inTheLab" data-title="Samples on ice"><img src="https://static.igem.org/mediawiki/2014/3/3c/Goettingen_lab_Photo22_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/1c/Goettingen_lab_Photo23.JPG" data-lightbox="inTheLab" data-title="Our bench on a normal day"><img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_lab_Photo23_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e4/Goettingen_lab_Photo24.JPG" data-lightbox="inTheLab" data-title="Our hood"><img src="https://static.igem.org/mediawiki/2014/3/35/Goettingen_lab_Photo24_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/71/Goettingen_lab_Photo25.JPG" data-lightbox="inTheLab" data-title="Cedric and Anika are working in the cold room"><img src="https://static.igem.org/mediawiki/2014/8/8e/Goettingen_lab_Photo25_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b0/Goettingen_lab_Photo27.JPG" data-lightbox="inTheLab" data-title="Antique lab equipment"><img src="https://static.igem.org/mediawiki/2014/6/63/Goettingen_lab_Photo27_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/33/Goettingen_lab_Photo26.JPG" data-lightbox="inTheLab" data-title="Equipment for protein purification"><img src="https://static.igem.org/mediawiki/2014/3/34/Goettingen_lab_Photo26_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/17/Goettingen_lab_photo1.jpg" data-lightbox="inTheLab" data-title="iGEM 2014 DNA Distributions have shipped! and arrived!! Work can start! "><img src="https://static.igem.org/mediawiki/2014/3/34/Goettingen_lab_photo1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/38/Goettingen_lab_Photo34.jpg" data-lightbox="inTheLab" data-title="Bahar and Cedric preparing the film set "><img src="https://static.igem.org/mediawiki/2014/8/8b/Goettingen_lab_Photo34_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/8/8b/Goettingen_lab_Photo29.jpg" data-lightbox="inTheLab" data-title="Happy Bahar after winning one giant microbe"><img src="https://static.igem.org/mediawiki/2014/7/7e/Goettingen_lab_Photo29_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_lab_Photo30.jpg" data-lightbox="inTheLab" data-title="Julia and Karthi, another lucky winners!"><img src="https://static.igem.org/mediawiki/2014/b/ba/Goettingen_lab_Photo30_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/55/Goettingen_lab_Photo28.jpg" data-lightbox="inTheLab" data-title="Post-Synbio Day meeting"><img src="https://static.igem.org/mediawiki/2014/2/20/Goettingen_lab_Photo28_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e1/Goettingen_lab_Photo31.jpg" data-lightbox="inTheLab" data-title="iGEM army preparing for battle!"><img src="https://static.igem.org/mediawiki/2014/6/60/Goettingen_lab_Photo31_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/a1/Goettingen_lab_Photo33.jpg" data-lightbox="inTheLab" data-title="Video director at work…silence required!"><img src="https://static.igem.org/mediawiki/2014/b/b1/Goettingen_lab_Photo33_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/1c/Goettingen_lab_Photo23.JPG" data-lightbox="inTheLab" data-title="iGEM time… at 2 am!"><img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_lab_Photo23_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo32.jpg" data-lightbox="inTheLab" data-title="We are watching....you"><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo32.jpg" width="120px"></a></li><br />
<br />
</ul><br />
<br /><br /><br />
</div><br />
<!-- Meetup in München --><br />
<div class="gallery_single_part" id="trip_in_Munich"><br />
<h3>Meetup in Munich</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/aa/CAS_meetupLMU_group2.jpg" data-lightbox="meeupLMU" data-title="The german iGEMers are gathering together in the University Munich!"><img src="https://static.igem.org/mediawiki/2014/a/ad/Goettingen_meetupLMU0_reduced.jpg" ></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/28/Goettingen_meetupLMU1.jpg" data-lightbox="meeupLMU" data-title="Julia is presenting our project!"><img src="https://static.igem.org/mediawiki/2014/0/09/Goettingen_meetupLMU1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/72/Goettingen_meetupLMU5.jpg" data-lightbox="meeupLMU" data-title="Nice smile, Lara :)"><img src="https://static.igem.org/mediawiki/2014/3/35/Goettingen_meetupLMU5_reduced.jpg" ></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/3d/Goettingen_meetupLMU6.jpg" data-lightbox="meeupLMU" data-title="A wonderful trip in Munich!"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_meetupLMU6_reduced.jpg" width="120"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<!-- SynBio Day --><br />
<div class="gallery_single_part" id="SynBioDay"><br />
<h3>SynBio Day</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_SynBioDay1.jpg" data-lightbox="SynBioDay" data-title="Our SynBioDay in Göttingen"><img src="https://static.igem.org/mediawiki/2014/2/2e/Goettingen_SynBioDay1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/be/Goettingen_SynBioDay7.jpg" data-lightbox="SynBioDay" data-title="Winners of the lottery"><img src="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_SynBioDay7_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_SynBioDay8.jpg" data-lightbox="SynBioDay" data-title="Another winner"><img src="https://static.igem.org/mediawiki/2014/9/9b/Goettingen_SynBioDay8_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/0d/Goettingen_SynBioDay2.jpg" data-lightbox="SynBioDay" data-title="Göttingens pedestrian zone"><img src="https://static.igem.org/mediawiki/2014/e/ed/Goettingen_SynBioDay2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_SynBioDay3.jpg" data-lightbox="SynBioDay" data-title="Friends visit us "><img src="https://static.igem.org/mediawiki/2014/3/39/Goettingen_SynBioDay3_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/27/Goettingen_SynBioDay4.jpg" data-lightbox="SynBioDay" data-title="Anika in a conversation"><img src="https://static.igem.org/mediawiki/2014/2/2a/Goettingen_SynBioDay4_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f5/Goettingen_SynBioDay5.jpg" data-lightbox="SynBioDay" data-title="Shantal is talking about our project"><img src="https://static.igem.org/mediawiki/2014/f/f2/Goettingen_SynBioDay5_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_SynBioDay10.jpg" data-lightbox="SynBioDay" data-title="Another interesting conversation"><img src="https://static.igem.org/mediawiki/2014/6/65/Goettingen_SynBioDay10_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/19/Goettingen_SynBioDay6.jpg" data-lightbox="SynBioDay" data-title="More talks"><img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_SynBioDay6_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/0c/Goettingen_SynBioDay9.jpg" data-lightbox="SynBioDay" data-title="Lara in a talk"><img src="https://static.igem.org/mediawiki/2014/a/a9/Goettingen_SynBioDay9_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/3a/Goettingen_SynBioDay11.jpg" data-lightbox="SynBioDay" data-title="Informing people about Synthetic Biology"><img src="https://static.igem.org/mediawiki/2014/5/5a/Goettingen_SynBioDay11_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e6/Goettingen_SynBioDay12.jpg" data-lightbox="SynBioDay" data-title="iGEM Goettingen being broadcasted by Stadtradio Göttingen "><img src="https://static.igem.org/mediawiki/2014/5/54/Goettingen_SynBioDay12_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/5a/Goettingen_SynBioDay13.jpg" data-lightbox="SynBioDay" data-title="Conversation"><img src="https://static.igem.org/mediawiki/2014/d/de/Goettingen_SynBioDay13_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f1/Goettingen_SynBioDay14.jpg" data-lightbox="SynBioDay" data-title="Our stand"><img src="https://static.igem.org/mediawiki/2014/3/30/Goettingen_SynBioDay14_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/79/Goettingen_SynBioDay15.jpg" data-lightbox="SynBioDay" data-title="Lara in action"><img src="https://static.igem.org/mediawiki/2014/7/74/Goettingen_SynBioDay15_reduced.jpg"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<br />
<!-- GZMB Symposium 2014 --><br />
<div class="gallery_single_part" id="GZMB"><br />
<h3>GZMB Symposium 2014</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/26/Goettingen_Presenters.jpg" data-lightbox="GZMBSym" data-title="Julia tells about iGEM"><img src="https://static.igem.org/mediawiki/2014/5/51/Goettingen_Presenters_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/05/Goettingen_Mr_Moderator.jpg" data-lightbox="GZMBSym" data-title="Joanan presenting our most wanted enemies!"><img src="https://static.igem.org/mediawiki/2014/4/43/Goettingen_Mr_Moderator_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_Mr_CoffeeHuger.jpg" data-lightbox="GZMBSym" data-title="Mr_CoffeeHuger"><img src="https://static.igem.org/mediawiki/2014/9/97/Goettingen_Mr_CoffeeHuger_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b0/Goettingen_BBQ_after.jpg" data-lightbox="GZMBSym" data-title="Our BBQ after the presentation"><img src="https://static.igem.org/mediawiki/2014/9/94/Goettingen_BBQ_after_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d3/Goettingen_GZMB1.jpg" data-lightbox="GZMBSym" data-title="Cheers!!!"><img src="https://static.igem.org/mediawiki/2014/8/81/Goettingen_GZMB1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/10/Goettingen_GZMB2.jpg" data-lightbox="GZMBSym" data-title="Cake is being translated!!!"><img src="https://static.igem.org/mediawiki/2014/7/7c/Goettingen_GZMB2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_GZMB3.jpg" data-lightbox="GZMBSym" data-title="Getting ready for the coffee break"><img src="https://static.igem.org/mediawiki/2014/2/2b/Goettingen_GZMB3_reduced.jpg"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_human_practices" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_videos" class="button_next"><b>Next</b></a></div><br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/project_overview/project_wetlab
Team:Goettingen/project overview/project wetlab
2014-10-18T00:54:14Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/projectLP}}<br />
<html><br />
<body><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery-1-11-1?action=raw&type=text/js" type="text/javascript"></script><br />
<!-- main part of the subpage --><br />
<div id="subpage"> <br />
<br />
<br />
<!-- right column--><br />
<div class="proRP" id="rpart1"><br />
<div class="trans_zh"><a href="https://2014.igem.org/Team:Goettingen/project_overview/project_wetlab_ZH"><b>中文</b></a></div><br />
<h1 id="wetlab">Results: Wetlab</h1><br />
<br />
<br />
<h2 id="approach">Approach</h2><br />
<p>Our experimental approach can be summarized as follows:</p><br /><br />
<br />
<ol><br />
<li><p>1. Organisms and surface proteins selection</p></li><br />
<li><p>2. Surface protein amplification and cloning</p></li><br />
<li><p>3. Yeast two-hybrid assay with an existing peptide library</p></li><br />
<li><p>4. Peptide functionalization</p></li><br />
</ol><br />
<br />
<br /><br /><br />
<a href="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" target="1"><img id="graphic" src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" width="700" data-zoom-image="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" /></a><caption><br /><br /><br />
<br />
<h2 id="wlresults">Results summary</h2><br />
<br />
<p>We chose the five fungi <i>Aspergillus fumigatus</i>, <i>A. nidulans</i>, <i>Candida glabrata</i>, <i>C. albicans</i> and <i>Saccharomyces cerevisiae</i> as well as the parasite <i>Toxoplasma gondii</i> for our project. In the first step, we amplified all in all 35 different genes encoding surface proteins of the mentioned organisms in a standard PCR reaction (compare table 1). We were able to transform 20 of our 35 genes into a so called bait vector (contains a DNA-binding domain) and performed the Yeast-Two-Hybrid (Y2H) screening with them. Thereby, we accomplished to find more than 3000 probable interaction partners for our surface proteins. </p><br /><br /><br />
<br />
<p><b>Table 1| Selected surface proteins and the corresponding organism.</b></p></br></br><br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th>Gene</td><br />
<th>Organism</td><br />
</tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AJ010064.1" target="1"><i>mp65</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_716672.1" target="1"><i>tos1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NW_139623.1" target="1"><i>sim1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_712917.1" target="1"><i>als1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/U87956.1" target="1"><i>als3</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0H06413g" target="1"><i>ssr1</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr class="con"><td colspan="3">Click to expand</td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0I06160g " target="1"><i>pir4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0G00308g " target="1"><i>scw4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0M08492g " target="1"><i>pir3</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0C02211g " target="1"><i>utr2</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI45" target="1"><i>crf2full</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI46" target="1"><i>crf2act</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleno</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WNS8" target="1"><i>ecm33</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WGL5" target="1"><i>sun1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/P41746" target="1"><i>roda</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleex</i></a></td><td><i>A. fumigatus</i></td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WQ14" target="1"><i>prm1 b</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q8J0P4 " target="1"><i>crf1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB243112.1" target="1"><i>roda</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Z49892" target="1"><i>xlna</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_658391.1" target="1"><i>npc2</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_675875.1" target="1"><i>sho1</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/50952829" target="1"><i>eglc</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WG16" target="1"><i>eglc</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/D37975.1" target="1"><i>CWP1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001180025.1" target="1"><i>CWP2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001183428.1" target="1"><i>TIR4</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001178902.1" target="1"><i>TIR1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001182221.1" target="1"><i>MID2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB530985.1" target="1"><i>SED1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/FJ593880.1" target="1"><i>ama1</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY587208.1" target="1"><i>rom5</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY704175.1" target="1"><i>rom4</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr class="con"><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/DQ459452.2" target="1"><i>gra7</i></a></td><td><i>T. gondii</i></td></tr> <br />
<br />
</table></center><br /><br />
<br />
<script><br />
$('.con').click(function () {<br />
var $this = $(this);<br />
$(this).nextUntil('tr.con').slideToggle(100).promise().done(function () {<br />
$this.find('span').text(function (_, value) {<br />
return value == '-' ? '+' : '-'<br />
});<br />
});<br />
});</script><br />
<script><br />
$(document).ready(function(){$('.con').trigger('click');});</script><br />
<p>The results for all the genes we selected are summarized in this <a href="https://static.igem.org/mediawiki/2014/6/60/Goettingen2014-NumberS.pdf" target="1">file.</a></p><br />
<br />
<br />
<br /><br /><br />
<br />
<p>To exclude “false positive” interaction partners (e.g. caused by a very weak interaction) we picked grown colonies and transferred them onto plates with a selection medium that allows only yeast cells containing peptides with a strong affinity to our surface proteins to grow. After this procedure and several previous selection steps, we still had around 70% of our interaction partners from the first screening. </p><br /><br /><br />
<p>To have a manageable amount of samples, we chose 10 of the interaction partners (peptides) which we found in the Y2H screen for each of our 20 surface proteins and used them for further analysis. The cells containing the plasmids were plated on selection plates and the Y2H screen was repeated to finally confirm the interaction between one of our surface proteins and a specific peptide. This time, we used a robot to fasten up the screen and to be able to analyze a large number of possible interactions at the same time. <br /><br /><br />
<br />
<b>Interactions could be verified in 70% of all tested interaction partners! </b><br /><br /><br />
In the last step, we tested the interaction of our surface proteins and the peptides in <i>in vivo</i> experiments. Previously, we chose some of the peptides and sequenced them to get to know the sequence and to exclude the possibility that we isolated the same peptides in different samples. The sequences encoding the peptides were introduced into an over-expression vector for <i>E. coli</i>; thereby, we were able to get large amounts of our peptides which we called <i>PepTags</i> from then on. In the last step for the time being, we tested the fungi <i>A. fumigatus</i>, <i>A. nidulans</i> and <i>C. glabrata</i> with peptides, which are supposed to interact specific with one of their surface proteins<i> in vivo </i>using fluorescence microscopy. <br /><br /><br />
With the<i> in vivo </i>experiments we want to proof that the identified <i>PepTags</i> not only bind to their surface proteins in an Y2H screen, but also to living fungi. To visualize the fungal surface itself, we stained structures containing chitin and cellulose in the fungal cell wall with calcofluor (figure 1C and 2C). The first organism with whom the functionality of our system was tested was A. fumigatus and the <i>PepTag</i> No.13. Binding of this <i>PepTag</i> to the fungi was visualized with an antibody fused to a fluorescent molecule (Chromeo 488, figure 1A and 2A).</p> <br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/0/08/Goettingen2014-fm-fig1.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/9/99/Goettingen2014-fm-fig1.png" width="600"></a></center><br />
<center><p style="font-size=8px;"><b>Figure 1| Fluorescence microscopy of <i>Aspergillus fumigatus</i> hyphae.</b> This figure shows an A. fumigatus hyphae incubated with <i>PepTag</i>13, antibody and stained with calcofluor. Under light with a wavelength of 488 nm, the complexes containing <i>PepTag</i>13 and antibody show fluorescence. The excitation of calcofluor at a wavelength of 358 nm allows the identification of the hyphal surface (blue light). The second picture shows the hyphae in a bright field, while the merged picture demonstrates that the green fluorescence is located in the same area as the blue one.</p></center><br />
<br />
<br /><br />
<p>We were able to show that our peptide binds specifically to the surface of <i>A. fumigatus</i>, which is visualized by the green dots along the outer surface of the fungal cells. We also tested <i>PepTag</i> No.13 with <i>A. nidulans</i> (figure 2) but could not see any fluorescent signal. That means that our <i>PepTag</i> No.13 binds not only specific to the fungal surface, but also specific to the surface protein Sun1 of <i>A. fumigatus</i>. Moreover, we could show that the antibody cannot bind unspecific to the fungal surface when the <i>PepTag</i> is missing . For further information <a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab#week23">have a look at our lab-book.</a></p><br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/6/64/Goettingen2014-fm-fig2.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/f/ff/Goettingen2014-fm-fig2.png" width="600"></a></center><br />
<p><b><p style="font-size=8px;">Figure 2| Fluorescence microscope picture of an <i>Aspergillus nidulans</i> hyphae.</b> This figure shows an <i>A. nidulans</i> hyphae incubated with <i>PepTag</i> No.13, antibody and calcofluor. Upon irradiation with light of 488 nm, no fluorescence occurs (first picture). The excitation of calcofluor at a wavelength of 358 nm allows identification of the surface of the hyphae (blue light). The <i>PepTag</i> cannot bind to the surface of <i>A. nidulans</i> and seems to be specifically to the surface of <i>A. fumigatus.</i></p><br /><br /><br />
<br />
<p>Finally, it was possible to identify a small peptide which binds specific to the surface of fungal hyphae. Moreover this <i>PepTag</i> is specific for the chosen fungus.</p><br />
<br /><br />
<video width="640" height="390" controls autoplay><source src="https://static.igem.org/mediawiki/2014/b/b2/Goettingen2014-fm-3d.mp4" type="video/mp4">Your browser does not support the video tag.</video><br />
<br />
<br /><br /><br />
<!-- wetlab end--><br />
<!-- drylab start--><br />
<br />
<h1 id="drylab">Results: Dry lab</h1><br />
<br />
<h2 id="approach">Homology modelling</h2><br />
<p>We modeled the 3D structure of our peptide-containing scaffolds (domain B1 of protein G from <i>Staphylococcus aureus</i>) by homology modelling. We used the <a href="http://salilab.org/modeller/" target="1">Modeller library</a> to accomplish that; since the peptide is about 20-25 amino acids long, it can be modeled as a loop inside the B1 domain scaffold for which there are already a number of 3D structures available at the Protein Data Bank.</p><br />
<br /><br />
<br />
<br />
<a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" width="700" /></a><center><br /><p align = "justify">This is the general homology modeling procedure we followed. All peptides were cloned inside a scaffold (B1 domain of protein G from <i>Staphylococcus aureus</i>. The peptides were short enough to be modeled as an internal loop by loop refinement; these structures should only be considered as a working model, since we do not have direct crystallographic data. <a href="https://2014.igem.org/Team:Goettingen/notebook_drylab">A detailed procedure can be found in this link.</a></p></center><br /><br /><br />
<br />
<br />
<br /><h2 id="dlresults">Results summary</h2><br />
<h3>Protein G scaffold</h3><br />
<p>The table 2 is a summary of the models we generated for our peptides inside the protein G scaffold. Their main purpose is to give us an idea if the calculated energy profile matches our assumption that the peptide is being exposed to the exterior of the scaffold. These models are in no way definitive, since we lack direct crystalographic data. As can be seen, all the structures show two distinct domains: one for the protein G scaffold and the other for the peptide.</p><br /><br />
<br />
<p><b>Table 2| Homology modeling for the peptides in a protein G scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">Video*</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<td style="font-size:80%;"><br />
<video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen2014-Prey3.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1e/Goettingen-Prey3-input.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.512</td><br />
<td style="font-size:70%;">-7053.966797</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/37/GoettingenPrey3-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f1/Goettingen2014-Prey4.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen-Prey4-1.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.468</td><br />
<td style="font-size:70%;">-7246.956055</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/0b/GoettingenPrey4-1-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f8/Goettingen2014-Prey5.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/86/Goettingen-Prey5.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.495</td><br />
<td style="font-size:70%;">-7501.071777</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/10/GoettingenPrey5-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/2/23/Goettingen2014-Prey13.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Prey13-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">K17-E42</td><br />
<td style="font-size:70%;">0.535</td><br />
<td style="font-size:70%;">-7729.056152</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/eb/GoettingenPrey13-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen2014-Prey15.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/7/77/Goettingen-Prey15-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.441</td><br />
<td style="font-size:70%;">-7685.998535</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/2/20/GoettingenPrey15-profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in blue.</b></p><br />
<br /><br />
<br />
<h3>GFP scaffold</h3><br />
<p>Table 3 shows the structures we generated for our peptides inside a GFP scaffold. In contrast to the models with the protein G scaffold, the GFP-peptide models show discontinuities.</p><br /><br />
<br />
<p><b>Table 3| Homology modeling for the peptides in a GFP scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">PNG*</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" width=100></a></td><br />
<br />
<br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8c/Prey3-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.43</td><br />
<td style="font-size:70%;">-26798.28125</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/4/4a/Prey3-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" target="1"><img src="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/89/Prey4-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.448</td><br />
<td style="font-size:70%;">-27891.212891</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/d/dd/GFP-aSsr1.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" target="1"><img src="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/b/bc/Prey5-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.483</td><br />
<td style="font-size:70%;">-26633.4375</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/3c/Prey5-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/09/Prey13-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">E103-E127</td><br />
<td style="font-size:70%;">0.404</td><br />
<td style="font-size:70%;">-27075.160156</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/a/a6/Prey13-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png"><img src="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png" target="1" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/ed/Prey15-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.413</td><br />
<td style="font-size:70%;">-26713.355469</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/00/Prey15-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in green.</b></p><br />
<br /><br />
<br />
<br />
<br />
<br /><br />
<br />
<br />
<br />
<br />
<hr><br />
<h2>References</h2><br />
<br /><br />
<ol><br />
<li><p>1. N. Eswar, M. A. Marti-Renom, B. Webb, M. S. Madhusudhan,<br />
D. Eramian, M. Shen, U. Pieper, A. Sali. Comparative Protein Structure<br />
Modeling With MODELLER. Current Protocols in Bioinformatics, John Wiley<br />
&amp; Sons, Inc., Supplement 15, 5.6.1-5.6.30, 2006.</p></li><br /><br />
<br />
<li><p>2. M.A. Marti-Renom, A. Stuart, A. Fiser, R. Sánchez,<br />
F. Melo, A. Sali. Comparative protein structure modeling of genes and genomes.<br />
Annu. Rev. Biophys. Biomol. Struct. 29, 291-325, 2000.</p></li><br /><br />
<br />
<li><p>3. A. Sali &amp; T.L. Blundell.<br />
Comparative protein modelling by satisfaction of spatial restraints. J.<br />
Mol. Biol. 234, 779-815, 1993.</p></li><br /><br />
<li><p>4. A. Fiser, R.K. Do, &amp; A. Sali.<br />
Modeling of loops in protein structures, Protein Science 9. 1753-1773,<br />
2000.</p></li><br /><br />
</ol><br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/project_overview/project" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/project_overview/perspectives" class="button_next"><b>Next</b></a></div><br />
<br /><br /><br /><br />
<!-- end of right column--><br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/project_overview/project_biobrick
Team:Goettingen/project overview/project biobrick
2014-10-18T00:41:31Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/projectLP}}<br />
<html><br />
<body><br />
<!-- main part of the subpage --><br />
<div id="subpage"> <br />
<br />
<!-- right column--><br />
<div class="proRP" id="rpart1"><br />
<h1>BioBrick Tools</h1><br />
<h2>Basic parts - auxotrophic selection marker for transformed yeasts</h2><br />
<p>We started by searching parts and DNA that could be used for working with yeast and other fungi. However, there were only few data related to this kind of organism, actually we could not find any selection marker for yeast in the delivered Biobrick plates. This situation took our efforts to create a Biobrick which allows the selection of positively transformed cells by means of auxotrophic markers. We are working with strains that are deficient of either the LEU2 gene or the TRP1 gene. Both of them are essential during amino acid biosynthesis of leucine and tryptophane respectively . The TRP1 gene encodes for a phosphoribosyl-anthranilate isomerase, an enzyme needed in the third step of tryptophane synthesis. The LEU2 gene codes the β isopropylmalate dehydrogenase, which is necessary for the third step in the biosynthesis of leucine. Therefore, these 2 specific genes were chosen for BioBrick construction. For amplification of plasmids in yeasts, we also created the 2 micron ori (see table 1) for plasmid replication in the yeast cells.</p><br />
<br /><br />
<p style="text-align:center" class="figure"><b>Table 1| Created basic parts for registry.</b></p><br />
<br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/75/Goettingen_BB_T1.png" width="650" /></center><br />
<br /><br />
<p>We used genomic DNA of <i>S. cerevisiae</i> to amplify the genes. We checked the sequences and noticed that most of the yeast genes contain <i>EcoR1</i> or<i> Xba1</i> restriction sites; this could be the main reason of the absence of many BioBricks of such type. Hence, we decided to mutagenize our genes with primers that allow the introduction of a point mutation (shown in figure 1). With this mutation, a so called silent mutation, the amino acid sequence will be the same, but the restriction site will be deleted.</p><br />
<br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/3/39/Goettingen_BB_F1.png" width="550" /></center><br />
<br /><br />
<p class="figure"><b>Figure 1| Workflow for the construction of selection marker for yeast.</b> A| Selection of the gene coding for the phosphoribosyl-anthranilate isomerase (TRP1) in the pathway of L-tryptophane synthesis and the gene for β isopropylmalate dehydrogenase (LEU2) in the pathway of the amino acid L-leucine. Both contain restriction sites not conform to the RFC10. B| Amplification of the genes in two fragments. Here, the specific sequence for restriction sites has been deleted using mutagenic primers. These primers contain a mismatch that creates a silent mutation at a specific site in the DNA (base pair is changed - amino acid sequence is not). C| In the last step, we used a set of primers that add prefix and suffix sequences and fused the two fragments of each gene. The obtained genes no longer contain restriction sites (*).</p><br />
<br /><br />
<p>We cloned these genes into the BioBrick backbone pSB1C3 so that it can be introduced into the library.</p><br />
<br /><br />
<h2>Composite parts - device to tag proteins in yeast with GFP or mRFP</p></h2><br />
<p>Furthermore, we intend to create a tool for yeast, which is made out of BioBricks, in order to be able to tag proteins in yeast or fungal cells with different fluorescent markers. We chose two promoters (TEF2 and TDH3) and two terminators (ADH1 and HHO1) from the BioBrick library (full list of used BioBricks in table 2). </p><br />
<br /><br />
<p style="text-align:center" class="figure"><b>Table 2| Used BioBricks for amplification of parts via PCR.</b></p><br />
<br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9c/Goettingen_BB_T2.png" width="600" /></center><br />
<br /><br />
<p>The genes for mRFP and GFP were chosen as fluorescent markers and were integrated downstream of and 19 bp long sequence that contain the<i> BamH1/Bgl2</i> restriction site. The gene of interest (GOI) follows directly behind this adaptor (compare figure 2). </p><br />
<br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/3/3e/Goettingen_BB_F2.png" width="600" /></center><br />
<br /><br />
<p class="figure"><b>Figure 2|Functional device to tag proteins in yeasts with different fluorescent proteins. </b>The first part of this is the selection marker that allows selection after transformation (in LEU2 or TRP1 deficient strains). The second part is the major part. There the restriction site for two enzymes allows easy introduction of proteins of interest into yeast and tag them with GFP or either mRFP. Color code: red - terminator; green - promoter; orange - adapter; blue - protein.</p><br />
<br /><br />
<p>In order to get a functional and successfully expressed plasmid, we added the mutated 2-micron ori of yeast into the plasmids we got so far. The ori was introduced downstream of the ADH1 terminator (see figure 3 for plasmid maps). </p><br />
<br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/f3/Goettingen_BB_F3a.png" width="300" /><img src="https://static.igem.org/mediawiki/2014/a/a6/Goettingen_BB_F3b.png" width="300" /></center><br />
<br /><br /><br />
<p class="figure"><b>Figure 3| The final plasmids of our composite parts.</b> The TRP-GFP- tool can be used to select for tryptophane auxotrophy and to tag a protein of interest in yeast with GFP. The LEU-mRFP-tool can be used to select for leucine auxotrophy and to tag a protein of interest in yeast with mRFP. These two BioBricks can also be used together, to analyse two different proteins in yeast.</p><br />
<br /><br />
<h2>Intermediate parts</h2><br />
<p>In the first step, we incorporated the TDH3 promoter upstream of our selection marker and inserted the terminator HHO1 downstream. This promoter-marker-terminator brick could also be used as a single part for other purposes (intermediate parts, table 3).</p><br />
<br /><br />
<p style="text-align:center" class="figure"><b>Table 3| Intermediate parts that we constructed.</b></p><br />
<br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/76/Goettingen_BB_T3.png" width="600" /></center><br />
<br /><br />
<p>In the second step, we introduced the TEF2 promoter upstream of the <i>BamH1/Bgl2</i> site, the fluorescent marker and the ADH1 terminator (see figure 2). <br />
In the last step we added in this construction the mutated 2 micron (compare creation of TRP1 and Leu2 genes, figure 1) and finalized our two plasmids as functional device (figure 3). <br />
</p><br />
<br /><br /><br />
<br />
<br />
<br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/project_overview/perspectives" class="button_pre"><b>Previous</b></a></div><br />
<br /><br /><br />
</div><br />
<!-- end of right column--><br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_newsletter
Team:Goettingen/outreach newsletter
2014-10-18T00:37:20Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2>Newsletters</h2><br />
<div id="Presentation"><br />
<p><b>This series of newsletters is initiated by Team Paris Bettencourt, providing news of different iGEM teams from all over the world.</b></p><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cc/IGEM_Newsletter_Issue_1.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>1st Newsletter</center></h3><p style="text-align:center">July 28th - August 10th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/Newsletter2iGEM.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>2rd Newsletter</center></h3><p style="text-align:center">August 11th - August 24th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/IGEM_Newsletter_Issue_3.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>3rd Newsletter</center></h3><p style="text-align:center">August 25th- September 7th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/8/8f/IGEM_Newsletter_Issue_4.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>4th Newsletter</center></h3><p style="text-align:center">September 1st - September 15th</p><br />
</div> <div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cd/NewsletteriGEM05.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>5th Newsletter</center></h3><p style="text-align:center">September 21st - October 10th</p><br />
</div><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_presentation" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal" class="button_next"><b>Next</b></a></div><br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_presentation
Team:Goettingen/outreach presentation
2014-10-18T00:37:04Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<br />
<h2>Presentations</h2><br />
<div id="Presentation"><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/f/fe/Goettingen_booklet_fund.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_booklet_cover.png" width="200px" /></a><br />
