http://2014.igem.org/wiki/index.php?title=Special:Contributions/Geoben&feed=atom&limit=50&target=Geoben&year=&month=2014.igem.org - User contributions [en]2024-03-29T13:29:40ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/Giant_Jamboree/PracticeSessionsGiant Jamboree/PracticeSessions2014-10-29T22:10:11Z<p>Geoben: </p>
<hr />
<div>{{CSS/GiantJamboreeStyle}}<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
<div id="columns-wrap"><br />
<br />
<div id="column1s"><br />
<h3> PROGRAM</h3><br />
<br />
<ul><br />
<li><a style="color: #49b677" href="https://2014.igem.org/Giant_Jamboree/Projects"><p> <b> Projects </p> </b> </a> </li><br />
<li><a style="color: #49b677" href="https://2014.igem.org/Giant_Jamboree/Booklet"><p><b>Booklet </p> </b></a></li><br />
<li><a style="color: #49b677" href="https://2014.igem.org/Giant_Jamboree/Schedule"><p><b> Schedule </p></b> </a> </li><br />
<li><a style="color: #49b677" href="https://2014.igem.org/Giant_Jamboree/SpecialEvents"><p><b> Special Events</p></b> </a> </li><br />
<li><a style="color: #49b677" href="https://2014.igem.org/Giant_Jamboree/Handbook"> <p> <b>Participant Handbook </b></p> </a> </li><br />
<li><a style="color: #49b677" href="https://2014.igem.org/Giant_Jamboree/PracticeSessions"> <p> <b>Practice Sessions </b> </p></a> </li><br />
</ul><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div id="column2s"><br />
<h3>Practice Sessions </h3><br />
<br />
<p>Use this sign-up sheet to sign up for a practice session slot on Thursday night (October 30) to practice your talk. Note that there will NOT be any A/V (audio/visual) support on staff. All rooms will be unlocked and you should use them and leave them as you found them. Be sure to bring necessary computer equipment with you, such as chargers and adapters, as these will not be provided.</p><br />
<br />
<p>There are a limited number of time slots available on a first-come first-serve basis so please only choose one slot. We cannot match the room that you will ultimately give your presentation in with the practice room (please see the campus map for building locations). This should, however, give you a chance to practice your talk in a new environment. Please keep in mind that there will be teams waiting to use the room after you, so make sure that your practice finishes on time.</p><br />
<br />
<p>Use the wiki <a style="color: #49b677" href="https://2014.igem.org/wiki/index.php?title=Giant_Jamboree/PracticeSessions&action=edit">edit button </a> to add your team to the schedule (the markup is located at the bottom of the page). Additional rooms may be added in the coming weeks.</p><br />
<br />
<p><i>** Please note that rooms 310 and 313 will not have any A/V.</i></p><br />
<br />
<br />
</div><br />
<div id="clear"></div><br />
<br />
<div id="columns-wrap"><br />
<table width="950px" align="center" ><br />
<br />
<tr align="center"><br />
<th width="85px"> Room/Hour </th><br />
<th width="85px">207</th><br />
<th width="85px">208</th><br />
<th width="85px">210</th><br />
<th width="85px">302</th><br />
<th width="85px">304</th><br />
<th width="85px">306</th><br />
<th width="85px">309</th><br />
<th width="85px">311</th><br />
<th width="85px">312</th><br />
<th width="85px">310 **</th><br />
<th width="85px">313 **</th><br />
</tr><br />
<tr><td colspan="12" height="10px"> </td></tr> <br />
<tr><td colspan="12" bgColor="#414141" height="1px"> </td></tr> <br />
<tr><td colspan="12" height="10px"> </td></tr> <br />
<br />
<tr align="center" height="25px"><br />
<td> 2:00 - 2:30 </td><br />
<td> SDU Denmark </td><br />
<td> NEAU-Harbin </td><br />
<td> Aalto-Helsinki </td><br />
<td> RHIT </td><br />
<td> HNU_China </td><br />
<td> Exeter </td><br />
<td> Aberdeen_Scotland</td><br />
<td> KAIT_JAPAN </td><br />
<td> Paris Bettencourt </td><br />
<td> J1 </td><br />
<td> K1 </td><br />
</tr><br />
<br />
<tr align="center" height="25px"><br />
<td> 2:30 - 3:00 </td><br />
<td> Berlin </td><br />
<td> ITESM CEM </td><br />
<td> Goettingen</td><br />
<td> Cambridge-JIC </td><br />
<td> Evry </td><br />
<td> Szu-China </td><br />
<td> Warwick </td><br />
<td> KIT-Kyoto</td><br />
<td> XMU-China </td><br />
<td> NCSU GES </td><br />
<td> K2 </td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 3:00 - 3:30 </td><br />
<td> Glasgow </td><br />
<td> Wageningen UR </td><br />
<td> UFAM_Brazil </td><br />
<td> Oxford </td><br />
<td> NJAU_China </td><br />
<td> ITB Indonesia </td><br />
<td> SJTU-Software </td><br />
<td> USTC-Software </td><br />
<td> METU_Turkey </td><br />
<td> HFUT-China </td><br />
<td> K3 </td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 3:30 - 4:00 </td><br />
<td> NYMU-Taipei </td><br />
<td> UCSD </td><br />
<td> CityU_HK </td><br />
<td> UCSC </td><br />
<td> NJU-QIBEBT </td><br />
<td> Jilin-China</td><br />
<td> Nagahama</td><br />
<td> Georgia Tech </td><br />
<td> NTU-Taida </td><br />
<td> J4 </td><br />
<td> K4 </td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 4:00 - 4:30 </td><br />
<td> USyd-Australia </td><br />
<td> Paris_Saclay </td><br />
<td> OUC-China </td><br />
<td> Sheffield </td><br />
<td> Macquarie_Australia </td><br />
<td> Sumbawagen </td><br />
<td> Gifu </td><br />
<td> Valencia Biocampus </td><br />
<td> Pitt </td><br />
<td> J5 </td><br />
<td> K5 </td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 4:30 - 5:00 </td><br />
<td> Tokyo_Tech</td><br />
<td> Nanjing-China </td><br />
<td> BIT-China </td><br />
<td> HZAU-China </td><br />
<td> Gaston_Day_School </td><br />
<td> TU Eindhoven </td><br />
<td> Kyoto </td><br />
<td> Edinburgh </td><br />
<td> Aix-Marseille </td><br />
<td> HokkaidoU_Japan </td><br />
<td> K6 </td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 5:30 - 6:00 </td><br />
<td> Tsinghua </td><br />
<td> UESTC-Software</td><br />
<td> Groningen </td><br />
<td> Valencia_UPV </td><br />
<td> TU_Darmstadt </td><br />
<td> Korea_U_Seoul </td><br />
<td> Saarland </td><br />
<td> UT-Tokyo </td><br />
<td> Virtus-Parva_Mexico </td><br />
<td> UMayor </td><br />
<td> K7 </td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 6:00 - 6:30 </td><br />
<td> ETH Zurich </td><br />
<td> Braunschweig </td><br />
<td> Bielefeld-CeBiTec </td><br />
<td> Aachen </td><br />
<td> Hannover </td><br />
<td> UST-Beijing </td><br />
<td> Uppsala </td><br />
<td> MIT </td><br />
<td> Austin_Texas </td><br />
<td> UGA-Georgia </td><br />
<td> LiTH </td><br />
</tr><br />
<br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 6:30 - 7:00 </td><br />
<td> Linköping University </td><br />
<td> UMaryland </td><br />
<td> ZJU-China</td><br />
<td> INSA - Lyon </td><br />
<td> ATOMS Turkiye </td><br />
<td> Minnesota </td><br />
<td> AHUT_China</td><br />
<td> Michigan </td><br />
<td> UESTC-China </td><br />
<td> J9 </td><br />
<td> Imperial </td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 7:00 - 7:30 </td><br />
<td> SYSU-China </td><br />
<td> Hong_Kong-CUHK </td><br />
<td> Calgary </td><br />
<td> UI-Indonesia </td><br />
<td> uOttawa </td><br />
<td> UFMG_Brazil </td><br />
<td> Peking </td><br />
<td> BNU-China </td><br />
<td> TCU-Taiwan </td><br />
<td> UCL </td><br />
<td> BIOSINT_Mexico </td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 7:30 - 8:00 </td><br />
<td> Caltech </td><br />
<td> Toulouse </td><br />
<td> BostonU </td><br />
<td> Dundee </td><br />
<td> UCSF_UCB </td><br />
<td> Nevada </td><br />
<td> Missouri_Miners </td><br />
<td> Carnegie_Mellon </td><br />
<td> NCTU_Formosa </td><br />
<td> J11 </td><br />
<td> Lethbridge </td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 8:00 - 8:30 </td><br />
<td> IIT Delhi</td><br />
<td> NU_Kazakhstan </td><br />
<td> WLC-Milwaukee </td><br />
<td> Warsaw </td><br />
<td> Georgia State </td><br />
<td> SUSTC-Shenzhen </td><br />
<td> Michigan_Software </td><br />
<td> Tec-Monterrey </td><br />
<td> Zamorano </td><br />
<td> SJTU-BioX-Shanghai </td><br />
<td> BYU Provo</td><br />
</tr><br />
<br />
<br />
<tr align="center" height="25px"><br />
<td> 8:30 - 9:00 </td><br />
<td> Freiburg </td><br />
<td> LMU-Munich </td><br />
<td> WHU-China </td><br />
<td> Technion_Israel </td><br />
<td> Cornell </td><br />
<td> Utah State </td><br />
<td> BGU-Israel</td><br />
<td> Colombia </td><br />
<td> Washington </td><br />
<td> SF BAY AREA DIYbio </td><br />
<td> UiOslo_Norway </td><br />
</tr><br />
<br />
<br />
<br />
<br />
</table><br />
<br><br />
<p>** Please note that rooms 310 and 313 will not have any A/V.</p><br />
</div><br />
</html><br />
{{MainPage2014/Footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:56:31Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E. coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water Filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<br><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter">G.xylinus</a></em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2><em><a href="https://2014.igem.org/Team:Imperial/EColi">E.coli</a></em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/coculture">RFP Co-Culture</a></h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Functionalisation">Functionalisation</a></h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">Mechanical Testing</a></h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result5"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Water_Filtration">Water filtration</a></h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-1"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/Water_Report">Water Report</a></h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
<section id="result7"><br />
<h2><a href="https://2014.igem.org/Team:Imperial/The_i_in_iGEM">The i in iGEM</a></h2><br />
<br />
<h3>Overview</h3><br />
<p>As an international competition, every year iGEM welcomes teams from a great range of countries, with a variety of languages spoken amongst its teams and judges. This part of our Policy & Practices seeks to understand the effect of English as the <em>lingua franca</em> of science on the participation and outcome of the competition. In order to achieve this we have looked into the different nationalities of the teams and finalists and the different lingual backgrounds of teams and finalists over the years. We derived our conclusions by comparing this data with factors such as academic output and impact of their countries of origins, the lingual background of the iGEM judges, the international rankings of their universities and the English Proficiency Index of their countries of origin.</p><br />
<br />
<h3>Key Findings </h3><br />
<ul><br />
<li>The majority of iGEM finalists come from either English speaking countries or countries with high English Proficiency Index.</li><br />
<li>China is the country with the highest increase in participation over the last five years and is now second in participation only to the US.</li><br />
<li>Around 40% of the judges in championships can speak at least 1 more language other than English. Those languages are usually French and Mandarin.</li><br />
<li>The same percentage in the non-English speaking teams is now 64% and has risen by 10% in the last 5 years.</li><br />
<br />
<br />
</ul><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/Art_and_DesignTeam:Imperial/Art and Design2014-10-18T03:55:09Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Art and Design</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#brainstorming">Brainstorming with RCA</a><br />
</li><br />
<li><a data-scroll href="#fashion">Fashion and Textiles</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<div class="pure-g"><br />
<section id="overview"><br />
<br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Throughout our project we collaborated with artists and designers. This involved including their input from the initial brainstorming to imagining applications of our final material.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Developed meaningful, long term collaboration with artists and designers</li><br />
<li>Involved artists in our initial brainstorming and project development</li><br />
<li>Produced an exhibition piece considering future uses of bacterial cellulose to be displayed at the giant jamboree</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="brainstorming"><br />
<h2>Brainstorming with the RCA</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/40/IC14-ArtDesign-1.jpg"><br />
<figcaption>The result of one of the sessions with the artists</figcaption><br />
</figure><br />
<p>At the beginning of July when we were coming up with our idea we took advantage of our location and enlisted the help of our neighbours at the <a target="_blank" href="http://www.rca.ac.uk/">Royal College of Art</a> (RCA). As scientists and engineers, we found that we all had similar ways of thinking. Our idea generation was driven by one of two methodologies; either trying to target a major problem or seeking to utilise an interesting technology. We very much constrained ourselves by what we felt was feasible and quickly dismissed “unrealistic” ideas. Our collaboration with the RCA allowed us to take a more open outlook on ideas.</p><br />
<p>We had several art students present their biology-based design work. These conceptual projects formed science-fiction visions of the future ranging from turning pigeon excrement into detergent to engineering gut bacteria and immune system to digest rotten food. It was a very different approach to presentations and design work that we were used to.</p><br />
<p>Our subsequent collaborative brainstorming sessions lead to the generation of a whole host of innovative ideas which we have documented on our <a href="https://2014.igem.org/Team:Imperial/Brainstorming">brainstorming</a> page.</p><br />
<br />
</section><br />
</div><br />
<br />
<section id="fashion"><br />
<div class="pure-u-1-1"><br />
<h2>Fashion and Textiles</h2><br />
<br />
<p>In addition to our goal of water filtration we were also keen to explore alternative uses of bacterial cellulose. Together with conceptual artists, fashion designers and materials specialists we looked into its use as a textile.</p><br />
</div><br />
<div class=pure-u-1-1><br />
<h3>Dyeing Cellulose</h3><br />
<p>During our processing we discovered that cellulose can hold a variety of dyes. Here are some of our samples</p><br />
<br />
<div class="pure-u-1-3"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a1/IC14-art-dye1.png"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-3"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/6/69/IC14-art-peng.png"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-3"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/38/IC14-art-dye2.png"><br />
<figcaption></figcaption><br />
</figure><br />
<br />
</div><br />
<div class="pure-u-1-1"><br />
<br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/7b/IC14-ArtDesign-Zuzana.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
<h3>Zuzana Gombosova - Design Researcher</h3><br />
<br />
<p>While looking into the artistic uses of cellulose we came across <a target="_blank" href="http://zuzana-gombosova.squarespace.com/">Zuzana Gombosova</a>, a design researcher who has previously explored bacterial cellulose as a material in her project “Invisible Resources”. She explored various manufacturing processes and applications including a concept for a biological printer. She visited our lab and shared some of her growth techniques our material as well as showed us some of her processed samples.</p><br />
</div><br />
<div class=pure-u-1-1><br />
<h3>VICTORIA GEANEY - CONCEPTUAL WOMENSWEAR DESIGNER</h3><br />
<p>In order to begin exploring the future potential of bacterial cellulose as a textile we invited Victoria Geaney to our lab to see our biomaterial. She found it an interesting medium and was keen to explore its use in the future.</p><br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/27/IC14-ArtDesign-Victoria.jpg"><br />
<figcaption>Victoria in our lab</figcaption><br />
</figure><br />
<br />
<br />
<br />
</div><br />
<div class="pure-u-1-1"><br />
<br />
<h3>Phil Townsend - Sustainable Raw Materials Specialist at M&S<br />
</h3><br />
<p>Our meeting with Phil Townsend was conceived by his initiative in locating other groups and individuals interested in cellulose. His search landed him on Koon-Yang Lee’s doorstep, who kindly referred him to us.<br />
</p><br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a9/IC14-ArtDesign-Marks.jpg"><br />
<figcaption>Marks & Spencers has interests in sustainable raw materials based on cellulose</figcaption><br />
</figure><br />
<p>As a Sustainable Raw Materials Specialist at Marks and Spencer, Phil has recently begun a long-term side project on ‘Man-made cellulosic materials’. The pressure of reducing the carbon footprint of the textile industry is driving research into man-made sustainable materials. His ideal solution would be to produce a bacterial cellulose fibre that possesses the feel, softness and breathability of cotton, as this is preferred by the company’s customers. Cotton, however, has a high demand on the environment as well as some social issues in regions of production. Thus a natural and cost-effective alternative that is attractive to their existing customer base is desirable.<br />
</p><br />
<p>Aside from fabrics, Phil suggested potential applications for our selective-binding cellulose in dye houses and other industries that are under scrutiny for certain chemicals in their waste outputs. All in all, our meeting was mutually enlightening for either party, and reminded us of the versatility and potential still to be explored with this biomaterial.<br />
</p><br />
<br />
</div><br />
<br />
</section><br />
<br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/Art_and_DesignTeam:Imperial/Art and Design2014-10-18T03:54:06Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Art and Design</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#brainstorming">Brainstorming with RCA</a><br />
</li><br />
<li><a data-scroll href="#fashion">Fashion and Textiles</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<div class="pure-g"><br />
<section id="overview"><br />
<br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Throughout our project we collaborated with artists and designers. This involved including their input from the initial brainstorming to imagining applications of our final material.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Developed meaningful, long term collaboration with artists and designers</li><br />
<li>Involved artists in our initial brainstorming and project development</li><br />
<li>Produced an exhibition piece considering future uses of bacterial cellulose to be displayed at the giant jamboree</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="brainstorming"><br />
<h2>Brainstorming with the RCA</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/40/IC14-ArtDesign-1.jpg"><br />
<figcaption>The result of one of the sessions with the artists</figcaption><br />
</figure><br />
<p>At the beginning of July when we were coming up with our idea we took advantage of our location and enlisted the help of our neighbours at the <a target="_blank" href="http://www.rca.ac.uk/">Royal College of Art</a> (RCA). As scientists and engineers, we found that we all had similar ways of thinking. Our idea generation was driven by one of two methodologies; either trying to target a major problem or seeking to utilise an interesting technology. We very much constrained ourselves by what we felt was feasible and quickly dismissed “unrealistic” ideas. Our collaboration with the RCA allowed us to take a more open outlook on ideas.</p><br />
<p>We had several art students present their biology-based design work. These conceptual projects formed science-fiction visions of the future ranging from turning pigeon excrement into detergent to engineering gut bacteria and immune system to digest rotten food. It was a very different approach to presentations and design work that we were used to.</p><br />
<p>Our subsequent collaborative brainstorming sessions lead to the generation of a whole host of innovative ideas which we have documented on our <a href="https://2014.igem.org/Team:Imperial/Brainstorming">brainstorming</a> page.</p><br />
<br />
</section><br />
</div><br />
<br />
<section id="fashion"><br />
<div class="pure-u-1-1"><br />
<h2>Fashion and Textiles</h2><br />
<br />
<p>In addition to our goal of water filtration we were also keen to explore alternative uses of bacterial cellulose. Together with conceptual artists, fashion designers and materials specialists we looked into its use as a textile.</p><br />
</div><br />
<div class=pure-u-1-1><br />
<h3>Dyeing Cellulose</h3><br />
<p>During our processing we discovered that cellulose can hold a variety of dyes. Here are some of our samples</p><br />
<br />
<div class="pure-u-1-3"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a1/IC14-art-dye1.png"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-3"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/6/69/IC14-art-peng.png"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-3"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/38/IC14-art-dye2.png"><br />
<figcaption></figcaption><br />
</figure><br />
<br />
</div><br />
<div class="pure-u-1-1"><br />
<br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/7b/IC14-ArtDesign-Zuzana.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
<h3>Zuzana Gombosova - Design Researcher</h3><br />
<br />
<p>While looking into the artistic uses of cellulose we came across <a target="_blank" href="http://zuzana-gombosova.squarespace.com/">Zuzana Gombosova</a>, a design researcher who has previously explored bacterial cellulose as a material in her project “Invisible Resources”. She explored various manufacturing processes and applications including a concept for a biological printer. She visited our lab and shared some of her growth techniques our material as well as showed us some of her processed samples.</p><br />
</div><br />
<div class=pure-u-1-1><br />
<h3>VICTORIA GEANEY-CONCEPTUAL WOMENSWEAR DESIGNER</h3><br />
<p>In order to begin exploring the future potential of bacterial cellulose as a textile we invited Victoria Geaney to our lab to see our biomaterial. She found it an interesting medium and was keen to explore its use in the future.</p><br />
<figure class="content-image image-half"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/27/IC14-ArtDesign-Victoria.jpg"><br />
<figcaption>Victoria in our lab</figcaption><br />
</figure><br />
<br />
<br />
<br />
</div><br />
<div class="pure-u-1-1"><br />
<br />
<h3>Phil Townsend - Sustainable Raw Materials Specialist at M&S<br />
</h3><br />
<p>Our meeting with Phil Townsend was conceived by his initiative in locating other groups and individuals interested in cellulose. His search landed him on Koon-Yang Lee’s doorstep, who kindly referred him to us.<br />
</p><br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a9/IC14-ArtDesign-Marks.jpg"><br />
<figcaption>Marks & Spencers has interests in sustainable raw materials based on cellulose</figcaption><br />
</figure><br />
<p>As a Sustainable Raw Materials Specialist at Marks and Spencer, Phil has recently begun a long-term side project on ‘Man-made cellulosic materials’. The pressure of reducing the carbon footprint of the textile industry is driving research into man-made sustainable materials. His ideal solution would be to produce a bacterial cellulose fibre that possesses the feel, softness and breathability of cotton, as this is preferred by the company’s customers. Cotton, however, has a high demand on the environment as well as some social issues in regions of production. Thus a natural and cost-effective alternative that is attractive to their existing customer base is desirable.<br />
</p><br />
<p>Aside from fabrics, Phil suggested potential applications for our selective-binding cellulose in dye houses and other industries that are under scrutiny for certain chemicals in their waste outputs. All in all, our meeting was mutually enlightening for either party, and reminded us of the versatility and potential still to be explored with this biomaterial.<br />
</p><br />
<br />
</div><br />
<br />
</section><br />
<br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/Policy_and_PracticesTeam:Imperial/Policy and Practices2014-10-18T03:48:15Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<h1>Policy and Practices</h1><br />
<div class="pure-g"><br />
<div class="pure-u-1-3"><br />
<div class="content content-single bg-orange"><br />
<h2>Introduction</h2><br />
<p>Synthetic biology does not exist in a vacuum. As with all science it exists embedded within society</p><p> During the summer we sought to explore the interface between society and our project, the iGEM competition and synthetic biology as a whole.</p><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<a class="youtube" href="http://www.youtube.com/embed/Xo_JrZxTTXE?autoplay=1"><img src="https://static.igem.org/mediawiki/2014/c/c0/IC14-P%26P-3.jpg"></a><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Informing Design</h2> <br />
<p>The engineering of biology is a multi-faceted challenge. The research and products created must interact and with society in a beneficial way. To ensure that our solutions achieved this we discussed our approach with experts from relevant fields including civil engineering, sustainable development and water treatment.<br />
</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Informing_Design">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-P%26P-2.jpg"><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Water Report</h2> <br />
<p>Water is a resource that is vital to all life on our planet. The driving motivation behind our project was to effect a change in how we use water. In order to better understand the problem we compiled a short report about the global water situation.<br />
</p><br />
<br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Water_Report">read more...</a><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>The i in iGEM</h2><br />
<p>Water is a global issue. While compiling our water report we came across literature from a range of institutions worldwide. Some critical papers had only their abstracts written in English, which hindered our research. This, along with the fact that our team consists of people from 7 different countries inspired us to look into the different languages in iGEM and the effect on the competition.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/The_i_in_iGEM">See what we found...</a><br />
</div><br />
<br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Educational Outreach</h2><br />
<p>Research should not only be accessible to experts. In order to foster the engagement of the broader community with our project and synthetic biology we took part in several outreach programmes and events.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Outreach">See what we did...</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/7/73/IC14-P%26P-awe.jpg"><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/f/f3/IC14-P%26P-1.jpg"><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/Policy_and_PracticesTeam:Imperial/Policy and Practices2014-10-18T03:46:12Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<h1>Policy and Practices</h1><br />
<div class="pure-g"><br />
<div class="pure-u-1-3"><br />
<div class="content content-single bg-orange"><br />
<h2>Introduction</h2><br />
<p>Synthetic biology does not exist in a vacuum. As with all science it exists embedded within society</p><p> During the summer we sought to explore the interface between society and our project, the iGEM competition and synthetic biology as a whole.</p><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<a class="youtube" href="http://www.youtube.com/embed/Xo_JrZxTTXE?autoplay=1"><img src="https://static.igem.org/mediawiki/2014/c/c0/IC14-P%26P-3.jpg"></a><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Informing Design</h2> <br />
<p>The engineering of biology is a multi-faceted challenge. The research and products created must interact and with society in a beneficial way. To ensure that our solutions achieved this we discussed our approach with experts from relevant fields including civil engineering, sustainable development and water treatment.<br />
</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Informing_Design">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-P%26P-2.jpg"><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Water Report</h2> <br />
<p>Water is a resource that binds together every human on the planet. The driving force behind our project was to effect a change in the use and misuse of water. In order to better understand the problem we compiled a short report about the global water situation and some specific cases.<br />
</p><br />
<br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Water_Report">read more...</a><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>The i in iGEM</h2><br />
<p>Water is a global issue. While compiling our water report we came across literature from a range of institutions worldwide. Some critical papers had only their abstracts written in English, which hindered our research. This, along with the fact that our team consists of people from 7 different countries inspired us to look into the different languages in iGEM and the effect on the competition.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/The_i_in_iGEM">See what we found...</a><br />
</div><br />
<br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Educational Outreach</h2><br />
<p>Research should not only be accessible to experts. In order to foster the engagement of the broader community with our project and synthetic biology we took part in several outreach programmes and events.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Outreach">See what we did...</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/7/73/IC14-P%26P-awe.jpg"><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/f/f3/IC14-P%26P-1.jpg"><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/Policy_and_PracticesTeam:Imperial/Policy and Practices2014-10-18T03:43:50Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<h1>Policy and Practices</h1><br />
<div class="pure-g"><br />
<div class="pure-u-1-3"><br />
<div class="content content-single bg-orange"><br />
<h2>Introduction</h2><br />
<p>Synthetic biology does not exist in a vacuum. As with all science it exists embedded within society</p><p> During the summer we sought to explore some of the interface between society and our project, the iGEM competition and synthetic biology as a whole.</p><br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<a class="youtube" href="http://www.youtube.com/embed/Xo_JrZxTTXE?autoplay=1"><img src="https://static.igem.org/mediawiki/2014/c/c0/IC14-P%26P-3.jpg"></a><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Informing Design</h2> <br />
<p>The engineering of biology is a multi-faceted challenge. The functions created must interact usefully with the rest of society. To ensure that our solution achieved this we discussed our approach with experts from relevant fields including civil engineering, sustainable development and water treatment.<br />
</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Informing_Design">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-P%26P-2.jpg"><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Water Report</h2> <br />
<p>Water is a resource that binds together every human on the planet. The driving force behind our project was to effect a change in the use and misuse of water. In order to better understand the problem we compiled a short report about the global water situation and some specific cases.<br />
</p><br />
<br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Water_Report">read more...</a><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>The i in iGEM</h2><br />
<p>Water is a global issue. While compiling our water report we came across literature from a range of institutions worldwide. Some critical papers had only their abstracts written in English, which hindered our research. This, along with the fact that our team consists of people from 7 different countries inspired us to look into the different languages in iGEM and the effect on the competition.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/The_i_in_iGEM">See what we found...</a><br />
</div><br />
<br />
<br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Educational Outreach</h2><br />
<p>Research should not only be accessible to experts. In order to foster the engagement of the broader community with our project and synthetic biology we took part in several outreach programmes and events.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Outreach">See what we did...</a><br />
</div><br />
<br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/7/73/IC14-P%26P-awe.jpg"><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<img class="bg" src="https://static.igem.org/mediawiki/2014/f/f3/IC14-P%26P-1.jpg"><br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:40:16Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E.coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">E. coli</em> and <em>G. xylinus iGEM</em> Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">The i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br><br />
<br><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2><em>G.xylinus</em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2><em>E.coli</em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2>RFP <em>E. coli</em> and <em>G. xylinus iGEM</em> Co-Culture</h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2>Functionalisation</h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2>Mechanical Testing</h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result6"><br />
<h2>Water filtration</h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2>Water Report</h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:39:23Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1"><em>G. xylinus</em></a><br />
</li><br />
<li><a data-scroll href="#result2"><em>E.coli</em></a><br />
</li><br />
<li><a data-scroll href="#result3">E. coli</em> and <em>G. xylinus iGEM</em> Co-Culture</a><br />
</li><br />
<li><a data-scroll href="#result4">Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#result5">Mechanical Testing</a><br />
</li><br />
<li><a data-scroll href="#result6">Water filtration</a><br />
</li><br />
<li><a data-scroll href="#result7">Water Report</a><br />
</li><br />
<li><a data-scroll href="#result7">The i in iGEM</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<ul><br />
<br />
<li>Assembled and demonstrated a functional cellulose-producing system in Escherichia coli based on the high producing Acs operon</li><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
<li>Developed a novel co-culture system for production of functionalised bacterial cellulose</li><br />
<br />
<li>Characterised three new cellulose binding domains for the registry and used them to functionalise bacterial cellulose with proteins of interest</li><br />
<br />
<li>Thoroughly characterised the properties of our manufactured biomaterial</li><br />
<br />
<li>Manufactured and tested ultrafiltration filters from bacterial cellulose</li><br />
<br />
<li>Demonstrated novel funtionalisation of cellulose filters with fusion proteins to improve binding of particular contaminants</li><br />
<br />
</ul><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2><em>G.xylinus</em></h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2><em>E.coli</em></h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2>RFP <em>E. coli</em> and <em>G. xylinus iGEM</em> Co-Culture</h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2>Functionalisation</h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2>Mechanical Testing</h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<section id="result6"><br />
<h2>Water filtration</h2><br />
<h3>Overview</h3><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>Key Achievements </h3><br />
<ul><br />
<li> Synthesized and characterised cellulose binding domains (CBD) and their phytochelatin fusions. </li><br />
<li>Proved that cellulose can be functionalised with CBD-phytochelatins.</li> <br />
<li>Showed that bacterial cellulose in itself can successfully filter metal out of solution.</li><br />
<li>Successfully demonstrated filtration of turbid water. </li><br />
<li>Captured Nickel ions on our customisable cellulose filter. </li><br />
<li>Functionalised our homegrown bacterial cellulose with our fusion proteins. </li><br />
</ul><br />
<br />
<section id="result6"><br />
<h2>Water Report</h2><br />
<h3>At a glance</h3><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
</ul><br />
<br />
<br />
<br />
<br />
</section><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:23:33Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1">G. xylinus</a><br />
</li><br />
<li><a data-scroll href="#result2">RESULT 2</a><br />
</li><br />
<li><a data-scroll href="#result3">RESULT 3</a><br />
</li><br />
<li><a data-scroll href="#result4">RESULT 4</a><br />
</li><br />
<li><a data-scroll href="#result5">RESULT 5</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2>G.xylinus</h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2>E.col</h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2>RFP <em>E. coli</em> and <em>G. xylinus iGEM</em> Co-Culture</h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2>Functionalisation</h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2>Mechanical Testing</h2><br />
<h3>Overview</h3><br />
<p>To check the feasibility of using our bacterial cellulose as a customisable ultrafiltration membrane, the mechanical properties were tested. For this to work, we checked the tensile strength of our filter, calculated the shear stress and estimated the processing method that produces membrane with the longest life-time. Our ultimate tensile stress calculated matched with literature values of bacterial cellulose within standard deviation, and the data analysis provided the insight to use non-blended cellulose rather than blended..</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Introduced a new aspect to the manufacturing track in terms of quantitatively characterising the mechanical properties of our product, bacterial cellulose<br />
</li><br />
<li>Quantified the tensile stress-strain properties of our bacterial cellulose.<br />
</li><br />
<li>Discovered that our bacterial cellulose can sustain an order of magnitude higher water pressures than those typically used for ultrafiltration membranes.<br />
</li><br />
<li>Established that non-blended compared to blended bacterial cellulose was significantly more ductile, and would have longer life time as a water filter, which informed the choice of cellulose for the final product.<br />
</li><br />
<li>Tested and analysed 20 samples of bacterial cellulose test pieces.<br />
</li><br />
<li>Created a size and quality optimised gif for visualisation of the experiment and written a protocol for future iGEM teams to do the same.<br />
</li><br />
<br />
<br />
<br />
</ul><br />
</section><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ResultsTeam:Imperial/Results2014-10-18T03:22:01Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Results</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#overview">Overview</a><br />
</li><br />
<li><a data-scroll href="#result1">G. xylinus</a><br />
</li><br />
<li><a data-scroll href="#result2">RESULT 2</a><br />
</li><br />
<li><a data-scroll href="#result3">RESULT 3</a><br />
</li><br />
<li><a data-scroll href="#result4">RESULT 4</a><br />
</li><br />
<li><a data-scroll href="#result5">RESULT 5</a><br />
</li><br />
<br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<h2>Overview</h2><br />
<br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Developed a set of new and improved protocols for synthetic biology in <em>G. xylinus</em></li><br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="result1"><br />
<h2>G.xylinus</h2><br />
<h3>Overview</h3><br />
<p>Bacterial cellulose has great potential in many areas, including water purification, tissue scaffolds, wound dressings, etc., however, until now, all bacterial cellulose-based materials have been created using chemical or physical post-production processing, not genetic engineering. This is due to the lack of well-developed tools and methods for Gluconacetobacter genetic engineering, as well as the lack of genome sequence of the highest cellulose-producing strain ATCC 53582. We have overcome the numerous difficulties associated with G.xylinus genetic engineering, and turned G.xylinus KI and ATCC 53852 strains into new platforms for the production of cellulose-based biomaterials by sequencing the genomes of ATCC 53582 and KI, creating a genetic toolbox of consisting of five new plasmid backbones and around 40 widely used genes, and developing a set of new and improved protocols for G.xylinus genetic engineering.</p><br />
<h3>Key Achievements</h3><br />
<ul><br />
<li>Isolated a new strain of <em>Gluconacetobacter</em> (named <em>G. xylinus</em> igem) from Kombucha tea and characterized its properties fully.</li><br />
<li>Sequenced the previously unknown genomes of <em>G. xylinus</em> ATCC 53582 and <em>G. xylinus</em> igem strains - the first genomes sequenced in the history of iGEM </li><br />
<li>Discovered four new plasmids capable of replication in <em>Gluconacetobacter</em> species - pSEVA321, pSEVA331, pSEVA351 and pBAV1K, which replicate both in <em>G. xylinus</em> ATCC 53582 and igem strains as well as in <em>E. coli</em></li><br />
<li>Were the first in science to create transgenic cells of <em>G.xylinus</em> igem strain </li><br />
<li>Using our discovered plasmids, created a genetic toolbox consisting of 40 genes for <em>G. xylinus</em> engineering and expressed them in the ATCC 53582 and igem</li> <br />
<br />
<li>Developed a set of new and improved protocols for efficient genetic engineering of <em>G. xylinus</em></li><br />
<li>In summary, turned <em>G. xylinus</em> ATCC 53582 and igem strains into new model organisms and developed the necessary tools to create a powerful platform for the synthesis of new cellulose-based biomaterials and water filters</li><br />
<br />
<br />
<br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result2"><br />
<h2>E.col</h2><br />
<h3>Overview</h3><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
<br />
</section><br />
<section id="result3"><br />
<h2>RFP <em>E. coli</em> and <em>G. xylinus iGEM</em> Co-Culture</h2><br />
<h3>Overview</h3><br />
<p>Based on the hypothesis of <em>E. coli</em> BL21D3 operating anaerobically and <em>G. xylinus</em> replicating aerobically, a co-culture experiment for bacterial cellulose was attempted. Initially, the best possible carbon source among 5 available was found experimentally. This data was used to inform the choice of glycerol and glucose as the carbon feedstock. With these carbon feedstocks, <em>E. coli</em> with RFP expressed were successfully embedded in the bacterial cellulose, and RFP was clearly visible. </p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Experimentally determined the optimum carbon feedstocks for a HS media based co-culture of <em>E. coli</em> and <em>G. xylinus</em>. </li><br />
</ul><br />
<br />
</section><br />
<section id="result4"><br />
<h2>Functionalisation</h2><br />
<h3>Overview</h3><br />
<p>Attaching functional proteins to cellulose can expand the properties of cellulose and allow us to selectivity capture specific contaminants in water. By creating fusion proteins of sfGFP and metal-binding proteins with five different cellulose binding domains, three of which are new to the registry, we were able to characterise the relative affinities of the CBDs and show proof-of-concept removal of contaminants from water.</p><br />
<br />
<h3>Key Achievements </h3><br />
<ul><br />
<li>Added three new cellulose binding domains to the registry</li><br />
<li>Performed an assay with sfGFP-fusions to determine the strongest potential binders which could be carried forward for further testing</li><br />
<li>Identified potential metal binding proteins to bind heavy metals from wastewater, including the addition of a new promising polypeptide phytochelatin EC20</li><br />
<li>Tested metal ion capture ability of the CBD-phytochelatin fusion constructs when attached to cellulose</li><br />
<br />
</ul><br />
<br />
</section><br />
<section id="result5"><br />
<h2>HEADLINE RESULT OVERVIEW 5</h2><br />
<p>Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.Much Text. Such prose. Wow.</p><br />
<br />
</section><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:10:59Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB3K3-LacI-pLAC</h4><br />
<p>A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has an RBS, the LacI repressor followed by a double terminator then a Lac inducible promoter. The composite part created give constitutive expression of the Lac repressor allowing for induction by IPTG. The parts were then moved into the pSB3k3 backbone to be compatible with pSB1C3.</p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: pSB-AcsAB</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: pSB-AcsCD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: pSB-AraC-pBAD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: pSB-AraC-pBAD-AcsAB and pSB-LacI-AcsAB</figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 3</figcaption><br />
</figure><br />
</div><br />
<br />
</section><br />
<section id="future"><br />
<h2>Future Work</h2><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:08:22Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB3K3-LacI-pLAC</h4><br />
<p>A compatible plasmid and induction system was cloned to allow expression of the operon in two parts. The medium/strong promoter J23110 was cloned in front of the quad part inverter Q01121. The inverter has in pSB3k3</p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: pSB-AcsAB</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: pSB-AcsCD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: pSB-AraC-pBAD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: pSB-AraC-pBAD-AcsAB and pSB-LacI-AcsAB</figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 3</figcaption><br />
</figure><br />
</div><br />
<br />
</section><br />
<section id="future"><br />
<h2>Future Work</h2><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T03:02:18Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB-LacI-pLAC</h4><br />
<p> text </p><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: pSB-AcsAB</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: pSB-AcsCD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: pSB-AraC-pBAD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: pSB-AraC-pBAD-AcsAB and pSB-LacI-AcsAB</figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 3</figcaption><br />
</figure><br />
</div><br />
<br />
</section><br />
<section id="future"><br />
<h2>Future Work</h2><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T02:57:41Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>E. coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Congo red staining of microbial cellulose in <em>E. coli</em></figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption></figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB-LacI-pLAC</h4><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: pSB-AcsAB</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: pSB-AcsCD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: pSB-AraC-pBAD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: pSB-AraC-pBAD-AcsAB and pSB-LacI-AcsAB</figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 3</figcaption><br />
</figure><br />
</div><br />
<br />
</section><br />
<section id="future"><br />
<h2>Future Work</h2><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/EColiTeam:Imperial/EColi2014-10-18T02:54:25Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1><em>E. coli</em></h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#aim">Aims</a><br />
</li><br />
<li><a data-scroll href="#engineering">Engineering</a><br />
</li><br />
<li><a data-scroll href="#methods">Materials and Methods</a><br />
</li><br />
<br />
<li><a data-scroll href="#results">Results</a><br />
</li><br />
<li><a data-scroll href="#future">Future Work</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p><em>Escherichia coli</em> is the organism of choice for synthetic biology. It is thoroughly characterised, easy to engineer and has numerous parts, control circuits and complex constructs tested in this host.</p><br />
<p>Some <em>Escherichia coli</em> strains have evolved to produce low amounts of cellulose but the machinery under specific regulatory control (its secretion is generally linked to biofilm formation and stress situations). In order to expand the use of bacterial cellulose as a functional biomaterial that is cost effective to produce, it is desirable for its production machinery to be implemented in an organisms that is easy to engineer and has proven success in large scale bioreactors.</p><br />
<p>Here, we confirm that the high output cellulose production machinery of <em>Gluconacetobacter Xylinus</em> can be transferred into other organisms. We have proven function of the Acs cellulose producing operon in <em>Escherichia coli</em> using Congo Red binding assays.<br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Contributed an optimised Asc cellulose production operon to Registry of Standard Parts.</li><br />
<li>Proved the portability of <em>Gluconacetobacter xylinus</em> operon.</li><br />
<li>Assembled a fully synthetic, functional, cellulose-producing system in <em>Escherichia coli</em></li><br />
<li>Demonstrated the synthesis operon in a two plasmid system for separate induction of genes</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<br/><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/2/20/IC14-ecoli-fig1.jpg"><br />
<figcaption>Figure 1</figcaption><br />
</figure><br />
</div><br />
<br />
<br />
<div class="pure-u-1-2"><br />
<figure class="content-image image-full"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/ad/IC14-ecoli-fig3.jpg"><br />
<figcaption>Figure 2</figcaption><br />
</figure><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<section id="Aims"><br />
<h2>Aims</h2><br />
<br />
<p>By transferring the cellulose production operon from its native organism <em>Gluconacetobacter xylinus</em> into the lab and industrially friendly host <em>Escherichia coli</em>, we aim to improve cellulose production per unit time to achieve more cost effective pellicle growth and to encourage further synthetic biology with microbial cellulose. <em>E. coli</em> grows considerably faster plus tolerates higher temperatures and more vigorous aeration. The ease of genetic engineering and the wealth of other characterized Biobricks increases the potential for exciting future projects</p><br />
<br />
<br />
</section><br />
<section id="engineering"><br />
<h2>Engineering</h2><br />
<p>The cellulose production operon in <em>Gluconacetobacter xylinus</em> is a 10kb genomic region, consisting of four main elements:</p><br />
<ul><br />
<li>acsAB, known as cellulose synthase, is made up of two domains: acsA being the catalytic domain, and acsB being the cyclic-di-GMP-binding domain. This modular enzyme requires the second messenger cyclic-di-GMP in order to carry out efficient catalysis.</li><br />
<li>acsC codes for an oligomeric element that gets embedded in the extracellular membrane and allows transport of the growing polymer across the cell membrane into the extracellular environment.</li><br />
<li>acsD is believed to be a non-essential element, although it is a key player in the control of cellulose crystallinity and required for maximal cellulose productivity.</li><br />
</ul><br />
<p>The native operon is highly regulated at transcriptional, translational and post-translational levels. Cellulose production responds to a wide set of internal signals and environmental cues. The native ribosomal binding sites (RBS) are predicted to be weak by translation rate calculators (The <a href="https://salis.psu.edu/software/"> Salis Lab RBS calculator </a> and <a href="http://sbi.postech.ac.kr/utr_designer"> Postech UTR designer </a>). This is perhaps to reduce noise in gene expression (strong promoter, weak RBS is less noisy that weak promoter strong RBS). The promoter region has not yet been characterized in <em>Gluconacetobacter xylinus</em>, however.</p><br />
<br />
<p>The first step of our computational design engineering was to identify the coding sequences and extract them from NCBI. We removed some native regulation by codon-optimizing the sequences for expression in <em>E.coli</em> and replaced the native RBS’s with the strong B0034 sequence. The 6 base pairs either side of the B0034 RBS were edited with the Salis Lab RBS calculator design function to tune RBS strength output to better preserve the natural stoichiometry.</p><br />
<br />
<p>Finally, in order to allow for even more customizable fine-tuning of the system, the operon was divided and cloned into two separate expression vectors: the AcsAB element was cloned under the control of the inducible pBAD promoter contained within pSB1C3, a high copy plasmid that would contribute to higher expression of Cellulose Synthase. Alternatively, AcsC and AcsD, believed to be expressed at lower levels in <em>G.xylinus</em>, was put under the control of the pLAC promoter and was transferred into a low copy plasmid, pSB3K3 so as to maintain lower levels of expression. This approach provided the following advantages:</p><br />
<ul><br />
<li>Reducing the size of the final expression vector avoids complications during assembly and vector take-up, and it also prevents a large construct from becoming a burden for cell growth and vector propagation.</li><br />
<li>By expressing the cellulose production machinery from two separate expression vectors, the following levels of control become available to us: the first being the changes in vector copy number, which directly affects gene expression levels throughout induction, and the second being the ability to activate the system using two different inducers. These key features of our system allow for a larger scope for fine-tuning and optimization of cellulose production levels.</li><br />
<br />
</ul><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/5/55/IC14-ecoli-pBAD-pLAC-CD.png"><br />
<figcaption>Figure 3: pSB-pBAD-AB and pLAC-CD</figcaption><br />
</figure><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-ABCDfragments.jpg.png"><br />
<figcaption>Figure 4: acsABCD fragments</figcaption><br />
</figure><br />
<p>With this approach, we allow for our system to be implemented in new range of hosts because a larger set of growth conditions, inducer concentrations and growth phases can be tested in order to achieve the required stoichiometry for the system to become functional.</p><br />
<br />
<br />
<p>In order to ease synthesis, the operon sequence was split into 4 fragments of similar sizes. We took advantage of the presence of two restriction sites: An NcoI present within the AcsAB sequence, and a PvuII site contained within AcsC. Furthermore, the BioBrick prefix and suffix were included and any additional sites removed elsewhere.</p><br />
<br />
<p>By standard cloning, these fragments could easily be put together to yield the following constructs:</p><br />
<figure class="content-image image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/ff/IC14-ecoli-AB-CD-constructs.png"><br />
<figcaption>Figure 5: acsAB and acsCD constructs</figcaption><br />
</figure><br />
<br />
<p>Gene Designer served as a very useful tool for assembling constructs and predicting cloning outcomes before proceeding with the experimental procedure. Find above the plasmid maps of our resulting constructs, and refer to Materials and Methods for a deeper insight into the assembly process.</p><br />
<br />
</section><br />
<section id="methods"><br />
<h2>Materials and Methods</h2><br />
<div class="accordion"><br />
<h3>1.0 Cell Strains and Media Components</h3><br />
<div><br />
<p><em>Escherichia coli</em> strain DH10B were made chemically competent following a standard protocol and were used to clone the pSB-AraC-pBAD and pSB-LacI-pLAC elements. Additionally, High Efficiency chemically competent DH10B <em>Escherichia coli</em> were purchased from New England Biolabs for assembly of the Acs cellulose-producing operon, which was codon-optimized for expression in E.coli and synthesized by GeneArt. Both strains were grown overnight in liquid cultures (supplemented with specific antibiotics), or on semi-solid LB-Agar plates, provided with the specific antibiotic, as listed on the table below.</p><br />
<br />
<p>Luria Broth Miller (LB) and LB Agar were purchased from VWR, prepared using standard protocols and used throughout the experimental procedure. During characterization, Acs-containing strains were supplemented with 1% D-glucose, 0.1% Arabinose and 0.5mM IPTG.<br />
</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th class="tg-e3zv">Plasmid name</th><br />
<th class="tg-e3zv">Vector backbone</th><br />
<th class="tg-e3zv">Antibiotic concentration (ug/ml)</th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AcsCD</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD-AcsAB</td><br />
<td class="tg-031e">pSB1C3</td><br />
<td class="tg-031e">Chloramphenicol 50</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-LacI-pLAC-CD</td><br />
<td class="tg-031e">pSB3K3</td><br />
<td class="tg-031e">Kanamycin 25</td><br />
</tr><br />
</table><br />
<figcaption>Figure 6: List of antibiotics used, in relation to their respective constructs</figcaption><br />
</figure><br />
<br />
</div><br />
<h3>2.0 Chemicals </h3><br />
<div><br />
<p>Congo Red was purchased from Sigma Aldrich (Steiheim, Germany) and diluted in 1x PBS to a concentration of 350 uM. The final Congo Red concentration used during system characterization steps was 20 uM. This was also used, also at a concentration of 20 uM, to make LB Agar Congo Red Assay plates.</p><br />
</div><br />
<h3>3.0 Construct Assembly</h3><br />
<div><br />
<h4>3.1 Cloning of pSB-AraC-pBAD</h4><br />
<div><br />
<p>The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates, all of which follow the standard structure showed on figure 7. The primers used during this procedure were as follows:<br />
</p><br />
<ul><br />
<li>Forward: TACTAGTAGCGGCCGCTGCAG</li><br />
<li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</li><br />
</ul><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/IC14-ecoli-AraC-pBAD.png"><br />
<figcaption>Figure 7 - Plasmid maps describing both the original (left) and engineered (right) AraC-pBAD-containing parts, including all relevant elements. These were designed and cloned in silico on GeneDesigner.</figcaption><br />
</figure><br />
</div><br />
<p>The amplified elements were DpnI-treated following a standard procedure (New England Biolabs), and were subsequently submitted to a purification step (Qiaquick PCR clean up, Qiagen) prior to self-ligation. Three different template concentrations were tested during ligation (specifically 3 ng, 7.5 ng and 15 ng), and were incubated at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.</p><br />
<h4>3.2 Cloning of pSB-LacI-pLAC</h4><br />
<div><br />
<br />
</div><br />
<h4>3.3 Assembly of AcsAB and AcsCD </h4><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3c/IC14-ecoli-construct-assembly.jpg"><br />
<figcaption>Figure 8:</figcaption><br />
</figure><br />
<p>The AcsABCD operon was designed in silico as described in the previous section. It was ordered for synthesis at GenArt in the form of four separate elements of similar sizes, named AcsA, AcsB, AcsC and AcsD, respectively. After synthesis, the constructs were directly transformed into DH10B <em>E.coli</em> using a standard chemical transformation protocol and plated overnight supplied with 50 ug/ml Kanamycin. 5ml LB were inoculated with a freshly growing colony and grown overnight at 37 C, under shaking conditions. Glycerol stocks were produced prior to proceeding with the assembly process.</p><br />
<p>In order to meet the Registry standards, we aimed to clone these elements into pSB1C3. To do so, we proceeded as described on figure 8. Two separate rounds of digestion were carried out using EcoRI, NcoI, PvuII and PstI to, and the resulting fragments (AcsA, AcsB, AcsC and AcsD and linearized pSB1C3) were submitted to a three-part ligation after dephosphorylation of the vector backbone (rAPid desphosphorylation, Roche). An equimolar ratio amongst all three parts was established during the ligation procedure, which in turn proceeded at 4 degrees overnight. The NEB High Efficiency Transformation protocol was used on NEB 10B cells (New England Biolabs) to propagate the resulting plasmid. Transformed cells were plated and incubated overnight at 37 C. 5 ml LB supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of colonies for further analysis (refer to Results for additional information).</p><br />
<br />
<h4>3.4 Assembly of pSB-AraC-pBAD-AcsAB</h4><br />
<p>AcsAB was cloned into pSB-AraC-pBAD by Biobrick cloning. The destination vector was linearized using SpeI and PstI (New England Biolabs), and AcsAB (previously digested with XbaI and PstI, and gel extracted using the Minelute Gel Extraction Kit, by Qiagen) was ligated at a 1:1 ratio throughout an overnight ligation at room temperature. The resulting part was transformed into chemically competent DH10B Escherichia coli and plated on LB Agar+Chloramphenicol plates, grown overnight at 37 C. 5 ml LB falcons supplied with 50 ug/ml Chloramphenicol were inoculated with a selection of freshly grown colonies for further restriction analysis (refer to Results for additional information)</p><br />