<h3>Booklet for fund-raising</h3> <p></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen_SynBio_Brochure.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_brochure.png" width="200px" /></a><br />
<h3>Brochure for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" width="200px" /></a><br />
<h3>Comic for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/96/Goettingen_Poster_igem.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/75/Goettingen_Poster_igem_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about iGEM</p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/5/5c/Goettingen_Poster_project.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_Poster_project_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about our project</p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/de/Goettingen_Poster_synbiology.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/9/93/Goettingen_Poster_synbiology_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about synthetic biology</p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_HP_Poster.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/ca/Goettingen_HP_Poster_reduced2.png" width="200px" /></a><br />
<h3>Poster for the colloquia</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/93/Goettingen_PPT.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Goettingen_PPTCover.png" width="200px" /></a><br />
<h3>GZMB Symposium Presentation</h3><p style="text-align:center"></p><br />
</div><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_videos" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_newsletter" class="button_next"><b>Next</b></a></div><br />
</div><br />
<br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_videos
Team:Goettingen/outreach videos
2014-10-18T00:36:48Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<br />
<div id="HP1"><br />
<br />
<h2>Videos</h2><br />
<center><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/5/5a/Goettingen2014-Y2H_Screening.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/7/7b/Goettingen2014-PCR.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/f/f5/Goettingen2014-Preparation_of_Competent_Cells_from_E._Coli_%28TOP_10%29_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/5/5c/Goettingen2014-E._coli_transformation_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/b/bb/Goettingen2014-Plasmid_Isolation_from_Yeast_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/2/2a/Goettingen2014-New_Robot.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls poster="https://static.igem.org/mediawiki/2014/5/5e/Goettingen_Video_TeamCover.png"><source src="https://static.igem.org/mediawiki/2014/a/aa/Goettingen2014-Introduction_of_the_iGEM_team_G%C3%B6ttingen_2014_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br /><br />
</center><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_gallery" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_presentation" class="button_next"><b>Next</b></a></div><br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_germanproposal
Team:Goettingen/outreach germanproposal
2014-10-18T00:35:27Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a><br />
</li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<br />
<div class="proRP" id="humanPractice"><br />
<div id="HP1"><br />
<div id="socioeconomics"> <br />
<h2>A proposal of the German iGEM Teams concerning Intellectual Property</h2><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br /><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br /><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br /><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br /><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br /><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br /><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br /><br /><br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br /><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br /><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br /><br />
</div><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_newsletter" class="button_pre"><b>Previous</b></a></div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_germanproposal
Team:Goettingen/outreach germanproposal
2014-10-18T00:35:08Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a><br />
</li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<br />
<div class="proRP" id="humanPractice"><br />
<div id="HP1"><br />
<div id="socioeconomics"> <br />
<h2>A proposal of the German iGEM Teams concerning Intellectual Property</h2><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br /><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br /><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br /><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br /><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br /><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br /><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br /><br /><br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br /><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br /><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br /><br />
</div><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_newsletter" class="button_pre"><b>Previous</b></a><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_newsletter
Team:Goettingen/outreach newsletter
2014-10-18T00:34:13Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2>Newsletters</h2><br />
<div id="Presentation"><br />
<p><b>This series of newsletters is initiated by Team Paris Bettencourt, providing news of different iGEM teams from all over the world.</b></p><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cc/IGEM_Newsletter_Issue_1.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>1st Newsletter</center></h3><p style="text-align:center">July 28th - August 10th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/Newsletter2iGEM.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>2rd Newsletter</center></h3><p style="text-align:center">August 11th - August 24th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/IGEM_Newsletter_Issue_3.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>3rd Newsletter</center></h3><p style="text-align:center">August 25th- September 7th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/8/8f/IGEM_Newsletter_Issue_4.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>4th Newsletter</center></h3><p style="text-align:center">September 1st - September 15th</p><br />
</div> <div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cd/NewsletteriGEM05.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>5th Newsletter</center></h3><p style="text-align:center">September 21st - October 10th</p><br />
</div><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_presentation" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal" class="button_next"><b>Next</b></a></div><br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_newsletter
Team:Goettingen/outreach newsletter
2014-10-18T00:33:24Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2>Newsletters</h2><br />
<div id="Presentation"><br />
<p><b>This series of newsletters is initiated by Team Paris Bettencourt, providing news of different iGEM teams from all over the world.</b></p><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cc/IGEM_Newsletter_Issue_1.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>1st Newsletter</center></h3><p style="text-align:center">July 28th - August 10th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/Newsletter2iGEM.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>2rd Newsletter</center></h3><p style="text-align:center">August 11th - August 24th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/IGEM_Newsletter_Issue_3.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>3rd Newsletter</center></h3><p style="text-align:center">August 25th- September 7th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/8/8f/IGEM_Newsletter_Issue_4.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>4th Newsletter</center></h3><p style="text-align:center">September 1st - September 15th</p><br />
</div> <div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cd/NewsletteriGEM05.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>5th Newsletter</center></h3><p style="text-align:center">September 21st - October 10th</p><br />
</div><br />
<div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_presentation" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal" class="button_next"><b>Next</b></a></div><br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_newsletter
Team:Goettingen/outreach newsletter
2014-10-18T00:33:05Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2>Newsletters</h2><br />
<div="Presentation"><br />
<p><b>This series of newsletters is initiated by Team Paris Bettencourt, providing news of different iGEM teams from all over the world.</b></p><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cc/IGEM_Newsletter_Issue_1.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>1st Newsletter</center></h3><p style="text-align:center">July 28th - August 10th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/Newsletter2iGEM.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>2rd Newsletter</center></h3><p style="text-align:center">August 11th - August 24th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/IGEM_Newsletter_Issue_3.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>3rd Newsletter</center></h3><p style="text-align:center">August 25th- September 7th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/8/8f/IGEM_Newsletter_Issue_4.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>4th Newsletter</center></h3><p style="text-align:center">September 1st - September 15th</p><br />
</div> <div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cd/NewsletteriGEM05.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>5th Newsletter</center></h3><p style="text-align:center">September 21st - October 10th</p><br />
</div><br />
<div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_presentation" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal" class="button_next"><b>Next</b></a></div><br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_newsletter
Team:Goettingen/outreach newsletter
2014-10-18T00:32:09Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<center><h2>Newsletters</h2></center><br />
<p><b>This series of newsletters is initiated by Team Paris Bettencourt, providing news of different iGEM teams from all over the world.</b></p><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cc/IGEM_Newsletter_Issue_1.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>1st Newsletter</center></h3><p style="text-align:center">July 28th - August 10th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/Newsletter2iGEM.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>2rd Newsletter</center></h3><p style="text-align:center">August 11th - August 24th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/4/4c/IGEM_Newsletter_Issue_3.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3><center>3rd Newsletter</center></h3><p style="text-align:center">August 25th- September 7th</p><br />
</div><br />
<div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/8/8f/IGEM_Newsletter_Issue_4.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>4th Newsletter</center></h3><p style="text-align:center">September 1st - September 15th</p><br />
</div> <div class="news"><br />
<a href="https://static.igem.org/mediawiki/2014/c/cd/NewsletteriGEM05.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_newsletter.png" width="200px" /></a><br />
<h3> <center>5th Newsletter</center></h3><p style="text-align:center">September 21st - October 10th</p><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_presentation" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal" class="button_next"><b>Next</b></a></div><br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/stylesheet
Team:Goettingen/stylesheet
2014-10-18T00:31:16Z
<p>Gwen Eleven: </p>
<hr />
<div><html><br />
<style><br />
/* CSS Document */<br />
<br />
<br />
/*reset padding, margin and list style*/<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td {<br />
padding:0;<br />
margin:0;<br />
list-style-type:none;<br />
list-style-image:url('');<br />
background-image:url('');<br />
border-bottom:none;<br />
}<br />
a{<br />
color:#6699FF;<br />
}<br />
<br />
a:link {<br />
text-decoration:none;<br />
color: #e98f00;<br />
}<br />
<br />
a:visited {<br />
text-decoration: none;<br />
color: #e98f00;<br />
}<br />
<br />
<br />
a:hover {<br />
color: #6699FF;<br />
text-decoration: underline;<br />
}<br />
<br />
h1,h2,h3,h4,h5,h6{<br />
font-weight:normal;<br />
font-size:100%;<br />
}<br />
p{<br />
line-height:150%;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
}<br />
body{<br />
background-color:#F7F7F7;<br />
}<br />
<br />
td{<br />
text-align: center;<br />
}<br />
<br />
#top-section{<br />
display:block;<br />
position:relative;<br />
margin-top:10px;<br />
background:none;<br />
<br />
}<br />
<br />
/*end of the reset*/<br />
<br />
<br />
#supportBox{<br />
position: absolute;<br />
top:80%;<br />
right:-18%;<br />
z-index: 5;<br />
overflow: visible<br />
}<br />
<br />
#globalWrapper{<br />
margin:0 auto;<br />
width:1002px;<br />
}<br />
<br />
/*header part*/<br />
#header{<br />
float:left;<br />
height:270px;<br />
width:1002px;<br />
margin-top:15px;<br />
}<br />
#headerPic{<br />
float:left;<br />
height:230px;<br />
width:1002px;<br />
background-image:url("https://static.igem.org/mediawiki/2014/7/75/Goettingen_header_Pic.png");<br />
background-size:contain;<br />
}<br />
#teamLogo{<br />
float:left;<br />
margin:35px 0;<br />
padding-left:25px;<br />
}<br />
#uniLogo{<br />
float:right;<br />
margin:160px 0px 20px 20px;<br />
}<br />
<br />
#igemLogo{<br />
float:right;<br />
margin:170px 0px 20px 20px;<br />
}<br />
<br />
#headerNavi{<br />
float:left;<br />
width:1002px;<br />
background-color:#e98f00;<br />
border-radius:5px;<br />
<br />
}<br />
#menuBar{<br />
float:left;<br />
height:38px;<br />
width:826px; <br />
text-align:center;<br />
font:18px Calibri,sans-serif;<br />
}<br />
#menuBar ul li{<br />
width:118px;<br />
line-height:38px;<br />
float:left;<br />
}<br />
#menuBar ul li a{<br />
color:#FFF;<br />
}<br />
#menuBar ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
#menuBar ul li:hover .wrap{<br />
display:block;<br />
z-index:99;<br />
}<br />
#menuBar ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#menuBar ul li:hover li a{<br />
color:white;<br />
}<br />
#menuBar ul li .wrap{<br />
position:absolute;<br />
width:210px;<br />
text-align:left;<br />
display:none;<br />
}<br />
#menuBar ul li ul li{<br />
line-height:20px;<br />
border-left:solid 5px #ccc;<br />
border-bottom:solid 1px #fff;<br />
padding:10px 20px;<br />
font-size:15px;<br />
background-color:#FFB573;<br />
}<br />
#menuBar ul li ul li:hover a{<br />
color:#e98f00;<br />
}<br />
#contact{<br />
float:right;<br />
height:38px; <br />
width:176px;<br />
padding:0;<br />
}<br />
#contact a{<br />
display:block;<br />
float:left;<br />
width:38px;<br />
height:38px;<br />
<br />
}<br />
#go2top{<br />
z-index:199;<br />
position:fixed;<br />
bottom:2%;<br />
right:2%;<br />
overflow:visible;<br />
/*background: url("https://static.igem.org/mediawiki/2014/5/5b/Goettingen_go2top.png");*/<br />
}<br />
/*<br />
#go2top img{<br />
display:none;<br />
}<br />
*/<br />
#go2top a:hover img{<br />
display:inline;<br />
}<br />
/*main part*/<br />
/*for the wrapper*/<br />
#wrapper {<br />
display: block;<br />
height: 360px;<br />
width: 1002px;<br />
margin: auto;<br />
}<br />
#container {<br />
background-color: #FFC;<br />
background-image: none;<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: auto;<br />
}<br />
#container #prev{<br />
background-image: url("https://static.igem.org/mediawiki/2014/8/84/Goettingen_prev_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
height: 360px;<br />
width: 100px;<br />
float: left;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #next {<br />
background-image: url("https://static.igem.org/mediawiki/2014/b/b5/Goettingen_next_icon.png");<br />
background-repeat: no-repeat;<br />
background-position: center center;<br />
background-size:40%;<br />
display: block;<br />
float: right;<br />
height: 360px;<br />
width: 100px;<br />
position: relative;<br />
z-index: 9;<br />
}<br />
#container #slider {<br />
display: block;<br />
float: left;<br />
height: 360px;<br />
width: 1002px;<br />
overflow: hidden;<br />
position: absolute;<br />
}<br />
/*For the four main parts*/<br />
<br />
#fourParts{<br />
float:left;<br />
margin:10px 0;<br />
height:650px;<br />
width:1002px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:4px;<br />
}<br />
.four{<br />
margin:5px 15px;<br />
padding:20px 10px 10px 10px;<br />
height:260px;<br />
width:440px;<br />
float:left;<br />
}<br />
#fourParts h1{<br />
display:block;<br />
font:20px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
border-bottom:solid thin #D3D3D3;<br />
}<br />
.pictures{<br />
margin:15px 0 25px 5px;<br />
height:170px;<br />
width:180px;<br />
float:left;<br />
}<br />
#Pic1{<br />
padding-top:25px;<br />
}<br />
#Pic3{<br />
padding-top:45px;<br />
}<br />
.paragraph{<br />
margin:5px 0;<br />
height:190px;<br />
width:250px;<br />
float:right;<br />
font-size:13px;<br />
line-height:18px;<br />
text-align:justify;<br />
}<br />
<br />
.button{<br />
width:80px;<br />
height:30px;<br />
float:right;<br />
background:#FFB573;<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.button a{<br />
line-height:30px; <br />
}<br />
.button a:hover{<br />
color:#FFFFFF;<br />
}<br />
.buttonGreen{<br />
<br />
float:right;<br />
<br />
font:14px Candara,sans-serif;<br />
text-align:center;<br />
}<br />
.buttonGreen a{<br />
line-height:30px; <br />
}<br />
.buttonGreen a:hover{<br />
color:#FFFFFF;<br />
}<br />
/*For Twitter & Facebook*/<br />
#Twitter{<br />
height:660px;<br />
}<br />
#Facebook{<br />
height:660px;<br />
}<br />
<br />
/*For the pre & next buttons*/<br />
.button_pre{<br />
display:block;<br />
float:left;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.button_next{<br />
display:block;<br />
float:right;<br />
margin:20px 0;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
.trans_zh{<br />
display:block;<br />
float:right;<br />
padding:5px;<br />
border:solid 1px #e98f00;<br />
border-radius:2px;<br />
}<br />
/*For the footer*/<br />
#footer{<br />
float:left;<br />
margin:40px auto;<br />
height:31px;<br />
width:1002px;<br />
border:solid 1px #CCC;<br />
}<br />
#copyrightIco{<br />
float:left;<br />
width:88px;<br />
height:31px;<br />
}<br />
<br />
#list1 ul li{<br />
display:block;<br />
float:left;<br />
width:130px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 15px;<br />
}<br />
<br />
#list2 ul li{<br />
display:block;<br />
float:left;<br />
width:140px;<br />
height:15px;<br />
text-align:center;<br />
font-size:10px;<br />
margin:0 22px;<br />
}<br />
#poweredByIco{<br />
float:right;<br />
}<br />
#footerbanner{<br />
float:left;<br />
margin:30px 0;<br />
}<br />
/*For the subpage*/<br />
<br />
/*next and previous buttons*/<br />
#goenext {<br />
float:right;<br />
<br />
}<br />
<br />
/* For team part*/<br />
.teamM{<br />
float:left;<br />
width:690px;<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.teamM img{<br />
width:200px;<br />
height:250px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
<br />
.titleLeft{<br />
float:left;<br />
width:200px;<br />
}<br />
.titleRight{<br />
float:right;<br />
width:200px;<br />
}<br />
.content{<br />
float:left;<br />
width:410px;<br />
margin-left:30px;<br />
margin-bottom:25px;<br />
}<br />
<br />
<br />
<br />
.instructors{<br />
float:left;<br />
width:690px;<br />
<br />
margin-top:10px;<br />
border-bottom-style:solid; <br />
border-width:2px;<br />
border-color:#CCC;<br />
}<br />
.instructors img{<br />
display:block;<br />
float:left;<br />
width:200px;<br />
margin-top:36px;<br />
border-radius:8%;<br />
}<br />
.instructors h2{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
height:36px;<br />
margin-left:25px;<br />
}<br />
.instructors h3{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
}<br />
.instructors p{<br />
display:block;<br />
float:left;<br />
width:410px;<br />
margin-left:40px;<br />
margin-bottom:20px;<br />
}<br />
#instr2 img{<br />
float: right;<br />
}<br />
#instr2 h2{<br />
margin-left:0;<br />
}<br />
#instr2 p{<br />
margin-left:20px;<br />
}<br />
/*For sponsor part*/<br />
#sponsorWrap{<br />
float:left;<br />
width:1000px;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
}<br />
#sponsorHeader{<br />
float:left;<br />
width:1002px;<br />
height:80px;<br />
margin-top:30px;<br />
text-align:center;<br />
line-height:40px;<br />
font-size:30px;<br />
font-family:Arial, Helvetica, sans-serif;<br />
color:#F90;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
<br />
#sponsorPic{<br />
float:left;<br />
width:952px;<br />
height:500px;<br />
padding:25px;<br />
border-bottom:solid #CCC 2px;<br />
}<br />
.spPic{<br />
float:left;<br />
height:120px;<br />
text-align:center;<br />
margin:6px;<br />
padding-left:25px;<br />
}<br />
.sponsors{<br />
float:left;<br />
width:982px;<br />
height:260px;<br />
margin-top:20px;<br />
padding:10px;<br />
border-bottom:solid #CCC 2px; <br />
}<br />
.sponsors a{<br />
display:block;<br />
float:left;<br />
width:240px;<br />
height:240px;<br />
margin-right:20px;<br />
text-align:center;<br />
}<br />
.sponsors h3{<br />
display:block;<br />
float:left;<br />
width:690px;<br />
margin-left:20px;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:24px;<br />
line-height:36px;<br />
color:#39F;<br />
}<br />
.sponsors p{<br />
display:block;<br />
float:left;<br />
margin:20px;<br />
padding-right:50px;<br />
width:632px;<br />
font-family:Helvetica, Arial, sans-serif;<br />
font-size:16px;<br />
line-height:24px;<br />
text-align:justify;<br />
}<br />
.links a{<br />
display:none;<br />
}<br />
/*For the acknowledge part*/<br />
.ackn{<br />
float:left;<br />
width:688px;<br />
}<br />
.ackn img{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin-bottom:30px;<br />
padding:0 20px 0 20px;<br />
border-radius:6%;<br />
}<br />
.ackn h3{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
height:36px;<br />
}<br />
.ackn p{<br />
display:block;<br />
float:left;<br />
width:520px;<br />
}<br />
#ackn2 img{<br />
float:right;<br />
}<br />
#ackn3 p{<br />
width:688px;<br />
}<br />
#ackn5 img{<br />
float:right;<br />
}<br />
#ackn7 img{<br />
float:right;<br />
}<br />
#ackn9 img{<br />
float:right;<br />
}<br />
#ackn14 img{<br />
float:right;<br />
}<br />
#ackn10 p{<br />
width:688px;<br />
}<br />
#ackn11 p{<br />
width:688px;<br />
}<br />
#ackn15 p{<br />
width:688px;<br />
}<br />
/*For protocol part*/<br />
/*For the overview page*/<br />
#OverviewTitle{<br />
text-align:center;<br />
font-size:36px;<br />
padding:30px 0 0 0;<br />
}<br />
.linkButton{<br />
display:block;<br />
float:right;<br />
position:relative;<br />
bottom:10px;<br />
}<br />
#empty{<br />
background-color:#F7F7F7;<br />
}<br />
#protocolOverview{<br />
float:left;<br />
width:1002px;<br />
}<br />
.pro_sub{<br />
float:left;<br />
width:280px;<br />
height:250px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
<br />
}<br />
.pro_sub h4 a{<br />
display:block;<br />
font-family:Verdana, Geneva, sans-serif;<br />
font-size:22px;<br />
line-height:26px;<br />
color:#F90;<br />
text-align:center;<br />
padding:10px;<br />
}<br />
.pro_sub ul li a{<br />
display:block;<br />
font-family:Arial, Helvetica, sans-serif;<br />
font-size:16px;<br />
font-size:16px;<br />
color:#000;<br />
padding:5px 15px 5px 5px;<br />
}<br />
.pro_sub a:hover{<br />
color:#F90;<br />
}<br />
.figure{<br />
font-size:14px;<br />
color:#5b686a;<br />
line-height:110%;<br />
padding:0 30px;<br />
}<br />
#pic img{<br />
vertical-align: top;<br />
<br />
}<br />
/*end of the Overview page*/<br />
<br />
.proLP{<br />
float:left;<br />
width:218px;<br />
margin:15px 15px;<br />
background-color:transparent;<br />
border-right-style:solid; <br />
border-width:2px;<br />
border-color:#CCC; <br />
<br />
}<br />
.proLP h3{<br />
font:"Trebuchet MS", Arial, Helvetica, sans-serif;<br />
font-size:24px;<br />
color:#000;<br />
padding:10px;<br />
text-align:center;<br />
}<br />
.proLP h4 a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:18px;<br />
color:#000;<br />
text-decoration:underline;<br />
}<br />
#protocol ul li a{<br />
display:block;<br />
font:Geneva, Arial, Helvetica, sans-serif;<br />
font-size:15px;<br />
color:#f88005;<br />
}<br />
.proLP ul li{<br />
display:block;<br />
padding:5px 25px 5px 0px;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:16px;<br />
line-height:28px; <br />
}<br />
<br />
.proLP ul li a{<br />
color:#F88005;<br />
}<br />
.proLP ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:14px;<br />
padding-left:20px;<br />
line-height:24px; <br />
}<br />
.proLP ul li ul li a{<br />
color:black;<br />
}<br />
<br />
.proLP ul li ul li ul li{<br />
display:block;<br />
font-family:"Lucida Sans Unicode", "Lucida Grande", sans-serif;<br />
font-size:13px;<br />
line-height:24px; <br />
}<br />
<br />
.proRP{<br />
float:left;<br />
width:690px;<br />
margin:15px 0 30px 0;<br />
padding:30px;<br />
background-color:transparent;<br />
border-style:solid;<br />
border-color:#CCC;<br />
border-width:1px;<br />
border-radius:4px;<br />
}<br />
.proRP h1{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:30px;<br />
font-weight:bold;<br />
color:#F88005;<br />
line-height:40px;<br />
text-align:left;<br />
padding:10px;<br />
}<br />
.proRP h2{<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
font-size:20px;<br />
line-height:36px;<br />
padding:0;<br />
color:#039648;<br />
text-align:left;<br />
}<br />
.proRP h3{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0;<br />
color:#BF2F15;<br />
text-align:left;<br />
}<br />
.proRP h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
line-height:24px;<br />
padding:10px 0;<br />
color:black;<br />
text-align:justify;<br />
font-weight:bold;<br />
}<br />
<br />
.proRP p{<br />
font-size:16px;<br />
text-align:justify;<br />
}<br />
#humanPractice img{<br />
border-radius:8%;<br />
}<br />
#protocol ul li:hover{<br />
background-color:#DFDFDF;<br />
border-radius:4px;<br />
}<br />
<br />
/*For the achievement part */<br />
#achv{<br />
float:left;<br />
margin:10px 0;<br />
padding:40px;<br />
width:922px;<br />
border:solid 1px #CCCCCC;<br />
border-radius:5px;<br />
}<br />
#achv h1{<br />
font:30px Helvetica,sans-serif;<br />
color:#BF2F15;<br />
}<br />
#achv h2{<br />
font:30px;<br />
}<br />
#achv p{<br />
text-align:justify;<br />
padding-left:25px;<br />
}<br />
#achv_img1{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p1{<br />
float: left;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#achv_img2{<br />
float: right;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p2{<br />
float: left;<br />
height:360px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px; <br />
}<br />
#achv_img3{<br />
float: left;<br />
height:400px;<br />
width:200px;<br />
}<br />
#achv_p3{<br />
float: left;<br />
height:399px;<br />
width:690px;<br />
border-bottom-style:solid;<br />
border-bottom-color:#CCC;<br />
border-bottom-width:1px;<br />
}<br />
#Achieve a{<br />
color:black;<br />
}<br />
/*For the gallery*/<br />
.gallery_single_part{<br />
float:left;<br />
width:650px;<br />
}<br />
.gallery li{<br />
display:block;<br />
float:left;<br />
width:120px;<br />
margin:15px;<br />
border:5px solid #eee;<br />
}<br />
<br />
/*For each overview part*/<br />
#overview{<br />
float:left;<br />
width:1002px;<br />
}<br />
#overview h1{<br />
font:25px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:20px 0;<br />
}<br />
/*For notebook part*/<br />
.note_three{<br />
float:left;<br />
width:334px;<br />
height:500px;<br />
}<br />
.note_three h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_three a{<br />
color:#f88005;<br />
<br />
}<br />
#note_nav li{<br />
padding-left:30px;<br />
}<br />
<br />
#note_safety{<br />
height:250px;<br />
}<br />
.note_three p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.collapsibleListTitle {<br />
cursor: pointer;<br />
position: relative;<br />
}<br />
.collapsibleListBody img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#notebookWrap h4{<br />
font-family:"Charter Black", sans-serif;<br />
font-size:18px;<br />
padding:5px 0px 5px 30px;<br />
border-bottom: solid 2px #ccc;<br />
}<br />
#notebookWrap p{<br />
background-color: #f4f4f8;<br />
}<br />
#notebookWrap h2{<br />
color:#000;<br />
}<br />
#BBWrap p img{<br />
display:block;<br />
margin:15px auto;<br />
}<br />
#lab_team1{<br />
background-color:#fcebeb;<br />
border-left:solid 10px #fcc;<br />
border-radius:5px;<br />
}<br />
#lab_team2{<br />
background-color:#fcedd6;<br />
border-left:solid 10px #fdd7a0;<br />
border-radius:5px;<br />
}<br />
#lab_team3{<br />
background-color:#daf1dc;<br />
border-left:solid 10px #b0dfb3;<br />
border-radius:5px;<br />
}<br />
#lab_team4{<br />
background-color:#dff4fa;<br />
border-left:solid 10px #9be3f8;<br />
border-radius:5px;<br />
}<br />
/*edit for the search box*/<br />
/* project overview */<br />
<br />
.note_sthree{<br />
float:left;<br />
width:280px;<br />
height:290px;<br />
margin:12px;<br />
padding:15px;<br />
background-color:#e7e7e7;<br />
border-radius:10px;<br />
}<br />
.note_sthree h2{<br />
font:20px Lucida Sans Unicode, Lucida Grande, sans-serif;<br />
padding:10px 0;<br />
color:#f88005;<br />
}<br />
.note_sthree a{<br />
color:#f88005;<br />
<br />
}<br />
<br />
.note_sthree p{<br />
padding:0 20px 10px 20px;<br />
text-align:justify;<br />
}<br />
.news{<br />
float:left;<br />
width:230px;<br />
margin-top:20px;<br />
text-align:center;<br />
}<br />
.news img{<br />
border-radius:50%;<br />
}<br />
<br />
/*This is for the presentation part*/<br />
#Presentation{<br />
float:left;<br />
width:690px;<br />
}<br />
.pres{<br />
float:left;<br />
width:220px;<br />
text-align:center;<br />
margin:20px 5px 0 5px;<br />
padding:20px 0;<br />
background-color:#faedda;<br />
border-radius:4px;<br />
}<br />
.pres img{<br />
border-radius:8%;<br />
<br />
}<br />
.pres h3{<br />
text-align:center;<br />
}<br />
<br />
/*Modify the table*/<br />
.table1 {<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
width:100%;<br />
border-collapse:collapse;<br />
}<br />
.table1 th, .table1 td{<br />
font-size:1em;<br />
border:1px solid #98bf21;<br />
padding:3px 7px 2px 7px;<br />
}<br />
<br />
.table1 th{<br />
font-size:1.1em;<br />
padding-top:5px;<br />
padding-bottom:4px;<br />
background-color:#A7C942;<br />
color:#ffffff;<br />
}<br />
.table1 tr:nth-child(odd){<br />
background-color:#EAF2D3;<br />
}<br />
.table2{<br />
background-color:#F7F7F7;<br />
font-family:"Helvetica Neue", "Helvetica", Helvetica, Arial, sans-serif;<br />
<br />
}<br />
.table2 td{<br />
padding:5px 15px;<br />
text-align:left;<br />
<br />
}<br />
/* social media boxes */<br />
.fblike iframe {<br />
width: 100px ;<br />
}<br />
/* YouTube player */<br />
#player {<br />
width: 348px;<br />
height: 240px;<br />
overflow: hidden;<br />
background: gray;<br />
position: absolute;<br />
border: solid 2px gray;<br />
}<br />
<br />
</style><br />
<br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_presentation
Team:Goettingen/outreach presentation
2014-10-18T00:30:22Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<br />
<h2>Presentations</h2><br />
<div id="Presentation"><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/f/fe/Goettingen_booklet_fund.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_booklet_cover.png" width="200px" /></a><br />
<h3>Booklet for fund-raising</h3> <p></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen_SynBio_Brochure.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_brochure.png" width="200px" /></a><br />
<h3>Brochure for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" width="200px" /></a><br />
<h3>Comic for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/96/Goettingen_Poster_igem.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/75/Goettingen_Poster_igem_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about iGEM</p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/5/5c/Goettingen_Poster_project.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_Poster_project_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about our project</p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/de/Goettingen_Poster_synbiology.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/9/93/Goettingen_Poster_synbiology_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about synthetic biology</p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_HP_Poster.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/ca/Goettingen_HP_Poster_reduced2.png" width="200px" /></a><br />
<h3>Poster for the colloquia</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/93/Goettingen_PPT.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Goettingen_PPTCover.png" width="200px" /></a><br />
<h3>GZMB Symposium Presentation</h3><p style="text-align:center"></p><br />
</div><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_videos" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_newsletter" class="button_next"><b>Next</b></a></div><br />
</div><br />
<br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_presentation
Team:Goettingen/outreach presentation
2014-10-18T00:29:54Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<br />
<h2>Presentations</h2><br />
<div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/f/fe/Goettingen_booklet_fund.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_booklet_cover.png" width="200px" /></a><br />
<h3>Booklet for fund-raising</h3> <p></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen_SynBio_Brochure.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_brochure.png" width="200px" /></a><br />
<h3>Brochure for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" width="200px" /></a><br />
<h3>Comic for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/96/Goettingen_Poster_igem.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/75/Goettingen_Poster_igem_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about iGEM</p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/5/5c/Goettingen_Poster_project.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_Poster_project_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about our project</p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/de/Goettingen_Poster_synbiology.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/9/93/Goettingen_Poster_synbiology_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about synthetic biology</p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_HP_Poster.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/ca/Goettingen_HP_Poster_reduced2.png" width="200px" /></a><br />
<h3>Poster for the colloquia</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/93/Goettingen_PPT.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Goettingen_PPTCover.png" width="200px" /></a><br />
<h3>GZMB Symposium Presentation</h3><p style="text-align:center"></p><br />
</div><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_videos" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_newsletter" class="button_next"><b>Next</b></a></div><br />
</div><br />
<br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_presentation
Team:Goettingen/outreach presentation
2014-10-18T00:28:59Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<div><br />
<h2>Presentations</h2><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/f/fe/Goettingen_booklet_fund.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_booklet_cover.png" width="200px" /></a><br />
<h3>Booklet for fund-raising</h3> <p></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen_SynBio_Brochure.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_brochure.png" width="200px" /></a><br />
<h3>Brochure for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" width="200px" /></a><br />
<h3>Comic for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/96/Goettingen_Poster_igem.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/75/Goettingen_Poster_igem_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about iGEM</p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/5/5c/Goettingen_Poster_project.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_Poster_project_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about our project</p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/de/Goettingen_Poster_synbiology.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/9/93/Goettingen_Poster_synbiology_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about synthetic biology</p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_HP_Poster.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/ca/Goettingen_HP_Poster_reduced2.png" width="200px" /></a><br />
<h3>Poster for the colloquia</h3><p style="text-align:center"></p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/93/Goettingen_PPT.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Goettingen_PPTCover.png" width="200px" /></a><br />