<br />
<h4>3.5 Assembly of pSB-LacI-pLAC-CD</h4><br />
<p>Similarly to 3.4, AcsCD was cloned by BioBrick cloning into the pSB3K3 low copy expression vector containing the LacI-pLAC regulatory elements. Vector and insert were ligated at a 1:1 ratio overnight at room temperature. After transformation and plating on LB Agar+Kanamycin (25 ug/ml), colonies were screened by Greentaq colony PCR, and were further confirmed during the Congo Red Assay.</p><br />
</div><br />
<h3>Electroporation of pSB-pLAC-CD into electrocompetent AcsAB-containing DH10B cells</h3> <br />
<div><br />
<p>DH10B E.coli already containing the AcsAB construct were made electrocompetent using a standard protocol, which can be found in the Protocols section. A second round of transformation was carried to insert pLAC-AcsCD. 5ul of miniprepped pSB-pLAC-CD (diluted in ddH2O) were added into 50ul electrocompetent DH10B cells already containing the pBAD-inducible AcsAB element. Electroporation was carried out in in 10mm electrocuvettes at 1.8 kV, 200 Ohm resistance and 25 mF capacitance. 500ul SOC medium was added to the electroporated samples and these were recovered at 37 °C for 1h before plating on Kanamycin25 + Chloramphenicol 50 LB Agar plates.</p><br />
</div><br />
<h3>Congo Red Characterization</h3><br />
<div><br />
<p>LB Agar Congo Red assay plates were prepared with a final Congo Red concentration of 20uM, and they were supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose. Transformed cells containing both AcsAB and AcsCD were plated on Congo Red assay plates and incubated at 37 °C. They were qualitatively assayed after 24h and 48h for cellulose production. Finally, 5 mL LB supplied with 0.1% Arabinose, 0.5mM IPTG, 50 ug/mL Chloramphenicol, 25 ug/mL Kanamycin and 1% Glucose were inoculated with freshly grown, cellulose-producing colonies and were grown for 16h at 30 °C, 180 rpm. An empty vector control was also grown overnight for comparative analysis. These liquid cultues were supplied with Congo Red, to yield a final concentration of 20uM. They were incubated under static conditions for 2h at room temperature, and were later pelleted down to allow for qualitative analysis of Congo Red binding.</p><br />
<br />
<p>AcsAB functionality was assayed by inducing AcsAB-containing cells with 0.1% Arabinose in 5mL LB supplied with 1% Glucose and Chloramphenicol. Overnight incubations were set up at 30 °C and 37 °C, and both empty vector controls and un-induced controls were also assayed. Cells were pelleted at 4000rpm for 10 minutes and the supernatant was kept for further analysis. Cells were resuspended in 1xPBS and sonicated for 3 minutes as on/off cycles of 15 seconds. Both the membrane and soluble samples produced after centrifugation were kept for further analysis. Congo Red was then added to the LB, soluble and membrane samples up to a final concentration of 20uM, and no Congo Red samples were also kept for further inspection. Samples were incubated for 2h at static conditions and at room temperature to allow for Congo Red binding. 96-well plates were inoculated for further absorbance measurements at 490nm.</p><br />
</div><br />
<br />
<br />
</div><br />
</section><br />
<br />
<br />
<section id="results"><br />
<h2>Results</h2><br />
<div class="accordion"><br />
<h3>Constructs</h3><br />
<div><br />
<p>All constructs were assembled as described in Materials and Methods. As a preliminary verification step, restriction analyses were carried out using the corresponding restriction enzymes (refer to figure legends for more details) and results were visualized on 0.7-1% agarose gels. Final confirmation was obtained by gene sequencing, during which the BioBrick Verification Primers and walking primers were used. These are shown on the table below, please refer to the Registry for further information.</p><br />
<br />
<figure class="content-image"><br />
<table class="tg image-full"><br />
<tr><br />
<th </th><br />
<th </th><br />
</tr><br />
<tr><br />
<td class="tg-031e">pSB-AraC-pBAD</td><br />
<td class="tg-031e">Forward: TACTAGTAGCGGCCGCTGCAG<br />
<br>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">BioBrick Verification Primers</td><br />
<td class="tg-031e">Forward: TGCCACCTGACGTCTAAGAA<br />
<br>Reverse: ATTACCGCCTTTGAGTGAGC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 1</td><br />
<td class="tg-031e">TCT GAA TTA TGC CAT TGG TCA TAC CG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 2</td><br />
<td class="tg-031e">ATA TGT TTC ATG CAG TTG GCA CC</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 3</td><br />
<td class="tg-031e">GAT GCA TGG GTT GAT TGG GG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 4</td><br />
<td class="tg-031e">ATC CAG CAC ATC CGA CCT TTG</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 5</td><br />
<td class="tg-031e">GTT ACC GCA AGT AAA CTG CAA G</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 6</td><br />
<td class="tg-031e">GAT GGT CTG ATT CGT CTG GTT A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 7</td><br />
<td class="tg-031e">ACG CAG CAC AGG TCA GAC CGG TGA A</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 8</td><br />
<td class="tg-031e">ATA TTG ATC TGA CCA CCG AACA</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 9</td><br />
<td class="tg-031e">TGC ACC GCC TGG TGA AAA TGG TT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 10</td><br />
<td class="tg-031e">GTG GCT ATG CAA TTC AGA CAG GT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 11</td><br />
<td class="tg-031e">TTC ATT CCC AGC GGT CGG TCG AT</td><br />
</tr><br />
<tr><br />
<td class="tg-031e">Walking Primer 12</td><br />
<td class="tg-031e">GTT TGC GTG GTG ATC TTT TT</td><br />
</tr><br />
</table><br />
<figcaption>Figure 9 - List of primers used by Team E.coli during the experimental procedure</figcaption><br />
</figure><br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/f8/IC14-ecoli-gel-pSB-AcsAB.jpg"><br />
<figcaption>Figure 10: pSB-AcsAB</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/c/c1/IC14-ecoli-gel-pSB-AcsCD.jpg"><br />
<figcaption>Figure 11: pSB-AcsCD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/b/b9/IC14-ecoli-gel-pSB-AraC-pBAD.jpg"><br />
<figcaption>Figure 12: pSB-AraC-pBAD</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/e/e7/IC14-ecoli-gel-pSB-AraC-pBAD-AcsAB-pSB-LacI-AcsAB.jpg"><br />
<figcaption>Figure 13: pSB-AraC-pBAD-AcsAB and pSB-LacI-AcsAB</figcaption><br />
</figure><br />
</div><br />
<br />
<div class="pure-u-1-2"><br />
<br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/4a/IC14-ecoli-gel-colony1.jpg"><br />
<figcaption>Figure 14: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
<div class="pure-u-1-2"><br />
<figure class="content-image"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/1/10/IC14-ecoli-gel-colony2.jpg"><br />
<figcaption>Figure 15: pLAC-AcsCD colony PCR results. Further details on the procedure can be found on the Methods and Materials section. Those colonies that we testes further have been highlighted with numbers on the pictures. Specifically, colony A1 was used for subcloning into AcsAB containing E.coli DH10B. <br />
Plates A and B were generated <br />
</figcaption><br />
</figure><br />
</div><br />
</div><br />
<br />
<br />
<br />
</div><br />
<h3>Characterising Cellulose Production</h3><br />
<div><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/f/fe/IC14-ecoli-fig2.png"><br />
<figcaption>Figure 3</figcaption><br />
</figure><br />
</div><br />
<br />
</section><br />
<section id="future"><br />
<h2>Future Work</h2><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/Water_ReportTeam:Imperial/Water Report2014-10-18T02:28:24Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<br />
<html><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:highcharts?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:data?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:exporting?action=raw&ctype=text/js"></script><br />
<br />
<br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:charts?action=raw&ctype=text/js"></script><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>The Water Report</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#water_stress">Water Stress</a><br />
</li><br />
<br />
<li><a data-scroll href="#sustainable">Sustainability</a><br />
</li><br />
<li><a data-scroll href="#decentralisation">Decentralisation</a><br />
</li><br />
<li><a data-scroll href="#wastewater">Wastewater</a><br />
</li><br />
<li><a data-scroll href="#synbio">Synthetic Biology</a><br />
</li><br />
<li><a data-scroll href="#conclusions">Conclusions</a><br />
</li><br />
<br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<br />
<h2>At a glance</h2><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>All life depends on water. Our Earth, home to all species, remains the only place we know capable of sustaining life. In our search for others amongst the stars, it is water we look for first.</p> <br />
<br />
<p>More than 71% of the planet is covered in this resource, but only a small proportion is suitable for human use. 97.5% percent of the world’s water is salt water and of the 2.5% freshwater, nearly 70% is locked in glaciers and the ice caps. The majority of what remains is inaccessible; either as soil moisture, permafrost or deep beneath the ground. All considered, less than 0.03% of global water is viable for human use (US Geological Survey 2014).</p> <br />
<br />
<p>With the world’s population is rising at a rate of 80 million people a year, water demands are increasing proportionally (Worldometers no date). In order to sustain over seven billion people, we require more than 200 million litres of clean water per second (Waterwise no date). 67% of this is for agriculture, 22% for domestic, and 11% for industrial use.</p><br />
<br />
<p>Our overstretched resources are very unevenly distributed. Areas with high natural resources are rarely near the urban centres of high demand and this is becoming more severe. For example the top countries for fresh water supplies, Brazil, Russia and Canada, with 30% of the world supply between them, are not areas of highest population growth, India, China and Nigeria take the top spots there (Cohen & Siu 2013).</p><br />
<div id="water_use_breakdown" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<br />
<br />
</section><br />
<br />
<section id="water_stress"><br />
<h2>Water Stress - An Increasing Problem</h2><br />
<br />
<p>Water stress occurs when the <em>demand for water exceeds the available amount during a certain period or when poor quality restricts its use</em> (EEA no date). Water stress usually occurs in places with low rainfall and high population density or in areas with intensive agricultural irrigation. It means deterioration of the available freshwater supply both in terms of quantity (from aquifer over-exploitation or drained rivers and lakes) and quality (from eutrophication, saline intrusion, organic matter pollution, heavy metal contamination and other problems).</p><br />
<h3>Causes of water stress and scarcity</h3><br />
<h4>Climate Change</h4><br />
<p>Climate change, due to an increasing greenhouse effect, has a direct impact on the hydrological cycle (IPCC 1996). Increased evaporation from water bodies leads to an overall increase in precipitation, but the changing climate also causes this to be distributed more unevenly. This can alter the durations of wet and dry seasons leading to droughts and floods with severe repercussions for water resources (Arnell 2004) . The changing climate makes our need for sustainable water scarcity solutions ever more pressing. </p><br />
<h4>Pollution</h4><br />
<p>Water sources contaminated from agricultural runoff, domestic wastewater, industrial pollutants and from atmospheric pollutants as a result of burning fossil fuels are at risk of eutrophication. Less dynamic water resources, such as lakes, are more susceptible due to longer water residence and through their action as integration sinks for multiple polluted water sources. The high-nutrient load (mainly nitrogen and phosphorus), causes algal blooms which may be toxic and complicate many methods of water purification.</h4><br />
<br />
<p>Another increasing issue with water quality is the influx of personal care products and pharmaceuticals. Examples of these pollutants include painkillers, antibiotics and female hormonal birth control (UNEP, ERCE, UNESCO. 2008). Certain compounds may be long lived so accumulate in recycled urban wastewater.</p> <br />
<br />
<figure class="content-image image-center"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a4/Water_stress_unep.jpg"><br />
<figcaption>Projected increase of water withdrawals between 2005 and 2025 (<em>unep.org</em>)</figcaption><br />
</figure><br />
<br />
<br />
<h3>Social and Economic Effects</h3><br />
<h4>Water conflict</h4><br />
<p>Water has a long history as a source of conflict and neighboring nations have often been at odds over disputed supplies. As far back as the 3rd millennium BCE, King Lagash, significantly reduced the water flow in the neighboring Umma (modern day Iraq) by building boundary canals around his territory. </p><br />
<br />
<p>There are many types of conflict including but not limited to:</p><br />
<ul><br />
<li><b>Disputes over control and development of water resources</b>: water resources, lakes, rivers and aquifers are valuable, interconnected and do not respect state boundaries.</li><br />
<li><b>Military tools and targets</b>. In the first case, water resources or systems are used as a tool or weapon for military action for example diverting supplies to cause flood or provide defence. In the second case, water resources are targets of military actions, deliberately polluting or destroying enemy supplies.</li><br />
<li><b>Use as a political tool</b>. Water resources or systems are controlled by state or non-state actors as a means to achieve political goals.</li><br />
<li><b>Target for Terrorism</b>. Water resources or systems are targeted or threatened and by non-state actors as means of violence and coercion.</li><br />
</ul><br />
<br />
<p>Notable current sources of water conflicts are demonstrated below:<br />
(Pacific Institute)(Gleick 1994)(Gleick 1998)</p><br />
<h4>In The News</h4><br />
<h5>Middle East</h5><br />
<p>Recent developments in the Middle East highlight the importance of water in conflict. Islamic State militants are using water as a weapon against villages that resist their advance by cutting off the supplies. Currently, IS control major parts of Tigris and Euphrates, on which all of Iraq and a large part of Syria rely for food, water and industry (Cunningham 2014) (Vidal 2014). Matthew Machowski, a Middle East security researcher for the UK Parliament and Queen Mary University notes that “It is already being used as an instrument of war by all sides. It can be claimed that controlling water resources in Iraq is strategically more important than controlling oil refineries… cut it off and you create great sanitation and health crises” (Vidal 2014).</p><br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/7e/Iraq_post_ISIS.jpeg"><br />
<figcaption>Iraqi men move a boat that was stuck on the banks of the Euphrates River after supplies were blocked by anti-government fighters who control a dam further upstream(<em>guardian.com</em>)</figcaption><br />
</figure><br />
<br />
<br />
<h5>Brazil</h5><br />
<p>One of the world’s most rapidly expanding economies has been affected by droughts this past summer. A major affected area was Sao Paulo, the southern hemisphere’s largest city. Reservoirs of the Cantareira system that supply 45% of the city fell to 9.7% capacity, an unprecedented low. Conflict ignited between Sao Paulo, Rio de Janeiro and Minas Gerais, the country’s three most prosperous – and most severely water stressed – states. Sao Paulo controversially diverted water from the Paraiba de Sul in order to supply the Cantareira system, by reducing the flow of the Jaguari River (a tributary to the Paraiba de Sul). Paraiba de Sul is one of the major water and energy supplies of Rio de Janeiro.</p><br />
<p>This move violated a federal pact between the three states, made due to fears water transfer to the Cantaneira system may have adverse effect on the environmental, economic and social balance of all three states.</p><br />
<p>The disagreement recently reached the Supreme Court and eventually concluded with Sao Paulo reducing water flow in two of its dams and Rio de Janeiro reducing water capture from the Paraiba de Sul river basin (International Law Office 2014).</p><br />
<br />
<figure class="content-image image-left image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/Cantaneira_system_current_state.jpg"><br />
<figcaption>The Cantaneira system that supplies 45% of Sao Paulo with water, here seen after the recent droughts (<em>guardian.com</em>)</figcaption><br />
</figure><br />
<br />
<p>Many conflicts stem from large areas and communities relying on a single, shared water supply. In addition to preventing overexploitation it is helpful to provide communities with alternative, more local purification solutions to empower them and give control of their own resources (Faeth and Weinthal 2012)<br />
<br />
<figure class="content-image image-center"><br />
<a class="iframe" href="https://static.igem.org/mediawiki/2014/3/3b/WATER_war_and_peace_2.jpg"><img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3b/WATER_war_and_peace_2.jpg"></a><br />
<figcaption><br />
The map displays nearly 2,000 incidents, involving conflict and collaboration alike, over shared river basins from 1990 to 2008. The circles in the sidebar compare about 2,200 events—including another 200 disputes over resources other than shared rivers—from the same period.<br />
<em>Data Visualization by Pitch Interactive; River locations courtesy The Global Runoff Data Centre, 56068 Koblenz, Germany</em>(<em>popsci.com</em>) </figcaption><br />
</figure><br />
<br />
<br />
<h4>Social implications</h4><br />
<p>It is predicted that within the next 15 years, more than half of the world’s population will be living under severe water stress (OECD 2012). So far, water scarcity has been an issue for individuals and families living in poverty, while most in the developed world enjoy reliable, plentiful access to safe water. As the stress increases, it will hit many of us who were previously unaffected but the majority of the hardship will continue to fall on the worlds poorest.</p> <br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/49/India_women_water.jpg"><br />
<figcaption>Women in India walking through dry land to access a water supply.</figcaption><br />
</figure><br />
<p>There are further issues arising from water accessibility and sanitation regarding gender inequality. In developing countries significant responsibility for acquisition and distribution of water is placed upon women and children of the family. Difficulties in access result in many hours lost that could instead be used for income generation, caring for family members or education (UNDP 2006). This reinforces the cycle of gender disempowerment and inequality. In rural parts of eastern Africa, women and girls spend significant amounts of their day trying to access water sources. Their journey may take them through treacherous places and increases risk of violence and sexual abuse. Women are more likely to voice concerns regarding water and sanitation compared to their male counterparts, however due to their inferior social standing such concerns often go unheard. (Mengistu 2012).</p> <br />
<br />
<p>Water stress can reinforce or increase inequality. Solutions to the water crisis are necessary not just for a healthier, more peaceful world, but also a fairer one. </p><br />
<br />
<h4>Economic Implications</h4><br />
<p>Water is a key input in the smallest of businesses and the largest of corporations alike. Without water it is impossible to generate energy or produce goods. Therefore the economic welfare of a state relies on its water resources, it sustains the backbone of the economy. Corporations are increasingly forced to take water availability into account. For example the Coca Cola plant in Mehdiganj, India, chose to close due to the increasing water stress in the region (Guardian 2014). The socioeconomic impacts of water stress are considered in case studies below.</p><br />
<div id="freshwater_breakdown" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<div id="freshwater_per_capita" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<div id="freshwater_per_capita_withdraw" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<br />
<h5>Case Study: BRICs</h5><br />
<p>The BRIC countries (Brazil, India, China and Russia) are large, developing economies, distinguished from other emerging markets by their demographic and developmental potential. These four countries are home to more than 2.5 billion people, 40% of the world’s population, cover 25% of the world’s area, and account for 25% of the global GDP. </p><br />
<br />
<p>Expanding economies such as these require increased energy production which in turn relies significantly on water. One third of global energy needs are currently met by oil, an immensely water-expensive fuel source. Natural gas is currently the most popular alternative to oil due to the “shale gas revolution” and is cleaner in terms of emissions. Shale gas is even more water intensive however and prospective shale-producing countries like China and India will face constraints due to inadequate water supplies (Cohen & Siu 2013).</p><br />
<br />
<p>Additionally, an expanding middle class in these countries causes shifts in dietary preference that have a significant impact on water use and management. Vegetable-oriented diets are turning into meat and dairy-oriented ones that are significantly more water intensive increasing stress on water-scarce nations (Cohen & Siu 2013).</p><br />
<br />
<p>Disparities in water also exist on more local levels within these countries. In China, the southern part of the country experiences sufficient precipitation and rich groundwater supplies but the North is particularly drought-prone. With large cities like Beijing and Tianjin situated in the North, water distribution is a pressing concern.</p> <br />
<br />
<p>Pollution of water supplies is also a significant issue faced by countries. According to the UN, only 28% of wastewater is Russia is properly treated and just 20% in Brazil. This contaminates freshwater supplies and can make otherwise safe water non-potable. A recent survey by the Chinese Ministry of Land and Resources states that only 22% of the countries groundwater supply is safe for human consumption (CMLR 2013) (Cohen & Siu 2013).</p> <br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a1/California_before_1.jpg"><br />
<figcaption>The marina at Oroville lake in 2011(<em>Getty Images</em>)</figcaption><br />
</figure><br />
<br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/7d/California_after_1.jpg"><br />
<figcaption>The marina at Oroville lake in 2014(<em>Getty Images</em>)</figcaption><br />
</figure><br />
<br />
<h5>Case Study: California</h5><br />
<p>California is the USA’s most populous state containing one eighth of American people. More than 90% of the region is under severe water stress (US Drought Monitor 2014).</p><br />
<p>The widespread drought is likely to worsen due to climate change, Diffenbaugh (2014) notes: “Research finds that extreme atmospheric high pressure in this region – which is strongly linked to unusually low precipitation in California – is much more likely to occur today than prior to the human emission of greenhouse gases that began during the Industrial Revolution in the 1800s”.</p><br />
<p>The ramifications could be severe. The drought is estimated to cost more than $2.2 billion to the Californian economy, with 17,100 part-time and seasonal jobs being lost (Howit 2014).</p><br />
<p>At present, California relies on groundwater reserves in order to replace surface water losses. If the drought continues for more than 2 years it will lead to significant groundwater depletion. and increasing costs of groundwater. This increase is not predicted to impact the prices of commodities and so would be translated as loss of revenue for farmers (Howitt et al 2014).</p><br />
<br />
<br />
<br />
<h5>Case Study: London</h5><br />
<p>With 164 days of precipitation per year, one might not imagine our home city, London as suffering water stress. Yet it ranks as the 15th most water stressed city in the world (edieWater 2014). With a population of more than 8.3 million, water demand is high and supply is tightly regulated. The situation is again predicted to become more severe as climate change causes rainfall to become more seasonal with summers being drier and winters wetter.</p> <br />
<br />
<p>The London sewage system is old, having been constructed in the mid-1800s. Emergency overflows into the Rivers Thames prevent overflowing into the cities streets and with around 60 such discharges every year, the water quality of the river is particularly poor (Greater London Authority no date).</p><br />
<br />
<br />
</section><br />
<br />
<section id="sustainable"><br />
<h2>Sustainable Water Management</h2><br />
<p>Sustainable Water Management (SWM) is the considered use and distribution of water resources accounting for the needs of both present and all future users.<br />
During the international Conference on Water and the Environment (ICWE) the following principles were devised to frame discussion on SWM</p><br />
<ol><br />
<li><em>Freshwater is a finite and valuable resource that is essential to sustain life, the environment and development</em></li><br />
<li><em>The development and management of our water resources should be based on a participatory approach, involving users, planners and policy makers at all levels</em></li><br />
<li><em>Women play a central role in the provision, management and safeguarding of water resources.<br />
</em></li><br />
<li><em>Water has an economic value and should therefore be seen as an economic good.</em></li><br />
</ol><br />
<br />
<p>Concepts emerging from a SWM approach include:<br />
</p><br />
<br />
<h3>Management of Water and Wastewater at Source<br />
</h3><br />
<p>Water purification can be implemented at community scale and industrial wastewater treatment can occur on site. Focus should be on treatment as close to the site of origin or use as possible, rather than transferring water and wastewater long distances, making the methods more sustainable and environmentally friendly (Abra & Simms no date).</p><br />
<h3>Low Impact Wastewater Treatment<br />
</h3><br />
<p>Recycling wastewater is essential for sustainable management of water supplies. Effort should be made however to reduce the input of chemicals and fossil-fuel energy into these processes (Abra & Simms no date).</p><br />
<br />
<br />
<br />
</section><br />
<br />
<section id="decentralisation"><br />
<h2>Decentralising the Water Supply</h2><br />
<p>Centralised water and wastewater treatment have been of critical importance for water resource management in the development of societies since the 1800s. Although centralised systems have served us cheaply and reliably so far, recent socioeconomic developments - population growth, increasing use of water for agricultural irrigation, increasing need for sustainable water management - call for new approaches (Gikas & Tchobanoglous 2009). Decentralised water and wastewater management can play an important role in the future of water resource management. Factors driving this change include:<br />
</p><br />
<br />
<h3>Capacity Limitations</h3><br />
<p>The continuous growth of urban areas has exerted increasing pressure on their water management systems. Whilst treatment facilities might have been initially located in remote areas, residential and commercial development has often started enveloping them. That makes potential for expansion limited to impossible. <br />
</p><br />
<br />
<h3>Rapid Growth<br />
</h3><br />
<p>Population growth equates to increased demand for potable water. Current surface and groundwater resources are stretched thin so new urban developments depend on new water purification and recycling systems. Decentralised facilities can more rapidly and adaptably meet changing demand. </p><br />
<br />
<h3>Homeland Security and Disaster Mitigation<br />
</h3><br />
<p>As previously discussed, centralised water systems are attractive target for potential terrorist activities. Damage can impact the lives of the many people residing in the large areas dependent on them. Additionally, natural disasters such as floods and earthquakes can knock out centralised facilities causing huge disruption. Decentralised water management systems are more resilient. Disruption is likely to affect a smaller area and temporary supplies can be diverted from nearby functioning facilities.</p><br />
</section><br />
<br />
<section id="wastewater"><br />
<h2>Wastewater Recycling</h2><br />
<p><em><strong>Society no longer has the luxury of using water only once</strong></em> (Levine 2004).<br />
</p><br />
<br />
<p>Water supply sustainability implies a balance between the rate of withdrawal and the rate of water replenishment. Additionally, the water returned should be of the same quality as the water withdrawn. Due to the huge water demand however, it is difficult to replenish supplies by natural means. Additionally, the distribution of water by use of dams, reservoirs alongside "<em>other shifts in land-use patterns alters the rate, extent and spatial distribution of freshwater consumption and replenishment</em>" (Levine 2004).</p><br />
<br />
<p>In order to achieve sustainable water use it is necessary to turn to methods that ensure that we replenish the water we use, for fresh - and groundwater replenishment this means water recycling via wastewater reclamation and treatment (Dolnicar 2009).</p><br />
<br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/8/8f/Florida_water_reuse_for_citrus_irrigation.jpg"><br />
<figcaption>Reclaimed water processing system for citrus irrigation in Florida(<em>waterencyclopedia.com</em>)</figcaption><br />
</figure><br />
<br />