<h3>GZMB Symposium Presentation</h3><p style="text-align:center"></p><br />
</div><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_videos" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_newsletter" class="button_next"><b>Next</b></a></div><br />
</div><br />
<br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_presentation
Team:Goettingen/outreach presentation
2014-10-18T00:28:19Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2>Presentations</h2><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/f/fe/Goettingen_booklet_fund.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_booklet_cover.png" width="200px" /></a><br />
<h3>Booklet for fund-raising</h3> <p></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen_SynBio_Brochure.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_brochure.png" width="200px" /></a><br />
<h3>Brochure for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" width="200px" /></a><br />
<h3>Comic for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/96/Goettingen_Poster_igem.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/75/Goettingen_Poster_igem_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about iGEM</p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/5/5c/Goettingen_Poster_project.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_Poster_project_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about our project</p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/de/Goettingen_Poster_synbiology.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/9/93/Goettingen_Poster_synbiology_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about synthetic biology</p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_HP_Poster.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/ca/Goettingen_HP_Poster_reduced2.png" width="200px" /></a><br />
<h3>Poster for the colloquia</h3><p style="text-align:center"></p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/93/Goettingen_PPT.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Goettingen_PPTCover.png" width="200px" /></a><br />
<h3>GZMB Symposium Presentation</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_videos" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_newsletter" class="button_next"><b>Next</b></a></div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_presentation
Team:Goettingen/outreach presentation
2014-10-18T00:27:40Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2>Presentations</h2><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/f/fe/Goettingen_booklet_fund.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_booklet_cover.png" width="200px" /></a><br />
<h3>Booklet for fund-raising</h3> <p></p><br />
</div><br />
<br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen_SynBio_Brochure.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_brochure.png" width="200px" /></a><br />
<h3>Brochure for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/da/Goettingen_comic.jpg" width="200px" /></a><br />
<h3>Comic for SynBio Day</h3><p style="text-align:center"></p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/96/Goettingen_Poster_igem.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/75/Goettingen_Poster_igem_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about iGEM</p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/5/5c/Goettingen_Poster_project.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/6/68/Goettingen_Poster_project_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about our project</p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/d/de/Goettingen_Poster_synbiology.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/9/93/Goettingen_Poster_synbiology_reduced.jpg" width="200px" /></a><br />
<h3>Poster for SynBio Day</h3><p style="text-align:center">Introduction about synthetic biology</p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_HP_Poster.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/ca/Goettingen_HP_Poster_reduced2.png" width="200px" /></a><br />
<h3>Poster for the colloquia</h3><p style="text-align:center"></p><br />
</div><br />
<div class="pres"><br />
<a href="https://static.igem.org/mediawiki/2014/9/93/Goettingen_PPT.pdf" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Goettingen_PPTCover.png" width="200px" /></a><br />
<h3>GZMB Symposium Presentation</h3><p style="text-align:center"></p><br />
</div><br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_videos" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_newsletter" class="button_next"><b>Next</b></a></div><br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_videos
Team:Goettingen/outreach videos
2014-10-18T00:26:25Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<br />
<div id="HP1"><br />
<br />
<h2>Videos</h2><br />
<center><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/5/5a/Goettingen2014-Y2H_Screening.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/7/7b/Goettingen2014-PCR.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/f/f5/Goettingen2014-Preparation_of_Competent_Cells_from_E._Coli_%28TOP_10%29_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/5/5c/Goettingen2014-E._coli_transformation_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/b/bb/Goettingen2014-Plasmid_Isolation_from_Yeast_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/2/2a/Goettingen2014-New_Robot.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls poster="https://static.igem.org/mediawiki/2014/5/5e/Goettingen_Video_TeamCover.png"><source src="https://static.igem.org/mediawiki/2014/a/aa/Goettingen2014-Introduction_of_the_iGEM_team_G%C3%B6ttingen_2014_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br /><br />
</center><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_gallery" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_presentation" class="button_next"><b>Next</b></a></div><br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_videos
Team:Goettingen/outreach videos
2014-10-18T00:25:40Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<br />
<div id="HP1"><br />
<center><br />
<h2>Videos</h2><br />
<br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/5/5a/Goettingen2014-Y2H_Screening.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/7/7b/Goettingen2014-PCR.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/f/f5/Goettingen2014-Preparation_of_Competent_Cells_from_E._Coli_%28TOP_10%29_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/5/5c/Goettingen2014-E._coli_transformation_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/b/bb/Goettingen2014-Plasmid_Isolation_from_Yeast_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/2/2a/Goettingen2014-New_Robot.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls poster="https://static.igem.org/mediawiki/2014/5/5e/Goettingen_Video_TeamCover.png"><source src="https://static.igem.org/mediawiki/2014/a/aa/Goettingen2014-Introduction_of_the_iGEM_team_G%C3%B6ttingen_2014_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br /><br />
</center><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_gallery" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_presentation" class="button_next"><b>Next</b></a></div><br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_videos
Team:Goettingen/outreach videos
2014-10-18T00:24:05Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<br />
<div id="HP1"><br />
<center><br />
<h2>Videos</h2><br />
<br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/5/5a/Goettingen2014-Y2H_Screening.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/7/7b/Goettingen2014-PCR.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/f/f5/Goettingen2014-Preparation_of_Competent_Cells_from_E._Coli_%28TOP_10%29_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/5/5c/Goettingen2014-E._coli_transformation_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/b/bb/Goettingen2014-Plasmid_Isolation_from_Yeast_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/2/2a/Goettingen2014-New_Robot.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls><source src="https://static.igem.org/mediawiki/2014/c/c8/Goettingen2014-The_Official_Video.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
<video width="640" height="390" controls poster="https://static.igem.org/mediawiki/2014/5/5e/Goettingen_Video_TeamCover.png"><source src="https://static.igem.org/mediawiki/2014/a/aa/Goettingen2014-Introduction_of_the_iGEM_team_G%C3%B6ttingen_2014_-_YouTube.mp4" type="video/mp4">Your browser does not support the video tag.</video><br /><br />
</center><br />
<br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
<br />
<br />
<br />
</div><br />
</div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_gallery
Team:Goettingen/outreach gallery
2014-10-18T00:22:29Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/lightbox}}<br />
<br />
<html><br />
<head><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery-1.11.0.min.js?action=raw&type=text/js" type="text/javascript"></script><br />
<script src="https://2014.igem.org/Team:Goettingen/lightbox.min?action=raw&type=text/js" type="text/javascript"></script><br />
</head><br />
<body><br />
<br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2><center>Gallery</center></h2><br />
<!--Meet us in the lab--><br />
<br />
<div class="gallery_single_part" id="in_the_lab"><br />
<h3>Meet us in the lab!</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/4/4c/Goettingen_lab_photo0.jpg" data-lightbox="inTheLab" data-title="First day in the lab. Everything is well organised!" ><img src="https://static.igem.org/mediawiki/2014/b/b4/Goettingen_lab_photo0_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/10/Goettingen_lab_photo2.jpg" data-lightbox="inTheLab" data-title="Be careful of these materials"><img src="https://static.igem.org/mediawiki/2014/4/46/Goettingen_lab_photo2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/5d/Goettingen_lab_photo3.jpg" data-lightbox="inTheLab" data-title="All the buffers and mediums are well prepared."><img src="https://static.igem.org/mediawiki/2014/1/19/Goettingen_lab_photo3_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_lab_Photo15.jpg" data-lightbox="inTheLab" data-title="Fancy experiments"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_lab_Photo15.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/78/Goettingen_lab_photo10.jpg" data-lightbox="inTheLab" data-title="Cedric on the microscope"><img src="https://static.igem.org/mediawiki/2014/7/78/Goettingen_lab_photo10.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/6/6f/Goettingen_lab_photo8.jpg" data-lightbox="inTheLab" data-title="The whole team is working hard"><img src="https://static.igem.org/mediawiki/2014/6/6f/Goettingen_lab_photo8.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/7f/Goettingen_lab_photo9.jpg" data-lightbox="inTheLab" data-title="On the microscope"><img src="https://static.igem.org/mediawiki/2014/7/7f/Goettingen_lab_photo9.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/ff/Goettingen_lab_photo14.jpg" data-lightbox="inTheLab" data-title="Lab without iGEMers"><img src="https://static.igem.org/mediawiki/2014/f/ff/Goettingen_lab_photo14.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/70/Goettingen_lab_Photo16.JPG" data-lightbox="inTheLab" data-title="Shooting videos"><img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_lab_Photo16_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c1/Goettingen_lab_Photo17.JPG" data-lightbox="inTheLab" data-title="Our international marketing guy!"><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo17_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d7/Goettingen_lab_Photo18.JPG" data-lightbox="inTheLab" data-title="Dry lab work"><img src="https://static.igem.org/mediawiki/2014/7/72/Goettingen_lab_Photo18_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/71/Goettingen_lab_Photo19.JPG" data-lightbox="inTheLab" data-title="This is our way to communicate!"><img src="https://static.igem.org/mediawiki/2014/0/09/Goettingen_lab_Photo19_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b5/Goettingen_lab_Photo20.JPG" data-lightbox="inTheLab" data-title="Happy Rayan"><img src="https://static.igem.org/mediawiki/2014/1/17/Goettingen_lab_Photo20_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/eb/Goettingen_lab_Photo21.JPG" data-lightbox="inTheLab" data-title="Kamal is at work"><img src="https://static.igem.org/mediawiki/2014/e/e9/Goettingen_lab_Photo21_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/2d/Goettingen_lab_Photo22.JPG" data-lightbox="inTheLab" data-title="Samples on ice"><img src="https://static.igem.org/mediawiki/2014/3/3c/Goettingen_lab_Photo22_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/1c/Goettingen_lab_Photo23.JPG" data-lightbox="inTheLab" data-title="Our bench on a normal day"><img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_lab_Photo23_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e4/Goettingen_lab_Photo24.JPG" data-lightbox="inTheLab" data-title="Our hood"><img src="https://static.igem.org/mediawiki/2014/3/35/Goettingen_lab_Photo24_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/71/Goettingen_lab_Photo25.JPG" data-lightbox="inTheLab" data-title="Cedric and Anika are working in the cold room"><img src="https://static.igem.org/mediawiki/2014/8/8e/Goettingen_lab_Photo25_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b0/Goettingen_lab_Photo27.JPG" data-lightbox="inTheLab" data-title="Antique lab equipment"><img src="https://static.igem.org/mediawiki/2014/6/63/Goettingen_lab_Photo27_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/33/Goettingen_lab_Photo26.JPG" data-lightbox="inTheLab" data-title="Equipment for protein purification"><img src="https://static.igem.org/mediawiki/2014/3/34/Goettingen_lab_Photo26_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/17/Goettingen_lab_photo1.jpg" data-lightbox="inTheLab" data-title="iGEM 2014 DNA Distributions have shipped! and arrived!! Work can start! "><img src="https://static.igem.org/mediawiki/2014/3/34/Goettingen_lab_photo1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/38/Goettingen_lab_Photo34.jpg" data-lightbox="inTheLab" data-title="Bahar and Cedric preparing the film set "><img src="https://static.igem.org/mediawiki/2014/8/8b/Goettingen_lab_Photo34_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/8/8b/Goettingen_lab_Photo29.jpg" data-lightbox="inTheLab" data-title="Happy Bahar after winning one giant microbe"><img src="https://static.igem.org/mediawiki/2014/7/7e/Goettingen_lab_Photo29_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_lab_Photo30.jpg" data-lightbox="inTheLab" data-title="Julia and Karthi, another lucky winners!"><img src="https://static.igem.org/mediawiki/2014/b/ba/Goettingen_lab_Photo30_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/55/Goettingen_lab_Photo28.jpg" data-lightbox="inTheLab" data-title="Post-Synbio Day meeting"><img src="https://static.igem.org/mediawiki/2014/2/20/Goettingen_lab_Photo28_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e1/Goettingen_lab_Photo31.jpg" data-lightbox="inTheLab" data-title="iGEM army preparing for battle!"><img src="https://static.igem.org/mediawiki/2014/6/60/Goettingen_lab_Photo31_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/a1/Goettingen_lab_Photo33.jpg" data-lightbox="inTheLab" data-title="Video director at work…silence required!"><img src="https://static.igem.org/mediawiki/2014/b/b1/Goettingen_lab_Photo33_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/1c/Goettingen_lab_Photo23.JPG" data-lightbox="inTheLab" data-title="iGEM time… at 2 am!"><img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_lab_Photo23_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo32.jpg" data-lightbox="inTheLab" data-title="###"><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo32.jpg" width="120px"></a></li><br />
<br />
</ul><br />
<br /><br /><br />
</div><br />
<!-- Meetup in München --><br />
<div class="gallery_single_part" id="trip_in_Munich"><br />
<h3>Meetup in Munich</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/aa/CAS_meetupLMU_group2.jpg" data-lightbox="meeupLMU" data-title="The german iGEMers are gathering together in the University Munich!"><img src="https://static.igem.org/mediawiki/2014/a/ad/Goettingen_meetupLMU0_reduced.jpg" ></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/28/Goettingen_meetupLMU1.jpg" data-lightbox="meeupLMU" data-title="Julia is presenting our project!"><img src="https://static.igem.org/mediawiki/2014/0/09/Goettingen_meetupLMU1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/72/Goettingen_meetupLMU5.jpg" data-lightbox="meeupLMU" data-title="Nice smile, Lara :)"><img src="https://static.igem.org/mediawiki/2014/3/35/Goettingen_meetupLMU5_reduced.jpg" ></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/3d/Goettingen_meetupLMU6.jpg" data-lightbox="meeupLMU" data-title="A wonderful trip in Munich!"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_meetupLMU6_reduced.jpg" width="120"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<!-- SynBio Day --><br />
<div class="gallery_single_part" id="SynBioDay"><br />
<h3>SynBio Day</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_SynBioDay1.jpg" data-lightbox="SynBioDay" data-title="Our SynBioDay in Göttingen"><img src="https://static.igem.org/mediawiki/2014/2/2e/Goettingen_SynBioDay1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/be/Goettingen_SynBioDay7.jpg" data-lightbox="SynBioDay" data-title="Winners of the lottery"><img src="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_SynBioDay7_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_SynBioDay8.jpg" data-lightbox="SynBioDay" data-title="Another winner"><img src="https://static.igem.org/mediawiki/2014/9/9b/Goettingen_SynBioDay8_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/0d/Goettingen_SynBioDay2.jpg" data-lightbox="SynBioDay" data-title="Göttingens pedestrian zone"><img src="https://static.igem.org/mediawiki/2014/e/ed/Goettingen_SynBioDay2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_SynBioDay3.jpg" data-lightbox="SynBioDay" data-title="Friends visit us "><img src="https://static.igem.org/mediawiki/2014/3/39/Goettingen_SynBioDay3_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/27/Goettingen_SynBioDay4.jpg" data-lightbox="SynBioDay" data-title="Anika in a conversation"><img src="https://static.igem.org/mediawiki/2014/2/2a/Goettingen_SynBioDay4_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f5/Goettingen_SynBioDay5.jpg" data-lightbox="SynBioDay" data-title="Shantal is talking about our project"><img src="https://static.igem.org/mediawiki/2014/f/f2/Goettingen_SynBioDay5_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_SynBioDay10.jpg" data-lightbox="SynBioDay" data-title="Another interesting conversation"><img src="https://static.igem.org/mediawiki/2014/6/65/Goettingen_SynBioDay10_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/19/Goettingen_SynBioDay6.jpg" data-lightbox="SynBioDay" data-title="More talks"><img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_SynBioDay6_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/0c/Goettingen_SynBioDay9.jpg" data-lightbox="SynBioDay" data-title="Lara in a talk"><img src="https://static.igem.org/mediawiki/2014/a/a9/Goettingen_SynBioDay9_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/3a/Goettingen_SynBioDay11.jpg" data-lightbox="SynBioDay" data-title="Informing people about Synthetic Biology"><img src="https://static.igem.org/mediawiki/2014/5/5a/Goettingen_SynBioDay11_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e6/Goettingen_SynBioDay12.jpg" data-lightbox="SynBioDay" data-title="iGEM Goettingen being broadcasted by Stadtradio Göttingen "><img src="https://static.igem.org/mediawiki/2014/5/54/Goettingen_SynBioDay12_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/5a/Goettingen_SynBioDay13.jpg" data-lightbox="SynBioDay" data-title="Conversation"><img src="https://static.igem.org/mediawiki/2014/d/de/Goettingen_SynBioDay13_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f1/Goettingen_SynBioDay14.jpg" data-lightbox="SynBioDay" data-title="Our stand"><img src="https://static.igem.org/mediawiki/2014/3/30/Goettingen_SynBioDay14_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/79/Goettingen_SynBioDay15.jpg" data-lightbox="SynBioDay" data-title="Lara in action"><img src="https://static.igem.org/mediawiki/2014/7/74/Goettingen_SynBioDay15_reduced.jpg"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<br />
<!-- GZMB Symposium 2014 --><br />
<div class="gallery_single_part" id="GZMB"><br />
<h3>GZMB Symposium 2014</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/26/Goettingen_Presenters.jpg" data-lightbox="GZMBSym" data-title="Julia tells about iGEM"><img src="https://static.igem.org/mediawiki/2014/5/51/Goettingen_Presenters_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/05/Goettingen_Mr_Moderator.jpg" data-lightbox="GZMBSym" data-title="Joanan presenting our most wanted enemies!"><img src="https://static.igem.org/mediawiki/2014/4/43/Goettingen_Mr_Moderator_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_Mr_CoffeeHuger.jpg" data-lightbox="GZMBSym" data-title="Mr_CoffeeHuger"><img src="https://static.igem.org/mediawiki/2014/9/97/Goettingen_Mr_CoffeeHuger_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b0/Goettingen_BBQ_after.jpg" data-lightbox="GZMBSym" data-title="Our BBQ after the presentation"><img src="https://static.igem.org/mediawiki/2014/9/94/Goettingen_BBQ_after_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d3/Goettingen_GZMB1.jpg" data-lightbox="GZMBSym" data-title="Cheers!!!"><img src="https://static.igem.org/mediawiki/2014/8/81/Goettingen_GZMB1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/10/Goettingen_GZMB2.jpg" data-lightbox="GZMBSym" data-title="Cake is being translated!!!"><img src="https://static.igem.org/mediawiki/2014/7/7c/Goettingen_GZMB2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_GZMB3.jpg" data-lightbox="GZMBSym" data-title="Getting ready for the coffee break"><img src="https://static.igem.org/mediawiki/2014/2/2b/Goettingen_GZMB3_reduced.jpg"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_human_practices" class="button_pre"><b>Previous</b></a><br />
<a href="https://2014.igem.org/Team:Goettingen/outreach_videos" class="button_next"><b>Next</b></a></div><br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_human_practices
Team:Goettingen/outreach human practices
2014-10-18T00:20:38Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a><br />
<ul><br />
<li><a href="#HP1">iGEM meets CAS-LMU</a></li><br />
<li><a href="#HP2">SynBio Day</a></li><br />
<li><a href="#HP3">GZMB Symposium 2014</a></li><br />
<li><a href="#HP4">Colloquia</a></li><br />
</ul><br />
</li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP" id="humanPractice"><br />
<div id="HP1"><br />
<h2>iGEM teams gather at Munich!</h2><br />
<center><img src="https://static.igem.org/mediawiki/2014/6/6e/Goettingen_meetupLMU0_reduced.png" width="600"></center><br />
<br /><br /><br />
<p>At the end of May, Julia Menzel and I (Lara Schmitz) went to Munich as representatives of our iGEM team to meet members of 11 iGEM teams from all over Germany. The weekend started with an official welcome by the iGEM team Munich and we heard a really interesting talk from Prof. Dr. Friedrich Simmel from the TU Munich. After that, we had a get-together with a barbeque to get to know the members of the other iGEM teams. Because of the good weather and the nice people we had a great evening with a lot of fun. <br /><br /><br />
The next day, all teams had the opportunity to present their projects. Most of the projects were really interesting; some teams were working on really intriguing topics. A discussion was held and the teams voiced their suggestions and comments about the projects of others. The day was wound up with a nice dinner at a typical Bavarian beer garden.<br /><br /><br />
On Monday, the last day of our trip, we had some free-time to explore Munich, visit the English Garden and relax a bit. Along with people from the iGEM teams Darmstadt, Freiburg and Saarland, we visited the Marienplatz in Munich and had lunch with them. After that, we joined the meeting at the Center for Advanced Studies (CAS) with a focus on Synthetic Biology with international speakers. We were one of six teams which had introduced our project to the audience in another brief talk. After that, we were really tired and took the last train back to Göttingen. But because the ICE had a delay, we missed our connecting train leaving us stuck at Fulda thereby compelling us to stay for a night in a hotel. This was the curious end of an eventful weekend and iGEM meeting in Munich. <br /><br /><br />
All in all, it was an exhausting weekend, but we also had a lot of fun with the other teams and we got to know a lot of people. The presentations were very interesting and we received a lot of constructive feedback and new ideas for our project.<br /><br /><br />
For more information, please visit the homepage of this event. Click <a href="https://2014.igem.org/Meetups/May_LMU-Munich" target="_blank">HERE</a>. <br /><br /><br />
To see more photos, click <a href="/Team:Goettingen/outreach_gallery#trip_in_Munich">HERE</a>.<br /><br /><br />
</p><br />
</div><br />
<div id="HP2"><br />
<h2>SynBio Day</h2><br />
<p>During the meet-up in Munich all the german iGEM Teams had the opportunity to participate in a Workshops. The participants at the Workshop agreed to an All Germany SynBio Week, which was scheduled in the second week of August.The day we chose was the 15th of August. On the SynBio Day we planned to present our project to the public of our city, Göttingen. The idea behind the SynBio Day was to increase awareness and the ridding of any prejudice or fear of Synthetic Biology. These aims could be achieved by talking face to face with all kinds of people on public places or making informative posters addressing aspects of Synthetic Biology in order to reach people via social media. Furthermore, we did a survey to get an idea about the general opinion of the public about Synthetic Biology.<br /><br /></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/71/Poster1.jpg" width="400"></center><br />
<br /><br />
<p>On this SynBio Day from 10 AM to 5 PM, our team members talked to the citizens of Göttingen at an information booth, which was located at the iconic Gänseliesel in the city center. By showing lively and comic posters, we caught the attention of many. People of different ages stopped by the booth, looked through all the posters and asked questions. Most of them were very curious about the field of Synthetic Biology and our topic especially. Our team members took pleasure in answering all their questions and as a bonus, cakes and muffins were offered to thank them for their attention and interest. </p><br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2e/Goettingen_synbioday_reduced.jpg" width="600"></center><br />
<br /><br />
<p>To see more photos, click <a href="/Team:Goettingen/outreach_gallery#SynBioDay">HERE</a>.<br /><br /></p><br />
</div><br />
<div id="HP3"><br />
<h2>GZMB Symposium 2014</h2><br />
<p>The GZMB symposium is a significant event held once a year in the Göttingen Center for molecular Biosciences (GZMB). Each year, scientists present their findings. This time around, our team managed to give a talk to let more professors and students learn about our project and receive feedback on the same;which, would go a long way to improve our performance in the final presentation.<br /><br /></p> <br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_Symposium_Poster_reduced.png" width="400"></center><br />
<p><br /><a href="https://static.igem.org/mediawiki/2014/d/d4/Goettingen_Symposium_Poster.pdf" target="_blank">HERE</a> is the poster for this event.</p><br />
<br /><br /><br />
<p>On this day, we were able to arouse curiosity in many from the audience. For that, we thank our speakers - Julia, Shantal and Joanan! Along with applause, we also received some constructive criticism regarding what and where we could do better. For example, Prof. Dr. Stülke, one of the supervisors of the iGEM team last year, gave us good suggestions regarding how to proceed with the dry lab section. With the improvements made and the positive feedback from the veterans we've been interacting with, we feel more and more confident and ready for Boston! yay!</p><br />
<br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/4/48/Goettingen_Symposium1_reduced.jpg" width="400"></center><br />
<br /><br />
<p>To see more photos, click <a href="/Team:Goettingen/outreach_gallery#GZMB">HERE</a>.<br /><br /></p><br />
</div><br />
<br />
<div id="HP4"><br />
<h2>Colloquia</h2><br />
<center><img src="https://static.igem.org/mediawiki/2014/4/49/Goettingen_Poster2.jpg" width="500"></center><br /><br /><br />
<br />
<p>Although we have hosted several seminars both in and out of the university, we have planned a grand colloquium for the 28th of this month. In addition to that, there will be an “experts-only” colloquium on the 20th of this month; which will only involve the team, its supervisors and a handful of experts in Infection Biology from our university’s medical microbiology center. This event is meant to ensure that we did justice to the topic at hand and to rectify factual errors (if any).<br /><br /></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ad/Goettingen_HP_Poster_reduced.png" width="500"></center><br /><br /><br />
<p>The invitation for the grand colloquium on the other hand, has been extended to as many people as possible; both from academic and non-academic sectors. Our goal here is to spread the word on not only our project in particular but also to inspire more people into participating in forthcoming iGEM jamborees. <br />
</p><br /><br /><br />
<br />
</div><br />
<br />
<div id="video"><br />
<h2>Educative videos as part of human practices online!</h2><br />
<p>As part of the human practice segment, videos with cogent explanation of simple laboratory protocols and methods were uploaded onto YouTube. This way, we intend to not only increase the awareness of the public on iGEM but also expose them to general laboratory working conditions. These videos can be accessed <a href="//www.youtube.com/channel/UCmdyv-J42xCtx95RkOLp41A" target="_blank">HERE</a>.</p><br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_overview" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/outreach_gallery" class="button_next"><b>Next</b></a></div> <br />
</div><br />
<br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_human_practices
Team:Goettingen/outreach human practices
2014-10-18T00:20:08Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a><br />
<ul><br />
<li><a href="#HP1">iGEM meets CAS-LMU</a></li><br />
<li><a href="#HP2">SynBio Day</a></li><br />
<li><a href="#HP3">GZMB Symposium 2014</a></li><br />
<li><a href="#HP4">Colloquia</a></li><br />
</ul><br />
</li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP" id="humanPractice"><br />
<div id="HP1"><br />
<h2>iGEM teams gather at Munich!</h2><br />
<center><img src="https://static.igem.org/mediawiki/2014/6/6e/Goettingen_meetupLMU0_reduced.png" width="600"></center><br />
<br /><br /><br />
<p>At the end of May, Julia Menzel and I (Lara Schmitz) went to Munich as representatives of our iGEM team to meet members of 11 iGEM teams from all over Germany. The weekend started with an official welcome by the iGEM team Munich and we heard a really interesting talk from Prof. Dr. Friedrich Simmel from the TU Munich. After that, we had a get-together with a barbeque to get to know the members of the other iGEM teams. Because of the good weather and the nice people we had a great evening with a lot of fun. <br /><br /><br />
The next day, all teams had the opportunity to present their projects. Most of the projects were really interesting; some teams were working on really intriguing topics. A discussion was held and the teams voiced their suggestions and comments about the projects of others. The day was wound up with a nice dinner at a typical Bavarian beer garden.<br /><br /><br />
On Monday, the last day of our trip, we had some free-time to explore Munich, visit the English Garden and relax a bit. Along with people from the iGEM teams Darmstadt, Freiburg and Saarland, we visited the Marienplatz in Munich and had lunch with them. After that, we joined the meeting at the Center for Advanced Studies (CAS) with a focus on Synthetic Biology with international speakers. We were one of six teams which had introduced our project to the audience in another brief talk. After that, we were really tired and took the last train back to Göttingen. But because the ICE had a delay, we missed our connecting train leaving us stuck at Fulda thereby compelling us to stay for a night in a hotel. This was the curious end of an eventful weekend and iGEM meeting in Munich. <br /><br /><br />
All in all, it was an exhausting weekend, but we also had a lot of fun with the other teams and we got to know a lot of people. The presentations were very interesting and we received a lot of constructive feedback and new ideas for our project.<br /><br /><br />
For more information, please visit the homepage of this event. Click <a href="https://2014.igem.org/Meetups/May_LMU-Munich" target="_blank">HERE</a>. <br /><br /><br />
To see more photos, click <a href="/Team:Goettingen/outreach_gallery#trip_in_Munich">HERE</a>.<br /><br /><br />
</p><br />
</div><br />
<div id="HP2"><br />
<h2>SynBio Day</h2><br />
<p>During the meet-up in Munich all the german iGEM Teams had the opportunity to participate in a Workshops. The participants at the Workshop agreed to an All Germany SynBio Week, which was scheduled in the second week of August.The day we chose was the 15th of August. On the SynBio Day we planned to present our project to the public of our city, Göttingen. The idea behind the SynBio Day was to increase awareness and the ridding of any prejudice or fear of Synthetic Biology. These aims could be achieved by talking face to face with all kinds of people on public places or making informative posters addressing aspects of Synthetic Biology in order to reach people via social media. Furthermore, we did a survey to get an idea about the general opinion of the public about Synthetic Biology.<br /><br /></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/71/Poster1.jpg" width="400"></center><br />
<br /><br />
<p>On this SynBio Day from 10 AM to 5 PM, our team members talked to the citizens of Göttingen at an information booth, which was located at the iconic Gänseliesel in the city center. By showing lively and comic posters, we caught the attention of many. People of different ages stopped by the booth, looked through all the posters and asked questions. Most of them were very curious about the field of Synthetic Biology and our topic especially. Our team members took pleasure in answering all their questions and as a bonus, cakes and muffins were offered to thank them for their attention and interest. </p><br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2e/Goettingen_synbioday_reduced.jpg" width="600"></center><br />
<br /><br />
<p>To see more photos, click <a href="/Team:Goettingen/outreach_gallery#SynBioDay">HERE</a>.<br /><br /></p><br />
</div><br />
<div id="HP3"><br />
<h2>GZMB Symposium 2014</h2><br />
<p>The GZMB symposium is a significant event held once a year in the Göttingen Center for molecular Biosciences (GZMB). Each year, scientists present their findings. This time around, our team managed to give a talk to let more professors and students learn about our project and receive feedback on the same;which, would go a long way to improve our performance in the final presentation.<br /><br /></p> <br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_Symposium_Poster_reduced.png" width="400"></center><br />
<p><br /><a href="https://static.igem.org/mediawiki/2014/d/d4/Goettingen_Symposium_Poster.pdf" target="_blank">HERE</a> is the poster for this event.</p><br />
<br /><br /><br />
<p>On this day, we were able to arouse curiosity in many from the audience. For that, we thank our speakers - Julia, Shantal and Joanan! Along with applause, we also received some constructive criticism regarding what and where we could do better. For example, Prof. Dr. Stülke, one of the supervisors of the iGEM team last year, gave us good suggestions regarding how to proceed with the dry lab section. With the improvements made and the positive feedback from the veterans we've been interacting with, we feel more and more confident and ready for Boston! yay!</p><br />
<br /><br />
<center><img src="https://static.igem.org/mediawiki/2014/4/48/Goettingen_Symposium1_reduced.jpg" width="400"></center><br />
<br /><br />
<p>To see more photos, click <a href="/Team:Goettingen/outreach_gallery#GZMB">HERE</a>.<br /><br /></p><br />
</div><br />
<br />
<div id="HP4"><br />
<h2>Colloquia</h2><br />
<center><img src="https://static.igem.org/mediawiki/2014/4/49/Goettingen_Poster2.jpg" width="500"></center><br /><br /><br />
<br />