<p>Wastewater recycling has been on the rise for the past two decades as our societies become increasingly urbanised. There are two different categories of water reuse: direct and indirect. As an example of indirect water reuse, Oxford and Reading are upstream of London on the River Thames. Sewage originating from these cities mixes with the water that ends up in the London water supply. Direct reuse is more controversial and has been mainly employed to provide water for irrigation. For example in the state of Florida, more than 56000 acres of golf courses, 200,000 residencies, 500 parks and 250 schools are irrigated by reclaimed water. St. Petersburg, FL is home to one of the largest dual distribution systems in the world, operating since the 70’s it provides water for landscape irrigation for cooling and other industrial applications. The state also reuses water for agricultural irrigation. The Water Conserv II project irrigates 3,000 acres of citrus orchard every year. Reused water provides great advantages for the growers, containing the correct amounts of boron and phosphorous to give optimum soil pH.</p><br />
<br />
<h3>Considerations</h3><br />
<p>Wastewater treatment and recycling can be challenging and controversial to implement. From a survey of industry experts by the Global Water Research Coalition, Miller (2005) describes “key factors of success” to be considered in design and implementation of water recycling systems. These include:<br />
</p><br />
<br />
<ul><br />
<br />
<li>A particularly clear definition of the project objectives and limitations. <br />
</li><br />
<li>Cost competitive pricing. Recycled water must be carefully priced to be viewed as a viable alternative. Cheaper, more efficient technologies in water recycling are desperately needed.<br />
</li><br />
<li>Chemical and microbiological safety. It is important to have technologies that ensure the removal of chemical contaminants, particularly endocrine disruptors such as pesticides, <strong>heavy metals</strong> and pharmaceuticals and removal or inactivation of microbiological pathogens. Water utilities must be able to reassure the public that the recycled water is completely safe for its intended use.<br />
</li><br />
<li>Public perception and acceptance. While the public is generally accepting of recycled water as a mean for landscape irrigation, for potable use, reactions are more negative.</li><br />
<br />
<br />
</ul><br />
<br />
<br />
<h3>Improving Public Acceptance</h3><br />
<p>Many studies have charted the perception and acceptance of recycled water over the years (Bruvold and Ward 1970; Bruvold 1972, 1979 and 1988, Nancarrow 2003, Dolnicar and Schäfer 2006, 2007 and 2009; Dolnicar and Hurlimann 2010; Hurlimann and Dolnicar 2010). Whilst levels of acceptance vary with time and location a few conclusions are consistently drawn:<br />
</p><br />
<ol><br />
<li>In general, public knowledge on the subject of water treatment and the advantages and disadvantages of different processes is relatively low.</li><br />
<li>General perception of recycled water is that, whilst it is an environmentally friendly solution, there are public health concerns.<br />
</li><br />
<li>Recycled water is considered acceptable for tasks such as gardening and car washing. When it comes to close body use (bathing and showering) there are reservations due to fears of residual wastewater in the recycled water.<br />
</li><br />
<li>Perception is very dependant on the particular source and treatment of the water.<br />
</li><br />
<li>Choice matters: in places where alternative sources of water were available, people were more sceptical of water reuse than in regions with water shortages.<br />
</li><br />
</ol><br />
<p>Education about the necessity and safety of recycled water is paramount for improving public perception and must accompany the technological implementation. A recent survey conducted by Guardian, posted alongside an article about Thames Water plans to introduce recycled water for potable use to meet demand by 2040, revealed a promising 63% of Londoners would be happy drinking recycled water (Saner 2014). As 100% of Londoners need to be drinking it by that date however, perception must catch up. <br />
</p><br />
<br />
</section><br />
<section id="synbio"><br />
<h2>Water innovation and Synthetic Biology : Overcoming barriers</h2><br />
<p>In order to use Synthetic Biology in such a large scale and significant project as water purification and recycling, we need to have a better insight into the potential development and commercialisation of synthetic biology applications. That of course would require the use of genetically modified micro-organisms (GMMO) on a setting outside traditional laboratories and entry into large scale industrial setups.</p> <br />
<p>Currently, the majority of synthetic biology projects involve micro-organisms (in our case the bacteria <em>G. Xylinus</em> and <em>E. Coli</em>) used as host cells (“chassis”). In essence, the first wave of commercial applications of synthetic biology consists of the production of natural compounds from the chassis in an industrial fermentation setup. In our particular case, we are using our two chassis in order to produce large amounts of bacterial cellulose that will in turn be used as water filters, after processing and functionalization with water contaminant-targeting proteins.</p><br />
<p>In the case of our project, there is no direct use of GMMO for bioremediation. Therefore, here we are dealing with <em>contained use</em> rather than with <em>deliberate release in the environment</em>, which are key categories in the EU/UK regulatory framework. In order to fit the <em>contained use</em> definition, <em>specific containment measures</em> should be used <em>to limit the contact [of the GMO] with and to with and to provide a high level of safety for, the general population and the environment</em> (Directives 2001/18/EC and 2009/41/EC). In the UK regulations, such containment measures are further defined as <em>physical, chemical or biological barriers</em> (UK Genetically Modified Organism (Contained Use) Regulation 2000) (Marris and Jefferson, 2012).</p><br />
<p>It is important to note that, apart from dealing with the issue of water recycling and water perception, we are dealing with the applications of Synthetic Biology in the field. The track record of public perception in terms of genetic engineering and its applications is generally poor. In the case of water innovation an <em>innovation barrier</em> is created significantly due to ignorance, in both public and industry level. This ignorance hampers the translation of concepts developed in an academic set up to a large scale industrial implementation project (Balmer & Molyneux – Hodgson 2013). </p><br />
<p>This is a great concern for our team, which is focusing in the application of a GMMO-derived biomaterial in a large scale project like reclaimed water purification for potable use. Furthermore, we are focusing on mass production of bacterial cellulose in order to make our system available as much as possible to areas that face water problems, given that pressing issue addressed previously in the report is indeed the pricing of recycling water. </p><br />
<p>Finally, one key barrier in the implementation of Synthetic Biology solutions in the water industry in the use of GM bacteria for direct water treatment. Deliberate release of bacteria in order to treat water supply is a concept that instigates a lot of skepticism in the public. In order to bypass this issue we decided to not use GM bacteria to directly treat water, but rather use the biomaterial derived from them. By demonstrating that the final, processed membrane will be indeed GM-free in the <a href=” https://2014.igem.org/Team:Imperial/Safety”>safety</a> section we hope to ease the public’s mind and make our method more widely acceptable.</p><br />
<br />
<br />
</section><br />
<section id="conclusions" class="content"><br />
<h2>Conclusions</h2><br />
<p>Our planet’s natural water resources continue to be unsustainably exploited; as a result, we are faced with the challenges of water stress and scarcity. Climate change, population growth and urbanisation fuel the worsening crisis. To avert disaster we must rethink the way we process and use our water supplies. Promisingly, solutions are emerging but significant technological and sociological issues need to be addressed. Water treatment systems are becoming decentralised which makes the system more reliable and adaptable. Supply can be better expanded to meet changing demands and systems can be more tailored to local supplies though improvements are needed to make smaller scale plants more cost effective. Recycled wastewater is becoming an increasingly important component of our water supplies, indirect reuse is common and direct reuse, whilst initially confined to irrigation, is becoming more common. Innovations are needed to improve quality and cost as well as public confidence in the process. </p><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<br />
<div class="accordion"><br />
<h3></h3><br />
<div><br />
<ul><br />
<li>Abby Josef Cohen, Rachel Siu (2013) <em>Sustainable Growth Taking a Deep Dive into Water</em> ONLINE Available at<br />
<a href="http//www.goldmansachs.com/our-thinking/clean-technology-and-renewables/cohen/report.pdf">http//www.goldmansachs.com/our-thinking/clean-technology-and-renewables/cohen/report.pdf</a><br />
</li><br />
<li>Abra J & Simms T (no date). <em>Low Impact Water and Wastewater Treatment</em>. [ONLINE] Available at:<br />
<a href="https://connect.innovateuk.org/web/low-impact-water">https://connect.innovateuk.org/web/low-impact-water</a><br />
</li><br />
<li>Abra J & Simms T (no date). <em>Management of Water and Wastewater at Source</em>. [ONLINE] Available at:<br />
<a href="https://connect.innovateuk.org/web/managing-water-and-wastewater-at-source/at-a-glance">https://connect.innovateuk.org/web/managing-water-and-wastewater-at-source/at-a-glance</a><br />
</li><br />
<li>Agence France-Presse (2014). <em>Nobel laureates call for a revolutionary shift in how humans use resources</em>. [ONLINE] Available at:<br />
<a href=”http://www.theguardian.com/science/2014/oct/07/nobel-laureates-call-for-a-revolutionary-shift-in-how-humans-use-resources”>http://www.theguardian.com/science/2014/oct/07/nobel-laureates-call-for-a-revolutionary-shift-in-how-humans-use-resources</a>.</li><br />
<li>Anderson, J., Arblaster, K., Bartley, J., Cooper, T., Kettunen, M., Kaphengst, T., ... & Holmberg, M. (2006). Climate change-induced water stress and its impact on natural and managed ecosystems. <em>Climate change-induced water stress and its impact on natural and managed ecosystems</em>.</li><br />
<li>Andrew S. Balmer & Susan Molyneux-Hodgson (2013): Bacterial cultures:<br />
ontologies of bacteria and ter engineering expertise at the nexus of synthetic biology and water<br />
services, Engineering Studies, 5:1, 59-73 </li><br />
<li>Arnell N W 1999 <em>Climate change and global water resources</em> Global environmental change 9 S31-S4</li><br />
<li>Arnell, N. W. (2004). Climate change and global water resources: SRES emissions and socio-economic scenarios. <em>Global environmental chang</em>e, 14(1), 31-52</li><br />
<br />
<br />
<li>Bruvold W & Ward P (1970) <em>Public Attitudes Toward Uses of Reclaimed Wastewater</em> Water & Sewage Works 120<br />
</li><br />
<li>Bruvold W (1972) <em> Public Attitudes Towards Reuse of Reclaimed Water</em> USA Univ of California</li><br />
<li>Bruvold W (1979) <em>Public Attitudes Towards Wastewater Reclamation and Reuse Options </em>USA Univ of California</li><br />
<li>Bruvold W (1988)<em> Public Opinion on Water Reuse Option</em>s Journal WPCF 60 1 45</li><br />
<li>Cunningham E (2014). <em>Islamic State jihadists are using water as a weapon in Iraq</em>. [ONLINE] Available at:<br />
<a href=”http://www.washingtonpost.com/world/middle_east/islamic-state-jihadists-are-using-water-as-a-weapon-in-iraq/2014/10/06/aead6792-79ec-4c7c-8f2f-fd7b95765d09_story.html”>http://www.washingtonpost.com/world/middle_east/islamic-state-jihadists-are-using-water-as-a-weapon-in-iraq/2014/10/06/aead6792-79ec-4c7c-8f2f-fd7b95765d09_story.html</a><br />
</li><br />
<li>Deutsche Borse Group (2013). <em>Focus On: BRICS Economic Growth </em>. [ONLINE] Available at:<br />
<a href=”http://www.mni-indicators.com/files/focus_on_brics_economic_growth.pdf”>http://www.mni-indicators.com/files/focus_on_brics_economic_growth.pdf</a>.<br />
</li><br />
<li>Dishman C, Sherrard J & Rebhun M (1989) Gaining Public Support for Direct Potable Water Reuse Journal of Professional Issues in Engineering 115 2 154<br />
</li><br />
<li>Dolnicar S & Hurlimann A (2009) <em>Drinking water from alternative water sources differences in beliefs social norms and factors of perceived behavioural control across eight Australian locations</em>, Water Science & Technology 60 6 1433-144</li><br />
<li>Dolnicar S & Hurlimann A (2010) <em>Desalinated Versus Recycled Water – What Does the Public Think In Escobar</em><br />
</li><br />
<li>Dolnicar S & Schäfer A I (2007) <em>Australians Raise Health Environment and Cost Concerns</em> Desalination & Water Reuse 16 4 10-15</li><br />
<li>Dolnicar S & Schäfer A I (2009) <em>Desalinated Versus Recycled Water — Public Perceptions and Profiles of the Accepters</em> Journal of Environmental Management 90 888-9</li><br />
<li>Dolnicar S, Hurlimann A & Nghiem L (2010) <em>The effect of information on public acceptance - The case of water from alternative sources</em>, Journal of Environmental Management 91 1288-1293 AVAILABLE FOR FREE AT http //ro uow edu au/commpapers/713/ edie/.<br />
</li><br />
<li>Economics, P. (2013). <em>World in 2050. The BRICs and Beyond: Prospects, challenges and opportunities</em>.</li><br />
<li>Gikas P & Tchobanoglous G (2009)<em> The role of satellite and decentralized strategies in water resources managemen</em>t, Journal of Environmental Management 90 1 144-15</li><br />
<li>Gleeson T, Wada Y, Bierkens M F & van Beek L P (2012) ,em>Water balance of global aquifers revealed by groundwater footprint</em>Nature 488 7410 197-20</li><br />
<li>Gleick P H (1994) “Water, war and peace in the Middle East ” <em>Environment</em> Vol 36 No 3 pp 6-on Heldref Publishers Washington</li><br />
<li>Gleick P H 1998 “,em>Water and conflict</em>” See Chronologies A and B In P H</li><br />
<li>Gleick The World’s Water( 1998-1999) Island Press Washington D C pp 105-13</li><br />
<li>Greater London Authority (no date). <em>Making every drop count</em>. [ONLINE] Available at:<br />
<a href=”https://www.london.gov.uk/priorities/environment/looking-after-londons-water/water-demand”>https://www.london.gov.uk/priorities/environment/looking-after-londons-water/water-demand</a><br />
</li><br />
<li>Guardian (2014). <em>Indian officials order Coca-Cola plant to close for using too much water </em>. [ONLINE] Available at:<br />
<a href=“http://www.theguardian.com/environment/2014/jun/18/indian-officals-coca-cola-plant-water-mehdiganj”>http://www.theguardian.com/environment/2014/jun/18/indian-officals-coca-cola-plant-water-mehdiganj</a><br />
</li><br />
<li>Hofstedt, T. (2010). China's water scarcity and its implications for domestic and international stability. <em>Asian Affairs: An American Review</em>, 37(2), 71-83</li><br />
<li>Howitt R, Medellín-Azuara J, MacEwan D, Lund J, Sumner D (2014). <em>Economic Analysis of the 2014 Drought for California Agriculture</em>. [ONLINE] Available at:<br />
<href=“ https://watershed.ucdavis.edu/files/content/news/Economic_Impact_of_the_2014_California_Water_Drought.pdf”>.</li><br />
<li>Hurlimann A & Dolnicar S (2010), Acceptance of Water Alternatives in Australia, <em>Water Science and Technology</em>, 61 (8), 2137-214</li><br />
<li>Hurlimann A & Dolnicar S (2010) When Public Opposition Defeats Alternative Water Projects - the Case of Toowoomba, Australia Water Research 44 287-29</li><br />
<li>I C & Schäfer A Eds <em>Sustainable Water for the Future Water Recycling Versus Desalination</em> Amsterdam Elsevier 375-388</li><br />
<li>Levine, A. D., & Asano, T. (2004). Peer reviewed: recovering sustainable water from wastewater. <em>Environmental science & technology</em>, 38(11), 201A-208A</li><br />
<li>Marks J S, Martin B & Zadoroznyj M (2006) <em>Acceptance of Water Recycling In Australia</em> National Baseline Data Water Journal of the Australian Water Association 33 (2) 151<br />
</li><br />
<li>Marris, C. and Jefferson, C. (2012). <em>Workshop on “Synthetic biology: containment and release of engineered micro-organisms”</em>.</li><br />
<li>Mascarelli A (2012), <em> Demand for water outstrips supply </em>, Nature</li><br />
<li>Masgon M. A. & Gensch R. (e.g. 2011). <em>Water, Sanitation and Gender</em>. [ONLINE] Available at:<br />
<a href="http://www.sswm.info/content/water-sanitation-and-gender.pdf"><br />
</li><br />
<li>Mengistu B. (2012). <em>Empowering women and girls. How water, sanitation and hygiene deliver gender equality </em>. [ONLINE] Available at:<br />
<a href="www.wateraid.org/~/media/Publications/empowering-women-girls-water-sanitation-hygiene-gender-equality.ash" x</li><br />
<li>Micklin, P. P. (1988).<em> Dessication of the Aral Sea: A water management disaster in the Soviet Union<e/em>. Science 241: 1170-7</li><br />
<li>Miller W G (2006)<em> Integrated concepts in water reuse managing global water needs </em>Desalination 187 1 65-75</li><br />
<li>Molyneux-Hodgson, S., & Balmer, A. S. (2013). Synthetic biology, water industry and the performance of an innovation barrier. <em>Science and Public Policy, sct074</em>.</li><br />
<li>Nancarrow, B Kaercher J & Po M (2002) <em>Community Attitudes to Water Restrictions Policies and Alternative Sources: A longitudinal Analysis</em> 1988-2002 Perth CSIRO Land and Water Consultancy Report November 2002<br />
</li><br />
<li>Organisation for Economic Co-operation and Development. (2008). <em>OECD environmental outlook to 2030</em>. Organisation for Economic Co-operation and Development.<br />
</li><br />
<li>Pacific Institute, Water conflict chronology timeline ONLINE Available at<br />
<a href="http://www2 worldwater org/conflict/timeline/">Pacific Institute Water</a> conflict ONLINE Available at <a href=”http://worldwater.org/water-conflict/”>http://worldwater.org/water-conflict/</a><br />
</li><br />
<li>Po M, Nancarrow B E & Kaercher J D (2003) <em>Literature review of factors influencing public perceptions of water reuse</em> pp 1-39 Victoria CSIRO Land and Wat</li><br />
<li>Pedley D (no date).<em> Environmental Measurement </em>. [ONLINE] Available at:<br />
<a href="https://connect.innovateuk.org/web/environmental-measurement/at-a-glance">https://connect.innovateuk.org/web/environmental-measurement/at-a-glance</a><br />
</li><br />
<li>Principles, D. (1992, January). The Dublin statement on water and sustainable development. In <em>International conference on water and the environment</em>.<br />
</li><br />
<li>Secretary of State for Environment, Food and Rural Affairs (2008). <em>Future Water The Government’s water strategy for England</em>. [ONLINE] Available at:<br />
<a href="https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/69346/pb13562-future-water-080204.pdf">https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/69346/pb13562-future-water-080204.pdf</a><br />
</li><br />
<li>State of California, The Resources Agency, Department of Water Resources (2014). <em>Public Update for Drought Response Groundwater Basins with Potential Water Shortages and Gaps in Groundwater Monitoring</em>. [ONLINE] Available at:<br />
<a href="http://www.water.ca.gov/waterconditions/docs/Drought_Response-Groundwater_Basins_April30_Final_BC.pdf">http://www.water.ca.gov/waterconditions/docs/Drought_Response-Groundwater_Basins_April30_Final_BC.pdf</a><br />
</li><br />
<li>Svoda M (2014). <em>US Drought Monitor</em>. [ONLINE] Available at:<br />
<a href=“http://droughtmonitor.unl.edu/Home.aspx”>http://droughtmonitor.unl.edu/Home.aspx</a>.</li><br />
<li>United Nations Development Programme (UNDP). (2006). <em>Human Development Report 2006, Beyond Scarcity: Power, poverty and the global water crisis</em><br />
</li><br />
<li>UN (2004). Sanitation Country Profile, Russian Federation. [ONLINE] Available at:<br />
<a href="http://www.un.org/esa/agenda21/natlinfo/countr/russia/RussiaSanitation04f.pdf">http://www.un.org/esa/agenda21/natlinfo/countr/russia/RussiaSanitation04f.pdf</a><br />
</li><br />
<li>UN Water (2014). <em>The united nations world water development report 2014 </em>. [ONLINE] Available at:<br />
<a href="http://unesdoc.unesco.org/images/0022/002257/225741E.pdf">http://unesdoc.unesco.org/images/0022/002257/225741E.pdf</a>.</li><br />
<li>US Geological Survey (2014) <em>How much water is there on in and above the Earth</em> ONLINE Available at<br />
<a href="http://water.usgs.gov/edu/earthhowmuch.html">http://water.usgs.gov/edu/earthhowmuch.html</a><br />
</li><br />
<li>Vidal J (2014). <em>Water supply key to outcome of conflicts in Iraq and Syria, experts warn.</em> [ONLINE] Available at:<br />
<a href="http://www.theguardian.com/environment/2014/jul/02/water-key-conflict-iraq-syria-isis">http://www.theguardian.com/environment/2014/jul/02/water-key-conflict-iraq-syria-isis</a><br />
</li><br />
<li>Water Quality for Ecosystems and Human Health 2nd edition UNEP ERCE UNESCO 2008</li><br />
<li>Water, U. N. (2007). Coping with water scarcity: challenge of the twenty-first century. <em>2007 World Water Day.</em><br />
</li><br />
<li>WHO/UNICEF Joint Monitoring Programme (JMP) for Water Supply and Sanitation. (2012). Progress on Sanitation and Drinking-Water, 2012 Update<br />
</li><br />
<li>World Health Organization (WHO). (2008). Safer Water, Better Health: Costs, benefits, and sustainability of interventions to protect and promote health; Updated Table 1: WSH deaths by region, 2004.<br />
</li><br />
<br />
<br />
</ul><br />
</div><br />
</div><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
<br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/Water_ReportTeam:Imperial/Water Report2014-10-18T02:20:06Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<br />
<html><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:highcharts?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:data?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:exporting?action=raw&ctype=text/js"></script><br />
<br />
<br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:charts?action=raw&ctype=text/js"></script><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>The Water Report</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#water_stress">Water Stress</a><br />
</li><br />
<br />
<li><a data-scroll href="#sustainable">Sustainability</a><br />
</li><br />
<li><a data-scroll href="#decentralisation">Decentralisation</a><br />
</li><br />
<li><a data-scroll href="#wastewater">Wastewater</a><br />
</li><br />
<li><a data-scroll href="#synbio">Synthetic Biology</a><br />
</li><br />
<li><a data-scroll href="#conclusions">Conclusions</a><br />
</li><br />
<br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<br />
<h2>At a glance</h2><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>All life depends on water. Our Earth, home to all species, remains the only place we know capable of sustaining life. In our search for others amongst the stars, it is water we look for first.</p> <br />
<br />
<p>More than 71% of the planet is covered in this resource, but only a small proportion is suitable for human use. 97.5% percent of the world’s water is salt water and of the 2.5% freshwater, nearly 70% is locked in glaciers and the ice caps. The majority of what remains is inaccessible; either as soil moisture, permafrost or deep beneath the ground. All considered, less than 0.03% of global water is viable for human use (US Geological Survey 2014).</p> <br />
<br />
<p>With the world’s population is rising at a rate of 80 million people a year, water demands are increasing proportionally (Worldometers no date). In order to sustain over seven billion people, we require more than 200 million litres of clean water per second (Waterwise no date). 67% of this is for agriculture, 22% for domestic, and 11% for industrial use.</p><br />
<br />
<p>Our overstretched resources are very unevenly distributed. Areas with high natural resources are rarely near the urban centres of high demand and this is becoming more severe. For example the top countries for fresh water supplies, Brazil, Russia and Canada, with 30% of the world supply between them, are not areas of highest population growth, India, China and Nigeria take the top spots there (Cohen & Siu 2013).</p><br />
<div id="water_use_breakdown" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<br />
<br />
</section><br />
<br />
<section id="water_stress"><br />
<h2>Water Stress - An Increasing Problem</h2><br />
<br />
<p>Water stress occurs when the <em>demand for water exceeds the available amount during a certain period or when poor quality restricts its use</em> (EEA no date). Water stress usually occurs in places with low rainfall and high population density or in areas with intensive agricultural irrigation. It means deterioration of the available freshwater supply both in terms of quantity (from aquifer over-exploitation or drained rivers and lakes) and quality (from eutrophication, saline intrusion, organic matter pollution, heavy metal contamination and other problems).</p><br />
<h3>Causes of water stress and scarcity</h3><br />
<h4>Climate Change</h4><br />
<p>Climate change, due to an increasing greenhouse effect, has a direct impact on the hydrological cycle (IPCC 1996). Increased evaporation from water bodies leads to an overall increase in precipitation, but the changing climate also causes this to be distributed more unevenly. This can alter the durations of wet and dry seasons leading to droughts and floods with severe repercussions for water resources (Arnell 2004) . The changing climate makes our need for sustainable water scarcity solutions ever more pressing. </p><br />
<h4>Pollution</h4><br />
<p>Water sources contaminated from agricultural runoff, domestic wastewater, industrial pollutants and from atmospheric pollutants as a result of burning fossil fuels are at risk of eutrophication. Less dynamic water resources, such as lakes, are more susceptible due to longer water residence and through their action as integration sinks for multiple polluted water sources. The high-nutrient load (mainly nitrogen and phosphorus), causes algal blooms which may be toxic and complicate many methods of water purification.</h4><br />
<br />
<p>Another increasing issue with water quality is the influx of personal care products and pharmaceuticals. Examples of these pollutants include painkillers, antibiotics and female hormonal birth control (UNEP, ERCE, UNESCO. 2008). Certain compounds may be long lived so accumulate in recycled urban wastewater.</p> <br />
<br />
<figure class="content-image image-center"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a4/Water_stress_unep.jpg"><br />
<figcaption>Projected increase of water withdrawals between 2005 and 2025 (<em>unep.org</em>)</figcaption><br />
</figure><br />
<br />
<br />
<h3>Social and Economic Effects</h3><br />
<h4>Water conflict</h4><br />
<p>Water has a long history as a source of conflict and neighboring nations have often been at odds over disputed supplies. As far back as the 3rd millennium BCE, King Lagash, significantly reduced the water flow in the neighboring Umma (modern day Iraq) by building boundary canals around his territory. </p><br />
<br />
<p>There are many types of conflict including but not limited to:</p><br />
<ul><br />
<li><b>Disputes over control and development of water resources</b>: water resources, lakes, rivers and aquifers are valuable, interconnected and do not respect state boundaries.</li><br />
<li><b>Military tools and targets</b>. In the first case, water resources or systems are used as a tool or weapon for military action for example diverting supplies to cause flood or provide defence. In the second case, water resources are targets of military actions, deliberately polluting or destroying enemy supplies.</li><br />
<li><b>Use as a political tool</b>. Water resources or systems are controlled by state or non-state actors as a means to achieve political goals.</li><br />
<li><b>Target for Terrorism</b>. Water resources or systems are targeted or threatened and by non-state actors as means of violence and coercion.</li><br />
</ul><br />
<br />
<p>Notable current sources of water conflicts are demonstrated below:<br />
(Pacific Institute)(Gleick 1994)(Gleick 1998)</p><br />
<h4>In The News</h4><br />
<h5>Middle East</h5><br />
<p>Recent developments in the Middle East highlight the importance of water in conflict. Islamic State militants are using water as a weapon against villages that resist their advance by cutting off the supplies. Currently, IS control major parts of Tigris and Euphrates, on which all of Iraq and a large part of Syria rely for food, water and industry (Cunningham 2014) (Vidal 2014). Matthew Machowski, a Middle East security researcher for the UK Parliament and Queen Mary University notes that “It is already being used as an instrument of war by all sides. It can be claimed that controlling water resources in Iraq is strategically more important than controlling oil refineries… cut it off and you create great sanitation and health crises” (Vidal 2014).</p><br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/7e/Iraq_post_ISIS.jpeg"><br />
<figcaption>Iraqi men move a boat that was stuck on the banks of the Euphrates River after supplies were blocked by anti-government fighters who control a dam further upstream(<em>guardian.com</em>)</figcaption><br />
</figure><br />
<br />
<br />
<h5>Brazil</h5><br />
<p>One of the world’s most rapidly expanding economies has been affected by droughts this past summer. A major affected area was Sao Paulo, the southern hemisphere’s largest city. Reservoirs of the Cantareira system that supply 45% of the city fell to 9.7% capacity, an unprecedented low. Conflict ignited between Sao Paulo, Rio de Janeiro and Minas Gerais, the country’s three most prosperous – and most severely water stressed – states. Sao Paulo controversially diverted water from the Paraiba de Sul in order to supply the Cantareira system, by reducing the flow of the Jaguari River (a tributary to the Paraiba de Sul). Paraiba de Sul is one of the major water and energy supplies of Rio de Janeiro.</p><br />
<p>This move violated a federal pact between the three states, made due to fears water transfer to the Cantaneira system may have adverse effect on the environmental, economic and social balance of all three states.</p><br />
<p>The disagreement recently reached the Supreme Court and eventually concluded with Sao Paulo reducing water flow in two of its dams and Rio de Janeiro reducing water capture from the Paraiba de Sul river basin (International Law Office 2014).</p><br />
<br />
<figure class="content-image image-left image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/Cantaneira_system_current_state.jpg"><br />
<figcaption>The Cantaneira system that supplies 45% of Sao Paulo with water, here seen after the recent droughts (<em>guardian.com</em>)</figcaption><br />
</figure><br />