<p>Although we have hosted several seminars both in and out of the university, we have planned a grand colloquium for the 28th of this month. In addition to that, there will be an “experts-only” colloquium on the 20th of this month; which will only involve the team, its supervisors and a handful of experts in Infection Biology from our university’s medical microbiology center. This event is meant to ensure that we did justice to the topic at hand and to rectify factual errors (if any).<br /><br /></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ad/Goettingen_HP_Poster_reduced.png" width="500"></center><br /><br /><br />
<p>The invitation for the grand colloquium on the other hand, has been extended to as many people as possible; both from academic and non-academic sectors. Our goal here is to spread the word on not only our project in particular but also to inspire more people into participating in forthcoming iGEM jamborees. <br />
</p><br /><br /><br />
<br />
</div><br />
<br />
<div id="video"><br />
<h2>Educative videos as part of human practices online!</h2><br />
<p>As part of the human practice segment, videos with cogent explanation of simple laboratory protocols and methods were uploaded onto YouTube. This way, we intend to not only increase the awareness of the public on iGEM but also expose them to general laboratory working conditions. These videos can be accessed <a href="//www.youtube.com/channel/UCmdyv-J42xCtx95RkOLp41A" target="_blank">HERE</a>.</p><br />
</div><br />
<br />
</div><br />
<div><a href="https://2014.igem.org/Team:Goettingen/outreach_overview" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/outreach_gallery" class="button_next"><b>Next</b></a></div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/project_overview/perspectives
Team:Goettingen/project overview/perspectives
2014-10-18T00:13:19Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/projectLP}}<br />
<html><br />
<body><br />
<!-- main part of the subpage --><br />
<div id="subpage"> <br />
<br />
<br />
<!-- right column--><br />
<div class="proRP" id="rpart1"><br />
<br />
<br />
<br />
<br />
<br />
<h1>Further perspectives</h1><br />
<br />
<p>We have attained two milestones as far as the applications of our project is concerned. First, the identification of peptides with an affinity to a specific fungal surface molecule and second, is the proof of principle that our selection scheme can be used to generate peptides with affinity to a molecule under scrutiny. Both milestones hold promise but before that, we would like to elaborate on the future scope of the first milestone since it bears relevance to medicine and healthcare.</p><br /><br />
<br />
<h2 id="diagnostics">Applications in Diagnostics</h2> <br /> <br />
<h3>Lowering costs</h3><br /><br />
<p>The attachment of a chemical moiety that emits a quantifiable signal (a <br />
<br />
fluorescent, enzymatic or luminiscent moiety) to our peptides can lead to an <br />
<br />
alternative diagnostic method to antibody and antibody fragments with the added <br />
<br />
benefit of the relative low cost of production and modification of small peptides. This cost reduction may <br />
<br />
help to spread this diagnostic tool to the markets of the developing world, where <br />
<br />
fungal infections have the largest mortality rates and where health care is <br />
<br />
largely affected by economic constraints. Moreover, if the peptides prove to have a high species-specificity, the diagnosis based on them may give more information for a proper therapy choice, potentially reducing the toxicity risks associated with the use of broad spectrum antimycotics.</p><br /><br />
<br />
<br />
<h3><i>In vivo</i> diagnosis and the potential of artificial selection</h3><br /><br />
<p>Short peptides are currently being used as diagnostic tools for certain kind <br />
<br />
of cancers. These peptides are naturally produced by humans <br />
<br />
and have their natural binding proteins in the surface of cells; however, they <br />
<br />
have been optimized to increase their half-life and their affinity towards their <br />
<br />
natural target, and they also have been modified with radionuclides that make it <br />
<br />
possible to detect the location of tumors cells where their binding proteins are <br />
<br />
overrepresented with PET or SECT imaging.</p><br /> <br />
<br />
<p>The most common isotopically labelled peptide used for diagnosisis a <sup>111</sup>In-labelled somatostatin analogue, known as OctreoScan<sup>TM</sup>, which is used to diagnose a variety of tumors. Other peptides under <br />
<br />
develompent are cholecystokinin/gastrin analogues, glucagon-like peptide-1, <br />
<br />
bombesin, chemokine receptor CXCR4 targeting peptides, RGD peptides, exendin, <br />
<br />
Substance P, LHRH, neurotensin, &alpha;-M2, &alpha;-M2H and VIP.</p> <br /><br />
<br />
<p>Following the same rationale, our artificially selected peptides can be modified and optimized to increase their binding affinity and their half-life. The peptides can then be tagged with radionuclides to enable the diagnosis by imaging techniques. The results of such a diagnostic method will give more information about the localization and spread of the fungal infection inside the patients body than any of the currently available diagnostic methods.</p><br /><br /><br />
<br />
<br /><br />
<br />
<h2 id="therapeutics">Therapeutic Applications</h1><br /> <br />
<br />
<br />
<p><br />
The peptides we developed have significant applications from a clinical standpoint: they can be modified with molecules that modulate the immune response against fungi and they can be attached to an anti-mycotic drug to increase specificity and potentially reduce the drug's adverse effects.</p><br />
<br />
<br />
<p><br />
We don't expect our peptides to be part of a one-drug therapy. Patients with invasive fungal infections are very often immunocompromised and measures have to be taken to strengthen their immune system for a therapy to be effective. As for the stimulation of the immune system in case of individuals with immunodeficiencies, the use of adjuvants (immune response enhancers) to augment the response is one strategy. In addition to this, natural immuno-modulatory molecules called cytokines (such as Interleukin-1 and Interferon-gamma) to stimulate the appropriate branches of the immune system can be employed as well. </p><br /><br />
<br />
<h3>Fungal Infections and the branches of the immune system that deal with them</h3><br /><br />
<br />
<p>It has been observed that individuals suffering from deficiencies in antibody and complement mediated cytotoxicity are less vulnerable to fungal infections than the ones suffering from phagocytic defects. Moreover, studies have shown that neutrophils are pivotal in fending off fungal infections. This is further supported by the fact that many cases of fungal infections were following a period of neutropenia (low neutrophil count in blood).</p> <br /><br />
<p>Two vital principles can be gathered from the aforementioned information:</p> <br /> <br />
<ul><br />
<li><p>- Phagocytes (especially neutrophils) play a very important role in the resolution (clearance) of the fungal infection.</li></p><br /><br />
<li><p>- Antibodies and the complement system are not that effective against fungal pathogens due to the surface of these pathogens being unsuitable to binding.</li></p><br /><br />
<br />
<p>As such, the modulation of these branches of the immune system should aid in the resolution of the disease. It is important to mention that since most patients suffering from invasive mycoses are immunocompromised and that there are different types of immunodeficiencies. Depending upon which branch is dysfunctional, an appropriate strategy of immunomodulation can be adopted.</p> <br /><br />
<br />
<br />
<p><br />
Our peptides can bind to the fungal surface and they can be further modified using the Fc (constant) region of the IgG1 or IgG3 antibody subtype (IgG2a in mice). This region is important as it is recognized by the effector cells (neutrophils and macrophages) of the immune system and thereafter, leads to the death of the target cell. This way, not only can it bind to fungal pathogens but can also “draw attention” towards itself from the immune system. In addition to this, the constant region can also activate the complement cascade via the "classical" pathway. Essentially, this set-up functions as a modified antibody with an added bonus of greater affinity. </p> <br /><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br /><br />
<h3>Homing anti-fungal drugs to the site of infection</h3><br /><br />
<p>Anti-mycotics, such as amphotericin B and fluconazole have been used extensively to treat fungal infections. While they have been effective, they are more toxic to the human body than antibiotics that kill bacteria. This is due to the fact that bacteria are more dissimilar to humans than fungi are. As a result, it is relatively simpler to find targets for antibiotics than anti-mycotics. Simply but, the more we humans have in common with a pathogen, the greater is the difficulty in coming up with a drug that harms only one (in other words, there is a need for selective toxicity).</p><br />
<br /><br />
<p>Thus, yet another potential application of the novel peptides we developed is that they can act as “guides” to these molecules thereby reducing side-effects due to the drug in question.</p><br />
<br /><br />
<hr><br />
<h2>References</h2><br />
<br /><br /><br />
<ul><br />
<li><br />
<p>1. Raghavan M, Bjorkman P (1996). "Fc receptors and their interactions with immunoglobulins". Annu Rev Cell Dev Biol 12: 181–220.<br />
<br /><br /></p></li><br />
<li><br />
<p>2. Swanson J, Hoppe A (2004). "The coordination of signaling during Fc receptor-mediated phagocytosis", J Leukoc Biol 76 (6): 1093–103. doi:10.1189/jlb.0804439<br />
<br /><br /></p></li><br />
<li><br />
<p>3. Pan L, Pei P (2003). "Signaling transduction by IgG receptors". Chin Med J (Engl) 116 (4): 487–94.<br />
<br /><br /></p></li><br />
<li><br />
<p>4. Mueller-Loebnitz C, Ostermann H, Franzke A,Loeffler J, Uharek L, Topp M, and Einsel H: Immunological Aspects of Candida and Aspergillus Systemic Fungal Infections: Interdisciplinary Perspectives on Infectious Diseases, Volume 2013 (2013), Article ID 102934<br />
<br /><br /></p></li><br />
<li><p>5. Fani, M., et al., (2012), Radiolabeled peptides: valuable tools for the detection and treatment of cancer, <i>Theranostics</i>, 2(5).<br /><br /></p></li><br />
<li><p>6. Laverman, P., (2012), Radiolabelled peptides for oncological diagnosis, <i>Eur J Nucl Med Mol Imaging</i>, 39 (Suppl I).<br /><br /></p></li><br />
</ul><br />
<br />
<br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/project_overview/project_wetlab" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/project_overview/project_biobrick" class="button_next"><b>Next</b></a></div><br />
<br /><br />
<!-- end of right column--><br />
</div><br />
<br />
<br />
</div><br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/project_overview/project_wetlab
Team:Goettingen/project overview/project wetlab
2014-10-18T00:11:55Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/projectLP}}<br />
<html><br />
<body><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery-1-11-1?action=raw&type=text/js" type="text/javascript"></script><br />
<!-- main part of the subpage --><br />
<div id="subpage"> <br />
<br />
<br />
<!-- right column--><br />
<div class="proRP" id="rpart1"><br />
<div class="trans_zh"><a href="https://2014.igem.org/Team:Goettingen/project_overview/project_wetlab_ZH"><b>中文</b></a></div><br />
<h1 id="wetlab">Results: Wetlab</h1><br />
<br />
<br />
<h2 id="approach">Approach</h2><br />
<p>Our experimental approach can be summarized as follows:</p><br /><br />
<br />
<ol><br />
<li><p>1. Organisms and surface proteins selection</p></li><br />
<li><p>2. Surface protein amplification and cloning</p></li><br />
<li><p>3. Yeast two-hybrid assay with an existing peptide library</p></li><br />
<li><p>4. Peptide functionalization</p></li><br />
</ol><br />
<br />
<br /><br /><br />
<a href="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" target="1"><img id="graphic" src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" width="700" data-zoom-image="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" /></a><caption><br /><br /><br />
<br />
<h2 id="wlresults">Results summary</h2><br />
<br />
<p>We chose the five fungi <i>Aspergillus fumigatus</i>, <i>A. nidulans</i>, <i>Candida glabrata</i>, <i>C. albicans</i> and <i>Saccharomyces cerevisiae</i> as well as the parasite <i>Toxoplasma gondii</i> for our project. In the first step, we amplified all in all 35 different genes encoding surface proteins of the mentioned organisms in a standard PCR reaction (compare table 1). We were able to transform 20 of our 35 genes into a so called bait vector (contains a DNA-binding domain) and performed the Yeast-Two-Hybrid (Y2H) screening with them. Thereby, we accomplished to find more than 3000 probable interaction partners for our surface proteins. </p><br /><br /><br />
<br />
<p><b>Table 1| Selected surface proteins and the corresponding organism.</b></p></br></br><br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th>Gene</td><br />
<th>Organism</td><br />
</tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AJ010064.1" target="1"><i>mp65</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_716672.1" target="1"><i>tos1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NW_139623.1" target="1"><i>sim1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_712917.1" target="1"><i>als1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/U87956.1" target="1"><i>als3</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0H06413g" target="1"><i>ssr1</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr class="con"><td colspan="3">Click to expand</td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0I06160g " target="1"><i>pir4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0G00308g " target="1"><i>scw4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0M08492g " target="1"><i>pir3</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0C02211g " target="1"><i>utr2</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI45" target="1"><i>crf2full</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI46" target="1"><i>crf2act</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleno</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WNS8" target="1"><i>ecm33</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WGL5" target="1"><i>sun1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/P41746" target="1"><i>roda</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleex</i></a></td><td><i>A. fumigatus</i></td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WQ14" target="1"><i>prm1 b</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q8J0P4 " target="1"><i>crf1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB243112.1" target="1"><i>roda</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Z49892" target="1"><i>xlna</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_658391.1" target="1"><i>npc2</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_675875.1" target="1"><i>sho1</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/50952829" target="1"><i>eglc</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WG16" target="1"><i>eglc</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/D37975.1" target="1"><i>CWP1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001180025.1" target="1"><i>CWP2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001183428.1" target="1"><i>TIR4</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001178902.1" target="1"><i>TIR1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001182221.1" target="1"><i>MID2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB530985.1" target="1"><i>SED1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/FJ593880.1" target="1"><i>ama1</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY587208.1" target="1"><i>rom5</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY704175.1" target="1"><i>rom4</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr class="con"><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/DQ459452.2" target="1"><i>gra7</i></a></td><td><i>T. gondii</i></td></tr> <br />
<br />
</table></center><br /><br />
<br />
<script><br />
$('.con').click(function () {<br />
var $this = $(this);<br />
$(this).nextUntil('tr.con').slideToggle(100).promise().done(function () {<br />
$this.find('span').text(function (_, value) {<br />
return value == '-' ? '+' : '-'<br />
});<br />
});<br />
});</script><br />
<script><br />
$(document).ready(function(){$('.con').trigger('click');});</script><br />
<p>The results for all the genes we selected are summarized in this <a href="https://static.igem.org/mediawiki/2014/6/60/Goettingen2014-NumberS.pdf" target="1">file.</a></p><br />
<br />
<br />
<br /><br /><br />
<br />
<p>To exclude “false positive” interaction partners (e.g. caused by a very weak interaction) we picked grown colonies and transferred them onto plates with a selection medium that allows only yeast cells containing peptides with a strong affinity to our surface proteins to grow. After this procedure and several previous selection steps, we still had around 70% of our interaction partners from the first screening. </p><br /><br /><br />
<p>To have a manageable amount of samples, we chose 10 of the interaction partners (peptides) which we found in the Y2H screen for each of our 20 surface proteins and used them for further analysis. The cells containing the plasmids were plated on selection plates and the Y2H screen was repeated to finally confirm the interaction between one of our surface proteins and a specific peptide. This time, we used a robot to fasten up the screen and to be able to analyze a large number of possible interactions at the same time. <br /><br /><br />
<br />
<b>Interactions could be verified in 70% of all tested interaction partners! </b><br /><br /><br />
In the last step, we tested the interaction of our surface proteins and the peptides in <i>in vivo</i> experiments. Previously, we chose some of the peptides and sequenced them to get to know the sequence and to exclude the possibility that we isolated the same peptides in different samples. The sequences encoding the peptides were introduced into an over-expression vector for <i>E. coli</i>; thereby, we were able to get large amounts of our peptides which we called <i>PepTags</i> from then on. In the last step for the time being, we tested the fungi <i>A. fumigatus</i>, <i>A. nidulans</i> and <i>C. glabrata</i> with peptides, which are supposed to interact specific with one of their surface proteins<i> in vivo </i>using fluorescence microscopy. <br /><br /><br />
With the<i> in vivo </i>experiments we want to proof that the identified <i>PepTags</i> not only bind to their surface proteins in an Y2H screen, but also to living fungi. To visualize the fungal surface itself, we stained structures containing chitin and cellulose in the fungal cell wall with calcofluor (figure 1C and 2C). The first organism with whom the functionality of our system was tested was A. fumigatus and the <i>PepTag</i> No.13. Binding of this <i>PepTag</i> to the fungi was visualized with an antibody fused to a fluorescent molecule (Chromeo 488, figure 1A and 2A).</p> <br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/0/08/Goettingen2014-fm-fig1.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/9/99/Goettingen2014-fm-fig1.png" width="600"></a></center><br />
<center><p style="font-size=8px;"><b>Figure 1| Fluorescence microscopy of <i>Aspergillus fumigatus</i> hyphae.</b> This figure shows an A. fumigatus hyphae incubated with <i>PepTag</i>13, antibody and stained with calcofluor. Under light with a wavelength of 488 nm, the complexes containing <i>PepTag</i>13 and antibody show fluorescence. The excitation of calcofluor at a wavelength of 358 nm allows the identification of the hyphal surface (blue light). The second picture shows the hyphae in a bright field, while the merged picture demonstrates that the green fluorescence is located in the same area as the blue one.</p></center><br />
<br />
<br /><br />
<p>We were able to show that our peptide binds specifically to the surface of <i>A. fumigatus</i>, which is visualized by the green dots along the outer surface of the fungal cells. We also tested <i>PepTag</i> No.13 with <i>A. nidulans</i> (figure 2) but could not see any fluorescent signal. That means that our <i>PepTag</i> No.13 binds not only specific to the fungal surface, but also specific to the surface protein Sun1 of <i>A. fumigatus</i>. Moreover, we could show that the antibody cannot bind unspecific to the fungal surface when the <i>PepTag</i> is missing . For further information <a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab#week23">have a look at our lab-book.</a></p><br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/6/64/Goettingen2014-fm-fig2.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/f/ff/Goettingen2014-fm-fig2.png" width="600"></a></center><br />
<p><b><p style="font-size=8px;">Figure 2| Fluorescence microscope picture of an <i>Aspergillus nidulans</i> hyphae.</b> This figure shows an <i>A. nidulans</i> hyphae incubated with <i>PepTag</i> No.13, antibody and calcofluor. Upon irradiation with light of 488 nm, no fluorescence occurs (first picture). The excitation of calcofluor at a wavelength of 358 nm allows identification of the surface of the hyphae (blue light). The <i>PepTag</i> cannot bind to the surface of <i>A. nidulans</i> and seems to be specifically to the surface of <i>A. fumigatus.</i></p><br /><br /><br />
<br />
<p>Finally, it was possible to identify a small peptide which binds specific to the surface of fungal hyphae. Moreover this <i>PepTag</i> is specific for the chosen fungus.</p><br />
<br /><br />
<video width="640" height="390" autoplay><source src="https://static.igem.org/mediawiki/2014/b/b2/Goettingen2014-fm-3d.mp4" type="video/mp4">Your browser does not support the video tag.</video><br />
<br />
<br /><br /><br />
<!-- wetlab end--><br />
<!-- drylab start--><br />
<br />
<h1 id="drylab">Results: Dry lab</h1><br />
<br />
<h2 id="approach">Homology modelling</h2><br />
<p>We modeled the 3D structure of our peptide-containing scaffolds (domain B1 of protein G from <i>Staphylococcus aureus</i>) by homology modelling. We used the <a href="http://salilab.org/modeller/" target="1">Modeller library</a> to accomplish that; since the peptide is about 20-25 amino acids long, it can be modeled as a loop inside the B1 domain scaffold for which there are already a number of 3D structures available at the Protein Data Bank.</p><br />
<br /><br />
<br />
<br />
<a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" width="700" /></a><center><br /><p align = "justify">This is the general homology modeling procedure we followed. All peptides were cloned inside a scaffold (B1 domain of protein G from <i>Staphylococcus aureus</i>. The peptides were short enough to be modeled as an internal loop by loop refinement; these structures should only be considered as a working model, since we do not have direct crystallographic data. <a href="https://2014.igem.org/Team:Goettingen/notebook_drylab">A detailed procedure can be found in this link.</a></p></center><br /><br /><br />
<br />
<br />
<br /><h2 id="dlresults">Results summary</h2><br />
<h3>Protein G scaffold</h3><br />
<p>The table 2 is a summary of the models we generated for our peptides inside the protein G scaffold. Their main purpose is to give us an idea if the calculated energy profile matches our assumption that the peptide is being exposed to the exterior of the scaffold. These models are in no way definitive, since we lack direct crystalographic data. As can be seen, all the structures show two distinct domains: one for the protein G scaffold and the other for the peptide.</p><br /><br />
<br />
<p><b>Table 2| Homology modeling for the peptides in a protein G scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">Video</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<td style="font-size:80%;"><br />
<video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen2014-Prey3.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1e/Goettingen-Prey3-input.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.512</td><br />
<td style="font-size:70%;">-7053.966797</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/37/GoettingenPrey3-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f1/Goettingen2014-Prey4.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen-Prey4-1.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.468</td><br />
<td style="font-size:70%;">-7246.956055</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/0b/GoettingenPrey4-1-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f8/Goettingen2014-Prey5.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/86/Goettingen-Prey5.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.495</td><br />
<td style="font-size:70%;">-7501.071777</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/10/GoettingenPrey5-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/2/23/Goettingen2014-Prey13.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Prey13-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">K17-E42</td><br />
<td style="font-size:70%;">0.535</td><br />
<td style="font-size:70%;">-7729.056152</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/eb/GoettingenPrey13-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen2014-Prey15.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/7/77/Goettingen-Prey15-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.441</td><br />
<td style="font-size:70%;">-7685.998535</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/2/20/GoettingenPrey15-profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in blue.</b></p><br />
<br /><br />
<br />
<h3>GFP scaffold</h3><br />
<p>Table 3 shows the structures we generated for our peptides inside a GFP scaffold. In contrast to the models with the protein G scaffold, the GFP-peptide models show discontinuities.</p><br /><br />
<br />
<p><b>Table 3| Homology modeling for the peptides in a GFP scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">3D structure</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" width=100></a></td><br />
<br />
<br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8c/Prey3-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.43</td><br />
<td style="font-size:70%;">-26798.28125</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/4/4a/Prey3-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" target="1"><img src="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/89/Prey4-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.448</td><br />
<td style="font-size:70%;">-27891.212891</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/d/dd/GFP-aSsr1.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" target="1"><img src="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/b/bc/Prey5-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.483</td><br />
<td style="font-size:70%;">-26633.4375</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/3c/Prey5-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/09/Prey13-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">E103-E127</td><br />
<td style="font-size:70%;">0.404</td><br />
<td style="font-size:70%;">-27075.160156</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/a/a6/Prey13-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png"><img src="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png" target="1" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/ed/Prey15-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.413</td><br />
<td style="font-size:70%;">-26713.355469</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/00/Prey15-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in green.</b></p><br />
<br /><br />
<br />
<br />
<br />
<br /><br />
<br />
<br />
<br />
<br />
<hr><br />
<h2>References</h2><br />
<br /><br />
<ol><br />
<li><p>1. N. Eswar, M. A. Marti-Renom, B. Webb, M. S. Madhusudhan,<br />
D. Eramian, M. Shen, U. Pieper, A. Sali. Comparative Protein Structure<br />
Modeling With MODELLER. Current Protocols in Bioinformatics, John Wiley<br />
&amp; Sons, Inc., Supplement 15, 5.6.1-5.6.30, 2006.</p></li><br /><br />
<br />
<li><p>2. M.A. Marti-Renom, A. Stuart, A. Fiser, R. Sánchez,<br />
F. Melo, A. Sali. Comparative protein structure modeling of genes and genomes.<br />
Annu. Rev. Biophys. Biomol. Struct. 29, 291-325, 2000.</p></li><br /><br />
<br />
<li><p>3. A. Sali &amp; T.L. Blundell.<br />
Comparative protein modelling by satisfaction of spatial restraints. J.<br />
Mol. Biol. 234, 779-815, 1993.</p></li><br /><br />
<li><p>4. A. Fiser, R.K. Do, &amp; A. Sali.<br />
Modeling of loops in protein structures, Protein Science 9. 1753-1773,<br />
2000.</p></li><br /><br />
</ol><br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/project_overview/project" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/project_overview/perspectives" class="button_next"><b>Next</b></a></div><br />
<br /><br /><br /><br />
<!-- end of right column--><br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/project_overview/perspectives
Team:Goettingen/project overview/perspectives
2014-10-18T00:06:44Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/projectLP}}<br />
<html><br />
<body><br />
<!-- main part of the subpage --><br />
<div id="subpage"> <br />
<br />
<br />
<!-- right column--><br />
<div class="proRP" id="rpart1"><br />
<br />
<br />
<br />
<br />
<br />
<h1>Further perspectives</h1><br />
<br />
<p>We have attained two milestones as far as the applications of our project is concerned. First, the identification of peptides with an affinity to a specific fungal surface molecule and second, is the proof of principle that our selection scheme can be used to generate peptides with affinity to a molecule under scrutiny. Both milestones hold promise but before that, we would like to elaborate on the future scope of the first milestone since it bears relevance to medicine and healthcare.</p><br /><br />
<br />
<h2 id="diagnostics">Applications in Diagnostics</h2> <br /> <br />
<h3>Lowering costs</h3><br /><br />
<p>The attachment of a chemical moiety that emits a quantifiable signal (a <br />
<br />
fluorescent, enzymatic or luminiscent moiety) to our peptides can lead to an <br />
<br />
alternative diagnostic method to antibody and antibody fragments with the added <br />
<br />
benefit of the relative low cost of production and modification of small peptides. This cost reduction may <br />
<br />
help to spread this diagnostic tool to the markets of the developing world, where <br />
<br />
fungal infections have the largest mortality rates and where health care is <br />
<br />
largely affected by economic constraints. Moreover, if the peptides prove to have a high species-specificity, the diagnosis based on them may give more information for a proper therapy choice, potentially reducing the toxicity risks associated with the use of broad spectrum antimycotics.</p><br /><br />
<br />
<br />
<h3><i>In vivo</i> diagnosis and the potential of artificial selection</h3><br /><br />
<p>Short peptides are currently being used as diagnostic tools for certain kind <br />
<br />
of cancers. These peptides are naturally produced by humans <br />
<br />
and have their natural binding proteins in the surface of cells; however, they <br />
<br />
have been optimized to increase their half-life and their affinity towards their <br />
<br />
natural target, and they also have been modified with radionuclides that make it <br />
<br />
possible to detect the location of tumors cells where their binding proteins are <br />
<br />
overrepresented with PET or SECT imaging.</p><br /> <br />
<br />
<p>The most common isotopically labelled peptide used for diagnosisis a <sup>111</sup>In-labelled somatostatin analogue, known as OctreoScan<sup>TM</sup>, which is used to diagnose a variety of tumors. Other peptides under <br />
<br />
develompent are cholecystokinin/gastrin analogues, glucagon-like peptide-1, <br />
<br />
bombesin, chemokine receptor CXCR4 targeting peptides, RGD peptides, exendin, <br />
<br />
Substance P, LHRH, neurotensin, &alpha;-M2, &alpha;-M2H and VIP.</p> <br /><br />
<br />
<p>Following the same rationale, our artificially selected peptides can be modified and optimized to increase their binding affinity and their half-life. The peptides can then be tagged with radionuclides to enable the diagnosis by imaging techniques. The results of such a diagnostic method will give more information about the localization and spread of the fungal infection inside the patients body than any of the currently available diagnostic methods.</p><br /><br /><br />
<br />
<br /><br />
<br />
<h2 id="therapeutics">Therapeutic Applications</h1><br /> <br />
<br />
<br />
<p><br />
The peptides we developed have significant applications from a clinical standpoint: they can be modified with molecules that modulate the immune response against fungi and they can be attached to an anti-mycotic drug to increase specificity and potentially reduce the drug's adverse effects.</p><br />
<br />
<br />
<p><br />
We don't expect our peptides to be part of a one-drug therapy. Patients with invasive fungal infections are very often immunocompromised and measures have to be taken to strengthen their immune system for a therapy to be effective. As for the stimulation of the immune system in case of individuals with immunodeficiencies, the use of adjuvants (immune response enhancers) to augment the response is one strategy. In addition to this, natural immuno-modulatory molecules called cytokines (such as Interleukin-1 and Interferon-gamma) to stimulate the appropriate branches of the immune system can be employed as well. </p><br /><br />
<br />
<h3>Fungal Infections and the branches of the immune system that deal with them</h3><br /><br />
<br />
<p>It has been observed that individuals suffering from deficiencies in antibody and complement mediated cytotoxicity are less vulnerable to fungal infections than the ones suffering from phagocytic defects. Moreover, studies have shown that neutrophils are pivotal in fending off fungal infections. This is further supported by the fact that many cases of fungal infections were following a period of neutropenia (low neutrophil count in blood).</p> <br /><br />
<p>Two vital principles can be gathered from the aforementioned information:</p> <br /> <br />
<ul><br />
<li><p>- Phagocytes (especially neutrophils) play a very important role in the resolution (clearance) of the fungal infection.</li></p><br /><br />
<li><p>- Antibodies and the complement system are not that effective against fungal pathogens due to the surface of these pathogens being unsuitable to binding.</li></p><br /><br />
<br />
<p>As such, the modulation of these branches of the immune system should aid in the resolution of the disease. It is important to mention that since most patients suffering from invasive mycoses are immunocompromised and that there are different types of immunodeficiencies. Depending upon which branch is dysfunctional, an appropriate strategy of immunomodulation can be adopted.</p> <br /><br />
<br />
<br />
<p><br />
Our peptides is can bind to the fungal surface and they can be further modified using the Fc (constant) region of the IgG1 or IgG3 antibody subtype (IgG2a in mice). This region is important as it is recognized by the effector cells (neutrophils and macrophages) of the immune system and thereafter, leads to the death of the target cell. This way, not only can it bind to fungal pathogens but can also “draw attention” towards itself from the immune system. In addition to this, the constant region can also activate the complement cascade via the "classical" pathway. Essentially, this set-up functions as a modified antibody with an added bonus of greater affinity. </p> <br /><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br /><br />
<h3>Homing anti-fungal drugs to the site of infection</h3><br /><br />
<p>Anti-mycotics, such as amphotericin B and fluconazole have been used extensively to treat fungal infections. While they have been effective, they are more toxic to the human body than antibiotics that kill bacteria. This is due to the fact that bacteria are more dissimilar to humans than fungi are. As a result, it is relatively simpler to find targets for antibiotics than anti-mycotics. Simply but, the more we humans have in common with a pathogen, the greater is the difficulty in coming up with a drug that harms only one (in other words, there is a need for selective toxicity).</p><br />
<br /><br />
<p>Thus, yet another potential application of the novel peptides we developed is that they can act as “guides” to these molecules thereby reducing side-effects due to the drug in question.</p><br />
<br /><br />
<hr><br />
<h2>References</h2><br />
<br /><br /><br />
<ul><br />
<li><br />
<p>1. Raghavan M, Bjorkman P (1996). "Fc receptors and their interactions with immunoglobulins". Annu Rev Cell Dev Biol 12: 181–220.<br />
<br /><br /></p></li><br />
<li><br />