<br />
<p>Many conflicts stem from large areas and communities relying on a single, shared water supply. In addition to preventing overexploitation it is helpful to provide communities with alternative, more local purification solutions to empower them and give control of their own resources (Faeth and Weinthal 2012)<br />
<br />
<figure class="content-image image-center"><br />
<a class="iframe" href="https://static.igem.org/mediawiki/2014/3/3b/WATER_war_and_peace_2.jpg"><img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3b/WATER_war_and_peace_2.jpg"></a><br />
<figcaption><br />
The map displays nearly 2,000 incidents, involving conflict and collaboration alike, over shared river basins from 1990 to 2008. The circles in the sidebar compare about 2,200 events—including another 200 disputes over resources other than shared rivers—from the same period.<br />
<em>Data Visualization by Pitch Interactive; River locations courtesy The Global Runoff Data Centre, 56068 Koblenz, Germany</em>(<em>popsci.com</em>) </figcaption><br />
</figure><br />
<br />
<br />
<h4>Social implications</h4><br />
<p>It is predicted that within the next 15 years, more than half of the world’s population will be living under severe water stress (OECD 2012). So far, water scarcity has been an issue for individuals and families living in poverty, while most in the developed world enjoy reliable, plentiful access to safe water. As the stress increases, it will hit many of us who were previously unaffected but the majority of the hardship will continue to fall on the worlds poorest.</p> <br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/49/India_women_water.jpg"><br />
<figcaption>Women in India walking through dry land to access a water supply.</figcaption><br />
</figure><br />
<p>There are further issues arising from water accessibility and sanitation regarding gender inequality. In developing countries significant responsibility for acquisition and distribution of water is placed upon women and children of the family. Difficulties in access result in many hours lost that could instead be used for income generation, caring for family members or education (UNDP 2006). This reinforces the cycle of gender disempowerment and inequality. In rural parts of eastern Africa, women and girls spend significant amounts of their day trying to access water sources. Their journey may take them through treacherous places and increases risk of violence and sexual abuse. Women are more likely to voice concerns regarding water and sanitation compared to their male counterparts, however due to their inferior social standing such concerns often go unheard. (Mengistu 2012).</p> <br />
<br />
<p>Water stress can reinforce or increase inequality. Solutions to the water crisis are necessary not just for a healthier, more peaceful world, but also a fairer one. </p><br />
<br />
<h4>Economic Implications</h4><br />
<p>Water is a key input in the smallest of businesses and the largest of corporations alike. Without water it is impossible to generate energy or produce goods. Therefore the economic welfare of a state relies on its water resources, it sustains the backbone of the economy. Corporations are increasingly forced to take water availability into account. For example the Coca Cola plant in Mehdiganj, India, chose to close due to the increasing water stress in the region (Guardian 2014). The socioeconomic impacts of water stress are considered in case studies below.</p><br />
<div id="freshwater_breakdown" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<div id="freshwater_per_capita" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<div id="freshwater_per_capita_withdraw" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<br />
<h5>Case Study: BRICs</h5><br />
<p>The BRIC countries (Brazil, India, China and Russia) are large, developing economies, distinguished from other emerging markets by their demographic and developmental potential. These four countries are home to more than 2.5 billion people, 40% of the world’s population, cover 25% of the world’s area, and account for 25% of the global GDP. </p><br />
<br />
<p>Expanding economies such as these require increased energy production which in turn relies significantly on water. One third of global energy needs are currently met by oil, an immensely water-expensive fuel source. Natural gas is currently the most popular alternative to oil due to the “shale gas revolution” and is cleaner in terms of emissions. Shale gas is even more water intensive however and prospective shale-producing countries like China and India will face constraints due to inadequate water supplies (Cohen & Siu 2013).</p><br />
<br />
<p>Additionally, an expanding middle class in these countries causes shifts in dietary preference that have a significant impact on water use and management. Vegetable-oriented diets are turning into meat and dairy-oriented ones that are significantly more water intensive increasing stress on water-scarce nations (Cohen & Siu 2013).</p><br />
<br />
<p>Disparities in water also exist on more local levels within these countries. In China, the southern part of the country experiences sufficient precipitation and rich groundwater supplies but the North is particularly drought-prone. With large cities like Beijing and Tianjin situated in the North, water distribution is a pressing concern.</p> <br />
<br />
<p>Pollution of water supplies is also a significant issue faced by countries. According to the UN, only 28% of wastewater is Russia is properly treated and just 20% in Brazil. This contaminates freshwater supplies and can make otherwise safe water non-potable. A recent survey by the Chinese Ministry of Land and Resources states that only 22% of the countries groundwater supply is safe for human consumption (CMLR 2013) (Cohen & Siu 2013).</p> <br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a1/California_before_1.jpg"><br />
<figcaption>The marina at Oroville lake in 2011(<em>Getty Images</em>)</figcaption><br />
</figure><br />
<br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/7d/California_after_1.jpg"><br />
<figcaption>The marina at Oroville lake in 2014(<em>Getty Images</em>)</figcaption><br />
</figure><br />
<br />
<h5>Case Study: California</h5><br />
<p>California is the USA’s most populous state containing one eighth of American people. More than 90% of the region is under severe water stress (US Drought Monitor 2014).</p><br />
<p>The widespread drought is likely to worsen due to climate change, Diffenbaugh (2014) notes: “Research finds that extreme atmospheric high pressure in this region – which is strongly linked to unusually low precipitation in California – is much more likely to occur today than prior to the human emission of greenhouse gases that began during the Industrial Revolution in the 1800s”.</p><br />
<p>The ramifications could be severe. The drought is estimated to cost more than $2.2 billion to the Californian economy, with 17,100 part-time and seasonal jobs being lost (Howit 2014).</p><br />
<p>At present, California relies on groundwater reserves in order to replace surface water losses. If the drought continues for more than 2 years it will lead to significant groundwater depletion. and increasing costs of groundwater. This increase is not predicted to impact the prices of commodities and so would be translated as loss of revenue for farmers (Howitt et al 2014).</p><br />
<br />
<br />
<br />
<h5>Case Study: London</h5><br />
<p>With 164 days of precipitation per year, one might not imagine our home city, London as suffering water stress. Yet it ranks as the 15th most water stressed city in the world (edieWater 2014). With a population of more than 8.3 million, water demand is high and supply is tightly regulated. The situation is again predicted to become more severe as climate change causes rainfall to become more seasonal with summers being drier and winters wetter.</p> <br />
<br />
<p>The London sewage system is old, having been constructed in the mid-1800s. Emergency overflows into the Rivers Thames prevent overflowing into the cities streets and with around 60 such discharges every year, the water quality of the river is particularly poor (Greater London Authority no date).</p><br />
<br />
<br />
</section><br />
<br />
<section id="sustainable"><br />
<h2>Sustainable Water Management</h2><br />
<p>Sustainable Water Management (SWM) is the considered use and distribution of water resources accounting for the needs of both present and all future users.<br />
During the international Conference on Water and the Environment (ICWE) the following principles were devised to frame discussion on SWM</p><br />
<ol><br />
<li><em>Freshwater is a finite and valuable resource that is essential to sustain life, the environment and development</em></li><br />
<li><em>The development and management of our water resources should be based on a participatory approach, involving users, planners and policy makers at all levels</em></li><br />
<li><em>Women play a central role in the provision, management and safeguarding of water resources.<br />
</em></li><br />
<li><em>Water has an economic value and should therefore be seen as an economic good.</em></li><br />
</ol><br />
<br />
<p>Concepts emerging from a SWM approach include:<br />
</p><br />
<br />
<h3>Management of Water and Wastewater at Source<br />
</h3><br />
<p>Water purification can be implemented at community scale and industrial wastewater treatment can occur on site. Focus should be on treatment as close to the site of origin or use as possible, rather than transferring water and wastewater long distances, making the methods more sustainable and environmentally friendly (Abra & Simms no date).</p><br />
<h3>Low Impact Wastewater Treatment<br />
</h3><br />
<p>Recycling wastewater is essential for sustainable management of water supplies. Effort should be made however to reduce the input of chemicals and fossil-fuel energy into these processes (Abra & Simms no date).</p><br />
<br />
<br />
<br />
</section><br />
<br />
<section id="decentralisation"><br />
<h2>Decentralising the Water Supply</h2><br />
<p>Centralised water and wastewater treatment have been of critical importance for water resource management in the development of societies since the 1800s. Although centralised systems have served us cheaply and reliably so far, recent socioeconomic developments - population growth, increasing use of water for agricultural irrigation, increasing need for sustainable water management - call for new approaches (Gikas & Tchobanoglous 2009). Decentralised water and wastewater management can play an important role in the future of water resource management. Factors driving this change include:<br />
</p><br />
<br />
<h3>Capacity Limitations</h3><br />
<p>The continuous growth of urban areas has exerted increasing pressure on their water management systems. Whilst treatment facilities might have been initially located in remote areas, residential and commercial development has often started enveloping them. That makes potential for expansion limited to impossible. <br />
</p><br />
<br />
<h3>Rapid Growth<br />
</h3><br />
<p>Population growth equates to increased demand for potable water. Current surface and groundwater resources are stretched thin so new urban developments depend on new water purification and recycling systems. Decentralised facilities can more rapidly and adaptably meet changing demand. </p><br />
<br />
<h3>Homeland Security and Disaster Mitigation<br />
</h3><br />
<p>As previously discussed, centralised water systems are attractive target for potential terrorist activities. Damage can impact the lives of the many people residing in the large areas dependent on them. Additionally, natural disasters such as floods and earthquakes can knock out centralised facilities causing huge disruption. Decentralised water management systems are more resilient. Disruption is likely to affect a smaller area and temporary supplies can be diverted from nearby functioning facilities.</p><br />
</section><br />
<br />
<section id="wastewater"><br />
<h2>Wastewater Recycling</h2><br />
<p><em><strong>Society no longer has the luxury of using water only once</strong></em> (Levine 2004).<br />
</p><br />
<br />
<p>Water supply sustainability implies a balance between the rate of withdrawal and the rate of water replenishment. Additionally, the water returned should be of the same quality as the water withdrawn. Due to the huge water demand however, it is difficult to replenish supplies by natural means. Additionally, the distribution of water by use of dams, reservoirs alongside "<em>other shifts in land-use patterns alters the rate, extent and spatial distribution of freshwater consumption and replenishment</em>" (Levine 2004).</p><br />
<br />
<p>In order to achieve sustainable water use it is necessary to turn to methods that ensure that we replenish the water we use, for fresh - and groundwater replenishment this means water recycling via wastewater reclamation and treatment (Dolnicar 2009).</p><br />
<br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/8/8f/Florida_water_reuse_for_citrus_irrigation.jpg"><br />
<figcaption>Reclaimed water processing system for citrus irrigation in Florida(<em>waterencyclopedia.com</em>)</figcaption><br />
</figure><br />
<br />
<p>Wastewater recycling has been on the rise for the past two decades as our societies become increasingly urbanised. There are two different categories of water reuse: direct and indirect. As an example of indirect water reuse, Oxford and Reading are upstream of London on the River Thames. Sewage originating from these cities mixes with the water that ends up in the London water supply. Direct reuse is more controversial and has been mainly employed to provide water for irrigation. For example in the state of Florida, more than 56000 acres of golf courses, 200,000 residencies, 500 parks and 250 schools are irrigated by reclaimed water. St. Petersburg, FL is home to one of the largest dual distribution systems in the world, operating since the 70’s it provides water for landscape irrigation for cooling and other industrial applications. The state also reuses water for agricultural irrigation. The Water Conserv II project irrigates 3,000 acres of citrus orchard every year. Reused water provides great advantages for the growers, containing the correct amounts of boron and phosphorous to give optimum soil pH.</p><br />
<br />
<h3>Considerations</h3><br />
<p>Wastewater treatment and recycling can be challenging and controversial to implement. From a survey of industry experts by the Global Water Research Coalition, Miller (2005) describes “key factors of success” to be considered in design and implementation of water recycling systems. These include:<br />
</p><br />
<br />
<ul><br />
<br />
<li>A particularly clear definition of the project objectives and limitations. <br />
</li><br />
<li>Cost competitive pricing. Recycled water must be carefully priced to be viewed as a viable alternative. Cheaper, more efficient technologies in water recycling are desperately needed.<br />
</li><br />
<li>Chemical and microbiological safety. It is important to have technologies that ensure the removal of chemical contaminants, particularly endocrine disruptors such as pesticides, <strong>heavy metals</strong> and pharmaceuticals and removal or inactivation of microbiological pathogens. Water utilities must be able to reassure the public that the recycled water is completely safe for its intended use.<br />
</li><br />
<li>Public perception and acceptance. While the public is generally accepting of recycled water as a mean for landscape irrigation, for potable use, reactions are more negative.</li><br />
<br />
<br />
</ul><br />
<br />
<br />
<h3>Improving Public Acceptance</h3><br />
<p>Many studies have charted the perception and acceptance of recycled water over the years (Bruvold and Ward 1970; Bruvold 1972, 1979 and 1988, Nancarrow 2003, Dolnicar and Schäfer 2006, 2007 and 2009; Dolnicar and Hurlimann 2010; Hurlimann and Dolnicar 2010). Whilst levels of acceptance vary with time and location a few conclusions are consistently drawn:<br />
</p><br />
<ol><br />
<li>In general, public knowledge on the subject of water treatment and the advantages and disadvantages of different processes is relatively low.</li><br />
<li>General perception of recycled water is that, whilst it is an environmentally friendly solution, there are public health concerns.<br />
</li><br />
<li>Recycled water is considered acceptable for tasks such as gardening and car washing. When it comes to close body use (bathing and showering) there are reservations due to fears of residual wastewater in the recycled water.<br />
</li><br />
<li>Perception is very dependant on the particular source and treatment of the water.<br />
</li><br />
<li>Choice matters: in places where alternative sources of water were available, people were more sceptical of water reuse than in regions with water shortages.<br />
</li><br />
</ol><br />
<p>Education about the necessity and safety of recycled water is paramount for improving public perception and must accompany the technological implementation. A recent survey conducted by Guardian, posted alongside an article about Thames Water plans to introduce recycled water for potable use to meet demand by 2040, revealed a promising 63% of Londoners would be happy drinking recycled water (Saner 2014). As 100% of Londoners need to be drinking it by that date however, perception must catch up. <br />
</p><br />
<br />
</section><br />
<section id="synbio"><br />
<h2>Water innovation and Synthetic Biology : Overcoming barriers</h2><br />
<p>In order to use Synthetic Biology in such a large scale and significant project as water purification and recycling, we need to have a better insight into the potential development and commercialisation of synthetic biology applications. That of course would require the use of genetically modified micro-organisms (GMMO) on a setting outside traditional laboratories and entry into large scale industrial setups.</p> <br />
<p>Currently, the majority of synthetic biology projects involve micro-organims (in our case the bacteria G.Xylinus) and E.Coli) used as host cells (“chassis”). In essence, the first wave of commercial applications of synthetic biology consists of the production of natural compounds from the chassis in an industrial fermentation setup. In our particular case, we are using our two chassis in order to produce large amounts of bacterial cellulose that will in turn be used as water filters, after processing and functionalization with water contaminant-targeting proteins.</p><br />
<p>In the case of our project, there is no direct use of GMMO for bioremediation. Therefore, here we are dealing with “contained use” rather than with “deliberate release in the environment”, which are key categories in the EU/UK regulatory framework. In order to fit the "contained use” definition, “specific containment measures” should be used “to limit the contact [of the GMO] with and to with and to provide a high level of safety for, the general population and the environment” (Directives 2001/18/EC and 2009/41/EC). In the UK regulations, such containment measures are further defined as “physical, chemical or biological barriers” (UK Genetically Modified Organism (Contained Use) Regulation 2000) (Marris and Jefferson, 2012).</p><br />
<p>It is important to note that, apart from dealing with the issue of water recycling and water perception, we are dealing with the applications of Synthetic Biology in the field. The track record of public perception in terms of genetic engineering and its applications is generally poor. In the case of water innovation an ‘innovation barrier’ is created significantly due to ignorance, in both public and industrial level. This ignorance hampers the translation of concepts developed in an academic set up to a large scale industrial implementation project (Balmer & Molyneux – Hodgson 2013). </p><br />
<p>This is a great concern for our team, which is focusing in the application of a GM-derived biomaterial in a large scale project like reclaimed water purification for potable use. Furthermore, we are focusing on mass production of bacterial cellulose in order to make our system available as much as possible to areas that face water problems, given that pressing issue addressed previously in the report is indeed the pricing of recycling water. </p><br />
<p>Finally, one key barrier in the implementation of Synthetic Biology solutions in the water industry in the use of GM bacteria for direct water treatment. Deliberate release of bacteria in order to treat water supply is a concept that instigates a lot of scepticism to the public. In order to bypass this issue we decide to not use GM bacteria to directly treat water, but rather use the biomaterial derived from them. By demonstrating that the final, processed membrane will be indeed GM-free in the <a href=” https://2014.igem.org/Team:Imperial/Safety”>safety</a> section we hope to ease the public’s mind and make our method more widely acceptable.</p><br />
<br />
<br />
</section><br />
<section id="conclusions" class="content"><br />
<h2>Conclusions</h2><br />
<p>Our planet’s natural water resources continue to be unsustainably exploited; as a result, we are faced with the challenges of water stress and scarcity. Climate change, population growth and urbanisation fuel the worsening crisis. To avert disaster we must rethink the way we process and use our water supplies. Promisingly, solutions are emerging but significant technological and sociological issues need to be addressed. Water treatment systems are becoming decentralised which makes the system more reliable and adaptable. Supply can be better expanded to meet changing demands and systems can be more tailored to local supplies though improvements are needed to make smaller scale plants more cost effective. Recycled wastewater is becoming an increasingly important component of our water supplies, indirect reuse is common and direct reuse, whilst initially confined to irrigation, is becoming more common. Innovations are needed to improve quality and cost as well as public confidence in the process. </p><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<br />
<div class="accordion"><br />
<h3></h3><br />
<div><br />
<ul><br />
<li>Abby Josef Cohen, Rachel Siu (2013) <em>Sustainable Growth Taking a Deep Dive into Water</em> ONLINE Available at<br />
<a href="http//www.goldmansachs.com/our-thinking/clean-technology-and-renewables/cohen/report.pdf">http//www.goldmansachs.com/our-thinking/clean-technology-and-renewables/cohen/report.pdf</a><br />
</li><br />
<li>Abra J & Simms T (no date). <em>Low Impact Water and Wastewater Treatment</em>. [ONLINE] Available at:<br />
<a href="https://connect.innovateuk.org/web/low-impact-water">https://connect.innovateuk.org/web/low-impact-water</a><br />
</li><br />
<li>Abra J & Simms T (no date). <em>Management of Water and Wastewater at Source</em>. [ONLINE] Available at:<br />
<a href="https://connect.innovateuk.org/web/managing-water-and-wastewater-at-source/at-a-glance">https://connect.innovateuk.org/web/managing-water-and-wastewater-at-source/at-a-glance</a><br />
</li><br />
<li>Agence France-Presse (2014). <em>Nobel laureates call for a revolutionary shift in how humans use resources</em>. [ONLINE] Available at:<br />
<a href=”http://www.theguardian.com/science/2014/oct/07/nobel-laureates-call-for-a-revolutionary-shift-in-how-humans-use-resources”>http://www.theguardian.com/science/2014/oct/07/nobel-laureates-call-for-a-revolutionary-shift-in-how-humans-use-resources</a>.</li><br />
<li>Anderson, J., Arblaster, K., Bartley, J., Cooper, T., Kettunen, M., Kaphengst, T., ... & Holmberg, M. (2006). Climate change-induced water stress and its impact on natural and managed ecosystems. <em>Climate change-induced water stress and its impact on natural and managed ecosystems</em>.</li><br />
<li>Andrew S. Balmer & Susan Molyneux-Hodgson (2013): Bacterial cultures:<br />
ontologies of bacteria and ter engineering expertise at the nexus of synthetic biology and water<br />
services, Engineering Studies, 5:1, 59-73 </li><br />
<li>Arnell N W 1999 <em>Climate change and global water resources</em> Global environmental change 9 S31-S4</li><br />
<li>Arnell, N. W. (2004). Climate change and global water resources: SRES emissions and socio-economic scenarios. <em>Global environmental chang</em>e, 14(1), 31-52</li><br />
<br />
<br />
<li>Bruvold W & Ward P (1970) <em>Public Attitudes Toward Uses of Reclaimed Wastewater</em> Water & Sewage Works 120<br />
</li><br />
<li>Bruvold W (1972) <em> Public Attitudes Towards Reuse of Reclaimed Water</em> USA Univ of California</li><br />
<li>Bruvold W (1979) <em>Public Attitudes Towards Wastewater Reclamation and Reuse Options </em>USA Univ of California</li><br />
<li>Bruvold W (1988)<em> Public Opinion on Water Reuse Option</em>s Journal WPCF 60 1 45</li><br />
<li>Cunningham E (2014). <em>Islamic State jihadists are using water as a weapon in Iraq</em>. [ONLINE] Available at:<br />
<a href=”http://www.washingtonpost.com/world/middle_east/islamic-state-jihadists-are-using-water-as-a-weapon-in-iraq/2014/10/06/aead6792-79ec-4c7c-8f2f-fd7b95765d09_story.html”>http://www.washingtonpost.com/world/middle_east/islamic-state-jihadists-are-using-water-as-a-weapon-in-iraq/2014/10/06/aead6792-79ec-4c7c-8f2f-fd7b95765d09_story.html</a><br />
</li><br />
<li>Deutsche Borse Group (2013). <em>Focus On: BRICS Economic Growth </em>. [ONLINE] Available at:<br />
<a href=”http://www.mni-indicators.com/files/focus_on_brics_economic_growth.pdf”>http://www.mni-indicators.com/files/focus_on_brics_economic_growth.pdf</a>.<br />
</li><br />
<li>Dishman C, Sherrard J & Rebhun M (1989) Gaining Public Support for Direct Potable Water Reuse Journal of Professional Issues in Engineering 115 2 154<br />
</li><br />
<li>Dolnicar S & Hurlimann A (2009) <em>Drinking water from alternative water sources differences in beliefs social norms and factors of perceived behavioural control across eight Australian locations</em>, Water Science & Technology 60 6 1433-144</li><br />
<li>Dolnicar S & Hurlimann A (2010) <em>Desalinated Versus Recycled Water – What Does the Public Think In Escobar</em><br />
</li><br />
<li>Dolnicar S & Schäfer A I (2007) <em>Australians Raise Health Environment and Cost Concerns</em> Desalination & Water Reuse 16 4 10-15</li><br />
<li>Dolnicar S & Schäfer A I (2009) <em>Desalinated Versus Recycled Water — Public Perceptions and Profiles of the Accepters</em> Journal of Environmental Management 90 888-9</li><br />
<li>Dolnicar S, Hurlimann A & Nghiem L (2010) <em>The effect of information on public acceptance - The case of water from alternative sources</em>, Journal of Environmental Management 91 1288-1293 AVAILABLE FOR FREE AT http //ro uow edu au/commpapers/713/ edie/.<br />
</li><br />
<li>Economics, P. (2013). <em>World in 2050. The BRICs and Beyond: Prospects, challenges and opportunities</em>.</li><br />
<li>Gikas P & Tchobanoglous G (2009)<em> The role of satellite and decentralized strategies in water resources managemen</em>t, Journal of Environmental Management 90 1 144-15</li><br />
<li>Gleeson T, Wada Y, Bierkens M F & van Beek L P (2012) ,em>Water balance of global aquifers revealed by groundwater footprint</em>Nature 488 7410 197-20</li><br />
<li>Gleick P H (1994) “Water, war and peace in the Middle East ” <em>Environment</em> Vol 36 No 3 pp 6-on Heldref Publishers Washington</li><br />
<li>Gleick P H 1998 “,em>Water and conflict</em>” See Chronologies A and B In P H</li><br />
<li>Gleick The World’s Water( 1998-1999) Island Press Washington D C pp 105-13</li><br />
<li>Greater London Authority (no date). <em>Making every drop count</em>. [ONLINE] Available at:<br />
<a href=”https://www.london.gov.uk/priorities/environment/looking-after-londons-water/water-demand”>https://www.london.gov.uk/priorities/environment/looking-after-londons-water/water-demand</a><br />
</li><br />
<li>Guardian (2014). <em>Indian officials order Coca-Cola plant to close for using too much water </em>. [ONLINE] Available at:<br />
<a href=“http://www.theguardian.com/environment/2014/jun/18/indian-officals-coca-cola-plant-water-mehdiganj”>http://www.theguardian.com/environment/2014/jun/18/indian-officals-coca-cola-plant-water-mehdiganj</a><br />
</li><br />
<li>Hofstedt, T. (2010). China's water scarcity and its implications for domestic and international stability. <em>Asian Affairs: An American Review</em>, 37(2), 71-83</li><br />
<li>Howitt R, Medellín-Azuara J, MacEwan D, Lund J, Sumner D (2014). <em>Economic Analysis of the 2014 Drought for California Agriculture</em>. [ONLINE] Available at:<br />
<href=“ https://watershed.ucdavis.edu/files/content/news/Economic_Impact_of_the_2014_California_Water_Drought.pdf”>.</li><br />
<li>Hurlimann A & Dolnicar S (2010), Acceptance of Water Alternatives in Australia, <em>Water Science and Technology</em>, 61 (8), 2137-214</li><br />
<li>Hurlimann A & Dolnicar S (2010) When Public Opposition Defeats Alternative Water Projects - the Case of Toowoomba, Australia Water Research 44 287-29</li><br />
<li>I C & Schäfer A Eds <em>Sustainable Water for the Future Water Recycling Versus Desalination</em> Amsterdam Elsevier 375-388</li><br />
<li>Levine, A. D., & Asano, T. (2004). Peer reviewed: recovering sustainable water from wastewater. <em>Environmental science & technology</em>, 38(11), 201A-208A</li><br />
<li>Marks J S, Martin B & Zadoroznyj M (2006) <em>Acceptance of Water Recycling In Australia</em> National Baseline Data Water Journal of the Australian Water Association 33 (2) 151<br />
</li><br />
<li>Marris, C. and Jefferson, C. (2012). <em>Workshop on “Synthetic biology: containment and release of engineered micro-organisms”</em>.</li><br />
<li>Mascarelli A (2012), <em> Demand for water outstrips supply </em>, Nature</li><br />
<li>Masgon M. A. & Gensch R. (e.g. 2011). <em>Water, Sanitation and Gender</em>. [ONLINE] Available at:<br />
<a href="http://www.sswm.info/content/water-sanitation-and-gender.pdf"><br />
</li><br />
<li>Mengistu B. (2012). <em>Empowering women and girls. How water, sanitation and hygiene deliver gender equality </em>. [ONLINE] Available at:<br />
<a href="www.wateraid.org/~/media/Publications/empowering-women-girls-water-sanitation-hygiene-gender-equality.ash" x</li><br />
<li>Micklin, P. P. (1988).<em> Dessication of the Aral Sea: A water management disaster in the Soviet Union<e/em>. Science 241: 1170-7</li><br />
<li>Miller W G (2006)<em> Integrated concepts in water reuse managing global water needs </em>Desalination 187 1 65-75</li><br />
<li>Molyneux-Hodgson, S., & Balmer, A. S. (2013). Synthetic biology, water industry and the performance of an innovation barrier. <em>Science and Public Policy, sct074</em>.</li><br />
<li>Nancarrow, B Kaercher J & Po M (2002) <em>Community Attitudes to Water Restrictions Policies and Alternative Sources: A longitudinal Analysis</em> 1988-2002 Perth CSIRO Land and Water Consultancy Report November 2002<br />
</li><br />
<li>Organisation for Economic Co-operation and Development. (2008). <em>OECD environmental outlook to 2030</em>. Organisation for Economic Co-operation and Development.<br />
</li><br />
<li>Pacific Institute, Water conflict chronology timeline ONLINE Available at<br />
<a href="http://www2 worldwater org/conflict/timeline/">Pacific Institute Water</a> conflict ONLINE Available at <a href=”http://worldwater.org/water-conflict/”>http://worldwater.org/water-conflict/</a><br />
</li><br />
<li>Po M, Nancarrow B E & Kaercher J D (2003) <em>Literature review of factors influencing public perceptions of water reuse</em> pp 1-39 Victoria CSIRO Land and Wat</li><br />
<li>Pedley D (no date).<em> Environmental Measurement </em>. [ONLINE] Available at:<br />
<a href="https://connect.innovateuk.org/web/environmental-measurement/at-a-glance">https://connect.innovateuk.org/web/environmental-measurement/at-a-glance</a><br />
</li><br />
<li>Principles, D. (1992, January). The Dublin statement on water and sustainable development. In <em>International conference on water and the environment</em>.<br />
</li><br />
<li>Secretary of State for Environment, Food and Rural Affairs (2008). <em>Future Water The Government’s water strategy for England</em>. [ONLINE] Available at:<br />
<a href="https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/69346/pb13562-future-water-080204.pdf">https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/69346/pb13562-future-water-080204.pdf</a><br />
</li><br />
<li>State of California, The Resources Agency, Department of Water Resources (2014). <em>Public Update for Drought Response Groundwater Basins with Potential Water Shortages and Gaps in Groundwater Monitoring</em>. [ONLINE] Available at:<br />
<a href="http://www.water.ca.gov/waterconditions/docs/Drought_Response-Groundwater_Basins_April30_Final_BC.pdf">http://www.water.ca.gov/waterconditions/docs/Drought_Response-Groundwater_Basins_April30_Final_BC.pdf</a><br />
</li><br />
<li>Svoda M (2014). <em>US Drought Monitor</em>. [ONLINE] Available at:<br />
<a href=“http://droughtmonitor.unl.edu/Home.aspx”>http://droughtmonitor.unl.edu/Home.aspx</a>.</li><br />
<li>United Nations Development Programme (UNDP). (2006). <em>Human Development Report 2006, Beyond Scarcity: Power, poverty and the global water crisis</em><br />
</li><br />
<li>UN (2004). Sanitation Country Profile, Russian Federation. [ONLINE] Available at:<br />
<a href="http://www.un.org/esa/agenda21/natlinfo/countr/russia/RussiaSanitation04f.pdf">http://www.un.org/esa/agenda21/natlinfo/countr/russia/RussiaSanitation04f.pdf</a><br />
</li><br />
<li>UN Water (2014). <em>The united nations world water development report 2014 </em>. [ONLINE] Available at:<br />
<a href="http://unesdoc.unesco.org/images/0022/002257/225741E.pdf">http://unesdoc.unesco.org/images/0022/002257/225741E.pdf</a>.</li><br />
<li>US Geological Survey (2014) <em>How much water is there on in and above the Earth</em> ONLINE Available at<br />
<a href="http://water.usgs.gov/edu/earthhowmuch.html">http://water.usgs.gov/edu/earthhowmuch.html</a><br />
</li><br />
<li>Vidal J (2014). <em>Water supply key to outcome of conflicts in Iraq and Syria, experts warn.</em> [ONLINE] Available at:<br />
<a href="http://www.theguardian.com/environment/2014/jul/02/water-key-conflict-iraq-syria-isis">http://www.theguardian.com/environment/2014/jul/02/water-key-conflict-iraq-syria-isis</a><br />
</li><br />
<li>Water Quality for Ecosystems and Human Health 2nd edition UNEP ERCE UNESCO 2008</li><br />
<li>Water, U. N. (2007). Coping with water scarcity: challenge of the twenty-first century. <em>2007 World Water Day.</em><br />
</li><br />
<li>WHO/UNICEF Joint Monitoring Programme (JMP) for Water Supply and Sanitation. (2012). Progress on Sanitation and Drinking-Water, 2012 Update<br />
</li><br />
<li>World Health Organization (WHO). (2008). Safer Water, Better Health: Costs, benefits, and sustainability of interventions to protect and promote health; Updated Table 1: WSH deaths by region, 2004.<br />
</li><br />
<br />
<br />
</ul><br />
</div><br />
</div><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
<br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ProjectTeam:Imperial/Project2014-10-18T02:01:59Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<br />
<html><br />
<div class="content-wrapper"><br />
<h1>Project</h1><br />
<div class="pure-g"><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Introduction</h2><br />
<p>This summer we investigated the exciting biomaterial bacterial cellulose. In our project we optimise the production of bacterial cellulose by engineering <em>Gluconacetobacter xylinus</em> and transferring the system into <em>E. coli</em>. We also explore processing of our synthetic biology material, producing and testing water filters. To improve our material's performance for this application we functionalise our cellulose with binding proteins to trap specific contaminants.<br />
</p><br />
</div><br />
<br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Background</h2><br />
<p>Cellulose is the most abundant organic polymer found in nature. Due to its versatility and ubiquity we find cellulose has applications in areas from medicine to textiles.Much of the cellulose we use is impure as it is derived from plants. Bacteria offer an alternative means of production that produces a cellulose that is purer and requires less processing.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Project_Background">read more...</a><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2><em>G. xylinus</em></h2> <br />
<p>Cellulose is naturally produced by bacteria of several genera as an extracellular matrix. This functions as a protective mechanism, shielding the bacteria from the environment. The gram-negative <em>Gluconacetobacter xylinus</em> (formerly <em>Acetobacter xylinum</em>) is a high-yielding producer of bacterial cellulose and so served as a suitable base for further optimisation.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Gluconacetobacter">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2><em>E. coli</em></h2> <br />
<p>While <em>Gluconacetobacter</em> is a high producer of bacterial cellulose, <em>E. coli</em> is currently a more robust host for synthetic biology. Transferring the bacterial cellulose operon into <em>E. coli</em> would ease further in-vivo modification of the cellulose by allowing well characterised parts to be used more directly and has the potential for higher productivity. <br />
</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/EColi">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Co-culturing</h2> <br />
<p>The idea of combining E. coli as an efficient cloning organism since it has the largest library of well characterised parts available and G. xylinus as a robust efficient cellulose producing host came about as a way to take advantage of the characteristics of each host.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/coculture">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Functionalisation</h2> <br />
<p>Pure bacterial cellulose is itself a useful biomaterial with material properties that facilitate applications from filtration to wound dressing. We modify the material, chemical and biological properties of our biomaterial through the addition of functional proteins. We investigated different methods of coupling these to the cellulose.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Functionalisation">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Water Filtration</h2> <br />
<p>Our mass produced and functionalised cellulose can be used for a range of exciting applications. The biological functionalisation allows our material to perform enzymatic actions on its environment. We targeted our functionalisation to the problem of water treatment and filtration.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Water_Filtration">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Mass Production and Processing</h2> <br />
<p>To produce a useable material from the wet pellicle we grew up cellulose in bulk in order to experiment with various methods of treating and processing it.This produced materials with a range of properties.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Mass_Production_and_Processing">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
<div class="pure-u-1-3"><br />
<div class="content content-single"><br />
<h2>Tensile Testing</h2> <br />
<p> Having produced large quantities of bacterial cellulose, it is key to quantify the quality of our biomaterial. This determines the water flow rates that can be expected in a membrane bioreactor water filtration setup.</p><br />
<div class="more-box more-box-bottom"><a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing">read more...</a><br />
</div><br />
<br />
<br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:43:57Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2> </h2><br />
<p><em><strong>“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.”</strong></em> - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure> <br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<br />
<br />
<p>Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m<sup>2</sup>. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif"><br />
<figcaption>Figure 2: Schematic for dead end membrane filtration with backwash (from www.meco.com)</figcaption><br />
</figure><br />
<p><br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:43:37Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2> </h2><br />
</br><br />
<p><em><strong>“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.”</strong></em> - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure> <br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<br />
<br />
<p>Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m<sup>2</sup>. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif"><br />
<figcaption>Figure 2: Schematic for dead end membrane filtration with backwash (from www.meco.com)</figcaption><br />
</figure><br />
<p><br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:40:32Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2> </h2><br />
<p><em><strong>“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.”</strong></em>- Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure> <br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<br />
<br />
<p>Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m<sup>2</sup>. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif"><br />
<figcaption>Figure 2: Schematic for dead end membrane filtration with backwash (from www.meco.com)</figcaption><br />
</figure><br />
<p><br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:39:34Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2> </h2><br />
<p><em><strong>“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.”</strong></em>- Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure><br />
<br />
<p>Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m<sup>2</sup>. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif"><br />
<figcaption>Figure 2: Schematic for dead end membrane filtration with backwash (from www.meco.com)</figcaption><br />
</figure><br />
<p><br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:37:26Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2> </h2><br />
<p> “To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure><br />
<br />
<p>Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m<sup>2</sup>. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif"><br />
<figcaption>Figure 2: Schematic for dead end membrane filtration with backwash (from www.meco.com)</figcaption><br />
</figure><br />
<p><br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:36:47Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2></h2><br />
<p> “To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure><br />
<br />
<p>Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m<sup>2</sup>. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif"><br />
<figcaption>Figure 2: Schematic for dead end membrane filtration with backwash (from www.meco.com)</figcaption><br />
</figure><br />
<p><br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:35:33Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure><br />
<br />
<p>Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m<sup>2</sup>. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif"><br />
<figcaption>Figure 2: Schematic for dead end membrane filtration with backwash (from www.meco.com)</figcaption><br />
</figure><br />
<p><br />
“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
<br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:30:36Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure><br />
<br />
<p>Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
<br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif<br />
(from www.meco.com)<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:29:43Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure><br />
<br />
<p>Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
<br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif<br />
(from www.meco.com)<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:28:55Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG"><br />
<figcaption>Figure 1: Size exclusion for different grades of filter (from http://www.edstrom.com/)</figcaption><br />
</figure><br />
<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
<br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif<br />
(from www.meco.com)<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:26:39Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
<br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif<br />
(from www.meco.com)<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:25:43Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
<br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif<br />
(from www.meco.com)<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<p>European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration</p><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:24:43Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
<br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif<br />
(from www.meco.com)<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
European Commission (2002) “Heavy Metals in Waste - Final Report” Accessed 17th October 2014 http://ec.europa.eu/environment/waste/studies/pdf/heavy_metalsreport.pdf<br />
<br />
Fifield, Leonard, “Bacterial Cellulose Composites Opportunities and Challenges” PNNL Applied Materials Science Group (2012). Accessed 17th October 2014<br />
http://www1.eere.energy.gov/manufacturing/rd/pdfs/sustainable_nanomaterials_workshop_pnnl.pdf<br />
<br />
<br />
Gatenholm, P., & Klemm, D. (2010). Bacterial nanocellulose as a renewable material for biomedical applications. MRS bulletin, 35(03), 208-213.<br />
<br />
James Queally “Toledo's tap water undrinkable for a second day; test results delayed” The LA times 3 August 2014. Accessed 17th October 2014<br />
http://www.latimes.com/nation/nationnow/la-na-nn-toledo-ohio-toxins-water-20140802-story.html#page=1<br />
Karl Mathiesen “Slug poison found in one in eight of England's drinking water sources” the Guardian, Wednesday 10 July 2013. Accessed 17th October 2014<br />
http://www.theguardian.com/environment/2013/jul/10/slug-poison-drinking-water-metaldehyde<br />
<br />
<br />
Lee, Koon‐Yang, Gizem Buldum, Athanasios Mantalaris, and Alexander Bismarck. "More than meets the eye in bacterial cellulose: Biosynthesis, bioprocessing, and applications in advanced fiber composites." Macromolecular bioscience 14, no. 1 (2014): 10-32.<br />
<br />
Mautner, A., Lee, K. Y., Lahtinen, P., Hakalahti, M., Tammelin, T., Li, K., & Bismarck, A. (2014). Nanopapers for organic solvent nanofiltration. Chemical Communications, 50(43), 5778-5781.<br />
<br />
Shenzhen Youber Technology Co., Ltd. Accessed 17th October 2014 http://water-treatment.en.alibaba.com/<br />
<br />
Figure references:<br />
http://www.edstrom.com/assets/1/7/Water_Purification_Spectrum1.JPG<br />
http://upload.wikimedia.org/wikipedia/en/c/c0/MBRvsASP_Schematic.jpg<br />
http://www.meco.com/meco-biopharmaceutical/products/membrane-filtration<br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:23:04Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
<br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif<br />
(from www.meco.com)<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term. </p><br />
<br />
<h3>Disposal of Contaminants</h3><br />
<p>Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products.</p><br />
<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:22:02Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Process Engineering">Process Engineering</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Process Engineering"><br />
<h2>Process Engineering</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
“To meet new environmental regulations, a step change is required in how we process water. Functionalised cellulose filtration could be a viable part of the solution.” - Dr. Michael Chipps, Principal Research Scientist at Thames Water<br />
<br />
We envisage functionalised bacterial cellulose membranes utilised in a plate and frame, dead end filtration setup for easy backflush cleaning and replacement when fouled.<br />
https://static.igem.org/mediawiki/2014/3/3f/IC-14_Membrane_backwash.gif<br />
(from www.meco.com)<br />
<br />
This process is particularly applicable for water recycling. Ultrafiltration combines well with activated sludge for purification when organic solids content is high and the additional membrane functionalisation can target removal of recalcitrant small molecules that can accumulate in recycled water. Current wastewater treatment plants could be easily retrofitted with the technology with dedicated facilities constructed in the longer term.<br />
<br />
<h3>Disposal of Contaminants</h3><br />
Heavy metal contaminants pose a serious problem for all water processing solutions as they ultimately cannot be destroyed. To prevent escape into the environment they must be recovered and disposed of into controlled landfill (European Commission 2002). Trapping contaminants on filtration membranes concentrates them for easy recovery. To prolong filter life, contaminants could be regularly eluted and collected. When membranes are spent they could either be disposed of directly into controlled landfill or to reduce volume - incinerated and the flue scrubbed. Incineration is the most effective solution to destroy recalcitrant organic pollutants and unlike for other materials, incineration of cellulose membranes produces no harmful by products. <br />
<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:12:24Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Future Functionalisation">Future Functionalisation</a><br />
</li><br />
<li><a data-scroll href="#Nickel filtration assay">Nickel filtration assay</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Future Functionalisation"><br />
<h2>Future Functionalisation</h2><br />
<p>Our system for functionalising cellulose membranes is inherently modular. Proteins to bind or degrade a limitless range of contaminants can be bound to cellulose membranes. Filtration can then be adapted to the particular contaminants, altering seasonally, geographically and adapting over time to emerging threats. Metaldehyde contamination in the English home counties (Mathiesen 2013) could be addressed with specific degradation enzymes and microcystin could be removed from supplies in Ohio contaminated from algal blooms (Queally 2014). <br />
</p><br />
</section><br />
<section id="Nickel filtration assay"><br />
<h2>Nickel filtration assay</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
The nickel ions are an example of heavy metals, poisonous even in relatively small concentrations in water and notoriously difficult to filter with current filtration methods. Therefore our filtration concept was tested against a concentration of nickel in water that far exceeds the safe limits. We have attempted to filter high amount of nickel (250 μM) through the cellulose filters grown by the <em>G. Xylinus</em> ATCC53582 strain (<a href=”http://parts.igem.org/Part:BBa_K1321305”>K1321305</a>). The phytochelatin-dCBD fusion (<a href=”http://parts.igem.org/Part:BBa_K1321110”>K1321110</a>) was coated on the surface of the cellulose to make a nickel specific functionalised ultra filtration membrane. To test the two membranes we have used coffee press. As a control measure we have also attempted to the filter the nickel solution through the cellulose that was not further functionalised.<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:10:29Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Aqualose">Aqualose</a><br />
</li><br />
<li><a data-scroll href="#Phytochelatin-dCBD metal binding assay">Phytochelatin-dCBD metal binding assay</a><br />
</li><br />
<li><a data-scroll href="#Nickel filtration assay">Nickel filtration assay</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Aqualose"><br />
<h2>Aqualose</h2><br />
<p>Microbial cellulose membranes are considerably cheaper than competitors. Whilst Polyvinylidene fluoride (PVDF) ultrafiltration membranes typically sell to the wastewater industry at upwards of $100 /m<sup>2</sup> (Shenzhen Youber Technology Co., Ltd. no date). Current bacterial cellulose production for nata de coco costs around $1.6 /gram (Lee et al. 2014) and our cellulose with <em>G. xylinus</em> igem cost only £0.09 ($0.14) /g. Our thin cellulose membranes for filtration weighed around 20 g/m<sup>2</sup> so would cost just $2.80 /m2. Whilst <a href="https://2014.igem.org/Team:Imperial/Mechanical_Testing"> Our studies</a> and existing literature (Fifield 2012) suggest bacterial cellulose is a strong and durable material however we would expect a shorter membrane life than the highly durable PVDF. Being considerably cheaper and easier to dispose of however, cellulose membranes could be more regularly replaced and still provide a more cost effective solution. This would also save on chemical washes regularly required to sustain the extended life of PVDF membranes. <br />
</p><br />
</section><br />
<section id="Phytochelatin-dCBD metal binding assay"><br />
<h2>Phytochelatin-dCBD metal binding assay</h2><br />
<br />
</section><br />
<section id="Nickel filtration assay"><br />
<h2>Nickel filtration assay</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
The nickel ions are an example of heavy metals, poisonous even in relatively small concentrations in water and notoriously difficult to filter with current filtration methods. Therefore our filtration concept was tested against a concentration of nickel in water that far exceeds the safe limits. We have attempted to filter high amount of nickel (250 μM) through the cellulose filters grown by the <em>G. Xylinus</em> ATCC53582 strain (<a href=”http://parts.igem.org/Part:BBa_K1321305”>K1321305</a>). The phytochelatin-dCBD fusion (<a href=”http://parts.igem.org/Part:BBa_K1321110”>K1321110</a>) was coated on the surface of the cellulose to make a nickel specific functionalised ultra filtration membrane. To test the two membranes we have used coffee press. As a control measure we have also attempted to the filter the nickel solution through the cellulose that was not further functionalised.<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:08:30Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Phytochelatin-dCBD metal binding assay">Phytochelatin-dCBD metal binding assay</a><br />
</li><br />
<li><a data-scroll href="#Nickel filtration assay">Nickel filtration assay</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>Text here</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Introduction</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Ultrafiltration"><br />
<h2>Ultrafiltration</h2><br />
<p><br />
</p><br />
</section><br />
<section id="Phytochelatin-dCBD metal binding assay"><br />
<h2>Phytochelatin-dCBD metal binding assay</h2><br />
<br />
</section><br />
<section id="Nickel filtration assay"><br />
<h2>Nickel filtration assay</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
The nickel ions are an example of heavy metals, poisonous even in relatively small concentrations in water and notoriously difficult to filter with current filtration methods. Therefore our filtration concept was tested against a concentration of nickel in water that far exceeds the safe limits. We have attempted to filter high amount of nickel (250 μM) through the cellulose filters grown by the <em>G. Xylinus</em> ATCC53582 strain (<a href=”http://parts.igem.org/Part:BBa_K1321305”>K1321305</a>). The phytochelatin-dCBD fusion (<a href=”http://parts.igem.org/Part:BBa_K1321110”>K1321110</a>) was coated on the surface of the cellulose to make a nickel specific functionalised ultra filtration membrane. To test the two membranes we have used coffee press. As a control measure we have also attempted to the filter the nickel solution through the cellulose that was not further functionalised.<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:05:24Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Phytochelatin-dCBD metal binding assay">Phytochelatin-dCBD metal binding assay</a><br />
</li><br />
<li><a data-scroll href="#Nickel filtration assay">Nickel filtration assay</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a></li><br />
<li>Limitations in current ultrafiltration technologies can be addressed by functionalised membranes for specific contaminant binding</li><br />
<li>The modularity underlying membrane fuctionalisation allows future targeting of any current or emerging contaminant</li><br />
<li>Our aqualose water treatment process offers a cost effective alternative to traditional ultrafiltration</li><br />
<li>The process is adaptable functioning equally as a bolt on to existing treatment facilities or as a standalone purification solution</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Introduction</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Ultrafiltration"><br />
<h2>Ultrafiltration</h2><br />
<br />
</section><br />
<section id="Phytochelatin-dCBD metal binding assay"><br />
<h2>Phytochelatin-dCBD metal binding assay</h2><br />
<br />
</section><br />
<section id="Nickel filtration assay"><br />
<h2>Nickel filtration assay</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
The nickel ions are an example of heavy metals, poisonous even in relatively small concentrations in water and notoriously difficult to filter with current filtration methods. Therefore our filtration concept was tested against a concentration of nickel in water that far exceeds the safe limits. We have attempted to filter high amount of nickel (250 μM) through the cellulose filters grown by the <em>G. Xylinus</em> ATCC53582 strain (<a href=”http://parts.igem.org/Part:BBa_K1321305”>K1321305</a>). The phytochelatin-dCBD fusion (<a href=”http://parts.igem.org/Part:BBa_K1321110”>K1321110</a>) was coated on the surface of the cellulose to make a nickel specific functionalised ultra filtration membrane. To test the two membranes we have used coffee press. As a control measure we have also attempted to the filter the nickel solution through the cellulose that was not further functionalised.<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:04:05Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Phytochelatin-dCBD metal binding assay">Phytochelatin-dCBD metal binding assay</a><br />
</li><br />
<li><a data-scroll href="#Nickel filtration assay">Nickel filtration assay</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>At a Glance</h2><br />
<ul><br />
<li>Ultrafiltration has many advantages for <a href="https://2014.igem.org/Team:Imperial/Water_Report#wastewate"> wastewater recycling </a>r</li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Introduction</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant output quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Ultrafiltration"><br />
<h2>Ultrafiltration</h2><br />
<br />
</section><br />
<section id="Phytochelatin-dCBD metal binding assay"><br />
<h2>Phytochelatin-dCBD metal binding assay</h2><br />
<br />
</section><br />
<section id="Nickel filtration assay"><br />
<h2>Nickel filtration assay</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
The nickel ions are an example of heavy metals, poisonous even in relatively small concentrations in water and notoriously difficult to filter with current filtration methods. Therefore our filtration concept was tested against a concentration of nickel in water that far exceeds the safe limits. We have attempted to filter high amount of nickel (250 μM) through the cellulose filters grown by the <em>G. Xylinus</em> ATCC53582 strain (<a href=”http://parts.igem.org/Part:BBa_K1321305”>K1321305</a>). The phytochelatin-dCBD fusion (<a href=”http://parts.igem.org/Part:BBa_K1321110”>K1321110</a>) was coated on the surface of the cellulose to make a nickel specific functionalised ultra filtration membrane. To test the two membranes we have used coffee press. As a control measure we have also attempted to the filter the nickel solution through the cellulose that was not further functionalised.<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T01:01:50Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Phytochelatin-dCBD metal binding assay">Phytochelatin-dCBD metal binding assay</a><br />
</li><br />
<li><a data-scroll href="#Nickel filtration assay">Nickel filtration assay</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Made cellulose binding domains</li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Introduction</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Chemical free (aside from cleaning)</li><br />
<li><br />
Constant product quality regardless of feed quality (excluding small molecule contaminants, changes in input water quality affect only the life of the membrane, not the quality of the flow through)</li><br />
<li><br />
Compact plant size, efficient for small scale, <a href="https://2014.igem.org/Team:Imperial/Water_Report#decentralisation"> decentralised</a> purification</li><br />
<li><br />
High quality of output water particularly with regards to pathogen removal</li><br />
</ul><br />
</p><br />
<p><br />
UF processes are currently limited by the high cost of membranes, inevitable membrane fouling means they must be regularly replaced. There use is also restricted by limitations in removal of small molecule contaminants. They can only be employed where feed water is free of these contaminants or in tandem with other (often slow or energy intensive) treatment methods for removing them. </p><br />