<p>2. Swanson J, Hoppe A (2004). "The coordination of signaling during Fc receptor-mediated phagocytosis", J Leukoc Biol 76 (6): 1093–103. doi:10.1189/jlb.0804439<br />
<br /><br /></p></li><br />
<li><br />
<p>3. Pan L, Pei P (2003). "Signaling transduction by IgG receptors". Chin Med J (Engl) 116 (4): 487–94.<br />
<br /><br /></p></li><br />
<li><br />
<p>4. Mueller-Loebnitz C, Ostermann H, Franzke A,Loeffler J, Uharek L, Topp M, and Einsel H: Immunological Aspects of Candida and Aspergillus Systemic Fungal Infections: Interdisciplinary Perspectives on Infectious Diseases, Volume 2013 (2013), Article ID 102934<br />
<br /><br /></p></li><br />
<li><p>5. Fani, M., et al., (2012), Radiolabeled peptides: valuable tools for the detection and treatment of cancer, <i>Theranostics</i>, 2(5).<br /><br /></p></li><br />
<li><p>6. Laverman, P., (2012), Radiolabelled peptides for oncological diagnosis, <i>Eur J Nucl Med Mol Imaging</i>, 39 (Suppl I).<br /><br /></p></li><br />
</ul><br />
<br />
<br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/project_overview/project_wetlab" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/project_overview/project_biobrick" class="button_next"><b>Next</b></a></div><br />
<br /><br />
<!-- end of right column--><br />
</div><br />
<br />
<br />
</div><br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/protocol_Plasmid_Con
Team:Goettingen/protocol Plasmid Con
2014-10-18T00:05:52Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/proLP}}<br />
<html><br />
<div class="proRP"><br />
<h3 id="rest_DNA">Restriction of DNA</h3><br />
<p>1. Use up to 1 µg of DNA in a 20 µl reaction volume. Add 1 µl enzyme, 2 µl 10x recommended buffer and add up to 20 µl water.<br /><br />
2. Incubate for at least 1 hour at 37°C (or enzyme specific temperature).<br /><br />
3. Following the incubation, add 1.5 µl SAP (shrimp alkaline phosphatase) to plasmid backbones for 5’‑dephosphorylation and incubate again at 37°C for 10-30 minutes.<br /><br />
4. Stop reaction by heat-inactivation at 65°C for 5 minutes.<br /><br /></p><br />
<br />
<h3 id="liga_DNA">Ligation of DNA fragments</h3><br />
<p>1. Measure the concentration of fragments which should be used for the ligation reaction.<br /><br />
2. Calculate the ratio between insert and backbone (1:1) using the following formula:<br /><br />
3. Pipette all things together. Use 2 µl of 10x T4 Ligation buffer (stored at -20°C, ATP containing) and at least 1 µl T4 ligase.<br /><br />
4. Incubate your reaction mix for 1 hour at room temperature or over night at 16°C.<br /><br />
5. Use at least 4 µl of the reaction mixture for transformation. (Previous purification of the ligation product can avoid false positive colonies!)<br /><br /></p><br />
<br />
<h3 id="BP">BP recombination reaction</h3><br />
<p>Perform a BP recombination reaction between an <i>attB</i>-flanked DNA fragment and an <i>attP</i>-containing donor vector to generate an entry clone: <br /><br />
1. Add the following components to a 1.5 ml microcentrifuge tube at room temperature and mix: <br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<i>attB-PCR</i> product&nbsp;&nbsp;&nbsp;&nbsp;0.6 μl<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;pDONR™ vector (supercoiled, 150 ng/μl) &nbsp;&nbsp;&nbsp;0.2 μl<br /><br />
2. Vortex BP Clonase™ enzyme mix briefly.Add 0.2 μl to the components above and mix well by vortexing briefly twice.<br /> 3. Immediately back into -80°C!<br /><br />
4. Incubate reaction at 25°C for 1 hour. <br /><br />
5. Add 2 μl of 2 μg/μl Proteinase K solution and incubate at 37°C for 10 minutes. <br /><br />
6. Transform competent <i>E. coli</i> and select for the appropriate antibiotic-resistant entry clones. <br /><br /><br />
</p><br />
<h3 id="LR">LR recombination reaction</h3><br />
<p><br />
Perform an LR recombination reaction between an <i>attL</i>-containing entry clone and an <i>attR</i>-containing destination vector to generate an expression clone:<br /><br />
1. Add the following components to a 1.5 ml microcentrifuge tube at room temperature and mix:<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Entry clone (supercoiled, 100-300 ng) &nbsp;&nbsp;&nbsp;0.6 μl<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Destination vector (supercoiled, 150 ng/μl) &nbsp;&nbsp;&nbsp;0.2 μl<br /><br />
2. Vortex LR Clonase™ enzyme mix briefly. Add 0.2 μl to the components above and mix well by vortexing briefly twice. <br /><br />
3. Immediately back into -80°C!<br /><br />
4. Incubate reaction at 25°C for 1 hour. <br /><br />
5. Add 2 μl of 2 μg/μl Proteinase K solution and incubate at 37°C for 10 minutes. <br /><br />
6. Transform competent <i>E. coli</i> and select for the appropriate antibiotic-resistant expression clones.<br /><br /><br />
</p><br />
<h3 id="seam_clone">SEAMLESS Cloning</h3><br />
<p><br />
1. Construct primers for the desired construct with 15 bp overhangs for homologous recombination later. <br /><br />
2. Amplify DNA fragments, purify them and measure concentration.<br /><br />
3. Calculate the amount of PCR product amount you need with the formula:<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<b>ng of insert = (2 x bp of insert x 100 (ng vector)) / bp of vector</b><br /><br />
4. Pipette 100 ng of vector and the calculated amount of insert together. Scale down the reaction from 20 µl to the smallest volume possible. <br /><br />
5. Add 5 fold buffer and last the 10 fold enzyme mix. <br /><br />
6. Incubate for 30 min at room temperature.<br /><br />
7. Cool the sample on ice for not more than 5 minutes.<br /><br />
8. Use the whole sample for transformation.<br /><br /><br />
</p><br />
<h3 id="LB">Peptide Library Construction</h3><br />
<p>Starting with GFP scaffolds (Denoted pRS 316-GFPM), random loop libraries were created. Randomized amino acids were inserted at Asp-102/Asp-103 and Glu-172/Asp-173 by using the NNK method in order to create the random loop libraries. NNK sequences in primers number 13 and 16 were used to create regions I and ӀӀӀ. After having randomized DNA sequences, these two regions were assembled with region ӀӀ which remained intact. In each of the amplification and extension steps, <a href="https://2014.igem.org/Team:Goettingen/protocol_PCR#Pfus_PCR"><i>Pfus</i> PCR protocol</a> was used. For the assembly of the three regions, a <a href="https://2014.igem.org/Team:Goettingen/protocol_PCR#Fusi_PCR">modified fusion PCR</a> was used. <br /><br /><br />
</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/Goettingen_peptide_library.png" width="350px"/></center><br /><br />
<p style="text-align:center"><b>Figure. Peptide Library Construction</b></p> <br /><br /><br />
<hr><br />
<br />
<h2>References </h2><br />
<p>Pavoor, Tej V., Yong Ku Cho, and Eric V. Shusta. "Development of GFP-based biosensors possessing the binding properties of antibodies." Proceedings of the National Academy of Sciences 106.29 (2009): 11895-11900.</p><br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/protocol_PCR" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/protocol_Plasmid_Tran" class="button_next"><b>Next</b></a></div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/project_overview/project_wetlab
Team:Goettingen/project overview/project wetlab
2014-10-18T00:01:17Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/projectLP}}<br />
<html><br />
<body><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery-1-11-1?action=raw&type=text/js" type="text/javascript"></script><br />
<!-- main part of the subpage --><br />
<div id="subpage"> <br />
<br />
<br />
<!-- right column--><br />
<div class="proRP" id="rpart1"><br />
<div class="trans_zh"><a href="https://2014.igem.org/Team:Goettingen/project_overview/project_wetlab_ZH"><b>中文</b></a></div><br />
<h1 id="wetlab">Results: Wetlab</h1><br />
<br />
<br />
<h2 id="approach">Approach</h2><br />
<p>Our experimental approach can be summarized as follows:</p><br /><br />
<br />
<ol><br />
<li><p>1. Organisms and surface proteins selection</p></li><br />
<li><p>2. Surface protein amplification and cloning</p></li><br />
<li><p>3. Yeast two-hybrid assay with an existing peptide library</p></li><br />
<li><p>4. Peptide functionalization</p></li><br />
</ol><br />
<br />
<br /><br /><br />
<a href="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" target="1"><img id="graphic" src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" width="700" data-zoom-image="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" /></a><caption><br /><br /><br />
<br />
<h2 id="wlresults">Results summary</h2><br />
<br />
<p>We chose the five fungi <i>Aspergillus fumigatus</i>, <i>A. nidulans</i>, <i>Candida glabrata</i>, <i>C. albicans</i> and <i>Saccharomyces cerevisiae</i> as well as the parasite <i>Toxoplasma gondii</i> for our project. In the first step, we amplified all in all 35 different genes encoding surface proteins of the mentioned organisms in a standard PCR reaction (compare table 1). We were able to transform 20 of our 35 genes into a so called bait vector (contains a DNA-binding domain) and performed the Yeast-Two-Hybrid (Y2H) screening with them. Thereby, we accomplished to find more than 3000 probable interaction partners for our surface proteins. </p><br /><br /><br />
<br />
<p><b>Table 1| Selected surface proteins and the corresponding organism.</b></p></br></br><br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th>Gene</td><br />
<th>Organism</td><br />
</tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AJ010064.1" target="1"><i>mp65</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_716672.1" target="1"><i>tos1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NW_139623.1" target="1"><i>sim1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_712917.1" target="1"><i>als1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/U87956.1" target="1"><i>als3</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0H06413g" target="1"><i>ssr1</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr class="con"><td colspan="3">Click to expand</td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0I06160g " target="1"><i>pir4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0G00308g " target="1"><i>scw4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0M08492g " target="1"><i>pir3</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0C02211g " target="1"><i>utr2</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI45" target="1"><i>crf2full</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI46" target="1"><i>crf2act</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleno</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WNS8" target="1"><i>ecm33</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WGL5" target="1"><i>sun1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/P41746" target="1"><i>roda</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleex</i></a></td><td><i>A. fumigatus</i></td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WQ14" target="1"><i>prm1 b</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q8J0P4 " target="1"><i>crf1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB243112.1" target="1"><i>roda</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Z49892" target="1"><i>xlna</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_658391.1" target="1"><i>npc2</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_675875.1" target="1"><i>sho1</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/50952829" target="1"><i>eglc</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WG16" target="1"><i>eglc</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/D37975.1" target="1"><i>CWP1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001180025.1" target="1"><i>CWP2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001183428.1" target="1"><i>TIR4</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001178902.1" target="1"><i>TIR1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001182221.1" target="1"><i>MID2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB530985.1" target="1"><i>SED1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/FJ593880.1" target="1"><i>ama1</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY587208.1" target="1"><i>rom5</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY704175.1" target="1"><i>rom4</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr class="con"><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/DQ459452.2" target="1"><i>gra7</i></a></td><td><i>T. gondii</i></td></tr> <br />
<br />
</table></center><br /><br />
<br />
<script><br />
$('.con').click(function () {<br />
var $this = $(this);<br />
$(this).nextUntil('tr.con').slideToggle(100).promise().done(function () {<br />
$this.find('span').text(function (_, value) {<br />
return value == '-' ? '+' : '-'<br />
});<br />
});<br />
});</script><br />
<script><br />
$(document).ready(function(){$('.con').trigger('click');});</script><br />
<p>The results for all the genes we selected are summarized in this <a href="https://static.igem.org/mediawiki/2014/6/60/Goettingen2014-NumberS.pdf" target="1">file.</a></p><br />
<br />
<br />
<br /><br /><br />
<br />
<p>To exclude “false positive” interaction partners (e.g. caused by a very weak interaction) we picked grown colonies and transferred them onto plates with a selection medium that allows only yeast cells containing peptides with a strong affinity to our surface proteins to grow. After this procedure and several previous selection steps, we still had around 70% of our interaction partners from the first screening. </p><br /><br /><br />
<p>To have a manageable amount of samples, we chose 10 of the interaction partners (peptides) which we found in the Y2H screen for each of our 20 surface proteins and used them for further analysis. The cells containing the plasmids were plated on selection plates and the Y2H screen was repeated to finally confirm the interaction between one of our surface proteins and a specific peptide. This time, we used a robot to fasten up the screen and to be able to analyze a large number of possible interactions at the same time. <br /><br /><br />
<br />
<b>Interactions could be verified in 70% of all tested interaction partners! </b><br /><br /><br />
In the last step, we tested the interaction of our surface proteins and the peptides in <i>in vivo</i> experiments. Previously, we chose some of the peptides and sequenced them to get to know the sequence and to exclude the possibility that we isolated the same peptides in different samples. The sequences encoding the peptides were introduced into an over-expression vector for <i>E. coli</i>; thereby, we were able to get large amounts of our peptides which we called „PepTags“ from then on. In the last step for the time being, we tested the fungi <i>A. fumigatus</i>, <i>A. nidulans</i> and <i>C. glabrata</i> with peptides, which are supposed to interact specific with one of their surface proteins<i> in vivo </i>using fluorescence microscopy. <br /><br /><br />
With the<i> in vivo </i>experiments we want to proof that the identified „PepTags“ not only bind to their surface proteins in an Y2H screen, but also to living fungi. To visualize the fungal surface itself, we stained structures containing chitin and cellulose in the fungal cell wall with calcofluor (figure 1C and 2C). The first organism with whom the functionality of our system was tested was A. fumigatus and the „PepTag“ No.13. Binding of this „PepTag“ to the fungi was visualized with an antibody fused to a fluorescent molecule (Chromeo 488, figure 1A and 2A).</p> <br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/0/08/Goettingen2014-fm-fig1.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/9/99/Goettingen2014-fm-fig1.png" width="600"></a></center><br />
<center><p style="font-size=8px;"><b>Figure 1| Fluorescence microscopy of <i>Aspergillus fumigatus</i> hyphae.</b> This figure shows an A. fumigatus hyphae incubated with „PepTag“13, antibody and stained with calcofluor. Under light with a wavelength of 488 nm, the complexes containing „PepTag“13 and antibody show fluorescence. The excitation of calcofluor at a wavelength of 358 nm allows the identification of the hyphal surface (blue light). The second picture shows the hyphae in a bright field, while the merged picture demonstrates that the green fluorescence is located in the same area as the blue one.</p></center><br />
<br />
<br /><br />
<p>We were able to show that our peptide binds specifically to the surface of <i>A. fumigatus</i>, which is visualized by the green dots along the outer surface of the fungal cells. We also tested „PepTag“ No.13 with <i>A. nidulans</i> (figure 2) but could not see any fluorescent signal. That means that our „PepTag“ No.13 binds not only specific to the fungal surface, but also specific to the surface protein Sun1 of <i>A. fumigatus</i>. Moreover, we could show that the antibody cannot bind unspecific to the fungal surface when the „PepTag“ is missing . For further information <a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab#week23">have a look at our lab-book.</a></p><br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/6/64/Goettingen2014-fm-fig2.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/f/ff/Goettingen2014-fm-fig2.png" width="600"></a></center><br />
<p><b><p style="font-size=8px;">Figure 2| Fluorescence microscope picture of an <i>Aspergillus nidulans</i> hyphae.</b> This figure shows an <i>A. nidulans</i> hyphae incubated with „PepTag“ No.13, antibody and calcofluor. Upon irradiation with light of 488 nm, no fluorescence occurs (first picture). The excitation of calcofluor at a wavelength of 358 nm allows identification of the surface of the hyphae (blue light). The “PepTag” cannot bind to the surface of <i>A. nidulans</i> and seems to be specifically to the surface of <i>A. fumigatus.</i></p><br /><br /><br />
<br />
<p>Finally, it was possible to identify a small peptide which binds specific to the surface of fungal hyphae. Moreover this „PepTag“ is specific for the chosen fungus.</p><br />
<br /><br />
<video width="640" height="390" autoplay><source src="https://static.igem.org/mediawiki/2014/b/b2/Goettingen2014-fm-3d.mp4" type="video/mp4">Your browser does not support the video tag.</video><br />
<br />
<br /><br /><br />
<!-- wetlab end--><br />
<!-- drylab start--><br />
<br />
<h1 id="drylab">Results: Dry lab</h1><br />
<br />
<h2 id="approach">Homology modelling</h2><br />
<p>We modeled the 3D structure of our peptide-containing scaffolds (domain B1 of protein G from <i>Staphylococcus aureus</i>) by homology modelling. We used the <a href="http://salilab.org/modeller/" target="1">Modeller library</a> to accomplish that; since the peptide is about 20-25 amino acids long, it can be modeled as a loop inside the B1 domain scaffold for which there are already a number of 3D structures available at the Protein Data Bank.</p><br />
<br /><br />
<br />
<br />
<a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" width="700" /></a><center><br /><p align = "justify">This is the general homology modeling procedure we followed. All peptides were cloned inside a scaffold (B1 domain of protein G from <i>Staphylococcus aureus</i>. The peptides were short enough to be modeled as an internal loop by loop refinement; these structures should only be considered as a working model, since we do not have direct crystallographic data. <a href="https://2014.igem.org/Team:Goettingen/notebook_drylab">A detailed procedure can be found in this link.</a></p></center><br /><br /><br />
<br />
<br />
<br /><h2 id="dlresults">Results summary</h2><br />
<h3>Protein G scaffold</h3><br />
<p>The table 2 is a summary of the models we generated for our peptides inside the protein G scaffold. Their main purpose is to give us an idea if the calculated energy profile matches our assumption that the peptide is being exposed to the exterior of the scaffold. These models are in no way definitive, since we lack direct crystalographic data. As can be seen, all the structures show two distinct domains: one for the protein G scaffold and the other for the peptide.</p><br /><br />
<br />
<p><b>Table 2| Homology modeling for the peptides in a protein G scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">Video</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<td style="font-size:80%;"><br />
<video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen2014-Prey3.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1e/Goettingen-Prey3-input.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.512</td><br />
<td style="font-size:70%;">-7053.966797</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/37/GoettingenPrey3-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f1/Goettingen2014-Prey4.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen-Prey4-1.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.468</td><br />
<td style="font-size:70%;">-7246.956055</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/0b/GoettingenPrey4-1-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f8/Goettingen2014-Prey5.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/86/Goettingen-Prey5.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.495</td><br />
<td style="font-size:70%;">-7501.071777</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/10/GoettingenPrey5-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/2/23/Goettingen2014-Prey13.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Prey13-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">K17-E42</td><br />
<td style="font-size:70%;">0.535</td><br />
<td style="font-size:70%;">-7729.056152</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/eb/GoettingenPrey13-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen2014-Prey15.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/7/77/Goettingen-Prey15-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.441</td><br />
<td style="font-size:70%;">-7685.998535</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/2/20/GoettingenPrey15-profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in blue.</b></p><br />
<br /><br />
<br />
<h3>GFP scaffold</h3><br />
<p>Table 3 shows the structures we generated for our peptides inside a GFP scaffold. In contrast to the models with the protein G scaffold, the GFP-peptide models show discontinuities.</p><br /><br />
<br />
<p><b>Table 3| Homology modeling for the peptides in a GFP scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">3D structure</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" width=100></a></td><br />
<br />
<br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8c/Prey3-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.43</td><br />
<td style="font-size:70%;">-26798.28125</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/4/4a/Prey3-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" target="1"><img src="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/89/Prey4-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.448</td><br />
<td style="font-size:70%;">-27891.212891</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/d/dd/GFP-aSsr1.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" target="1"><img src="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/b/bc/Prey5-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.483</td><br />
<td style="font-size:70%;">-26633.4375</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/3c/Prey5-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/09/Prey13-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">E103-E127</td><br />
<td style="font-size:70%;">0.404</td><br />
<td style="font-size:70%;">-27075.160156</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/a/a6/Prey13-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png"><img src="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png" target="1" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/ed/Prey15-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.413</td><br />
<td style="font-size:70%;">-26713.355469</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/00/Prey15-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in green.</b></p><br />
<br /><br />
<br />
<br />
<br />
<br /><br />
<br />
<br />
<br />
<br />
<hr><br />
<h2>References</h2><br />
<br /><br />
<ol><br />
<li><p>1. N. Eswar, M. A. Marti-Renom, B. Webb, M. S. Madhusudhan,<br />
D. Eramian, M. Shen, U. Pieper, A. Sali. Comparative Protein Structure<br />
Modeling With MODELLER. Current Protocols in Bioinformatics, John Wiley<br />
&amp; Sons, Inc., Supplement 15, 5.6.1-5.6.30, 2006.</p></li><br /><br />
<br />
<li><p>2. M.A. Marti-Renom, A. Stuart, A. Fiser, R. Sánchez,<br />
F. Melo, A. Sali. Comparative protein structure modeling of genes and genomes.<br />
Annu. Rev. Biophys. Biomol. Struct. 29, 291-325, 2000.</p></li><br /><br />
<br />
<li><p>3. A. Sali &amp; T.L. Blundell.<br />
Comparative protein modelling by satisfaction of spatial restraints. J.<br />
Mol. Biol. 234, 779-815, 1993.</p></li><br /><br />
<li><p>4. A. Fiser, R.K. Do, &amp; A. Sali.<br />
Modeling of loops in protein structures, Protein Science 9. 1753-1773,<br />
2000.</p></li><br /><br />
</ol><br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/project_overview/project" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/project_overview/perspectives" class="button_next"><b>Next</b></a></div><br />
<br /><br /><br /><br />
<!-- end of right column--><br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/notebook_wetlab/biobricks
Team:Goettingen/notebook wetlab/biobricks
2014-10-17T23:50:17Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery_collapsibleList?action=raw&type=text/js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
//hide the all of the element with class collapsibleListBody<br />
$(".collapsibleListBody").hide();<br />
//toggle the componenet with class collapsibleListBody<br />
$(".collapsibleListTitle").click(function(){<br />
$(this).next(".collapsibleListBody").slideToggle(100);<br />
});<br />
});<br />
</script><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Notebook</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/notebook_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/notebook_safety">Safety</a></li><br />
<li><a href="/Team:Goettingen/notebook_drylab">Dry lab</a></li><br />
<li><a href="/Team:Goettingen/notebook_wetlab">Wet lab</a><br />
<ul><br />
<li><a href="/Team:Goettingen/notebook_wetlab">PepTag Team</a></li> <br />
<li><a href="/Team:Goettingen/notebook_wetlab/biobricks">BioBrick Team</a></li><br />
<li><a href="/Team:Goettingen/notebook_wetlab/gfp">GFP Team</a></li><br />
</ul><br />
</li><br />
<li><a href="/Team:Goettingen/notebook_materials">Materials</a></li><br />
</ul><br />
</div><br />
<br />
<br />
<div class="proRP" id="BBWrap"><br />
<br /><h2>July</h2><br /><br />
<p><br />
- Used BioBricks from library:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/Goettingen_TableBB1.png" width="600" /><br />
- Tick with a tip a hole in plate and resolve the pellet in 10µl sterile water, red color was visible, pipeting up and down, wait 5 minutes and put 10 µl into a PCR cup and freeze it<br /><br />
- 1 µl is transformed into DH5α → plated on Cm or kan plates<br /><br />
- Transformation worked, pick colonies for o/n in LB + Cm to isolate BB-plasmids<br /><br />
- Isolation of plasmids<br /><br /><br />
<b>Agarose gel (1%):</b><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/Goettingen_FigureBB2.png" width="300" /><br />
<br /><br />
</p><br />
<br />
<h2>August</h2><br /><br />
<p><br />
<b>→After several tries to construct our BioBricks on the described way we changed to seamless cloning technique</b><br /><br /><br />
- PCRs for seamless cloning:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/6/63/Goettingen_TableBB2.png" width="650" /><br /><br />
<b>Agarose gels (1%):</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/Goettingen_FigureBB3.png" width="300" /><br />
<img src="https://static.igem.org/mediawiki/2014/c/c6/Goettingen_FigureBB4.png" width="300" /><br />
- Purification of the products and measurement of the concentration of each product.<br /><br />
- Amplification of Leu2, Trp1 and 2-micron with 2 sets of primers to create mutated genes that loose restriction sites:<br /><br /><br />
<br />
1. PCR to create for each gene 2 fragments that contain 15 bp overhangs to the other one.<br /><br />
2. Use fusion PCR approach to fuse genes with silent mution together.<br /><br />
3. Gel extract the rightly fused PCR product and use it in a normal PCR for amplification.<br /><br />
<img src="https://static.igem.org/mediawiki/2014/f/fb/Goettingen_FigureBB5.png" width="450" /><br />
- Purification and sequencing of this three samples <br /><br />
</p><br />
<br />
<br /><h2>September</h2><br /><br />
<p><br />
<b>- results sequencing:</b><br /><br /><br />
Trp1 AGGCCGCAGAATGTGCTCT<font color="#c33418"><b>G</b></font>GATTCCGATGCTGACTTGCT<br /><br />
Trp1*AGGCCGCAGAATGTGCTCT<font color="#c33418"><b>A</b></font>GATTCCGATGCTGACTTGCT<br /><br />
<br /><br />
Leu2 TGGTCCTAAATGGGGTAC<font color="#c33418"><b>C</b></font>GGTAGTGTTAGACCTGAACAA<br /><br />
Leu2*TGGTCCTAAATGGGGTAC<font color="#c33418"><b>A</b></font>GGTAGTGTTAGACCTGAACAA<br /><br />
<br /><br />
2-micron GAAGTTCCTATACTTTCTAG****AGAATAGGAACTTCGGAATAGGAACTTC<br /><br />
2-micron*GAAGTTCCTATACTTTCTAG<font color="#c33418"><b>CTAG</b></font>AGAATAGGAACTTCGGAATAGGAACTTC<br /><br />
<br /><br />
⇒ silent mutations delete the restriction sides<br /><br />
<br /><br />
- Prepare seamless mixture (see protocol and formula) with I – VI<br /><br />
- Transformation of the whole reaction sample into DH5α.<br /><br />
- Grown colonies on plates → pick several colonies and grow over night.<br /><br />
- Colony PCR with primer on backbone and primer in insert<br /><br />
- plasmid isolation of positives <br /><br />
<br /><br />
- Amplification of construct via PCR <br /><br />
<img src="https://static.igem.org/mediawiki/2014/f/f6/Goettingen_FigureBB1.png" width="250" /><br />
- Gel extraction & Purification & seamless cloning with A-F<br /><br />
- Transformation into DH5α<br /><br />
- Pick colonies and isolate plasmids from overnight culture<br /><br />
- colony PCR to verify construct<br /><br />
- restriction of the two different plasmids and the fusion product of 2-micron ligation over night of the 2-micron behind restriction site in plasmid backbones<br /><br />
- Transformation into DH5α.<br /><br />
- Pick several colonies into 4 mL LB +Cm for overnight cultures.<br /><br />
- Colony PCR and isolation of plasmids.<br /><br />
- Chose positives for further work and shipping to the registry<br /><br /><br />
<br />
</p><br />
<div><a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab/gfp" class="button_next"><b>Next</b></a></div><br />
</div><br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/notebook_wetlab
Team:Goettingen/notebook wetlab
2014-10-17T23:49:40Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
<br />
<html><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery_collapsibleList?action=raw&type=text/js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
//hide the all of the element with class collapsibleListBody<br />
$(".collapsibleListBody").hide();<br />
//toggle the componenet with class collapsibleListBody<br />
$(".collapsibleListTitle").click(function(){<br />
$(this).next(".collapsibleListBody").slideToggle(100);<br />
});<br />
});<br />
</script><br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Notebook</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/notebook_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/notebook_safety">Safety</a></li><br />
<li><a href="/Team:Goettingen/notebook_drylab">Dry lab</a></li><br />
<li><a href="/Team:Goettingen/notebook_wetlab">Wet lab</a><br />
<ul><br />
<li><a href="/Team:Goettingen/notebook_wetlab">PepTag Team</a></li><br />
<ul id="note_nav" style="padding-left:15px;"><br />
<li class="collapsibleListTitle" style="cursor:pointer; padding-left:30px;">October</li><br />
<ul class="collapsibleListBody"><br />
<li><a href="#week23">Week 23</a></li><br />
<li><a href="#week22">Week 22</a></li><br />
<li><a href="#week21">Week 21</a></li><br />
</ul><br />
<li class="collapsibleListTitle" style="cursor:pointer; padding-left:30px;" >September</li><br />
<ul class="collapsibleListBody"><br />
<li><a href="#week20">Week 20</a></li><br />
<li><a href="#week19">Week 19</a></li><br />
<li><a href="#week18">Week 18</a></li><br />
<li><a href="#week17">Week 17</a></li><br />
</ul><br />
<li class="collapsibleListTitle" style="cursor:pointer; padding-left:30px;">August</li><br />
<ul class="collapsibleListBody"><br />
<li><a href="#week16">Week 16</a></li><br />
<li><a href="#week15">Week 15</a></li><br />
<li><a href="#week14">Week 14</a></li><br />
<li><a href="#week13">Week 13</a></li><br />
<li><a href="#week12">Week 12</a></li><br />
</ul><br />
<li class="collapsibleListTitle" style="cursor:pointer; padding-left:30px;" >July</li><br />
<ul class="collapsibleListBody"><br />
<li><a href="#week11">Week 11</a></li><br />
<li><a href="#week10">Week 10</a></li><br />
<li><a href="#week9">Week 9</a></li><br />
<li><a href="#week8">Week 8</a></li><br />
</ul><br />
<li class="collapsibleListTitle" style="cursor:pointer; padding-left:30px;" >June</li><br />
<ul class="collapsibleListBody"><br />
<li><a href="#week7">Week 7</a></li><br />
<li><a href="#week6">Week 6</a></li><br />
<li><a href="#week5">Week 5</a></li><br />
<li><a href="#week4">Week 4</a></li><br />
</ul><br />
<li class="collapsibleListTitle" style="cursor:pointer; padding-left:30px;">May</li><br />
<ul class="collapsibleListBody"><br />
<li><a href="#week3">Week 3</a></li><br />
<li><a href="#week2">Week 2</a></li><br />
<li><a href="#week1">Week 1</a></li><br />
</ul><br />
</ul> <br />
<li><a href="/Team:Goettingen/notebook_wetlab/biobricks">BioBricks Team</a></li><br />
<li><a href="/Team:Goettingen/notebook_wetlab/gfp">GFP Team</a></li><br />
</ul><br />
</li><br />
<li><a href="/Team:Goettingen/notebook_materials">Materials</a></li><br />
</ul><br />
</div><br />
<div class="proRP" id="notebookWrap"><br />
<br />
<!--Template:<br />
<div id="week2"><br />
<h2>August 19th, week2</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br /></p><br />
</div><br />
<br />
note: team1 is for Candida albicans and Candida glabrata; team2 is for A. fumigatus and A. nidulans; team3 is for S. cerevisiae; team4 is for Toxoplasma gondii.<br />
--><br />
<br />
<br />
<div id="week23"><br />
<h2>October 13th, week 23</h2><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<br />
<b><i>A. fumigatus</i></b><br /><br />
- Results of robot Y2H:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/7/76/Goettingen_TableA14.png" width="500" /><br />
<b>(red color indicates a positive interaction, a blue colony. The grey color means that the result is not clear and it could possibly be a positive colony)</b><br /><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Growth and blue color indicates that there is an interaction between surface protein and the peptag.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ to verify the interaction we will select on the peptag-plasmids and isolate them and transfer them into strep-vector (pGP172) for over expression in BL21(DE3)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ the isolated protein is then used for <i>in vivo</i> studies<br /><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ More <i>in vivo</i> experiments with the interacting peptide of Sun1 from <i>A. fumigatus</i>.<br /><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Goettingen2014-fm-afumigatus.png" width="600" /><br />
<br /><br /><br />
<br />
<b><i>A. nidulans</i></b><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ <i>In vivo</i> experiment with the Sun1 interacting peptide from <i>A. fumigatus </i>with <i>A. nidulans </i>to prove that the peptide binds specifically to <i>A. fumigatus</i>.<br /><br />
<img src="https://static.igem.org/mediawiki/2014/1/1f/Goettingen2014-fm-anidulans.png" width="600" /><br />
<br />
<br />
<br />
<br />
<br /></p><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Results of the robot Y2H (see <i>Aspergillus</i>)<br /><br />
- New<i> in vivo </i>experiments with Ssr1<br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week22"><br />
<h2>October 6th, week 22</h2><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- Continue the robot Y2H: replicate colonies from selection medium to selection medium with X-α-Gal<br /><br />
<img src="https://static.igem.org/mediawiki/2014/8/8c/Goettingen_FigureA8.png" width="600" /><br />
- First<i> in vivo</i> experiment with the interacting peptide of Sun1 from <i>Aspergillus fumigatus Strep</i>MAB Classic conjugated with Chromeo<sup>TM</sup> 488 <br /><br /><br />
<b><i>A. nidulans</i></b><br /><br />
- Continue the robot Y2H (plate on to SC-LWH + 3mM 3-AT plates and X-α-gal plates)<br /><br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Continue the robot Y2H (plate on to SC-LWH + 3mM 3-AT plates and X-α-gal plates)<br /><br />
- <i>In vivo</i> test with<i> Candida glabrata ssr1</i> – k.o. strain → no fluorescence, due to too low protein concentrations (only worked for Sun1 from <i>Aspergillus fumigatus</i>)<br /><br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Continue the <a href="https://2014.igem.org/Team:Goettingen/protocol_Colony#Y2H_robot">robot Y2H</a> (plate on to SC-LWH + 3mM 3-AT plates and X-α-gal plates)<br />
<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Continue the robot Y2H (plate on to SC-LWH + 3mM 3-AT plates and X-α-gal plates)<br /><br />
<br /></p><br />
</div><br />
<div id="week21"><br />
<h2>September 29th, week 21</h2><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- Robot Y2H to confirm interaction<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Tested samples: AIG001, 02, 03, 04, 05, 06, 09, 10, 12, 13, 14, 15, 17, 19<br /><br />
- Grow AIG strains and isolated interaction partners (YIG strains) in selection medium over night at 30 °C<br /><br />
- Pipet grown colonies in 96 well plate (200 µl each)<br /><br />
<img src="https://static.igem.org/mediawiki/2014/5/57/Goettingen_TableA12.png" width="650" /><br />
- Preparation of robo-agar-plates<br /><br />
- Use AIG 96 well to stamp to -trp plates, YIG for - leu plates and incubate for 2 days at 30 °C<br /><br />
- Mating of grown colonies on YPAD plates<br /><br />
- Replicate colonies from YPAD to selection plates<br /><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/Goettingen_FigureA6.png" width="600" /><br />
- Replicate colonies from selction to selection medium<br /><br />
<img src="https://static.igem.org/mediawiki/2014/b/b0/Goettingen_FigureA7.png" width="600" /><br /><br />
<b><i>A. nidulans</i></b><br /><br />
- Robot Y2H to confirm interaction.<br /><br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Robot Y2H to confirm interaction (see <i>Aspergillus</i>)<br /><br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Inoculation of AIG021 + 22 and YIG021 + 22 for<a href="https://2014.igem.org/Team:Goettingen/protocol_Colony#Y2H_robot"> robot Y2H</a><br />
<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Inoculation of AIG025and YIG025 for robot Y2H<br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week20"><br />
<h2>September 22nd, week 20</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Dialysis of purificated proteins (see <i>Aspergillus</i>)<br /><br />
- Preparation for robot Y2H<br /><br />
<br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- Contamination on robot plates → Again<br /><br />
- Prepare 10x PBS buffer and medium for<i> in vivo</i> tests<br /><br />
- Boil dialysis tubes for 10 minutes and add EDTA. Cool them down and fill in proteins for dialysis. Dialyze overnight at 4 °C.<br /><br />
- Streak out AIG04 on SC - Trp, YIG04.1 and YIG04.2 on SC - Leu<br /><br />
- Prepare robot plates the robot Y2H<br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week19"> <br />
<h2>September 15th, week 19</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Purification of the peptides 3, 4.1, 4.2, 5 and 13<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;• 1 L LB inoculated at an OD600 of 0.2 → grown to 0.8, then expression is induced with 1mM IPTG<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;• After 3h: centrifuged at 5000rpm for 15 min at 4°C<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;• After solving in Buffer W the cells are disrupted by French press and centrifuged for 1h at 35.000 rpm and 4 °C<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;• The proteins are extracted via Strep-Tactin® columns <br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;• Samples were loaded onto an 12% SDS Gel<br /><br /><br />
SDS Gels (12%)<br /><br />
Strep 3:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/9/99/Goettingen_FigureC7.png" width="450" /><br />
⇒ There should be a clear band in the elutions steps for ~ 20 -22 kDa; for strep 3 is no such band<br /><br />
<br /><br />
Strep 4.1:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/8/8a/Goettingen_FigureC8.png" width="450" /><br />
⇒ No band of ~20-22 kDa in the elution steps for strep 4<br /><br />
<br /><br />
Strep 4.2:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/0/0f/Goettingen_FigureC9.png" width="450" /><br />
⇒ The right band can be seen in the elution steps, but it is not as strong as it should be<br /><br />
<br /><br />
Strep 5:<br /><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/b/b8/Goettingen_FigureC10.png" width="450" /><br />
<br />
⇒ The enlarged band in the elution steps has a size of ~ 15 kDa, which seems to be a little small for our peptide<br /><br />
<br /><br />
Strep 13:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_FigureC11.png" width="450" /><br />
⇒ For strep 13 the right bands of ~20-22 kDa can be seen in all lines, especially in the elution steps<br /><br />
<br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- Starting Seamless cloning mix, incubate at RT for 30 minutes, 4 minutes on ice and then <i>E. coli</i> transformation into TOP10 strain. Plating 200 µl and rest on cat plates.<br /><br />
- Determination of OD600 of strep cultures and inoculate 1 L LB + Amp to an OD of 0.2 and let them grow to an OD of 0.8 (approx. 1 h). Induction with 1 ml of 1 M IPTG and incubation at 180 rpm and 37 °C for 3 hours. Centrifugation in autoclaved bottles for 15 minutes at 5 krpm at 4 °C. Freeze pellets in -20 °C overnight.<br /><br />
- Preparing robot plates and distribute 200 µl of each cell culture <br /><br />
- Run spotting program on the robot. And incubate at 30 °C<br /><br />
- Pre-cool french press stuff in ice water. Pre-cool Buffer W and tips and columns in cold room at 4 °C. Resuspend each pellet in 15 ml ice cold Buffer W. Run french press as in the protocol. Centrifuge the disrupted cells at 4 °C for 1 h and 35.000 krpm. <br /><br />
- Prepare columns, Buffer E, Buffer R and pack each column with 1 ml streptacin 50 %. <br /><br />
- Run the supernatant from UZ over the columns. Save rest in falcon tubes from not purified, flow through. Save wash step 1- 4 elution step 1- 4 in labeled 1.5 ml Ecups. <br /><br />
- Prepare 4 SDS gels 12.0 % (Gels see <i>Candida</i>)<br /><br />
- Calculation of protein amount in CE and FT with Bradford.<br /><br />
- Y2H with robot to confirm interactions<br /><br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Repeat trafo in Y187<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Repeat trafo in Y187<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week18"><br />
<h2>September 8th, week 18</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- PCR for sequencing on strep-tag plasmids<br /><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/Goettingen_FigureC6.png" width="400" /><br />
- Purification and sequencing <br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Sequencing looks ok<br /><br />
- Test expression for peptides 3, 4.1, 4.2, 5, 13<br /><br />
SDS gels (12%)<br /><br />
Peptide 3:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_FigureC3.png" width="400" /><br />
Peptides 13 and 4.1:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/0/04/Goettingen_FigureC4.png" width="400" /><br />
Peptides 4.2 and 5:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/c/c4/Goettingen_FigureC5.png" width="400" /><br />
- Test expression looks good; nothing in negative control (NK)<br /><br />
- super-competent cells with iGEM protocol → see <i>Aspergillus</i><br /><br />
<br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- PCR with T7 primers for sequencing of 6 plasmid inserts (seqlab) → purification<br /><br />
- <b>NanoDrop:</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/4/46/Goettingen_TableA11.png" width="250" /><br />
- Pick colonies from strep plates inoculate over night culture. Inoculation over day culture to OD600 0.3. Prepare test expression <br /><br />
- Ligation of cut clean pGP172 (11ng/µl) with cc5, 9, 10 ,15<br /><br />
- Follow blunt end-ligation protocol: 20 µl sample included 2 µl PEG4000 1 µl T4 ligase<br /><br />
- Preparation of final robot Y2H<br /><br />
- Transformation into <i>E. coli</i> DH5α<br /><br />
- Sequences of Seqlab looks ok<br /><br />
- Test expression of 3, 4, 13<br /><br />
- Samples from test expression were filled up with 15 µl of SDS loading dye and boiled for 15 min at 95 °C. Loaded to SDS 12% PAGE. (Gels see<i> Candida</i>)<br /><br />
- Prepare comp. cells from TOP10 strain. Overnight culture was grown at 18°C for 19h OD600=0.395 → 1:1 dilution with 250 ml SOB for 1 h incubation at 18 °C. OD600 = 0.32, putted on ice and filled into prechilled 50 ml flasks. Followed the protocol. <br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Test the competence → worked very well!<br /><br /><br />
<br />
<b><i>A. nidulans</i></b><br /><br />
- prepare robot screening for 2st Y2H with the isolated plasmids out of the Y187 transformation<br /><br />
- 2st Y2H screening on plates - failed<br /><br />
<br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Pick colonies from<i> E. coli </i>plates and isolate plasmids<br /><br />
- Transformation of yeast (Y187)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo failed<br />
<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Pick colonies from E. coli plates and isolate plasmids<br /><br />
- Transformation of yeast (Y187)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo failed<br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week17"><br />
<h2>September 1st, week 17</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- New ligation of 4.1 (ssr1 interacting peptide) (see <i>Aspergillus</i>)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Test via PCR, if insert is in the vector (bigger fragment) → see <i>Aspergillus</i><br /><br /><br />
- Sequencing: again 10 + 15 (+ BP1)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Results: 10 and 15 are exactly the same interacting peptide<br /><br />
<br />
<br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- Measure DNA conc. pGP172 → 350ng/µl<br /><br />
- Use 1.000 ng for restriction. 16 µl mixture 4 µl buffer (Tango) 2 µl <i>Sma1</i> incubation for 120 minutes at 30 °C. Then add 2 µl of <i>BamH1</i> for more 2 h. dephosphorylation with SAP for additional 30 minutes. <br /><br />
- Measure OD of o/N culture Y187 (5.4) and AH109 (18.4). Inoculation of 50 ml YPAD 0.54 ml and 1.89 ml<br /><br />
- AH109 0.7 OD600 follow long term storage protocol. Freeze at -80°C there was no sorbitol inside<br /><br />
- purification of pGP172 - nanoDrop: 50ng<br /><br />
- Ligation over night at 16 °C<br /><br />
- cut pGP172 + fragments cc_number<br /><br />
- Inoculation of AH109/Y187 for storage cultures <br /><br />
- PCR with PIGY9 and 10 with IG099 and IG1003 <br /><br />
- Measure OD600 from o/N cultures; AH109 [12.9] and Y187 [12.1]. →use 0.78 ml and 0.82 ml of the strains to inoculate to an OD600 of 0.2. After 3 hours follow long term storage protocol<br /><br />
- Purification of PCR product from 9 and 10 <br /><br />
- Cut pIGY9 and 10 with<i> Hpa1</i> and <i>BamH1</i><br /><br />
<b>Agarose Gel (1%)</b><br />
<img src="https://static.igem.org/mediawiki/2014/0/05/Goettingen_FigureA3.png" width="300" /><br />
- Prep. of pGP172cut and clean: Sma1 and BamH1 - SAP 50 µl sample and purification<br /><br />
- Transformation of all ligations → nothing on plates <br /><br />
- Inoculation of BL21blue and pGP172.<br /><br />
- Restriction of pGP172 again for ligation of inserts. 1:1 ratio, Ligation with three inserts 3, 4.1 and 15. <br /><br />
- Transformation into DH5α.<br /><br />
- Growth on plates: Pick 10 colonies from each transformation plates grow over day 37°C with respective antibiotics and start plasmid isolation - stopped at 2-prop step over night [also pGP172 3x purification].<br /><br />
- New Oligos: Check PCR with T7p and T7t (52°) for strep<br /><br />
- PCR (12,5µl samples) with strep-4.1 and strep-NK(15/3?)<br /><br />
<b>Agarose Gels (1%):</b><br />
<img src="https://static.igem.org/mediawiki/2014/f/fd/Goettingen_FigureA4.png" width="450" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Bands in 3, 4, 5, 7, 8, 9 are positive<br /><br />
<img src="https://static.igem.org/mediawiki/2014/e/e9/Goettingen_FigureA5.png" width="450" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Bands in 4 and 8 are positive<br /><br />
- Inoculations from overnight culture a 500 ml flask with 50 ml LB and shake it till OD600 0.35 and follow fast comp. cell protocol. Use 2 µl from each plasmid and incubation over 2 days at 37°C.<br /><br />
<br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Spot positive clones on SC-LWH plates with 3mM 3-AT<br /><br />
- Wash cells from plates and isolate plasmids<br /><br />
- Transformation into DH5α<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Spot positive clones on SC-LWH plates with 3mM 3-AT<br /><br />
- Wash cells from plates and isolate plasmids<br /><br />
- Transformation into DH5α <br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week16"><br />
<h2>August 25th, week 16</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- PCR with Primers IG1003 and IG0099 → product that can be sequenced and cut with enzymes for strep tag plasmid insertion (samples of prey from 3, 13 and 15)<br /><br />
Agarose gel (1%):<br /><br />
<img src="https://static.igem.org/mediawiki/2014/9/96/Goettingen_Agar13.png" width="400" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Bands in lines 1, 2, 3, 4, 5 6, 9 and 11 have the right size and are first purified and then send for sequencing with Primer IG1003 (rev)<br /><br /><br />
- Prey samples of 3A.1, 3A.2, 3A.3, 3B.1, 3B.2, 13.3, 15 digested with<i> BamHI </i>and <i>HpaI</i><br /><br />
<img src="https://static.igem.org/mediawiki/2014/0/06/Goettingen_Agar14.png" width="350" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Clear difference between cut and uncut; also cut bands are very weak<br /><br /><br />
- Results of sequencing (3, 13, 15):<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 3A.1, 3A.2, 3A.3 are the same peptide<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 3B.1 and 3B.2: sequences are not useful<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 13.3 and 13.4: same peptide<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 9: one interacting peptide<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 10 + 15: same interacting peptide→?<br /><br />
- New test expression (see <i>Aspergillus</i>)<br /><br />
<br />
<br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- centrifuge 5 min at 13 krpm - freeze at -20 °C<br /><br />
- Preparation of Amp and Cm plates, streak out of used strains on Amp-plates<br /><br />
- SDS-gels prepared and stored in PLP 1x buffer at 4 °C<br /><br />
- staining of sds gel → empty<br /><br />
- PCR with fragments (3, 13, 15) (Agarose gel see <i>Candida</i>)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Purification of: 13.3 15 3.1A 3.2A 3.3A 3.1B 3.2B<br /><br />
- purified PCR products for restriction, ligation and transformation<br /><br />
- Preparation of 10 x PLP buffer and new SDS-gels <br /><br />
- Loading of 5 µl sample onto the gels→ expected size empty ~11.5 kDa<br /><br />
- New test expression at 30 °C and test also supernatant. <br /><br />
- Inoculation over night cultures of desired strains.<br /><br />
- Toxicity cannot be the case, Protein G subunit backbone was shown to hide this <br /><br />
- Streak out DB3.1 strains containing pDONR and pDEST<br /><br />
- Inoculation of over day cultures to OD600 of 0.1. Grow for 90 minutes at 30 °C<br /><br />
- Measure OD600 and take sample (safe also the supernatant)<br /><br />
- Add IPTG and take samples after 1, 2, 3 hours. <br /><br />
- Follow test expression protocol<br /><br />
- PCR with strep-tagged proteins T7 promotor / terminator<br /><br />
<b>Agarose Gel (1%):</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/9/9f/Goettingen_FigureA2.png" width="250" /><br />
- cut again pGP172 (520 ng and 1080 ng) with <i>Sma1</i> and <i>BamH1 </i>(Tango Buffer for 2 h) <br /><br />
- pick 5 different colonies from strep tagged inserts into DH5α → colony PCR<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ false inserts ☹ <br /><br />
- Transformation of ligation into DH5α<br /><br /><br />
<b><i>A.nidulans</i></b><br /><br />
- Repeat yest transformation in Y187 with the genes <i>rodA </i>and <i>npc2</i><br /><br />
- isolate plasmids <br /><br />
<br />
<br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Y2H in semi solid media with the two genes<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Y2H in semi solid media <br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week15"><br />
<h2>August 18th, week 15</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
PCR with different plasmid isolation samples for prey amplification (IG1003 and IG0099; 52,5 °C)<br /><br /><br />
<b>Agarose gel (1%):</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/0/06/Goettingen_Agar11.png" width="600" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Bands in all samples<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Purification and restriction with<i> HpaI</i> and <i>BamHI</i><br /><br /><br />
- Restriction of of 0,1 µl (14500ng/µl) pGP172 with <i>SmaI </i>and <i>BamHI</i> o/n 16°C<br /><br />
- ligation of cut cleaned PCR prey products with pGP172 (10ng/µl) 4µl of each with 1µl T4 Ligase in 20 µl sample<br /><br />
- Transformation into DH5α <br /><br />
- Again: plasmid isolation and PCR with T7 promotor and terminator primer on plasmids<br /><br /><br />
<b>Agarose gel (1%):</b><br /><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/Goettingen_Agar12.png" width="450" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ In lines 4 to 9 seems to be the right fragment; 2 and 3 are wrong<br /><br /><br />
- Transformation into BL21<br /><br />
- Test-expression of strep-tag strains: 4.1A, 4.1B, 5A, 5B, 14.5A, 14.5B, 14.8A, 14.8B<br /><br />
- Preparation of SDS gels<br /><br />
- PCR with Primers IG1003 and IG0099 → product that can be sequenced and cut with enzymes for strep tag plasmid insertion (samples of prey from 3, 13 and 15)<br /><br /><br />
<b>Agarose gel (1%):</b><br /><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/9/96/Goettingen_Agar13.png" width="500" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Bands in lines 1, 2, 3, 4, 5 6, 9 and 11 have the right size and are first purified and then send for sequencing with Primer IG1003 (rev)<br /><br /><br />
- Prey samples of 3A.1, 3A.2, 3A.3, 3B.1, 3B.2, 13.3, 15 digested with <i>BamHI</i> and <i>HpaI</i><br /><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/0/06/Goettingen_Agar14.png" width="500" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Clear difference between cut and uncut; also cut bands are very weak<br /><br /><br />
- Results of sequencing (3, 13, 15):<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 3A.1, 3A.2, 3A.3 are the same peptide<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 3B.1 and 3B.2: sequences are not useful<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 13.3 and 13.4: same peptide<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 9: one interacting peptide<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 10 + 15: same interacting peptide→?<br /><br /><br />
<br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- PCR from diff. plasmids for prey amplification 52,5 °C (Agarose Gel see <i>Candida</i>)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Worked for all<br /><br />
- Purification of prey pcr products, restriction with <i>HpaI</i> and <i>BamH1 </i><br /><br />
- restriction of 0.1 µl (14500 ng/µl) pGP172 with <i>Sma1</i> and <i>BamH1</i> o/n 16 °C<br /><br />
- ligation of cutted cleaned PCR prey products with pGP172 (10 ng/µl); 4 µl of each with 1 µl T4 Ligase in 20 µl sample<br /><br />
- PCR (100 µl vol) with sample 5 and 4.1 to increase amount of product<br /><br />
<b>Agarose gel(1%)</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/2/20/Goettingen_FigureA1.png" width="250" /><br />
- Transformation of strep-prey plasmids worked. over day cultures in LB at 42 °C for plasmid isolation and colony PCR<br /><br />
- Inoculation of<i> E. coli</i> BL21blue for fresh comp cell to transform strep plasmids<br /><br />
- pGP172 o/N 16 °C restriction compared with 0,1 µl and 1 µl non cut plasmid<br /><br />
- nothing in colony PCR<br /><br />
- pellets from over day cultures<br /><br />
- Plasmid isolation<br /><br />
<b>NanoDrop:</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Goettingen_TableA8.png" width="300" /><br />
- PCR with T7 promotor and terminator primer on plasmids (Agarose gel see <i>Candida</i>)<br /><br />
- LB medium, BL21 blue competent cells, transformation with plasmids<br /><br />
- Transformation of BL21blue with the plasmids worked <br /><br />
- Inoculation of 10 ml LB medium incubation for 2 h at 37 °C<br /><br />
- Take samples before induction and after 1 - 2 - 3 h [ 100/OD600 ]<br /><br />
<img src="https://static.igem.org/mediawiki/2014/3/3b/Goettingen_TableA9.png" width="350" /><br />
- centrifuged 5 min at 13 krpm → freeze at -20°C<br /><br />
- Preparation of Amp and Cm plates, streak out of used strains on Amp-plates<br /><br />
- SDS-gels prepared and stored in 1x PLP buffer at 4 °C<br /><br /><br />
<b><i>A. nidulans</i></b><br /><br />
- Repeat transformation of isolated plasmids out of the 1st Y2H experiment in <i>E. coli</i> DH5α <br /><br />
- Plasmid isolation out of <i>E. coli</i> DH5α <br /><br />
- NanoDrop:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/3/31/Goettingen_TableA10.png" width="300" /><br />
- Repeat transformation in Y187 on SC-Leu medium - failed<br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week14"><br />
<h2>August 11th, week 14</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Yeast Plasmid isolation of preys for: 01, 02, 06, 08, 12, 13, 15, 16 (pIGX)<br /><br /><br />
<b>NanoDrop:</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/9/92/Goettingen_Table7.png" width="300" /><br />
- Preparation of fresh competent cells<br /><br />
- <i>E. coli</i> Transformation: supercompetent cells and fresh competent cells are transformed with different plasmids (see table) <br /> <br />
- Results of <i>E. coli</i> transformation:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/0/09/Goettingen_Table8.png" width="400" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Plasmid isolation and transformation into Yeast Y187 → but no colonies<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. nidulans</i></b><br /><br />
- Repeat transformation in Y187 on SC-Leu medium - failed<br /><br />
- Repeat transformation in Y187 on SC-Leu medium- failed<br /><br />
- running out of isolated plasmids out of <i>E. coli</i> DH5α for Yeast transformation<br /><br />
<br />
<br /></p><br />
</div><br />
<br />
<div id="week13"><br />
<h2>August 4th, week 13</h2><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- O/N cultures from <i>E. coli</i> prey colonies to isolate plasmids again for restriction and ligation into pGP172<br /><br /><br />
<b><i>A. nidulans</i></b><br /><br />
- Transformation in <i>E. coli</i> DH5α <br /><br />
- Plasmid isolation out of<i> E. coli</i> DH5α <br /><br />
- Transformation in Y187 - failed<br /><br />
<br />
<br /></p><br />
<br />
</div><br />
<br />
<div id="week12"><br />
<h2>July 28th, week 12</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Yeast transformation (Y187) from preys of 01, 02, 02C, 03A+B, 06, 07, 13, 15, 16, 16C<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ no colonies for 02C, 06 and 16C<br /><br />
- Plasmid multiplication and isolation of prey plasmids from 04, 05, 09, 10, 14<br /><br /><br />
</p><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Yeast transformation (AH109) of pIGB22 and 21<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Yeast transformation (AH109)<br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week11"><br />
<h2>July 21st, week 11</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Evaluation of Sequencing:<br /><br />
- Bad/ not useful sequences: 9, 10, 14.1, 14.3, 14.4, 14.7, 4.2 (4.2→ new PCR necessary, wrong fragment)<br /><br />
- Peptides from: 4.1, 5, 14.5, 14.6, 14.8 (=14.10), 14.9<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- pick colonies = o/n cultures for plasmid isolation<br /><br />
- plasmid- prep. of pGP172 acc. to the protocol<br /><br /><br />
<b><i>A. nidulans</i></b><br /><br />
- 1st Y2H experiment with the genes rodA, xlnA, npc2, slno1 in semi solid medium - worked only for the plasmids pIGA17 (<i>rodA</i>) and pIGA19 (<i>npc2</i>)<br /><br />
- after growing the yeast colonies are washed from plates <br /><br />
- plasmid isolation <br /><br />
<br />
<br /></p><br />
</div><br />
<br />
<div id="week10"><br />
<h2>July 14th, week 10</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Confirmed interactions from <a href="https://2014.igem.org/Team:Goettingen/protocol_Colony#Y2H_robot">robot Y2H </a>are used for Plasmid isolation (prey): 4.1; 4.2; 5; 9; 10; 14.1; 14.3; 14.4; 14.5; 14.6; 14.7; 14.8; 14.9 and 14.10 + Isolation of interacting preys of AIG003, 07, 08, 12, 13<br /><br /><br />
- <b>NanoDrop</b> <br /><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/Goettingen_Table5.png" width="500" /><br />
- additional plasmid purification for sequencing of plasmids 4.1, 4.2, 5, 9, 10, 14.1<br /><br />
- all plasmids are used in a PCR with Primers IG1002 (1170_fwd) and IG1003(1170_rev) (56°C)<br /><br /><br />
<b>Agarose gel (1%):</b><br />
<img src="https://static.igem.org/mediawiki/2014/a/a3/Goettingen_Agar10.png" width="500" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ PCR products with IG1003 for sequencing (line 3→ fragment bigger than others, but also sequenced)<br /><br /><br />
- Transformation <i>E. coli</i> DH5α with 03, 07, 08, 12, 13<br /><br />
- Plasmid isolation of E. coli 02, 06, 15, 16, 2C, 16C<br /><br /><br />
<b>NanoDrop:</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/3/37/Goettingen_Table6.png" width="300" /><br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- Test of mated colonies from robot Y2H on X- α-gal plates<br /><br />
- 3rd Y2H: after spotting, wash colonies from plates and plasmid isolation<br /><br />
<br />
<br /></p><br />
</div><br />
<br />
<div id="week9"><br />
<h2>July 7th, week 9</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Plasmid isolation of prey interactions of 02, 06, 15, 16 and transformation into<i> E. coli</i> (Amp plates) <br /><br /><br />
- Another Y2H is performed with AIG004, 05, 09, 10, 14 and YIG04, 05, 09, 10, 14 to confirm the interactions we saw in the first Y2H (using a <a href="https://2014.igem.org/Team:Goettingen/protocol_Colony#Y2H_robot">robot</a>); testing on SC-LWH plates with 3mM 3-AT and X-α-Gal plates<br /><br /><br />
<br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- Plasmid isolation of the genes 02, 06, 15, 16<br /><br />
- <b>NanoDrop:</b><br />
<img src="https://static.igem.org/mediawiki/2014/2/23/Goettingen_TableA6.png" width="300" /><br />
- 3rd Y2H is performed with the strains AIG003, 07, 08, 12 and 13<br /><br />
Titerplates:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/9/91/Goettingen_TableA7.png" width="500" /><br />
- Robot Y2H with 04, 05, 09, 10, 14 (see <i>Candida</i>)<br /><br />
- Transformation of 02, 06, 15, 16 pool into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Only grown with single colonies → again with different concentrations<br /><br />
<br />
<br /></p><br />
</div><br />
<br />
<div id="week8"><br />
<h2>June 30th, week 8</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- 1st) Transformation in yeast: some colonies are grown, but not for all → tried transformation again<br /><br />
- Plasmid isolation and saving of prey strains on SC-L plates<br /><br />
- 2nd) Plasmid isolation from yeast for prey plasmids interacting with AIG002, AIG006, AIG015, AIG016 (pIGX plasmids)<br /><br />
- Transformation in DH5α → not successful (next week again)<br /><br />
- Third Y2H screening of AIG003 (<i>sim1</i>), 07 (<i>pir3</i>), 08 (<i>utr2</i>), 12(<i>ecm33</i>), 13 (<i>sun1</i>)<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus</i></b><br /><br />
- Yeast Trafo into Y187 again<br /><br />
- 2nd Y2H: Plasmid isolation for Transformation into <i>E. coli</i> (pIGZ)<br /><br />
- Safe prey interacting partners on SC-L<br /><br />
- Preparation of new AA mixture<br /><br /><br />
<br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Repeat LR reaction and transformation into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br />
- Cracking of <i>E. coli</i> cells → right plasmid in cells<br /><br />
- Plasmid isolation (2528,7 ng/µl)<br /><br />
<br />
<br /></p><br />
</div><br />
<br />
<div id="week7"><br />
<h2>June 23rd, week 7</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Spotting of second Y2H (AIG002 (<i>tos1</i>), 06 (<i>scw4</i>), 15 (<i>als3</i>), 16 (<i>rodA</i>)) (picture)<br /><br />
<img src="https://static.igem.org/mediawiki/2014/8/80/Gottingen_PlateC2.png" width="250" /><br />
<br />
<b>Figure: Different interacting and matted colonies are spotted onto the plate(Example)</b><br /><br /><br />
- 1st) Yeast colonies from first spotting are solved in water and centrifugated to pellets<br /><br />
- Isolation of plasmids from pellets (see <a href="/Team:Goettingen/protocol_Plasmid_Tran">protocol</a>) (pIGX plasmids)<br /><br />
- Transformation in DH5α (70 µl of pooled plasmid DNA plated on Amp-plates)<br /><br />
- Thin layer of <i>E. coli</i> cells are washed from plates with 1,5 ml of sterile water; centrifugation (4krpm, 5min), plasmid isolation (pIGY plasmids)<br /><br />
- Transformation into yeast (Y187) cells. Plated onto SC-L plates (YIG strains)<br /><br />
- 2nd) Yeast colonies from second spotting are solved in water and centrifugated to pellets → frozen<br /><br /><br />
<br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<i><b>A. fumigatus</b></i><br /><br />
- Preparation of yeast plasmid prep. Solutions P1, P2, and N3<br /><br />
- 1st Y2H: Yeast colonies are washed from plates; plasmid isolation, Transformation into<i> E. coli; E. coli</i> plasmid isolation and again transformation into yeast (Y187) (YIG strains) (see<i> Candida</i>)<br /><br />
- 2nd Y2H: yeast colonies are washed from plates and centrifuged to pellets → frozen<br /><br />
<br /><br />
<i><b>A. nidulans</b></i><br /><br />
- <i>E. coli</i> plasmid isolation of cells with LR product<br /><br />
- PCR on plasmids → no positives<br /><br />
- Repeat LR reactions and transformation<br /><br />
- Again plasmid isolation and PCR<br /><br />
<b>Agarose Gel </b>(1%):<br /><br />
<img src="https://static.igem.org/mediawiki/2014/1/10/Goettingen_gel4.png" width="550"/><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Right bands in: 1, 2, 4, 5, 6, 7, 8, 9, 16<br /><br />
- Plasmid isolation of all positive clones<br /><br /><br />
<br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- PCR on isolated plasmids<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Nothing on Gel<br /><br />
- LR reaction was repeated for <i>CWP1, CWP2, SED1, MID2</i><br /><br />
- Transformation of DH5 α <br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Worked for all, except<i> CWP1</i><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Cracking failed<br /><br />
- Colony PCR<br /><br />
- <b>NanoDrop:</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/6/61/Goettingen_nano_table8.png" width="450" /><br />
<br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- LR reaction and transformation into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo didn’t work<br /><br />
<br />
<br /></p><br />
</div><br />
<br />
<div id="week6"><br />
<h2>June 16th, week 6</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Second Y2H screening for (<i>tos1</i>), 06 (<i>scw4</i>), 15 (<i>als3</i>), 16 (<i>rodA</i>) (titerplates didn’t work)<br /><br />
- From first Y2H screening (AIG001, 04,05,09,10,14): 10 µl of each growing colony from semi solid medium is transferred into 100 µl of SC-LWH → 3µl spotted onto SC-LWH + 3mM 3-AT plates (picture) (rest: glycerol added and frozen) <br /><br />
<img src="https://static.igem.org/mediawiki/2014/3/32/Goettingen_Plate1.png" width="250" /><br />
<b>Figure: Colonies are growing inside the semi-solid medium</b> <br /><br /></p><br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<i><b>A. fumigatus</b></i><br /><br />
- Preparation for Y2H<br /><br />
- Second Y2H (see <i>Candida</i>) <br /><br />
- Spotting of colonies from first Y2H<br /><br /><br />
<i><b>A. nidulans</b></i><br /><br />
- Repeat LR reaction and Transformation in fresh competent DH5α cells<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br />
- Cracking<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ No positives → cracking may have failed<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Try with colony PCR → failed<br /><br /><br />
<br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Transformation of DH5α with LR product<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked for all, except<i> CWP2</i><br /><br />
- Cracking of the colonies<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ No positives<br /><br />
- Isolation of plasmids<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Repeat BP reaction and transformation into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br />
- <i>E. coli</i> cracking<br /><br />
<b>Agarose Gel (1%):</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/Goettingen_FigureT2.png" width="300" /><br />
- Plasmid isolation of <i>ama1 </i>(pIGA25); NanoDrop: 1308,3 ng/µl<br /><br />
<br /></p><br />
</div><br />
<br />
<div id="week5"><br />
<h2>June 9th, week 5</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- No growth on auto-activity plates<br /><br />
- Preparation of media for Y2H<br /><br />
- First Y2H screening (semi solid medium) of AIG001 (<i>mp65</i>); AIG004 (<i>ssr1</i>); AIG005 (<i>pir4</i>), AIG009 (<i>crf2full</i>); AIG010 (<i>crf2act</i>); AIG014 (<i>als1</i>); <br />
- Titerplates on SC-LW medium<br /><br /><br />
<b>Titerplates:<br /></b><br />
<img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_Table4.png" width="600" /> <br /><br />
</p><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<i><b>A. fumigatus</b></i><br /><br />
- LR reaction and transformation of pIGA11 and 13<br /><br />
- Transformation into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked!<br /><br />
- Transformation into Yeast AH109<br /><br />
- First Y2H of AIG09 and AIG10 (see <i>Candida</i> notebook)<br /><br />
<br /><br />
<i><b>A. nidulans</b></i><br /><br />
- Repeat BP reactions and transformation into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br />
- Cracking (see <i>Candida</i>)<br /><br />
- o/n cultures of positive clones<br /><br />
<b>Agarose Gel (1%) </b>of cracking:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/2/28/Goettingen_gel3.png" width="550" /><br />
- Plasmid isolation<br /><br />
- <b>NanoDrop</b>:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_nano_table4.png" width="400" /><br />
- LR reaction with the 4 plasmids<br /><br />
- Transformation into fresh competent DH5α cells<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo failed<br /><br /><br />
</p><br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Cracking for<i> CWP1, CWP2, SED1, MID2</i><br /><br />
<b>Agarose gel (1%): </b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/a/aa/Goettingen_gel6.png" width="550" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ All of the <i>E. coli </i>strains contain the right plasmid (band 4 is negative due to pipetting mistake)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Sample 2 of each gene was chosen for plasmid isolation<br /><br />
- <b>NanoDrop</b>:<br />
<img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_nano_table6.png" width="280" /><br />
- LR reactions<br /><br /><br />
<br />
</p><br />
</div><br />
<br />
<div id="week4"><br />
<h2>June 2nd, week 4</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- LR reactions with pDEST and pIGA-plasmids and Transformation into DH5α<br /><br />
- Transformation was successful → Cracking + 4 mL LB+ kan o/n cultures<br /><br /><br />
<b>Agarose gels (1%):</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/3/36/Goettingen_Agar6.png" width="500" /><br /><br />
- Samples 1 (mp65), 6 (tos1), 7(sim1), 11(ssr1), 13 (pir4) and 15 (scw4) are used for plasmid isolation.<br /><br />
<img src="https://static.igem.org/mediawiki/2014/7/78/Goettingen_Agar7.png" width="500" /><br /><br />
- Samples 2 (pir3), 4 (utr2), 6 (crf2 full), 9 (crf2 act) and 13 (ecm33) were used to isolate the plasmids. <br /><br />
- The samples from 10-12 (bglCno) were cracked again.<br /><br />
<img src="https://static.igem.org/mediawiki/2014/1/16/Goettingen_Agar8.png" width="500" /><br /><br />
- Samples 9 (als3) and 14 (eglC) are used to isolate the plasmids. The samples for sun1, als1 and rodA are cracked again.<br /><br />
- Cracking of each 3 samples of 11(bglEno), 13(sun1), 14(als1), 16(rodA)<br /><br /><br />
<b>Agarose gels (1%):</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/0/0a/Goettingen_Agar9.png" width="500" /><br /><br />
- Samples 9 (als1) and 12 (rodA) are used to isolate the plasmids. No results for bglEno and sun1 (<i>A. fumigatus</i>)<br /><br />