</section><br />
<section id="Ultrafiltration"><br />
<h2>Ultrafiltration</h2><br />
<br />
</section><br />
<section id="Phytochelatin-dCBD metal binding assay"><br />
<h2>Phytochelatin-dCBD metal binding assay</h2><br />
<br />
</section><br />
<section id="Nickel filtration assay"><br />
<h2>Nickel filtration assay</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
The nickel ions are an example of heavy metals, poisonous even in relatively small concentrations in water and notoriously difficult to filter with current filtration methods. Therefore our filtration concept was tested against a concentration of nickel in water that far exceeds the safe limits. We have attempted to filter high amount of nickel (250 μM) through the cellulose filters grown by the <em>G. Xylinus</em> ATCC53582 strain (<a href=”http://parts.igem.org/Part:BBa_K1321305”>K1321305</a>). The phytochelatin-dCBD fusion (<a href=”http://parts.igem.org/Part:BBa_K1321110”>K1321110</a>) was coated on the surface of the cellulose to make a nickel specific functionalised ultra filtration membrane. To test the two membranes we have used coffee press. As a control measure we have also attempted to the filter the nickel solution through the cellulose that was not further functionalised.<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T00:59:18Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Phytochelatin-dCBD metal binding assay">Phytochelatin-dCBD metal binding assay</a><br />
</li><br />
<li><a data-scroll href="#Nickel filtration assay">Nickel filtration assay</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Made cellulose binding domains</li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Introduction</h2><br />
<p><br />
Ultrafiltration (UF) membranes have a pore size of 0.1 to 0.01um (10 to 100nm) and are capable of removing particulates, bacteria and viruses. Microbial cellulose sheets naturally have pore sizes in this range (Gatenholm, P., & Klemm, D. (2010), Mautner et al 2014). Current ultrafiltration cannot remove small molecule contaminants such as pesticides and heavy metals however. Whilst nanofiltration and reverse osmosis membranes can exclude these small molecules they are expensive and energy intensive to use. Flow rates are low, they require very high pressures and the input water must be already purified by primary and secondary processes to avoid damaging the membranes.</p><br />
<p><br />
https://static.igem.org/mediawiki/2014/4/47/IC-14_Water_Purification_Spectrum1.JPG<br />
<br />
Size exclusion for different grades of filter (from http://www.edstrom.com/)<br />
<br />
Depending on input water quality UF systems may replace or complement existing secondary (coagulation, flocculation, sedimentation) and tertiary filtration (sand filtration and chlorination) systems in water treatment plants. Pretreatment of feed water is usually required to prevent reduce damage to the membrane units though ultrafiltration may be used in standalone systems for isolated regions. UF processes have the following advantages over traditional treatment methods:<br />
</p><br />
<p><br />
<ul><br />
<li><br />
Pore size - average or maximum size of pores in the material</li><br />
<li><br />
Porosity - volume of the filter not occupied by solid material</li><br />
<li><br />
Tortuosity - length of paths through the filter compared with a straight line</li><br />
<li><br />
Adhesion - the strength of hydrogen bond interactions between the fluid and filter</li><br />
<li><br />
Kinetic rate constants - parameters defining how the filter material affects chemical reactions in the fluid</li><br />
</ul><br />
</p><br />
<p><br />
These properties contribute to the filter’s flow rate, measured in units of fluid filtered per unit surface area of the filter per unit time (e.g. Ga m<sup>-2</sup> h<sup>-1</sup>). Altering the filter’s flow rate generally affects the filter’s efficiency at removing its targets, as increasing the flow rate typically involves increasing the pore size or reducing the surface area of the filter in contact with the fluid. This trade-off is the main hurdle in industrial water filtration, where demands for high-quality filtration require very low flow rates. Industrial processes are further complicated by blockage of the pores, fouling of the filter by organisms and the lack of a complete set of materials that will exhaustively filter all contaminants - heavy metal ions, small organic molecules and non-polar compounds remain difficult to filter without prior chemical treatments that themselves need to be filtered out.</p><br />
</section><br />
<section id="Ultrafiltration"><br />
<h2>Ultrafiltration</h2><br />
<br />
</section><br />
<section id="Phytochelatin-dCBD metal binding assay"><br />
<h2>Phytochelatin-dCBD metal binding assay</h2><br />
<br />
</section><br />
<section id="Nickel filtration assay"><br />
<h2>Nickel filtration assay</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
The nickel ions are an example of heavy metals, poisonous even in relatively small concentrations in water and notoriously difficult to filter with current filtration methods. Therefore our filtration concept was tested against a concentration of nickel in water that far exceeds the safe limits. We have attempted to filter high amount of nickel (250 μM) through the cellulose filters grown by the <em>G. Xylinus</em> ATCC53582 strain (<a href=”http://parts.igem.org/Part:BBa_K1321305”>K1321305</a>). The phytochelatin-dCBD fusion (<a href=”http://parts.igem.org/Part:BBa_K1321110”>K1321110</a>) was coated on the surface of the cellulose to make a nickel specific functionalised ultra filtration membrane. To test the two membranes we have used coffee press. As a control measure we have also attempted to the filter the nickel solution through the cellulose that was not further functionalised.<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/ImplementationTeam:Imperial/Implementation2014-10-18T00:57:09Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>Implementation</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#Introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#Ultrafiltration">Ultrafiltration</a><br />
</li><br />
<li><a data-scroll href="#Phytochelatin-dCBD metal binding assay">Phytochelatin-dCBD metal binding assay</a><br />
</li><br />
<li><a data-scroll href="#Nickel filtration assay">Nickel filtration assay</a><br />
</li><br />
<li><a data-scroll href="#References">References</a><br />
</li><br />
<br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>By attaching functional proteins to cellulose we can expand it's properties and selectivity capture specific contaminants in water. We used five different cellulose binding domains and fused them to different metal binding proteins, and sfGFP. We performed assays to test the binding of the CBD fusions to our cellulose.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li>Made cellulose binding domains</li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<section id="Introduction"><br />
<h2>Introduction</h2><br />
<p><br />
Water is typically purified by passing it through layers of porous materials, each specially selected for its ability to remove specific forms of contamination. All porous materials can filter particles by size, many have extra capabilities thanks to their chemical properties. For example, charcoal - or activated carbon - is a porous component of household and industrial water filters that can also bind large or electron-rich molecules via the van der Waals forces, and catalyse the breakdown of other chemicals such as molecular chlorine. While there are many different types of filters, we can categorise and compare them using their measurable physical and chemical properties. The key physical properties are:</p><br />
<p><br />
<ul><br />
<li><br />
Pore size - average or maximum size of pores in the material</li><br />
<li><br />
Porosity - volume of the filter not occupied by solid material</li><br />
<li><br />
Tortuosity - length of paths through the filter compared with a straight line</li><br />
<li><br />
Adhesion - the strength of hydrogen bond interactions between the fluid and filter</li><br />
<li><br />
Kinetic rate constants - parameters defining how the filter material affects chemical reactions in the fluid</li><br />
</ul><br />
</p><br />
<p><br />
These properties contribute to the filter’s flow rate, measured in units of fluid filtered per unit surface area of the filter per unit time (e.g. Ga m<sup>-2</sup> h<sup>-1</sup>). Altering the filter’s flow rate generally affects the filter’s efficiency at removing its targets, as increasing the flow rate typically involves increasing the pore size or reducing the surface area of the filter in contact with the fluid. This trade-off is the main hurdle in industrial water filtration, where demands for high-quality filtration require very low flow rates. Industrial processes are further complicated by blockage of the pores, fouling of the filter by organisms and the lack of a complete set of materials that will exhaustively filter all contaminants - heavy metal ions, small organic molecules and non-polar compounds remain difficult to filter without prior chemical treatments that themselves need to be filtered out.</p><br />
</section><br />
<section id="Ultrafiltration"><br />
<h2>Ultrafiltration</h2><br />
<br />
</section><br />
<section id="Phytochelatin-dCBD metal binding assay"><br />
<h2>Phytochelatin-dCBD metal binding assay</h2><br />
<br />
</section><br />
<section id="Nickel filtration assay"><br />
<h2>Nickel filtration assay</h2><br />
<figure class="content-image image-right"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/9/9d/IC14-Water_filtration_pictures.png"><br />
<figcaption>Figure X: The set up for the nickel filtration assay. A) The coffee press used for the mounting of the cellulose and for filtration process. B) Cellulose without attached phytochelatin-dCBD protein. C) Functionalised cellulose with attached phytochelatin-dCBD protein.</figcaption><br />
</figure><br />
<p><br />
The nickel ions are an example of heavy metals, poisonous even in relatively small concentrations in water and notoriously difficult to filter with current filtration methods. Therefore our filtration concept was tested against a concentration of nickel in water that far exceeds the safe limits. We have attempted to filter high amount of nickel (250 μM) through the cellulose filters grown by the <em>G. Xylinus</em> ATCC53582 strain (<a href=”http://parts.igem.org/Part:BBa_K1321305”>K1321305</a>). The phytochelatin-dCBD fusion (<a href=”http://parts.igem.org/Part:BBa_K1321110”>K1321110</a>) was coated on the surface of the cellulose to make a nickel specific functionalised ultra filtration membrane. To test the two membranes we have used coffee press. As a control measure we have also attempted to the filter the nickel solution through the cellulose that was not further functionalised.<br />
</p><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
</br><br />
<br />
<br />
<h3>Results</h3><br />
<br />
</section><br />
<div class="pure-u-1-1"><br />
<section id="References"><br />
<h2>References</h2><br />
<br />
</section><br />
</div><br />
</div><br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/File:IC-14_Membrane_backwash.gifFile:IC-14 Membrane backwash.gif2014-10-17T23:38:03Z<p>Geoben: </p>
<hr />
<div></div>Geobenhttp://2014.igem.org/File:IC-14_Water_Purification_Spectrum1.JPGFile:IC-14 Water Purification Spectrum1.JPG2014-10-17T23:23:11Z<p>Geoben: </p>
<hr />
<div></div>Geobenhttp://2014.igem.org/Team:Imperial/The_i_in_iGEMTeam:Imperial/The i in iGEM2014-10-17T18:50:21Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<!-- <script src="https://2014.igem.org/Team:Imperial/Resources/JS:highmaps?action=raw&ctype=text/js"></script> --><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:highcharts?action=raw&ctype=text/js"></script><br />
<script src="http://code.highcharts.com/maps/modules/map.js"></script><br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:data?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:exporting?action=raw&ctype=text/js"></script><br />
<script src="http://code.highcharts.com/mapdata/custom/world-robinson-highres.js"></script><br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:maps?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:charts?action=raw&ctype=text/js"></script><br />
<script><br />
$(document).ready(function () {<br />
$('#bxslider').bxSlider({<br />
<br />
});<br />
});<br />
</script><br />
<body><br />
<!--End of Header section--><br />
<br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>The i in iGEM</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction" >Introduction</a><br />
</li><br />
<li><a data-scroll href="#english" >Lingua Academica</a><br />
</li><br />
<li><a data-scroll href="#methods" >Methods</a><br />
</li><br />
<li><a data-scroll href="#countries" >The Countries</a><br />
</li><br />
<li><a data-scroll href="#language" >The Language</a><br />
</li><br />
<li><a data-scroll href="#judges">The Judges</a><br />
</li><br />
<li><a data-scroll href="#recommendations">Recommendations</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>As an international competition, every year iGEM welcomes teams from a great range of countries, with a variety of languages spoken amongst its teams and judges. This part of our Policy & Practices seeks to understand the effect of English as the <em>lingua franca</em> of science on the participation and outcome of the competition. In order to achieve this we have looked into the different nationalities of the teams and finalists and the different lingual backgrounds of teams and finalists over the years. We derived our conclusions by comparing this data with factors such as academic output and impact of their countries of origins, the lingual background of the iGEM judges, the international rankings of their universities and the English Proficiency Index of their countries of origin.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<br />
<p>iGEM stands for ‘International Genetically Engineered Machine” and as the first word of this acronym indicates, countries and universities from all over the world are well represented. The iGEM competition has grown into a diverse community with a great range of nationalities, cultures and languages represented. The competition took its name in 2005, when 14 teams from 4 different countries came together to develop novel ideas based on synthetic biology. At that time, German and English were the only two languages represented. Since then, the competition has grown, reaching the 100 team milestone in 2009 and climbing to a staggering 245 teams from 32 different countries with 20 languages this year, its 10th anniversary. The competition has been expanding in all directions. Different teams compete in different tracks, for different awards and there is now a separation between undergraduate and overgraduate teams.<br />
</p><br />
<p>The language that all the teams communicate their project is English, as per <em>lingua academica</em>. In the spirit of synthetic biology, where standardization and application of the same principals throughout the discipline is promoted, it is certainly essential that all the stakeholders have a common language of communication. Rapid international expansion and the necessity of a single language however present many challenges which need to be addressed.<br />
</p><br />
<div class="bxslider" style="height:500px"><br />
<div id="CitableDocuments" style="max-width: 900px;height:450px"></div><br />
<div id="Citations" style="max-width: 900px"></div><br />
<br />
<div id="EPI" style="max-width: 900px"></div><br />
<div id="Finalists" style="max-width: 900px"></div><br />
<br />
<div id="journalRanking" style="max-width: 900px"></div><br />
<br />
<div id="QS_Biological" style="max-width: 900px"></div><br />
<br />
<div id="QS_Overall" style="max-width: 900px"></div><br />
</div><br />
<br />
<br />
<br />
<br />
<div id="JudgesAndTeams" style="max-width: 900px;height:450px"></div><br />
<div id="JudgesTop5Languages" style="max-width: 900px"></div><br />
<br />
<div id="LanguageFamily" style="max-width: 900px"></div><br />
<div id="MultilingualJudges" style="max-width: 900px"></div><br />
<br />
<div id="TeamCountryLanguage" style="max-width: 900px"></div><br />
<br />
<div id="Top10Countries" style="max-width: 900px"></div><br />
<br />
<div id="Top13Countries" style="max-width: 900px"></div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<section id="entroduction"><br />
<h2>English as the lingua franca of science</h2><br />
<p>The vast volume of scientific information available in today’s “Information Age” demands effective management and distribution to individuals and institutions. Such communication of ideas across cultures and national borders requires the use of a common language. During the 20th century, English became the primary language for international communication in science and business (Tardy 2006) and English-speaking countries (mainly US and the UK) are the major players in the distribution and generation of knowledge, as demonstrated by their domination in the university and journal rankings.</p> <br />
<p>The status of English as <em>lingua academica</em> does not come without its controversies. In non-English speaking countries, the main role of English is the reporting of professional knowledge, rather than direct communication between scholars. Whilst non-native English speaking scientists may have a good level of competency in jargon and understanding written English they are still at a disadvantage when called to communicate their complex ideas in an international setting. According to SCImago Journal & Country Rankings (SJR 2014), the majority of high impact journals are in English. This forces many non-English speaking scientists and engineers to communicate their science in English, in order to gain status and recognition. This is an additional disadvantage the researchers, who are trying to conduct high impact science from a nation with peripheral status (Tardy 2006).</p><br />
<p>Other effects of the language barrier can be seen in international scientific collaborations. It is well established that the growing importance of international scientific collaborations requires not only common knowledge and understanding of the scientific terminology, but also clear communication. Using a common language is the intuitive way to achieve this and English has been filling that role (Hwang 2012). Again, non-native speakers are at a disadvantage, Babcock and Du-Babcok (2001) explain that “in communication encounters, low proficiency second-language speakers contribute fewer ideas than do fluent second-language speakers or first-language speakers”. Interestingly a study conducted by Ylvanez and Shrum in 2009 showed that a reason behind the collaboration between Philippine and Japanese scientists and engineers was their similar, low levels of English competency (Ylvanez & Shrum 2009), reflecting perhaps a method of compromise so the voices of both sides can be heard equally.<br />
</p><br />
<br />
<br />
<br />
</section><br />
<br />
<br />
</section><br />
<section id="methods"><br />
<h2>Study Methods</h2><br />
<p>Language data was collected as follows: We looked into all the teams that participated in iGEM over the years (iGEM 2004 – 2014) and looked into the country. If the country has only one official language, that is considered the language of the team. For countries with more than one official languages, we looked into the specific language of the institution, as well as the location of the institution within the country (for example, in India and Canada, different languages are spoken in geographical regions). In order to get a better insight in the finalists of previous years, we contacted students of this year’s team from the same university and, when possible, members of the finalist team. That gave us a good insight into the teaching methods of their university, attitude to iGEM and how that reflects on the result of the competition. QS rankings was our university ranking system of choice, because it put a lot of gravity in Academic reputation of the institutions and citations per faculty, while it did not ignore the universities’ diversity, by looking into the international student ratio and the international staff ratio (QS 2014).<br />
</p><br />
<p>For data on judges The iGEM organization publishes the names of the participating judges from the year 2009 up to 2013. Between 2011 and 2013, when the regional jamborees occurred, there is a record of judges that were part of the regionals, as well as the championships. Our first assumption was that all judges speak English. We then took each name and tried to match it to an individual and via online CVs, LinkedIn, academic and business profiles we tried to discover the lingual background of the particular individuals. The best case scenario was people listing the languages they can speak (and their level of competency) in their CVs and LinkedIn. If that was not the case, we moved to the university they come from and where they gained their undergraduate degree from. Finally, some judges mentioned their country of origin in their business/ academic profiles and the language was matched. While we recognize that a lot of mistakes could have been made in the process, we tried to be as precise as possible throughout the procedure.</p><br />
<h3>Case Studies</h3><br />
<br />
<br />
</section><br />
<br />
<section id="countries"><br />
<h2>The Countries and Continents</h2><br />
<p>Over the years, 43 different countries have participated in the competition.<br />
North America is home to iGEM and the continent with most participating teams. With 33 of its universities in the top 100 of the QS rankings, it’s arguably the leading continent in academia. Over the years, 453 teams originate from the continent, mostly from the United States. Over the years, the US has had teams in the finalists (top 6), 9 times.<br />
Alongside North America, Europe was one of the initial participants in the competition when it became international in 2005. It has been represented by 343 universities and colleges over the years. Home to 41 of the 100 top universities in the world, according to QS rankings, Europe attracts a large student population from around the world to its academic institutions. Universities in the UK and Germany have had particularly strong presence in iGEM. European teams have been finalists in the competition an amazing 26 times, more than any other continent in the history of the competition. The best year for Europe was 2009, when all the finalists originated from the continent. Last year, all of the Undergraduate finalists and 2 out of the 3 overgraduate finalists where European teams.</p><br />
<p>Asia is the continent whose participation in the competition has seen the most rapid increase. Between 2010 and 2014 the participation of Asian teams has grown 115% percent, compared to the 76% of Europe, 79% of North America and the 91% growth in the competition overall. The key player here is China, which has seen a huge 455% increase in number of teams, significantly more than any other participating country. Despite the growth of the continent in the competition, this has not translated into finalists. Only 12% of finalists come from Asia, a mere 5 out of 41 previous finalists. No more than one Asian team has been a finalist per year.<br />
</p><br />
<br />
<h3>Case Study: China and the USA</h3><br />
<p>Consider two examples: On one hand, we have the USA, visible in the first map as the country with most citable publications (87,600). It keeps its throne in the second map with almost 2 million citations. Here it should be noted that the second country, Germany, ranks to only around half a million.</p><br />
<p>On the other hand, we have China. In the second place, with 37,225 citable documents, it slips to place 6 when it comes to citations. With about 285,000 citations, it falls below countries like the UK and France that occupy the 6th (20,065 publications) and 8th (13,652 publications) place respectively in the citable documents ranking.</p> <br />
<p>For the h-index of both countries, which measures the <em>productivity and impact of published work of a scientist or scholar</em>, the US maintains the top spot, while China slips to 13th. The UK, which only produces around 60% of citable documents compared to China, is placed 3<sup>rd</sup>. Australia, with less than 8,000 citable publications, is ranked just 2 places below China (SJR 2014). It seems language barriers can reduce impact of published work from non-native English speaking countries. Whilst many cultural and socioeconomic factors contribute to the discrepancy between China’s publishing output and h-index rankings language also has a role to play (Moed 2002)</p><br />
<br />
<br />
<h3>University Case studies: Team Members are Multinational</h3><br />
<p>Needs and introductory sentence e.g. iGEM is international between teams but also within teams. The competition attracts top universities and top universities attract students from around the world.</p><br />
<p>In the UK, 18% of the student population comes from outside the country. That translates to about 425,000 students. If we take a look specifically into institutions that have the longest history of participation in iGEM, the numbers are even higher: In our very own Imperial College London, 44% of the students come outside of the UK. Cambridge, the first UK University to participate in the competition has a population of 33% foreign students and the University of Edinburgh includes 35% non-UK students in its body (UKISA 2013).<br />
Moving to Germany, a similar story unfolds: 11.3%, or 282,201 of the students come from outside the country (DAAD 2014). In the two universities with the longest history in the competition, University of Heidelberg and University of Freiburg, 17.1% and 15% of the students respectively come from outside of Germany (NUS International Relations Office 2014) (University of Heidelberg 2014).</p><br />
<p>Finally, the United States of America. In 2013, it was reported that about 820,000 non US nationals were enrolled in US universities. That makes up only 3.3% percent of the population. If we look specifically though into universities that have been participating in iGEM for a while, those percentages shift dramatically. MIT, birthplace of the competition, 28.63% of the students are international (MIT ISO 2014). In Purdue University, another early iGEM participant, the percentage is 15% for undergraduates and 38% for graduate students (Purdue 2012).</p><br />
<p>Currently, there is no way of knowing this however since iGEM does not record the nationality of participants. As a result, the i in iGEM refers only to the origin of the participant universities, rather than the participating individuals. Countries with no representation through teams in the competition are still represented by individuals. Just within the history of Imperial College iGEM there are students from 5 different countries with no official participation in the competition: Cyprus, Estonia, Greece, Pakistan and Slovakia (Imperial iGEM wiki 2008, 2009, 2011, and 2014).</p><br />
<p>Many internationally educated scholars end up returning to their home country or wishing to have an impact on its scientific output. A study conducted by the University of California, Berkeley in 2009 showed that only 10% of Chinese, 6% of Indian and 15% of European students were intending to stay in the US post studies (Wadhwa 2009). A survey conducted in Europe by the ICEF monitor reveals that only 12.5% of the students studying abroad in the UK, France, the Netherlands, Sweden and Germany wish to stay in those countries 5 years after their graduation. The majority of them plan to return back home (SVR 2012). It is likely that when returning home many of these scientists will establish themselves in their field of interest, using the skills they acquired from their studies abroad. In the case of iGEM, people that seek to participate in the competition have a keen interest in Synthetic Biology and it is common for alumni to consider a career in the field. Since Synthetic Biology is such a young and ever expanding discipline, it is not unlikely that iGEM alumni that come from countries with no previous history in the competition, will return home and try to set the scene for the growth of SynBio and even iGEM itself.</p><br />
<p>Although a significant number of countries enters the competition every year, the top 6 is occupied only by very few of them, as demonstrated in the map (Heatmap with top 6).<br />
</p> <br />
<br />
<h3>Case studies</h3><br />
<h4>China</h4><br />
<p>The country with the biggest growth in participation is China. As seen in the figure, the participation of Chinese teams has leaped from 9 in 2010 to a staggering 50 within the last four years. Although the number of Chinese teams is on the rise, this is not reflected in the annual top 6 teams in the competition. There has been only one finalist team in 2013, 2011, 2010 and 2007 and none in any other years. The teams come from some of the highest ranked universities in the country (QS 2013) and as noted previously, China is placed 2<sup>nd</sup> in the citable publications rankings (SJR 2014). Therefore the result seems unexpected for a country with such strong presence in the competition and significant academic reputation. Many factors are at play here but it is certainly a consideration that the country is ranked in place 34 out of 60 in the EF proficiency index (EF English Proficiency Index 2014), classified as ‘low’. This can have a significant impact in the communication of the project which turn affects its competition performance.</p><br />
<br />
<br />
<h4>Case study: Germany, a success story</h4><br />
<p>Germany is a country that frequents the top 6 of the competition, and the non-English speaking country with most finalists in its history. Last year Germany dominated iGEM: 3 out of the 6 finalists came from the country. In Undergrad, the winner and 1<sup>st</sup> runner up were teams from German universities. There are many factors to which the success of Germany can be attributed. With 3 universities in the world top 100 according to QS, it is second only to Switzerland to non-English speaking countries with a strong presence in the rankings. Producing the 5nd highest number of citable publications, it is ranked 2<sup>nd</sup> to publication cites and enjoys the 2<sup>nd</sup> highest H index, it is a major player in the scientific community. It comes as no surprise that it attracts a large number of international students that seek to be educated in one of its institutions. Additionally, it is ranked 13<sup>th</sup> in the EF English Proficiency Index, with classification ‘High Proficiency’. Also, before the dawn of English in the 20th century, German held the status of <em>lingua academica</em> and a lot of core scientific knowledge is accessible to its speakers. All these facts combined make a strong case for well-rounded teams, that do not only come from a strong scientific background, but can also can effectively communicate their projects.</p><br />