- Plasmid isolation<br /><br />
- <b>Nano-Drop results:</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/Goettingen_Table2.png" width="500"/><br /><br />
- Transformation in Yeast (AH109) → plated on SC-W plates<br /><br />
- Transformation worked → single colonies are streaked on SC-W and SC-HW +3mM 3AT (auto-activity test) plates<br /><br />
<img src="https://static.igem.org/mediawiki/2014/7/75/Goettingen_Table3.png" width="250"/><br />
</p><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
<b><i>A. fumigatus </i></b><br /><br />
- LR reaction with pDEST and pIGA- plasmids<br /><br />
- Transformation into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br />
- Validation of positive clones via<i> E. coli </i>cracking (from each plate 3 colonies) (pictures see <i>Candida</i>)<br /><br />
- 4 ml LB with kanamycin inoculated for positive clones<br /><br />
- Plasmid isolation (pIGB plasmids)<br /><br />
- <b>NanoDrop:</b> (pIGB11 and 13 were empty)<br /><br />
<img src="https://static.igem.org/mediawiki/2014/c/cd/Goettingen_nano_table3.png" width="300" /><br />
<br /><br />
- Yeast (AH109) transformation (AIG strains)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br />
- Test on autoinduction (His auxotrophy) on SC-HW + 3mM 3-AT <br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ No autoinduction (grid plate see<i> Candida</i> labbook)<br /><br />
<br /><br />
<b><i>A. nidulans</i></b><br /><br />
- Amplification of GOI (size) <br /> <br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ <i>A. nidulans</i>: <br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>rodA</i> (467 bp)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>xlnA</i> (749 bp)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>sho1</i> (934 bp)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>npc2</i> (627 bp)<br /><br />
<img src="https://static.igem.org/mediawiki/2014/f/f4/Goettingen_gel2.png" width="400" /><br />
- Purification of PCR products<br /><br />
- BP reaction into pDONR vector<br /><br />
- Transformation into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo failed<br /><br /><br /> <br />
<br />
</p><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team4"><i>T. gondii</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Amplification of the gene of interest via PCR:<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ <i>Toxoplasma: ama1 </i>(Annealing temperature) 54°C<br /><br />
<b>Agarose Gel(1%):</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/4/4d/Goettingen_FigureT1.png" width="300" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Purification of fragment. NanoDrop → 157,6 ng/µl<br /><br /><br />
- BP reaction and transformation into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo didn’t work<br /><br />
<br />
<br /></p><br />
</div><br />
<br />
<div id="week3"><br />
<h2>May 26th, week 3</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Transformation of BP reaction into fresh competent cells (50 µl+ rest)<br /><br />
- Transformation Efficienty test for supercompetent cells with iGEM kit (control with fresh competent cells)<br /><br />
&nbsp;&nbsp;&nbsp;⇒ Did not work → Kit is not useful !<br /><br /><br />
- Transformation of all BP reactions worked, except for als1 and als3<br /><br />
- 3 colonies from each transformation were picked and dissolved in 10 µl H2O. 5µl of this were used for cracking and 5 µl to incubate a 4 ml LB culture over day.<br /><br /><br />
<b>Agarose Gels:</b><br /><br />
Samples A (from each plasmid):<br /><br />
<img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_Agar2.png" width="600" /><br />
Samples B (from each plasmid):<br /><br />
<img src="https://static.igem.org/mediawiki/2014/8/86/Goettingen_Agar3.png" width="600" /><br />
Samples C (from each plasmid):<br /><br />
<img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_Agar4.png" width="600" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Plasmids can be found in almost all cultures → one positive culture for each plasmid was chosen and centrifuged (5 min, 5000rpm)<br /><br /><br />
- PCR for als1 and als3 were repeated: <br /><br />
<img src="https://static.igem.org/mediawiki/2014/1/1f/Goettingen_Agar5.png" width="500"/><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒1+3 purification (eluted in 70 µl H2O)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ <b>Nano Drop: </b><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 8,8 ng/µl<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 24,3 ng/µl<br /><br />
→ PCR product from first PCR for als1 and from second PCR for als3 were used for the BP reaction (+Trafo)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;- Plasmid isolation of the samples from <i>C. albicans</i>, <i>C. glabrata</i> and <i>A. Fumigatus</i> (see <a href="">protocol</a>) (o/n cultures)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;-<b> NanoDrop results:</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/3/31/Goettingen_Table1.png" width="600"/><br /><br />
</p><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- BP reactions of PCR products into pDONR207 and transformation into DH5α<br /><br />
- Transformation into<i> E. coli</i> DH5α cells<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br />
- Cracking of eight different colonies from each transformation (Agarose gel pictures see<i> Candida</i> notebook)<br /><br />
- 4 ml LB + gentamycin inoculated with positive clones<br /><br />
- Plasmid isolation (pIGA plasmids)<br /><br />
- <b>NanoDrop:</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_nano_table2.png" width="500"/><br /><br />
</p><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team3"><i>S. cerevisiae</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Amplification of the genes of interest via PCR:<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ <i>S. cerevisiae:</i> <br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<i>CWP1</i> (700 bp)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<i>CWP</i> (300 bp)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<i>TIR1</i> (800 bp)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<i>SED1</i> (1000 bp)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<i>TIR4</i> (1500bp)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<i>MID2</i> (1200 bp)<br /><br />
<b>Agarose Gel</b> (1%):<br /><br />
<img src="https://static.igem.org/mediawiki/2014/c/c1/Goettingen_gel5.png" width="550" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ 1,2,3,4,7,8,11,12 worked; 9 + 10 will be repeated because of the two separate bands<br /><br />
- Purification of right fragments<br /><br />
- <b>NanoDrop</b>:<br /><br />
<img src="https://static.igem.org/mediawiki/2014/5/56/Goettingen_nano_table5.png" width="280" /><br />
- BP reaction of <i>CWP1, CWP2, SED1, MID2</i><br /><br />
- Transformation into DH5α<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Trafo worked<br /><br />
- Repeat PCR for<i> TIR1</i> and<i> TIR4</i> fragments → no bands in agarose gel<br /><br /><br />
<br />
<br />
</p><br />
</div><br />
<br />
<div id="week2"><br />
<h2>May 19th, week 2</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Amplification of the genes of interest via PCR<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ <i>C. albicans: mp65, als1, tos1, sim1, als3</i><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ <i>C. glabrata: ssr1, pir4, scw4, pir3, utr2</i><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Annealing temperature: 56 °C<br /><br /><br />
- <b>Agarose Gel (1%):</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/3/3d/Goettingen_Agar1.png" width="600" /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Band 5 (als3) is a little bit weak → but PCR product is also purified and further used<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Purification of the PCR products with the Nucleo Spin® Gel and PCR Clean-up kit from Macherey-Nagel<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;⇒ Nano Drop Values were not useful<br /><br /><br />
- Preparation of supercompetent <i> E. coli</i> DH5α cells (see <a href="https://2014.igem.org/Team:Goettingen/protocol_Plasmid_Tran#E_comp">protocol</a>)<br /><br /><br />
- BP reaction of all genes (see <a href="https://2014.igem.org/Team:Goettingen/protocol_Plasmid_Con#BP">protocol</a>)<br /><br /><br />
</p><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Amplification of the genes of interest via PCR (→ Annealing Temperature)<br /><br />
⇒ <i>A. fumigatus: </i><br /> <br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>crf2</i> full (mature peptide AA: 21-416) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; (58°C)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>crf2</i> act (active side AA: 21-190) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; (56°C)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>bglE</i> no ( no GlcNAc outside AA: 594-908) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; (58°C)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>ecm33</i> ( active protein AA: 20-372) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; (58°C)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>sun1</i> (sequence between GlcNAc AA: 80-1133) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; (58°C)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>rodA</i> (AA: 19 – 159) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; (56°C)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>prm1</i> (extracellular AA: 419-603) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; (58°C)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>crf1 </i>(active side before GlcNac AA: 20-310) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; (58°C)<br /><br />
<br /><b>Agarose gel (1%):</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/1/1e/Goettingen_gel1.png" width="400" /><br />
⇒ Purification of the PCR products with the Nucleo Spin® Gel and PCR Clean-up kit from Macherey-Nagel<br /><br /><br />
</p><br />
</div><br />
<br />
<div id="week1"><br />
<h2>May 12th, week 1</h2><br />
<h4 class="collapsibleListTitle" id="lab_team1"><i>C. albicans & C. glabrata</i></h4><br />
<p class="collapsibleListBody" id="organ1"><br /><br />
- Test of supercompetent <i>E. coli</i> cells with the transformation efficiency kit (from iGEM) <br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;⇒ Did not work! No colonies<br /><br /><br />
- Got cDNA of <i>Candida albicans</i> and <i>Candida glabrata</i> from<a href="https://2014.igem.org/Team:Goettingen/team_acknowledges#ackn7"> Oliver Baders Lab</a>:<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>Candida albicans</i> strain SCS314<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <i>Candida glabrata</i> strain CBS138<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;⇒ Both high concentrations : dilution (10 µl DNA + 990 µl H2O)<br /><br /><br />
</p><br />
<br />
<h4 class="collapsibleListTitle" id="lab_team2"><i>A. fumigatus & A. nidulans</i></h4><br />
<p class="collapsibleListBody"><br /><br />
- Preparation of competent cells <i>E. coli</i> DB3.1 (mutated gyrase, resistant against ccdB) with CaCl2 (see <a href ="https://2014.igem.org/Team:Goettingen/protocol_Plasmid_Tran#E_comp">Protocol for fresh comp. cells</a>)<br /><br />
- Transformation with pDONR207 and pDEST (Plating of 50µl and rest on LB+ Cm plates, incubation over night at 37°C)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ⇒ Trafo worked! Single colonies in 4 ml LB + 4µl Cm<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ⇒ Also saving of the strains on plates<br /><br />
- Plasmid isolation with M&N Kit, Elution in 70µl dH2O<br /><br />
- <b>Nano Drop:</b><br /><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Goettingen_nano_table1.png" width="300"/><br /><br />
</p><br />
</div><br />
<br /><br /><br />
<div><a href="https://2014.igem.org/Team:Goettingen/notebook_drylab" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab/biobricks" class="button_next"><b>Next</b></a></div><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/project_overview/project_wetlab
Team:Goettingen/project overview/project wetlab
2014-10-17T23:38:09Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/projectLP}}<br />
<html><br />
<body><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery-1-11-1?action=raw&type=text/js" type="text/javascript"></script><br />
<!-- main part of the subpage --><br />
<div id="subpage"> <br />
<br />
<br />
<!-- right column--><br />
<div class="proRP" id="rpart1"><br />
<div class="trans_zh"><a href="https://2014.igem.org/Team:Goettingen/project_overview/project_wetlab_ZH"><b>中文</b></a></div><br />
<h1 id="wetlab">Results: Wetlab</h1><br />
<br />
<br />
<h2 id="approach">Approach</h2><br />
<p>Our experimental approach can be summarized as follows:</p><br /><br />
<br />
<ol><br />
<li><p>1. Organisms and surface proteins selection</p></li><br />
<li><p>2. Surface protein amplification and cloning</p></li><br />
<li><p>3. Yeast two-hybrid assay with an existing peptide library</p></li><br />
<li><p>4. Peptide functionalization</p></li><br />
</ol><br />
<br />
<br /><br /><br />
<a href="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" target="1"><img id="graphic" src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" width="700" data-zoom-image="https://static.igem.org/mediawiki/2014/a/a1/Goettingen-wetlabInfographic.jpg" /></a><caption><br /><br /><br />
<br />
<h2 id="wlresults">Results summary</h2><br />
<br />
<p>We chose the five fungi <i>Aspergillus fumigatus</i>, <i>A. nidulans</i>, <i>Candida glabrata</i>, <i>C. albicans</i> and <i>Saccharomyces cerevisiae</i> as well as the parasite <i>Toxoplasma gondii</i> for our project. In the first step, we amplified all in all 35 different genes encoding surface proteins of the mentioned organisms in a standard PCR reaction (compare table 1). We were able to transform 20 of our 35 genes into a so called bait vector (contains a DNA-binding domain) and performed the Yeast-Two-Hybrid (Y2H) screening with them. Thereby, we accomplished to find more than 3000 probable interaction partners for our surface proteins. </p><br /><br /><br />
<br />
<p><b>Table 1| Selected surface proteins and the corresponding organism.</b></p></br></br><br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th>Gene</td><br />
<th>Organism</td><br />
</tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AJ010064.1" target="1"><i>mp65</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_716672.1" target="1"><i>tos1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NW_139623.1" target="1"><i>sim1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_712917.1" target="1"><i>als1</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/U87956.1" target="1"><i>als3</i></a></td><td><i>C. albicans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0H06413g" target="1"><i>ssr1</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr class="con"><td colspan="3">Click to expand</td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0I06160g " target="1"><i>pir4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0G00308g " target="1"><i>scw4</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0M08492g " target="1"><i>pir3</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/CAGL0C02211g " target="1"><i>utr2</i></a></td><td><i>C. glabrata</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI45" target="1"><i>crf2full</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WI46" target="1"><i>crf2act</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleno</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WNS8" target="1"><i>ecm33</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WGL5" target="1"><i>sun1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/P41746" target="1"><i>roda</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WD56" target="1"><i>bgleex</i></a></td><td><i>A. fumigatus</i></td></tr><br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WQ14" target="1"><i>prm1 b</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q8J0P4 " target="1"><i>crf1</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB243112.1" target="1"><i>roda</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Z49892" target="1"><i>xlna</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_658391.1" target="1"><i>npc2</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/XM_675875.1" target="1"><i>sho1</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/50952829" target="1"><i>eglc</i></a></td><td><i>A. nidulans</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/Q4WG16" target="1"><i>eglc</i></a></td><td><i>A. fumigatus</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/D37975.1" target="1"><i>CWP1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001180025.1" target="1"><i>CWP2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001183428.1" target="1"><i>TIR4</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001178902.1" target="1"><i>TIR1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/NM_001182221.1" target="1"><i>MID2</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AB530985.1" target="1"><i>SED1</i></a></td><td><i>S. cerevisiae</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/FJ593880.1" target="1"><i>ama1</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY587208.1" target="1"><i>rom5</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/AY704175.1" target="1"><i>rom4</i></a></td><td><i>T. gondii</i></td></tr> <br />
<tr class="con"><td><a href="http://www.ncbi.nlm.nih.gov/nuccore/DQ459452.2" target="1"><i>gra7</i></a></td><td><i>T. gondii</i></td></tr> <br />
<br />
</table></center><br /><br />
<br />
<script><br />
$('.con').click(function () {<br />
var $this = $(this);<br />
$(this).nextUntil('tr.con').slideToggle(100).promise().done(function () {<br />
$this.find('span').text(function (_, value) {<br />
return value == '-' ? '+' : '-'<br />
});<br />
});<br />
});</script><br />
<script><br />
$(document).ready(function(){$('.con').trigger('click');});</script><br />
<p>The results for all the genes we selected are summarized in this <a href="https://static.igem.org/mediawiki/2014/6/60/Goettingen2014-NumberS.pdf" target="1">file.</a></p><br />
<br />
<br />
<br /><br /><br />
<br />
<p>To exclude “false positive” interaction partners (e.g. caused by a very weak interaction) we picked grown colonies and transferred them onto plates with a selection medium that allows only yeast cells containing peptides with a strong affinity to our surface proteins to grow. After this procedure and several previous selection steps, we still had around 70% of our interaction partners from the first screening. </p><br /><br /><br />
<p>To have a manageable amount of samples, we chose 10 of the interaction partners (peptides) which we found in the Y2H screen for each of our 20 surface proteins and used them for further analysis. The cells containing the plasmids were plated on selection plates and the Y2H screen was repeated to finally confirm the interaction between one of our surface proteins and a specific peptide. This time, we used a robot to fasten up the screen and to be able to analyze a large number of possible interactions at the same time. <br /><br /><br />
<br />
<b>Interactions could be verified in 70% of all tested interaction partners! </b><br /><br /><br />
In the last step, we tested the interaction of our surface proteins and the peptides in <i>in vivo</i> experiments. Previously, we chose some of the peptides and sequenced them to get to know the sequence and to exclude the possibility that we isolated the same peptides in different samples. The sequences encoding the peptides were introduced into an over-expression vector for <i>E. coli</i>; thereby, we were able to get large amounts of our peptides which we called „PepTags“ from then on. In the last step for the time being, we tested the fungi <i>A. fumigatus</i>, <i>A. nidulans</i> and <i>C. glabrata</i> with peptides, which are supposed to interact specific with one of their surface proteins<i> in vivo </i>using fluorescence microscopy. <br /><br /><br />
With the<i> in vivo </i>experiments we want to proof that the identified „PepTags“ not only bind to their surface proteins in an Y2H screen, but also to living fungi. To visualize the fungal surface itself, we stained structures containing chitin and cellulose in the fungal cell wall with calcofluor (figure 1C and 2C). The first organism with whom the functionality of our system was tested was A. fumigatus and the „PepTag“ No.13. Binding of this „PepTag“ to the fungi was visualized with an antibody fused to a fluorescent molecule (Chromeo 488, figure 1A and 2A).</p> <br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/0/08/Goettingen2014-fm-fig1.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/9/99/Goettingen2014-fm-fig1.png" width="600"></a></center><br />
<center><p style="font-size=8px;"><b>Figure 1| Fluorescence microscopy of <i>Aspergillus fumigatus</i> hyphae.</b> This figure shows an A. fumigatus hyphae incubated with „PepTag“13, antibody and stained with calcofluor. Under light with a wavelength of 488 nm, the complexes containing „PepTag“13 and antibody show fluorescence. The excitation of calcofluor at a wavelength of 358 nm allows the identification of the hyphal surface (blue light). The second picture shows the hyphae in a bright field, while the merged picture demonstrates that the green fluorescence is located in the same area as the blue one.</p></center><br />
<br />
<br /><br />
<p>We were able to show that our peptide binds specifically to the surface of <i>A. fumigatus</i>, which is visualized by the green dots along the outer surface of the fungal cells. We also tested „PepTag“ No.13 with <i>A. nidulans</i> (figure 2) but could not see any fluorescent signal. That means that our „PepTag“ No.13 binds not only specific to the fungal surface, but also specific to the surface protein Sun1 of <i>A. fumigatus</i>. Moreover, we could show that the antibody cannot bind unspecific to the fungal surface when the „PepTag“ is missing . For further information <a href="https://2014.igem.org/Team:Goettingen/notebook_wetlab#week23">have a look at our lab-book.</a></p><br /><br /><br />
<center><a href="https://static.igem.org/mediawiki/2014/6/64/Goettingen2014-fm-fig2.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/f/ff/Goettingen2014-fm-fig2.png" width="600"></a></center><br />
<p><b><p style="font-size=8px;">Figure 2| Fluorescence microscope picture of an <i>Aspergillus nidulans</i> hyphae.</b> This figure shows an <i>A. nidulans</i> hyphae incubated with „PepTag“ No.13, antibody and calcofluor. Upon irradiation with light of 488 nm, no fluorescence occurs (first picture). The excitation of calcofluor at a wavelength of 358 nm allows identification of the surface of the hyphae (blue light). The “PepTag” cannot bind to the surface of <i>A. nidulans</i> and seems to be specifically to the surface of <i>A. fumigatus.</i></p><br /><br /><br />
<br />
<p>Finally, it was possible to identify a small peptide which binds specific to the surface of fungal hyphae. Moreover this „PepTag“ is specific for the chosen fungus.</p><br />
<br /><br />
<video width="640" height="390" autoplay><source src="https://static.igem.org/mediawiki/2014/b/b2/Goettingen2014-fm-3d.mp4" type="video/mp4">Your browser does not support the video tag.</video><br />
<br />
<br /><br /><br />
<!-- wetlab end--><br />
<!-- drylab start--><br />
<br />
<h1 id="drylab">Results: Dry lab</h1><br />
<br />
<h2 id="approach">Homology modelling</h2><br />
<p>We modeled the 3D structure of our peptide-containing scaffolds (domain B1 of protein G from <i>Staphylococcus aureus</i>) by homology modelling. We used the <a href="http://salilab.org/modeller/" target="1">Modeller library</a> to accomplish that; since the peptide is about 20-25 amino acids long, it can be modeled as a loop inside the B1 domain scaffold for which there are already a number of 3D structures available at the Protein Data Bank.</p><br />
<br /><br />
<br />
<br />
<a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" target="1"><img src="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Drylab-graphic.jpg" width="700" /></a><center><br /><p align = "justify">This is the general homology modeling procedure we followed. All peptides were cloned inside a scaffold (B1 domain of protein G from <i>Staphylococcus aureus</i>. The peptides were short enough to be modeled as an internal loop by loop refinement; these structures should only be considered as a working model, since we do not have direct crystallographic data. <a href="https://2014.igem.org/Team:Goettingen/notebook_drylab">A detailed procedure can be found in this link.</a></p></center><br /><br /><br />
<br />
<br />
<br /><h2 id="dlresults">Results summary</h2><br />
<h3>Protein G scaffold</h3><br />
<p>The table 2 is a summary of the models we generated for our peptides inside the protein G scaffold. Their main purpose is to give us an idea if the calculated energy profile matches our assumption that the peptide is being exposed to the exterior of the scaffold. These models are in no way definitive, since we lack direct crystalographic data. As can be seen, all the structures show two distinct domains: one for the protein G scaffold and the other for the peptide.</p><br /><br />
<br />
<p><b>Table 2| Homology modeling for the peptides in a protein G scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">Video</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<td style="font-size:80%;"><br />
<video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/a/a1/Goettingen2014-Prey3.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1e/Goettingen-Prey3-input.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.512</td><br />
<td style="font-size:70%;">-7053.966797</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/37/GoettingenPrey3-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f1/Goettingen2014-Prey4.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/1b/Goettingen-Prey4-1.txt" target="1">Download</a></td><br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.468</td><br />
<td style="font-size:70%;">-7246.956055</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/0b/GoettingenPrey4-1-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/f/f8/Goettingen2014-Prey5.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/86/Goettingen-Prey5.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E44</td><br />
<td style="font-size:70%;">0.495</td><br />
<td style="font-size:70%;">-7501.071777</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/1/10/GoettingenPrey5-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/2/23/Goettingen2014-Prey13.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8e/Goettingen-Prey13-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">K17-E42</td><br />
<td style="font-size:70%;">0.535</td><br />
<td style="font-size:70%;">-7729.056152</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/eb/GoettingenPrey13-profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td><video width="120" poster="" autoplay><source src="https://static.igem.org/mediawiki/2014/1/1d/Goettingen2014-Prey15.ogg" type="video/ogg">Your browser does not support HTML5 video.</video><br />
</td><br />
<br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/7/77/Goettingen-Prey15-input.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">K17-E42</td><br />
<td style="font-size:70%;">0.441</td><br />
<td style="font-size:70%;">-7685.998535</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/2/20/GoettingenPrey15-profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in blue.</b></p><br />
<br /><br />
<br />
<h3>GFP scaffold</h3><br />
<p>Table 3 shows the structures we generated for our peptides inside a GFP scaffold. In contrast to the models with the protein G scaffold, the GFP-peptide models show discontinuities.</p><br /><br />
<br />
<p><b>Table 3| Homology modeling for the peptides in a GFP scaffold.</b></p></br></br> <br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th style="font-size:80%;">Peptide</th><br />
<th style="font-size:80%;">Video</th><br />
<th style="font-size:80%;">PDB</th><br />
<th style="font-size:80%;">Peptide location</th><br />
<th style="font-size:80%;">QMEAN score</th><br />
<th style="font-size:80%;">Overall DOPE score</th><br />
<th style="font-size:80%;">Energy profile</th><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 3</td><br />
<br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f5/GfpPrey3.png" width=100></a></td><br />
<br />
<br />
</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/8c/Prey3-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.43</td><br />
<td style="font-size:70%;">-26798.28125</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/4/4a/Prey3-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 4.1</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" target="1"><img src="https://static.igem.org/mediawiki/2014/6/62/GfpPrey4.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/8/89/Prey4-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.448</td><br />
<td style="font-size:70%;">-27891.212891</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/d/dd/GFP-aSsr1.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 5</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" target="1"><img src="https://static.igem.org/mediawiki/2014/a/a7/GfpPrey5.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/b/bc/Prey5-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.483</td><br />
<td style="font-size:70%;">-26633.4375</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/3/3c/Prey5-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 13</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" target="1"><img src="https://static.igem.org/mediawiki/2014/f/f3/GfpPrey13.png" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/09/Prey13-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;>">E103-E127</td><br />
<td style="font-size:70%;">0.404</td><br />
<td style="font-size:70%;">-27075.160156</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/a/a6/Prey13-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
<br />
<tr><br />
<td style="font-size:80%;">Prey 15</td><br />
<td style="font-size:80%;"><a href="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png"><img src="https://static.igem.org/mediawiki/2014/f/f7/GfpPrey15.png" target="1" width=100></a></td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/e/ed/Prey15-gfp.pdb.txt" target="1">Download</a></td><br />
<br />
<td style="font-size:80%;">E103-E127</td><br />
<td style="font-size:70%;">0.413</td><br />
<td style="font-size:70%;">-26713.355469</td><br />
<td style="font-size:70%;"><a href="https://static.igem.org/mediawiki/2014/0/00/Prey15-gfp.pdb.profile.txt" target="1">Download</a></td><br />
</tr><br />
</table></center><p style="font-size:10px"><b>*The peptide is shown in red and the scaffold in green.</b></p><br />
<br /><br />
<br />
<br />
<br />
<br /><br />
<br />
<br />
<br />
<br />
<hr><br />
<h2>References</h2><br />
<br /><br />
<ol><br />
<li><p>1. N. Eswar, M. A. Marti-Renom, B. Webb, M. S. Madhusudhan,<br />
D. Eramian, M. Shen, U. Pieper, A. Sali. Comparative Protein Structure<br />
Modeling With MODELLER. Current Protocols in Bioinformatics, John Wiley<br />
&amp; Sons, Inc., Supplement 15, 5.6.1-5.6.30, 2006.</p></li><br /><br />
<br />
<li><p>2. M.A. Marti-Renom, A. Stuart, A. Fiser, R. Sánchez,<br />
F. Melo, A. Sali. Comparative protein structure modeling of genes and genomes.<br />
Annu. Rev. Biophys. Biomol. Struct. 29, 291-325, 2000.</p></li><br /><br />
<br />
<li><p>3. A. Sali &amp; T.L. Blundell.<br />
Comparative protein modelling by satisfaction of spatial restraints. J.<br />
Mol. Biol. 234, 779-815, 1993.</p></li><br /><br />
<li><p>4. A. Fiser, R.K. Do, &amp; A. Sali.<br />
Modeling of loops in protein structures, Protein Science 9. 1753-1773,<br />
2000.</p></li><br /><br />
</ol><br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/project_overview/project" class="button_pre"><b>Previous</b></a><a href="https://2014.igem.org/Team:Goettingen/project_overview/perspectives" class="button_next"><b>Next</b></a></div><br />
<br /><br /><br /><br />
<!-- end of right column--><br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_gallery
Team:Goettingen/outreach gallery
2014-10-17T23:35:44Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/lightbox}}<br />
<br />
<html><br />
<head><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery-1.11.0.min.js?action=raw&type=text/js" type="text/javascript"></script><br />
<script src="https://2014.igem.org/Team:Goettingen/lightbox.min?action=raw&type=text/js" type="text/javascript"></script><br />
</head><br />
<body><br />
<br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2><center>Gallery</center></h2><br />
<!--Meet us in the lab--><br />
<br />
<div class="gallery_single_part" id="in_the_lab"><br />
<h3>Meet us in the lab!</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/4/4c/Goettingen_lab_photo0.jpg" data-lightbox="inTheLab" data-title="First day in the lab. Everything is well organised!" ><img src="https://static.igem.org/mediawiki/2014/b/b4/Goettingen_lab_photo0_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/10/Goettingen_lab_photo2.jpg" data-lightbox="inTheLab" data-title="Be careful of these materials"><img src="https://static.igem.org/mediawiki/2014/4/46/Goettingen_lab_photo2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/5d/Goettingen_lab_photo3.jpg" data-lightbox="inTheLab" data-title="All the buffers and mediums are well prepared."><img src="https://static.igem.org/mediawiki/2014/1/19/Goettingen_lab_photo3_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_lab_Photo15.jpg" data-lightbox="inTheLab" data-title="Fancy experiments"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_lab_Photo15.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/78/Goettingen_lab_photo10.jpg" data-lightbox="inTheLab" data-title="Cedric on the microscope"><img src="https://static.igem.org/mediawiki/2014/7/78/Goettingen_lab_photo10.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/6/6f/Goettingen_lab_photo8.jpg" data-lightbox="inTheLab" data-title="The whole team is working hard"><img src="https://static.igem.org/mediawiki/2014/6/6f/Goettingen_lab_photo8.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/7f/Goettingen_lab_photo9.jpg" data-lightbox="inTheLab" data-title="On the microscope"><img src="https://static.igem.org/mediawiki/2014/7/7f/Goettingen_lab_photo9.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/ff/Goettingen_lab_photo14.jpg" data-lightbox="inTheLab" data-title="Lab without iGEMers"><img src="https://static.igem.org/mediawiki/2014/f/ff/Goettingen_lab_photo14.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/70/Goettingen_lab_Photo16.JPG" data-lightbox="inTheLab" data-title="Shooting videos"><img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_lab_Photo16_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c1/Goettingen_lab_Photo17.JPG" data-lightbox="inTheLab" data-title="Our international marketing guy!"><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo17_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d7/Goettingen_lab_Photo18.JPG" data-lightbox="inTheLab" data-title="Dry lab work"><img src="https://static.igem.org/mediawiki/2014/7/72/Goettingen_lab_Photo18_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/71/Goettingen_lab_Photo19.JPG" data-lightbox="inTheLab" data-title="This is our way to communicate!"><img src="https://static.igem.org/mediawiki/2014/0/09/Goettingen_lab_Photo19_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b5/Goettingen_lab_Photo20.JPG" data-lightbox="inTheLab" data-title="Happy Rayan"><img src="https://static.igem.org/mediawiki/2014/1/17/Goettingen_lab_Photo20_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/eb/Goettingen_lab_Photo21.JPG" data-lightbox="inTheLab" data-title="Kamal is at work"><img src="https://static.igem.org/mediawiki/2014/e/e9/Goettingen_lab_Photo21_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/2d/Goettingen_lab_Photo22.JPG" data-lightbox="inTheLab" data-title="Samples on ice"><img src="https://static.igem.org/mediawiki/2014/3/3c/Goettingen_lab_Photo22_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/1c/Goettingen_lab_Photo23.JPG" data-lightbox="inTheLab" data-title="Our bench on a normal day"><img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_lab_Photo23_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e4/Goettingen_lab_Photo24.JPG" data-lightbox="inTheLab" data-title="Our hood"><img src="https://static.igem.org/mediawiki/2014/3/35/Goettingen_lab_Photo24_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/71/Goettingen_lab_Photo25.JPG" data-lightbox="inTheLab" data-title="Cedric and Anika are working in the cold room"><img src="https://static.igem.org/mediawiki/2014/8/8e/Goettingen_lab_Photo25_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b0/Goettingen_lab_Photo27.JPG" data-lightbox="inTheLab" data-title="Antique lab equipment"><img src="https://static.igem.org/mediawiki/2014/6/63/Goettingen_lab_Photo27_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/33/Goettingen_lab_Photo26.JPG" data-lightbox="inTheLab" data-title="Equipment for protein purification"><img src="https://static.igem.org/mediawiki/2014/3/34/Goettingen_lab_Photo26_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/17/Goettingen_lab_photo1.jpg" data-lightbox="inTheLab" data-title="iGEM 2014 DNA Distributions have shipped! and arrived!! Work can start! "><img src="https://static.igem.org/mediawiki/2014/3/34/Goettingen_lab_photo1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/38/Goettingen_lab_Photo34.jpg" data-lightbox="inTheLab" data-title="Bahar and Cedric preparing the film set "><img src="https://static.igem.org/mediawiki/2014/8/8b/Goettingen_lab_Photo34_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/8/8b/Goettingen_lab_Photo29.jpg" data-lightbox="inTheLab" data-title="Happy Bahar after winning one giant microbe"><img src="https://static.igem.org/mediawiki/2014/7/7e/Goettingen_lab_Photo29_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_lab_Photo30.jpg" data-lightbox="inTheLab" data-title="Julia and Karthi, another lucky winners!"><img src="https://static.igem.org/mediawiki/2014/b/ba/Goettingen_lab_Photo30_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/55/Goettingen_lab_Photo28.jpg" data-lightbox="inTheLab" data-title="Post-Synbio Day meeting"><img src="https://static.igem.org/mediawiki/2014/2/20/Goettingen_lab_Photo28_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e1/Goettingen_lab_Photo31.jpg" data-lightbox="inTheLab" data-title="iGEM army preparing for battle!"><img src="https://static.igem.org/mediawiki/2014/6/60/Goettingen_lab_Photo31_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/a1/Goettingen_lab_Photo33.jpg" data-lightbox="inTheLab" data-title="Video director at work…silence required!"><img src="https://static.igem.org/mediawiki/2014/b/b1/Goettingen_lab_Photo33_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/1c/Goettingen_lab_Photo23.JPG" data-lightbox="inTheLab" data-title="iGEM time… at 2 am!"><img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_lab_Photo23_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo32.jpg" data-lightbox="inTheLab" data-title="###"><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo32.jpg" width="120px"></a></li><br />
<br />
</ul><br />
<br /><br /><br />
</div><br />
<!-- Meetup in München --><br />
<div class="gallery_single_part" id="trip_in_Munich"><br />
<h3>Meetup in Munich</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/aa/CAS_meetupLMU_group2.jpg" data-lightbox="meeupLMU" data-title="The german iGEMers are gathering together in the University Munich!"><img src="https://static.igem.org/mediawiki/2014/a/ad/Goettingen_meetupLMU0_reduced.jpg" ></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/28/Goettingen_meetupLMU1.jpg" data-lightbox="meeupLMU" data-title="Julia is presenting our project!"><img src="https://static.igem.org/mediawiki/2014/0/09/Goettingen_meetupLMU1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/72/Goettingen_meetupLMU5.jpg" data-lightbox="meeupLMU" data-title="Nice smile, Lara :)"><img src="https://static.igem.org/mediawiki/2014/3/35/Goettingen_meetupLMU5_reduced.jpg" ></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/3d/Goettingen_meetupLMU6.jpg" data-lightbox="meeupLMU" data-title="A wonderful trip in Munich!"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_meetupLMU6_reduced.jpg" width="120"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<!-- SynBio Day --><br />
<div class="gallery_single_part" id="SynBioDay"><br />
<h3>SynBio Day</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_SynBioDay1.jpg" data-lightbox="SynBioDay" data-title="Our SynBioDay in Göttingen"><img src="https://static.igem.org/mediawiki/2014/2/2e/Goettingen_SynBioDay1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/be/Goettingen_SynBioDay7.jpg" data-lightbox="SynBioDay" data-title="Winners of the lottery"><img src="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_SynBioDay7_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_SynBioDay8.jpg" data-lightbox="SynBioDay" data-title="Another winner"><img src="https://static.igem.org/mediawiki/2014/9/9b/Goettingen_SynBioDay8_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/0d/Goettingen_SynBioDay2.jpg" data-lightbox="SynBioDay" data-title="Göttingens pedestrian zone"><img src="https://static.igem.org/mediawiki/2014/e/ed/Goettingen_SynBioDay2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_SynBioDay3.jpg" data-lightbox="SynBioDay" data-title="Friends visit us "><img src="https://static.igem.org/mediawiki/2014/3/39/Goettingen_SynBioDay3_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/27/Goettingen_SynBioDay4.jpg" data-lightbox="SynBioDay" data-title="Anika in a conversation"><img src="https://static.igem.org/mediawiki/2014/2/2a/Goettingen_SynBioDay4_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f5/Goettingen_SynBioDay5.jpg" data-lightbox="SynBioDay" data-title="Shantal is talking about our project"><img src="https://static.igem.org/mediawiki/2014/f/f2/Goettingen_SynBioDay5_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_SynBioDay10.jpg" data-lightbox="SynBioDay" data-title="Another interesting conversation"><img src="https://static.igem.org/mediawiki/2014/6/65/Goettingen_SynBioDay10_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/19/Goettingen_SynBioDay6.jpg" data-lightbox="SynBioDay" data-title="More talks"><img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_SynBioDay6_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/0c/Goettingen_SynBioDay9.jpg" data-lightbox="SynBioDay" data-title="Lara in a talk"><img src="https://static.igem.org/mediawiki/2014/a/a9/Goettingen_SynBioDay9_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/3a/Goettingen_SynBioDay11.jpg" data-lightbox="SynBioDay" data-title="Informing people about Synthetic Biology"><img src="https://static.igem.org/mediawiki/2014/5/5a/Goettingen_SynBioDay11_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e6/Goettingen_SynBioDay12.jpg" data-lightbox="SynBioDay" data-title="iGEM Goettingen being broadcasted by Stadtradio Göttingen "><img src="https://static.igem.org/mediawiki/2014/5/54/Goettingen_SynBioDay12_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/5a/Goettingen_SynBioDay13.jpg" data-lightbox="SynBioDay" data-title="Conversation"><img src="https://static.igem.org/mediawiki/2014/d/de/Goettingen_SynBioDay13_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f1/Goettingen_SynBioDay14.jpg" data-lightbox="SynBioDay" data-title="Our stand"><img src="https://static.igem.org/mediawiki/2014/3/30/Goettingen_SynBioDay14_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/79/Goettingen_SynBioDay15.jpg" data-lightbox="SynBioDay" data-title="Lara in action"><img src="https://static.igem.org/mediawiki/2014/7/74/Goettingen_SynBioDay15_reduced.jpg"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<br />
<!-- GZMB Symposium 2014 --><br />
<div class="gallery_single_part" id="GZMB"><br />
<h3>GZMB Symposium 2014</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/26/Goettingen_Presenters.jpg" data-lightbox="GZMBSym" data-title="Julia tells about iGEM"><img src="https://static.igem.org/mediawiki/2014/5/51/Goettingen_Presenters_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/05/Goettingen_Mr_Moderator.jpg" data-lightbox="GZMBSym" data-title="Joanan presenting our most wanted enemies!"><img src="https://static.igem.org/mediawiki/2014/4/43/Goettingen_Mr_Moderator_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_Mr_CoffeeHuger.jpg" data-lightbox="GZMBSym" data-title="Mr_CoffeeHuger"><img src="https://static.igem.org/mediawiki/2014/9/97/Goettingen_Mr_CoffeeHuger_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b0/Goettingen_BBQ_after.jpg" data-lightbox="GZMBSym" data-title="Our BBQ after the presentation"><img src="https://static.igem.org/mediawiki/2014/9/94/Goettingen_BBQ_after_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d3/Goettingen_GZMB1.jpg" data-lightbox="GZMBSym" data-title="Cheers!!!"><img src="https://static.igem.org/mediawiki/2014/8/81/Goettingen_GZMB1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/10/Goettingen_GZMB2.jpg" data-lightbox="GZMBSym" data-title="Cake is being translated!!!"><img src="https://static.igem.org/mediawiki/2014/7/7c/Goettingen_GZMB2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_GZMB3.jpg" data-lightbox="GZMBSym" data-title="Getting ready for the coffee break"><img src="https://static.igem.org/mediawiki/2014/2/2b/Goettingen_GZMB3_reduced.jpg"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/project_overview
Team:Goettingen/project overview
2014-10-17T23:30:28Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/projectLP}}<br />
<html><br />
<body><br />
<br />
<br />
<br />
<!-- main part of the subpage --><br />
<div id="subpage"> <br />
<!-- left column--><br />
<br />
<!-- use the projectLP link--><br />
<br />
<!-- end of left column--><br />
<br />
<!-- right column--><br />
<div class="proRP" id="rpart1"><br />
<div class="trans_zh"><a href="https://2014.igem.org/Team:Goettingen/project_overview_ZH"><b>中文</b></a></div><br />
<h1>Background</h1><br />
<h2 id="burden">The global burden of fungal infections</h2><br /><br /><br />
<p>Fungal pathogens are a major public health threat with significant global effects which, surprisingly, are not being addressed as they should. Globally, invasive fungal infections take around 1.5 million lives, and the number of people who die each year from the top 10 invasive fungal diseases is at least equal to those dying from tuberculosis or malaria. Moreover, the mortality rate of invasive fungal infections is usually greater than 50%.</p><br><p>In contrast, funding for medical mycology is highly underrepresented, accounting for 1.4-2.5% of the total of what the Welcome Trust, the U.K. Medical Research Council and the U.S. National Institutes of Health spent in the last 5 years. This under-representation could be just an effect of the number of applications for funding in the area, but even so, the need for an increased awareness and engagement by funding institutions and researchers is no less urgent: the development of new diagnostic and therapeutic tools is critical to improve the situation of high-risk patients.</p><br /><br />
<br />
<p>The most common fungal infections are superficial skin, nails and mucosal infections, which are caused in most cases by fungi of the genus <i>Candida</i>. These infections are usually not life threatening and have such common manifestations as athlete's foot and vulvovaginal candidiasis.</p><br />
<br /><p>Invasive fungal infections, on the other hand, have unacceptably high mortality rates. Patients with a compromised immune system -such as AIDS patients and post-transplantation patients taking immunosuppresants- are at special risk as they do not have the usual barriers that prevent invasive infections in healthy individuals.</p><br /><br />
<p>According to Brown <i>et al</i>., (2012), more than 90% of the reported deaths caused by fungi are associated with species from four genera: <i>Cryptococcus</i>, <i>Candida</i>, <i>Aspergillus</i> and <i>Pneumocystis</i>, but epidemiological data for fungal infections is poor, as these infections are often misdiagnosed and there is a lack of accurate data from the developing world.</p><br /><br />
<br />
<h3>Endemic dimorphic mycoses</h3><br /><br />
<p>Endemic mycoses occur in geographically localized hotspots where even immunocompetent individuals are at risk. The following table is a reproduction of the information presented in Brown <i>et al</i>., (2012), where the authors make some comments regarding the quality of that information: 1) The data is extrapolated from a few and geographically localized studies and 2) accurate data is lacking from the developing world and the calculations may underestimate the true values of the presented statistics.</p><br /><br />
<br />
<br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th>Disease (most common species)</td><br />
<th>Location</td><br />
<th>Estimated life-threatening infections/year at that location</td><br />
<th>Mortality rates (% in infected population)</td><br />
</tr><br />
<tr><td colspan="4">Endemic dimorphic mycoses</td></tr><br />
<br />
<tr><td><i>Blastomycosis (Blastomyces dermatitidis)</i></td><td> Midwestern and Atlantic United States</td><td>~3,000</td><td><2–68</td></tr><br />
<br />
<tr><td><i>Coccidioidomycosis (Coccidioides immitis)</i></td><td> Southwestern United States </td><td>~25,000</td><td> <1–70</td></tr><br />
<tr><td><i>Histoplasmosis (Histoplasma capsulatum)</i></td><td> Midwestern United States </td><td>~25,000 </td><td>28–50</td></tr><br />
<tr><td><i>Paracoccidioidomycosis (Paracoccidioidesbrasiliensis)</i></td><td>Brazil </td><td>~4,000 </td><td>5–27</td></tr><br />
<tr><td><i>Penicilliosis (Penicillium marneffei)</i> </td><td>Southeast Asia </td><td>>8,000 </td><td>2–75</td></tr><br />
</table></center><br />
<br /><br />
<h3>Opportunistic invasive mycoses</h3><br /><br />
<p>Opportunistic mycoses affect those patients with a compromised immune system, such as AIDS patients and patients taking immmunosuppressants, particularly those that were received a solid transplantation. The following table is also a reproduction of the information presented in Brown <i>et al</i>., (2012).</p><br /><br />
<br />
<br />
<center><table class="table1" style="width:700px"><br />
<tr style="font-weight:bold;"><br />
<th>Disease (most common species)</td><br />
<th>Location</td><br />
<th>Estimated life-threatening infections/year at that location</td><br />
<th>Mortality rates (% in infected population)</td><br />
</tr><br />
<tr><td colspan="4">Opportunistic invasive mycoses</td></tr><br />
<tr><td><i>Aspergillosis (Aspergillus fumigatus)</i></td><td>Worldwide </td><td>>200,000 </td><td>30–95</td></tr><br />
<tr><td><i>Candidiasis (Candida albicans)</i> </td><td>Worldwide </td><td>>400,000 </td><td>46–75</td></tr><br />
<tr><td><i>Cryptococcosis (Cryptococcus neoformans) </i></td><td>Worldwide </td><td>>1,000,000 </td><td>20–70</td></tr><br />
<tr><td><i>Mucormycosis (Rhizopus oryzae)</i> </td><td>Worldwide </td><td>>10,000 </td><td>30–90</td></tr><br />
<tr><td><i>Pneumocystis (Pneumocystis jirovecii)</i> </td><td>Worldwide </td><td>>400,000 </td><td>20–80</td></tr><br />
</table></center><br />
<br />
<br /><br />
<br />
<h2 id="tools">The diagnostic tools currently employed to detect fungal pathogens:</h2> <br /><br /><br />
<p>The methods employed to diagnose fungal infections at present vary in performance as each type of pathogen has a greater proclivity for being detected by some tests than others. However, microscopy has always been the mainstay as far as diagnosis of fungal infections is concerned. We look forward to improve the diagnostic capabilities of conventional microscopy by enhancing specificity and visibility through the application of molecular biology.The following table was compiled from <a href="http://www.fungalinfectiontrust.org/diagnosis.html">Fungal Infection Thrust</font></a>.</p><br /><br /><br />
<br />
<table class="table1" border="1" cellspacing="0" cellpadding="0"><br />
<tbody style="font-size:80%;"><br />
<tr><br />
<th rowspan="2"><strong>Fungal infection </strong></th><br />
<th colspan="6" valign="top"><strong>Diagnostic technique </strong></th><br />
</tr><br />
<tr><br />
<th width="91" valign="top"><a href="http://en.wikipedia.org/wiki/Microscopy" style="color:#FFFFFF;">Microscopy</a></th><br />
<th width="103" valign="top"><a href="http://en.wikipedia.org/wiki/Agar_plate" style="color:#FFFFFF;">Agar culture</a></th><br />
<th width="96" valign="top"><a href="http://en.wikipedia.org/wiki/X-ray_computed_tomography" style="color:#FFFFFF;">Xrays/scans</a></th><br />
<th width="72" valign="top"><a href="http://en.wikipedia.org/wiki/Antigen" style="color:#FFFFFF;">Antigen</a></th><br />
<th width="120" valign="top"><a href="http://en.wikipedia.org/wiki/Antibody" style="color:#FFFFFF;">Blood antibody</a></th><br />
<th width="114" valign="top"><a href="http://en.wikipedia.org/wiki/Polymerase_chain_reaction" style="color:#FFFFFF;">DNA detection</a></th><br />
</tr><br />
<tr><br />
<td width="175" valign="top"><a href="http://en.wikipedia.org/wiki/Candidiasis">Thrush</a></td><br />
<td width="91" valign="top">+++</td><br />
<td width="103" valign="top">+++</td><br />
<td width="96" valign="top">-</td><br />
<td width="72" valign="top">-</td><br />
<td width="120" valign="top">-</td><br />
<td width="114" valign="top">-</td><br />
</tr><br />
<tr><br />
<td width="175" valign="top"><a href="http://en.wikipedia.org/wiki/Candidemia">Candida bloodstream</a></td><br />
<td width="91" valign="top">-</td><br />
<td width="103" valign="top">+++</td><br />
<td width="96" valign="top">+</td><br />
<td width="72" valign="top">+</td><br />
<td width="120" valign="top">+</td><br />
<td width="114" valign="top">+++</td><br />
</tr><br />
<tr><br />
<td width="175" valign="top">Candida abdominal</td><br />
<td width="91" valign="top">+</td><br />
<td width="103" valign="top">+++</td><br />
<td width="96" valign="top">+</td><br />
<td width="72" valign="top">-</td><br />
<td width="120" valign="top">-</td><br />
<td width="114" valign="top">-</td><br />
</tr><br />
<tr><br />
<td width="175" valign="top"><a href="http://en.wikipedia.org/wiki/Cryptococcal_meningitis">Cryptococcal meningitis</a></td><br />
<td width="91" valign="top">++</td><br />
<td width="103" valign="top">+++</td><br />
<td width="96" valign="top">+</td><br />
<td width="72" valign="top">+++</td><br />
<td width="120" valign="top">-</td><br />
<td width="114" valign="top">-</td><br />
</tr><br />
<tr><br />
<td width="175" valign="top"><a href="http://en.wikipedia.org/wiki/Aspergillosis">Invasive aspergillosis</a></td><br />
<td width="91" valign="top">+</td><br />
<td width="103" valign="top">+</td><br />
<td width="96" valign="top">+++</td><br />
<td width="72" valign="top">++</td><br />
<td width="120" valign="top">-</td><br />
<td width="114" valign="top">++</td><br />
</tr><br />
<tr><br />
<td width="175" valign="top"><a href="http://www.aspergillus.org.uk/aspergilloma.htm">Chronic aspergillosis</a></td><br />
<td width="91" valign="top">+</td><br />
<td width="103" valign="top">+</td><br />
<td width="96" valign="top">+++</td><br />
<td width="72" valign="top">-</td><br />
<td width="120" valign="top">+++</td><br />
<td width="114" valign="top">++</td><br />
</tr><br />
<tr><br />
<td width="175" valign="top"><a href="http://www.aspergillus.org.uk/abpa.htm">Allergic aspergillosis</a></td><br />
<td width="91" valign="top">+</td><br />
<td width="103" valign="top">+</td><br />
<td width="96" valign="top">++</td><br />
<td width="72" valign="top">-</td><br />
<td width="120" valign="top">+++</td><br />
<td width="114" valign="top">+</td><br />
</tr><br />
<tr><br />
<td width="175" valign="top"><a href="http://en.wikipedia.org/wiki/Coccidioidomycosis">Coccidioidomycosis</a></td><br />
<td width="91" valign="top">+</td><br />
<td width="103" valign="top">++</td><br />
<td width="96" valign="top">++</td><br />
<td width="72" valign="top">-</td><br />
<td width="120" valign="top">+++</td><br />
<td width="114" valign="top">-</td><br />
</tr><br />
<tr><br />
<td width="175" valign="top"><a href="http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0002073/">Histoplasmosis</a></td><br />
<td width="91" valign="top">+</td><br />
<td width="103" valign="top">++</td><br />
<td width="96" valign="top">+</td><br />
<td width="72" valign="top">++</td><br />
<td width="120" valign="top">-</td><br />
<td width="114" valign="top">-</td><br />
</tr><br />
<tr><br />
<td width="175" valign="top"><a href="fungaldismucormyc.html">Zygomycosis</a></td><br />
<td width="91" valign="top">+++</td><br />
<td width="103" valign="top">+</td><br />
<td width="96" valign="top">++</td><br />
<td width="72" valign="top">-</td><br />
<td width="120" valign="top">-</td><br />
<td width="114" valign="top">-</td><br />
</tr><br />
</tbody></table><br />
<br /><br />
<h3>Detection by Polymerase Chain Reaction</h3> <br /><br />
<p> The table above denotes a summary of the techniques used at present to detect the leading fungal pathogens in the world. Note that the column titled "DNA detection" is a term that mainly involves the use of the Polymerase Chain Reaction (PCR) to detect pathogens. Although it is touted as a reliable technique, it has several disadvantages such as high cost, requirement of laboratory settings of high standards and false positives due to detection of pathogenic DNA EVEN AFTER the resolution (clearance) of the disease. Finally, PCR amplifies the DNA in a sample and only gives qualitative results. While Real-Time PCR can give information on the initial amount of the sample, it requires RNA samples which are degraded by RNases in the body and even if it is not, it requires a well equipped laboratory to prevent further degradation.Therefore, this method cannot be used reliably in many parts of the world (especially in underdeveloped countries). <br /><br /><br />
Another technique to detect pathogens through their DNA is <b>DNA-hybridization</b>, but the downside with this method is that it is labor intensive and involves the use of radio-labelled probes. <br />
<br /><br /> <br />
<h3>Detection by Microscopy</h3><br /><br />
<p>As mentioned before, microscopy has been the mainstay for detection of pathogenic fungi. This is primarily due to the fact that it is one of the oldest and most widely available means of detection. It only requires a microscope, a stain for contrast, the sample from a patient and a user with some experience. Furthermore, this technique requires neither the consideration of multiple parameters (such as in a PCR) nor much time (agar plate cultures need at least a day) to yield results. </p><br />
<br /><br /><br />
<p>Thus, we believe that improving detectability through microscopy by giving it the advantage of molecular biology (specificity and a better scope for visualization) while maintaining the advantages of conventional microscopy.</p><br />
<br />
<br /><br />
<br /><br />
<br />
<br />
<hr><br />
<h2>References</h2><br /><br />
<ol><br />
<li>1. Brown <i>et al</i>., (2012), Hidden Killers: Human Fungal Infections, <i>Sci Transl Med</i>, Vol. 4, Issue 165.</li><br />
</ol><br />
<br />
<br />
<br />
<!-- end of right column--><br />
<br />
<br />
<br />
<br />
<div><a href="https://2014.igem.org/Team:Goettingen/project_overview/project" class="button_next"><b>Next</b></a></div><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven
http://2014.igem.org/Team:Goettingen/outreach_gallery
Team:Goettingen/outreach gallery
2014-10-17T22:53:27Z
<p>Gwen Eleven: </p>
<hr />
<div>{{:Team:Goettingen/header}}<br />
{{:Team:Goettingen/lightbox}}<br />
<br />
<html><br />
<head><br />
<script src="https://2014.igem.org/Team:Goettingen/jquery-1.11.0.min.js?action=raw&type=text/js" type="text/javascript"></script><br />
<script src="https://2014.igem.org/Team:Goettingen/lightbox.min?action=raw&type=text/js" type="text/javascript"></script><br />
</head><br />
<body><br />
<br />
<!-- main part --><br />
<div id="protocolOverview"><br />
<div class="proLP"><br />
<h3>Outreach</h3><br />
<ul><br />
<li><a href="/Team:Goettingen/outreach_overview">Overview</a></li><br />
<li><a href="/Team:Goettingen/outreach_human_practices">Human Practices</a></li><br />
<li><a href="/Team:Goettingen/outreach_gallery">Gallery</a></li><br />
<li><a href="/Team:Goettingen/outreach_videos">Videos</a></li><br />
<li><a href="/Team:Goettingen/outreach_presentation">Presentations</a></li><br />
<li><a href="/Team:Goettingen/outreach_newsletter">Paris Bettencourt Newsletters</a></li><li><a href="https://2014.igem.org/Team:Goettingen/outreach_germanproposal">German teams' proposal</a></li><br />
</ul><br />
</div><br />
<div class="proRP"><br />
<h2><center>Gallery</center></h2><br />
<!--Meet us in the lab--><br />
<br />
<div class="gallery_single_part" id="in_the_lab"><br />
<h3>Meet us in the lab!</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/4/4c/Goettingen_lab_photo0.jpg" data-lightbox="inTheLab" data-title="First day in the lab. Everything is well organised!" ><img src="https://static.igem.org/mediawiki/2014/b/b4/Goettingen_lab_photo0_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/10/Goettingen_lab_photo2.jpg" data-lightbox="inTheLab" data-title="Be careful of these materials"><img src="https://static.igem.org/mediawiki/2014/4/46/Goettingen_lab_photo2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/5d/Goettingen_lab_photo3.jpg" data-lightbox="inTheLab" data-title="All the buffers and mediums are well prepared."><img src="https://static.igem.org/mediawiki/2014/1/19/Goettingen_lab_photo3_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_lab_Photo15.jpg" data-lightbox="inTheLab" data-title="Fancy experiments"><img src="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_lab_Photo15.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/78/Goettingen_lab_photo10.jpg" data-lightbox="inTheLab" data-title="Cedric on the microscope"><img src="https://static.igem.org/mediawiki/2014/7/78/Goettingen_lab_photo10.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/6/6f/Goettingen_lab_photo8.jpg" data-lightbox="inTheLab" data-title="The whole team is working hard"><img src="https://static.igem.org/mediawiki/2014/6/6f/Goettingen_lab_photo8.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/7f/Goettingen_lab_photo9.jpg" data-lightbox="inTheLab" data-title="On the microscope"><img src="https://static.igem.org/mediawiki/2014/7/7f/Goettingen_lab_photo9.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/ff/Goettingen_lab_photo14.jpg" data-lightbox="inTheLab" data-title="Lab without iGEMers"><img src="https://static.igem.org/mediawiki/2014/f/ff/Goettingen_lab_photo14.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/70/Goettingen_lab_Photo16.JPG" data-lightbox="inTheLab" data-title="Shooting videos"><img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_lab_Photo16_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c1/Goettingen_lab_Photo17.JPG" data-lightbox="inTheLab" data-title="Our international marketing guy!"><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo17_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d7/Goettingen_lab_Photo18.JPG" data-lightbox="inTheLab" data-title="Dry lab work"><img src="https://static.igem.org/mediawiki/2014/7/72/Goettingen_lab_Photo18_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/71/Goettingen_lab_Photo19.JPG" data-lightbox="inTheLab" data-title="This is our way to communicate!"><img src="https://static.igem.org/mediawiki/2014/0/09/Goettingen_lab_Photo19_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b5/Goettingen_lab_Photo20.JPG" data-lightbox="inTheLab" data-title="Happy Rayan"><img src="https://static.igem.org/mediawiki/2014/1/17/Goettingen_lab_Photo20_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/eb/Goettingen_lab_Photo21.JPG" data-lightbox="inTheLab" data-title="Kamal is at work"><img src="https://static.igem.org/mediawiki/2014/e/e9/Goettingen_lab_Photo21_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/2d/Goettingen_lab_Photo22.JPG" data-lightbox="inTheLab" data-title="Samples on ice"><img src="https://static.igem.org/mediawiki/2014/3/3c/Goettingen_lab_Photo22_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/1c/Goettingen_lab_Photo23.JPG" data-lightbox="inTheLab" data-title="Our bench on a normal day"><img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_lab_Photo23_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e4/Goettingen_lab_Photo24.JPG" data-lightbox="inTheLab" data-title="Our hood"><img src="https://static.igem.org/mediawiki/2014/3/35/Goettingen_lab_Photo24_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/71/Goettingen_lab_Photo25.JPG" data-lightbox="inTheLab" data-title="Cedric and Anika are working in the cold room"><img src="https://static.igem.org/mediawiki/2014/8/8e/Goettingen_lab_Photo25_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b0/Goettingen_lab_Photo27.JPG" data-lightbox="inTheLab" data-title="Antique lab equipment"><img src="https://static.igem.org/mediawiki/2014/6/63/Goettingen_lab_Photo27_reduced.jpg" width="120px"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/33/Goettingen_lab_Photo26.JPG" data-lightbox="inTheLab" data-title="Equipment for protein purification"><img src="https://static.igem.org/mediawiki/2014/3/34/Goettingen_lab_Photo26_reduced.jpg" width="120px"></a></li><br />
<br />
<br />
<li><a href="https://static.igem.org/mediawiki/2014/1/17/Goettingen_lab_photo1.jpg" data-lightbox="inTheLab" data-title="iGEM 2014 DNA Distributions have shipped! and arrived!! Work can start! "><img src="https://static.igem.org/mediawiki/2014/3/34/Goettingen_lab_photo1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/38/Goettingen_lab_Photo34.jpg" data-lightbox="inTheLab" data-title="Bahar and Cedric preparing the film set "><img src="https://static.igem.org/mediawiki/2014/8/8b/Goettingen_lab_Photo34_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/8/8b/Goettingen_lab_Photo29.jpg" data-lightbox="inTheLab" data-title="Happy Bahar after winning one giant microbe"><img src="https://static.igem.org/mediawiki/2014/7/7e/Goettingen_lab_Photo29_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_lab_Photo30.jpg" data-lightbox="inTheLab" data-title="Julia and Karthi, another lucky winners!"><img src="https://static.igem.org/mediawiki/2014/b/ba/Goettingen_lab_Photo30_reduced.jpg"></a></li><br />
<br />
<li><a href="https://static.igem.org/mediawiki/2014/5/55/Goettingen_lab_Photo28.jpg" data-lightbox="inTheLab" data-title="Post-Synbio Day meeting"><img src="https://static.igem.org/mediawiki/2014/2/20/Goettingen_lab_Photo28_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e1/Goettingen_lab_Photo31.jpg" data-lightbox="inTheLab" data-title="iGEM army preparing for battle!"><img src="https://static.igem.org/mediawiki/2014/6/60/Goettingen_lab_Photo31_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/a1/Goettingen_lab_Photo33.jpg" data-lightbox="inTheLab" data-title="Video director at work…silence required!"><img src="https://static.igem.org/mediawiki/2014/b/b1/Goettingen_lab_Photo33_reduced.jpg"></a></li><br />
<br />
<li><a href="https://static.igem.org/mediawiki/2014/1/1c/Goettingen_lab_Photo23.JPG" data-lightbox="inTheLab" data-title="iGEM time… at 2 am!"><img src="https://static.igem.org/mediawiki/2014/e/e2/Goettingen_lab_Photo23_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo32.jpg" data-lightbox="inTheLab" data-title="###"><img src="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_lab_Photo32.jpg" width="120px"></a></li><br />
<br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br /><br /><br />
</div><br />
<!-- Meetup in München --><br />
<div class="gallery_single_part" id="trip_in_Munich"><br />
<h3>Meetup in Munich</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/aa/CAS_meetupLMU_group2.jpg" data-lightbox="meeupLMU" data-title="The german iGEMers are gathering together in the University Munich!"><img src="https://static.igem.org/mediawiki/2014/a/ad/Goettingen_meetupLMU0_reduced.jpg" ></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/28/Goettingen_meetupLMU1.jpg" data-lightbox="meeupLMU" data-title="Julia is presenting our project!"><img src="https://static.igem.org/mediawiki/2014/0/09/Goettingen_meetupLMU1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/72/Goettingen_meetupLMU5.jpg" data-lightbox="meeupLMU" data-title="Nice smile, Lara :)"><img src="https://static.igem.org/mediawiki/2014/3/35/Goettingen_meetupLMU5_reduced.jpg" ></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/3d/Goettingen_meetupLMU6.jpg" data-lightbox="meeupLMU" data-title="A wonderful trip in Munich!"><img src="https://static.igem.org/mediawiki/2014/4/47/Goettingen_meetupLMU6_reduced.jpg" width="120"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<!-- SynBio Day --><br />
<div class="gallery_single_part" id="SynBioDay"><br />
<h3>SynBio Day</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/c/c7/Goettingen_SynBioDay1.jpg" data-lightbox="SynBioDay" data-title="Our SynBioDay in Göttingen"><img src="https://static.igem.org/mediawiki/2014/2/2e/Goettingen_SynBioDay1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/be/Goettingen_SynBioDay7.jpg" data-lightbox="SynBioDay" data-title="Winners of the lottery"><img src="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_SynBioDay7_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/75/Goettingen_SynBioDay8.jpg" data-lightbox="SynBioDay" data-title="Another winner"><img src="https://static.igem.org/mediawiki/2014/9/9b/Goettingen_SynBioDay8_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/0d/Goettingen_SynBioDay2.jpg" data-lightbox="SynBioDay" data-title="Göttingens pedestrian zone"><img src="https://static.igem.org/mediawiki/2014/e/ed/Goettingen_SynBioDay2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f9/Goettingen_SynBioDay3.jpg" data-lightbox="SynBioDay" data-title="Friends visit us "><img src="https://static.igem.org/mediawiki/2014/3/39/Goettingen_SynBioDay3_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/27/Goettingen_SynBioDay4.jpg" data-lightbox="SynBioDay" data-title="Anika in an conversation"><img src="https://static.igem.org/mediawiki/2014/2/2a/Goettingen_SynBioDay4_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f5/Goettingen_SynBioDay5.jpg" data-lightbox="SynBioDay" data-title="Shantal is talking about our project"><img src="https://static.igem.org/mediawiki/2014/f/f2/Goettingen_SynBioDay5_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d2/Goettingen_SynBioDay10.jpg" data-lightbox="SynBioDay" data-title="Another interesting conversation"><img src="https://static.igem.org/mediawiki/2014/6/65/Goettingen_SynBioDay10_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/19/Goettingen_SynBioDay6.jpg" data-lightbox="SynBioDay" data-title="More talks"><img src="https://static.igem.org/mediawiki/2014/8/83/Goettingen_SynBioDay6_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/0c/Goettingen_SynBioDay9.jpg" data-lightbox="SynBioDay" data-title="Lara in a talk"><img src="https://static.igem.org/mediawiki/2014/a/a9/Goettingen_SynBioDay9_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/3/3a/Goettingen_SynBioDay11.jpg" data-lightbox="SynBioDay" data-title="Informing people about Synthetic Biology"><img src="https://static.igem.org/mediawiki/2014/5/5a/Goettingen_SynBioDay11_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/e/e6/Goettingen_SynBioDay12.jpg" data-lightbox="SynBioDay" data-title="Our team on the streets of Göttingen"><img src="https://static.igem.org/mediawiki/2014/5/54/Goettingen_SynBioDay12_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/5/5a/Goettingen_SynBioDay13.jpg" data-lightbox="SynBioDay" data-title="Conversation"><img src="https://static.igem.org/mediawiki/2014/d/de/Goettingen_SynBioDay13_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/f/f1/Goettingen_SynBioDay14.jpg" data-lightbox="SynBioDay" data-title="Our stand"><img src="https://static.igem.org/mediawiki/2014/3/30/Goettingen_SynBioDay14_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/7/79/Goettingen_SynBioDay15.jpg" data-lightbox="SynBioDay" data-title="Lara in action"><img src="https://static.igem.org/mediawiki/2014/7/74/Goettingen_SynBioDay15_reduced.jpg"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<br />
<!-- GZMB Symposium 2014 --><br />
<div class="gallery_single_part" id="GZMB"><br />
<h3>GZMB Symposium 2014</h3><br />
<ul class="gallery"><br />
<li><a href="https://static.igem.org/mediawiki/2014/2/26/Goettingen_Presenters.jpg" data-lightbox="GZMBSym" ><img src="https://static.igem.org/mediawiki/2014/5/51/Goettingen_Presenters_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/0/05/Goettingen_Mr_Moderator.jpg" data-lightbox="GZMBSym" ><img src="https://static.igem.org/mediawiki/2014/4/43/Goettingen_Mr_Moderator_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d0/Goettingen_Mr_CoffeeHuger.jpg" data-lightbox="GZMBSym" data-title="Mr_CoffeeHuger"><img src="https://static.igem.org/mediawiki/2014/9/97/Goettingen_Mr_CoffeeHuger_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/b/b0/Goettingen_BBQ_after.jpg" data-lightbox="GZMBSym" data-title="Our BBQ after the presentation"><img src="https://static.igem.org/mediawiki/2014/9/94/Goettingen_BBQ_after_reduced.jpg"></a></li><br />
<br />
<li><a href="https://static.igem.org/mediawiki/2014/d/d3/Goettingen_GZMB1.jpg" data-lightbox="GZMBSym" data-title="###"><img src="https://static.igem.org/mediawiki/2014/8/81/Goettingen_GZMB1_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/1/10/Goettingen_GZMB2.jpg" data-lightbox="GZMBSym" data-title="###"><img src="https://static.igem.org/mediawiki/2014/7/7c/Goettingen_GZMB2_reduced.jpg"></a></li><br />
<li><a href="https://static.igem.org/mediawiki/2014/a/a4/Goettingen_GZMB3.jpg" data-lightbox="GZMBSym" data-title="###"><img src="https://static.igem.org/mediawiki/2014/2/2b/Goettingen_GZMB3_reduced.jpg"></a></li><br />
</ul><br />
<br /><br /><br />
</div><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div id="footerbanner"><a href="https://2014.igem.org/Team:Goettingen/team_sponsors"><img src="https://static.igem.org/mediawiki/2014/7/7a/Goettingen_footer_banner.png" /></a></div><br />
</body><br />
</html></div>
Gwen Eleven