<br />
<br />
<h4>Japan versus the Netherlands</h4><br />
<p>Japan and the Netherlands are two countries with a long history in the competition. Starting in 2007 and 2008 respectively, both have been consistently represented since. Japan has 5 universities in the top 100 (QS 2014) compared to the 6 in the Netherlands (QS, 2014). Japan is the 3<sup>rd </sup>country in the world in citable publications output, while the Netherlands is ranked 12<sup>th </sup>. The gap closed when we look into Cites rankings, where Japan ranks 4<sup>th</sup> and the Netherlands ranks 9<sup>th</sup>. Finally, in terms of H index, the countries are closely comparable with Japan placed 5<sup>th</sup> and the Netherlands 6<sup>th</sup> (SJR 2014).</p><br />
<p>Even though the academic performance of these countries in science/engineering generally, as well as Biotechnology specifically, is similar, their performance in iGEM is not. Japan has averaged 8 teams in the competition every year, while the Netherlands have had only 4, yet Japan has never been a finalist in the competition, while Netherlands has had a winner already (2012) and has been a finalist twice on top of this. It is perhaps a contributing factor that the Netherlands are ranked 3<sup>rd</sup> in the EF English Proficiency index, while Japan falls 26<sup>th</sup> out of 60 (EF English Proficiency Index 2014).</p><br />
</section><br />
<br />
<section id="language"><br />
<h2>The Language</h2><br />
<p>Another dimension of the inter-nationality of iGEM is the different languages represented in the competition. In the last 5 years, at least 20 different languages are represented. The usual, widely spoken internationally, are English, Mandarin, Spanish, German and French, while some less widely spoken languages, such as Finnish, Kazakh, Nepalese and Hungarian have made appearances.</p><br />
<p>The dominant language of the competition is English, with about 40% of the participants coming from English-speaking universities. That means that 60% of the participants come from different lingual backgrounds. The second greatest presence is Mandarin (spoken by Chinese and Taiwanese teams) and there is a strong presence of Romance and Germanic languages (Spanish, French, German, Dutch), coming from the European and Latin American participants.</p><br />
<br />
<h3>Insight into the finalists</h3><br />
<p>We had a chance to speak to all but two of the non-English speaking finalists in order to get a better insight into the challenges of the language barrier. The overwhelming majority of the successful European teams (examples include Paris Bettencourt, Groningen, Bielefeld and TU Delft) have noted that their teams include many international students. Classes are taught in both the language native to their university and English, with students offered a choice on the language of their thesis or having to write in English (Valencia). In cases where courses were not taught in English (Bielefeld), seminars that included both home and international students where Anglophone. Additionally, due to the composition of their research labs in some certain cases communication between the team members is in English.<br />
Speaking with a former member of a past team of Slovenia gave us quite a different picture compared to the rest of the European teams. As explained to us, the team was made purely of home students with Slovenian being the language of communication within the team. The majority of the material at their university has been taught in their native language, although the teaching material was in English, exposing the students in English scientific writing. Additionally, their advisors where all Slovenian PhD students that carried the majority of their studies in the native country. It needs to be noted though that when asked, that the team members were able to communicate their projects in English with ease. That could possibly be explained by Slovenia’s high ranking in the PE English Proficiency Index (10th place).<br />
</p><br />
<p>When we spoke to the Asian teams, they painted a different picture. The teams are composed exclusively by home students (in the case of ZJU China, this was because their team was composed mainly by undergraduate students, when most of the international students are postgraduate) and the primary teaching and communication is done in their native language. On the other hand, some of the teaching mediums (textbooks, Powepoint slides) are in English. The exception to this was Peking. In their university material is taught in both Chinese and English, while the students participate in classes of English for academic writing. Finally, the team composition (for this year, at least) is not entirely of home students, as an exchange student from an American university has joint.<br />
In addition to language differences, other contrasting attitudes towards the competition emerged which may also be factors affecting team performance. European teams may start brainstorming throughout their Spring term, but official work in their project is conducted mainly during an intense summer term. On the other hand, for the Asian teams iGEM is a more spread out, year-long endeavor, with the project starting even before registration for some (SYSU China).<br />
</p><br />
<br />
</section><br />
<section id="judges"><br />
<h2>The Judges</h2><br />
<p>Another aspect we have considered this year is the nationality and languages of judges recruited for the competition. As an international competition, it is expected and desired for the judges to reflect this. The majority come from participating universities and of course have a background in Synthetic Biology as scientists, engineers or social scientists in the field.<br />
From 2009 to 2013, approximately 40% of the judges are able to speak one or more languages in addition to English. Although this is generally good, specific languages are often under represented amongst the judges. A good example is the representation of Mandarin, in 2013 less than 5% of the judges were speakers, whereas 20% of the teams (over 40 from China and Taiwan) spoke the language, however the percentage is more balanced in other years .<br />
</p><br />
<p>Over the years, the percentage of multilingual judges has remained relatively constant. The dominant second languages are Mandarin or French with German and Japanese also being well represented. All these languages are spoken in countries with a consistent presence in the competition.</p><br />
<p>A case could be made that the lingual abilities of judges should not be playing a role in the competition. This is partially true, as all of the teams are expected to present their projects in English, up to the standards of the international scientific community. On the other hand we can argue that it is easier for scientists with a foreign background to understand and appreciate the additional challenges for teams where English is not their first language. Like the teams, these scientists are also called to break through language barriers in order to gain their rightful recognition in the field.</p><br />
</section><br />
<section id="recommendations" class="content"><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<h2>Recommendations</h2><br />
<p>Through the data and observations considered here and discussions with linguists and universities that deal with a large influx of international students, we offer a list of recommendations that could reduce the language barrier in iGEM and it could help non-English speaking teams to communicate their projects in a more effective way.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>For the Teams</h3><br />
<ul><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
</ul><br />
<br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>For iGEM</h3><br />
<ul><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<script src="http://code.highcharts.com/mapdata/custom/world-robinson-highres.js"></script><br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/The_i_in_iGEMTeam:Imperial/The i in iGEM2014-10-17T18:46:02Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<br />
<!-- <script src="https://2014.igem.org/Team:Imperial/Resources/JS:highmaps?action=raw&ctype=text/js"></script> --><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:highcharts?action=raw&ctype=text/js"></script><br />
<script src="http://code.highcharts.com/maps/modules/map.js"></script><br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:data?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:exporting?action=raw&ctype=text/js"></script><br />
<script src="http://code.highcharts.com/mapdata/custom/world-robinson-highres.js"></script><br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:maps?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:charts?action=raw&ctype=text/js"></script><br />
<script><br />
$(document).ready(function () {<br />
$('#bxslider').bxSlider({<br />
<br />
});<br />
});<br />
</script><br />
<body><br />
<!--End of Header section--><br />
<br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>The i in iGEM</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction" >Introduction</a><br />
</li><br />
<li><a data-scroll href="#english" >Lingua Academica</a><br />
</li><br />
<li><a data-scroll href="#methods" >Methods</a><br />
</li><br />
<li><a data-scroll href="#countries" >The Countries</a><br />
</li><br />
<li><a data-scroll href="#language" >The Language</a><br />
</li><br />
<li><a data-scroll href="#judges">The Judges</a><br />
</li><br />
<li><a data-scroll href="#recommendations">Recommendations</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>As an international competition, every year iGEM welcomes teams from a great range of countries, with a variety of languages spoken amongst its teams and judges. This part of our Policy & Practices seeks to understand the effect of English as the <em>lingua franca</em> of science on the participation and outcome of the competition. In order to achieve this we have looked into the different nationalities of the teams and finalists and the different lingual backgrounds of teams and finalists over the years. We derived our conclusions by comparing this data with factors such as academic output and impact of their countries of origins, the lingual background of the iGEM judges, the international rankings of their universities and the English Proficiency Index of their countries of origin.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<br />
<p>iGEM stands for ‘International Genetically Engineered Machine” and as the first word of this acronym indicates, countries and universities from all over the world are well represented. The iGEM competition has grown into a diverse community with a great range of nationalities, cultures and languages represented. The competition took its name in 2005, when 14 teams from 4 different countries came together to develop novel ideas based on synthetic biology. At that time, German and English were the only two languages represented. Since then, the competition has grown, reaching the 100 team milestone in 2009 and climbing to a staggering 245 teams from 32 different countries with 20 languages this year, its 10th anniversary. The competition has been expanding in all directions. Different teams compete in different tracks, for different awards and there is now a separation between undergraduate and overgraduate teams.<br />
</p><br />
<p>The language that all the teams communicate their project is English, as per <em>lingua academica</em>. In the spirit of synthetic biology, where standardization and application of the same principals throughout the discipline is promoted, it is certainly essential that all the stakeholders have a common language of communication. Rapid international expansion and the necessity of a single language however present many challenges which need to be addressed.<br />
</p><br />
<div class="bxslider" style="height:500px"><br />
<div id="CitableDocuments" style="max-width: 900px;height:450px"></div><br />
<div id="Citations" style="max-width: 900px"></div><br />
<br />
<div id="EPI" style="max-width: 900px"></div><br />
<div id="Finalists" style="max-width: 900px"></div><br />
<br />
<div id="journalRanking" style="max-width: 900px"></div><br />
<br />
<div id="QS_Biological" style="max-width: 900px"></div><br />
<br />
<div id="QS_Overall" style="max-width: 900px"></div><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<section id="entroduction"><br />
<h2>English as the lingua franca of science</h2><br />
<p>The vast volume of scientific information available in today’s “Information Age” demands effective management and distribution to individuals and institutions. Such communication of ideas across cultures and national borders requires the use of a common language. During the 20th century, English became the primary language for international communication in science and business (Tardy 2006) and English-speaking countries (mainly US and the UK) are the major players in the distribution and generation of knowledge, as demonstrated by their domination in the university and journal rankings.</p> <br />
<p>The status of English as <em>lingua academica</em> does not come without its controversies. In non-English speaking countries, the main role of English is the reporting of professional knowledge, rather than direct communication between scholars. Whilst non-native English speaking scientists may have a good level of competency in jargon and understanding written English they are still at a disadvantage when called to communicate their complex ideas in an international setting. According to SCImago Journal & Country Rankings (SJR 2014), the majority of high impact journals are in English. This forces many non-English speaking scientists and engineers to communicate their science in English, in order to gain status and recognition. This is an additional disadvantage the researchers, who are trying to conduct high impact science from a nation with peripheral status (Tardy 2006).</p><br />
<p>Other effects of the language barrier can be seen in international scientific collaborations. It is well established that the growing importance of international scientific collaborations requires not only common knowledge and understanding of the scientific terminology, but also clear communication. Using a common language is the intuitive way to achieve this and English has been filling that role (Hwang 2012). Again, non-native speakers are at a disadvantage, Babcock and Du-Babcok (2001) explain that “in communication encounters, low proficiency second-language speakers contribute fewer ideas than do fluent second-language speakers or first-language speakers”. Interestingly a study conducted by Ylvanez and Shrum in 2009 showed that a reason behind the collaboration between Philippine and Japanese scientists and engineers was their similar, low levels of English competency (Ylvanez & Shrum 2009), reflecting perhaps a method of compromise so the voices of both sides can be heard equally.<br />
</p><br />
<br />
<br />
<br />
</section><br />
<br />
<br />
</section><br />
<section id="methods"><br />
<h2>Study Methods</h2><br />
<p>Language data was collected as follows: We looked into all the teams that participated in iGEM over the years (iGEM 2004 – 2014) and looked into the country. If the country has only one official language, that is considered the language of the team. For countries with more than one official languages, we looked into the specific language of the institution, as well as the location of the institution within the country (for example, in India and Canada, different languages are spoken in geographical regions). In order to get a better insight in the finalists of previous years, we contacted students of this year’s team from the same university and, when possible, members of the finalist team. That gave us a good insight into the teaching methods of their university, attitude to iGEM and how that reflects on the result of the competition. QS rankings was our university ranking system of choice, because it put a lot of gravity in Academic reputation of the institutions and citations per faculty, while it did not ignore the universities’ diversity, by looking into the international student ratio and the international staff ratio (QS 2014).<br />
</p><br />
<p>For data on judges The iGEM organization publishes the names of the participating judges from the year 2009 up to 2013. Between 2011 and 2013, when the regional jamborees occurred, there is a record of judges that were part of the regionals, as well as the championships. Our first assumption was that all judges speak English. We then took each name and tried to match it to an individual and via online CVs, LinkedIn, academic and business profiles we tried to discover the lingual background of the particular individuals. The best case scenario was people listing the languages they can speak (and their level of competency) in their CVs and LinkedIn. If that was not the case, we moved to the university they come from and where they gained their undergraduate degree from. Finally, some judges mentioned their country of origin in their business/ academic profiles and the language was matched. While we recognize that a lot of mistakes could have been made in the process, we tried to be as precise as possible throughout the procedure.</p><br />
<h3>Case Studies</h3><br />
<br />
<br />
</section><br />
<br />
<section id="countries"><br />
<h2>The Countries and Continents</h2><br />
<p>Over the years, 43 different countries have participated in the competition.<br />
North America is home to iGEM and the continent with most participating teams. With 33 of its universities in the top 100 of the QS rankings, it’s arguably the leading continent in academia. Over the years, 453 teams originate from the continent, mostly from the United States. Over the years, the US has had teams in the finalists (top 6), 9 times.<br />
Alongside North America, Europe was one of the initial participants in the competition when it became international in 2005. It has been represented by 343 universities and colleges over the years. Home to 41 of the 100 top universities in the world, according to QS rankings, Europe attracts a large student population from around the world to its academic institutions. Universities in the UK and Germany have had particularly strong presence in iGEM. European teams have been finalists in the competition an amazing 26 times, more than any other continent in the history of the competition. The best year for Europe was 2009, when all the finalists originated from the continent. Last year, all of the Undergraduate finalists and 2 out of the 3 overgraduate finalists where European teams.</p><br />
<p>Asia is the continent whose participation in the competition has seen the most rapid increase. Between 2010 and 2014 the participation of Asian teams has grown 115% percent, compared to the 76% of Europe, 79% of North America and the 91% growth in the competition overall. The key player here is China, which has seen a huge 455% increase in number of teams, significantly more than any other participating country. Despite the growth of the continent in the competition, this has not translated into finalists. Only 12% of finalists come from Asia, a mere 5 out of 41 previous finalists. No more than one Asian team has been a finalist per year.<br />
</p><br />
<br />
<h3>Case Study: China and the USA</h3><br />
<p>Consider two examples: On one hand, we have the USA, visible in the first map as the country with most citable publications (87,600). It keeps its throne in the second map with almost 2 million citations. Here it should be noted that the second country, Germany, ranks to only around half a million.</p><br />
<p>On the other hand, we have China. In the second place, with 37,225 citable documents, it slips to place 6 when it comes to citations. With about 285,000 citations, it falls below countries like the UK and France that occupy the 6th (20,065 publications) and 8th (13,652 publications) place respectively in the citable documents ranking.</p> <br />
<p>For the h-index of both countries, which measures the <em>productivity and impact of published work of a scientist or scholar</em>, the US maintains the top spot, while China slips to 13th. The UK, which only produces around 60% of citable documents compared to China, is placed 3<sup>rd</sup>. Australia, with less than 8,000 citable publications, is ranked just 2 places below China (SJR 2014). It seems language barriers can reduce impact of published work from non-native English speaking countries. Whilst many cultural and socioeconomic factors contribute to the discrepancy between China’s publishing output and h-index rankings language also has a role to play (Moed 2002)</p><br />
<br />
<br />
<h3>University Case studies: Team Members are Multinational</h3><br />
<p>Needs and introductory sentence e.g. iGEM is international between teams but also within teams. The competition attracts top universities and top universities attract students from around the world.</p><br />
<p>In the UK, 18% of the student population comes from outside the country. That translates to about 425,000 students. If we take a look specifically into institutions that have the longest history of participation in iGEM, the numbers are even higher: In our very own Imperial College London, 44% of the students come outside of the UK. Cambridge, the first UK University to participate in the competition has a population of 33% foreign students and the University of Edinburgh includes 35% non-UK students in its body (UKISA 2013).<br />
Moving to Germany, a similar story unfolds: 11.3%, or 282,201 of the students come from outside the country (DAAD 2014). In the two universities with the longest history in the competition, University of Heidelberg and University of Freiburg, 17.1% and 15% of the students respectively come from outside of Germany (NUS International Relations Office 2014) (University of Heidelberg 2014).</p><br />
<p>Finally, the United States of America. In 2013, it was reported that about 820,000 non US nationals were enrolled in US universities. That makes up only 3.3% percent of the population. If we look specifically though into universities that have been participating in iGEM for a while, those percentages shift dramatically. MIT, birthplace of the competition, 28.63% of the students are international (MIT ISO 2014). In Purdue University, another early iGEM participant, the percentage is 15% for undergraduates and 38% for graduate students (Purdue 2012).</p><br />
<p>Currently, there is no way of knowing this however since iGEM does not record the nationality of participants. As a result, the i in iGEM refers only to the origin of the participant universities, rather than the participating individuals. Countries with no representation through teams in the competition are still represented by individuals. Just within the history of Imperial College iGEM there are students from 5 different countries with no official participation in the competition: Cyprus, Estonia, Greece, Pakistan and Slovakia (Imperial iGEM wiki 2008, 2009, 2011, and 2014).</p><br />
<p>Many internationally educated scholars end up returning to their home country or wishing to have an impact on its scientific output. A study conducted by the University of California, Berkeley in 2009 showed that only 10% of Chinese, 6% of Indian and 15% of European students were intending to stay in the US post studies (Wadhwa 2009). A survey conducted in Europe by the ICEF monitor reveals that only 12.5% of the students studying abroad in the UK, France, the Netherlands, Sweden and Germany wish to stay in those countries 5 years after their graduation. The majority of them plan to return back home (SVR 2012). It is likely that when returning home many of these scientists will establish themselves in their field of interest, using the skills they acquired from their studies abroad. In the case of iGEM, people that seek to participate in the competition have a keen interest in Synthetic Biology and it is common for alumni to consider a career in the field. Since Synthetic Biology is such a young and ever expanding discipline, it is not unlikely that iGEM alumni that come from countries with no previous history in the competition, will return home and try to set the scene for the growth of SynBio and even iGEM itself.</p><br />
<p>Although a significant number of countries enters the competition every year, the top 6 is occupied only by very few of them, as demonstrated in the map (Heatmap with top 6).<br />
</p> <br />
<br />
<h3>Case studies</h3><br />
<h4>China</h4><br />
<p>The country with the biggest growth in participation is China. As seen in the figure, the participation of Chinese teams has leaped from 9 in 2010 to a staggering 50 within the last four years. Although the number of Chinese teams is on the rise, this is not reflected in the annual top 6 teams in the competition. There has been only one finalist team in 2013, 2011, 2010 and 2007 and none in any other years. The teams come from some of the highest ranked universities in the country (QS 2013) and as noted previously, China is placed 2<sup>nd</sup> in the citable publications rankings (SJR 2014). Therefore the result seems unexpected for a country with such strong presence in the competition and significant academic reputation. Many factors are at play here but it is certainly a consideration that the country is ranked in place 34 out of 60 in the EF proficiency index (EF English Proficiency Index 2014), classified as ‘low’. This can have a significant impact in the communication of the project which turn affects its competition performance.</p><br />
<br />
<br />
<h4>Case study: Germany, a success story</h4><br />
<p>Germany is a country that frequents the top 6 of the competition, and the non-English speaking country with most finalists in its history. Last year Germany dominated iGEM: 3 out of the 6 finalists came from the country. In Undergrad, the winner and 1<sup>st</sup> runner up were teams from German universities. There are many factors to which the success of Germany can be attributed. With 3 universities in the world top 100 according to QS, it is second only to Switzerland to non-English speaking countries with a strong presence in the rankings. Producing the 5nd highest number of citable publications, it is ranked 2<sup>nd</sup> to publication cites and enjoys the 2<sup>nd</sup> highest H index, it is a major player in the scientific community. It comes as no surprise that it attracts a large number of international students that seek to be educated in one of its institutions. Additionally, it is ranked 13<sup>th</sup> in the EF English Proficiency Index, with classification ‘High Proficiency’. Additionally, before the dawn of English in the 20th century, German held the status of ‘lingua academica’ and a lot of core scientific knowledge is accessible to its speakers. All these facts combined make a strong case for well-rounded teams, that do not only come from a strong scientific background, but can also can effectively communicate their projects.</p><br />
<br />
<br />
<h4>Japan versus the Netherlands</h4><br />
<p>Japan and the Netherlands are two countries with a long history in the competition. Starting in 2007 and 2008 respectively, both have been consistently represented since. Japan has 5 universities in the top 100 (QS 2014) compared to the 6 in the Netherlands (QS, 2014). Japan is the 3<sup>rd </sup>country in the world in citable publications output, while the Netherlands is ranked 12<sup>th </sup>. The gap closed when we look into Cites rankings, where Japan ranks 4<sup>th</sup> and the Netherlands ranks 9<sup>th</sup>. Finally, in terms of H index, the countries are closely comparable with Japan placed 5<sup>th</sup> and the Netherlands 6<sup>th</sup> (SJR 2014).</p><br />
<p>Even though the academic performance of these countries in science/engineering generally, as well as Biotechnology specifically, is similar, their performance in iGEM is not. Japan has averaged 8 teams in the competition every year, while the Netherlands have had only 4, yet Japan has never been a finalist in the competition, while Netherlands has had a winner already (2012) and has been a finalist twice on top of this. It is perhaps a contributing factor that the Netherlands are ranked 3<sup>rd</sup> in the EF English Proficiency index, while Japan falls 26<sup>th</sup> out of 60 (EF English Proficiency Index 2014).</p><br />
</section><br />
<br />
<section id="language"><br />
<h2>The Language</h2><br />
<p>Another dimension of the inter-nationality of iGEM is the different languages represented in the competition. In the last 5 years, at least 20 different languages are represented. The usual, widely spoken internationally, are English, Mandarin, Spanish, German and French, while some less widely spoken languages, such as Finnish, Kazakh, Nepalese and Hungarian have made appearances.</p><br />
<p>The dominant language of the competition is English, with about 40% of the participants coming from English-speaking universities. That means that 60% of the participants come from different lingual backgrounds. The second greatest presence is Mandarin (spoken by Chinese and Taiwanese teams) and there is a strong presence of Romance and Germanic languages (Spanish, French, German, Dutch), coming from the European and Latin American participants.</p><br />
<br />
<h3>Insight into the finalists</h3><br />
<p>We had a chance to speak to all but two of the non-English speaking finalists in order to get a better insight into the challenges of the language barrier. The overwhelming majority of the successful European teams (examples include Paris Bettencourt, Groningen, Bielefeld and TU Delft) have noted that their teams include many international students. Classes are taught in both the language native to their university and English, with students offered a choice on the language of their thesis or having to write in English (Valencia). In cases where courses were not taught in English (Bielefeld), seminars that included both home and international students where Anglophone. Additionally, due to the composition of their research labs in some certain cases communication between the team members is in English.<br />
Speaking with a former member of a past team of Slovenia gave us quite a different picture compared to the rest of the European teams. As explained to us, the team was made purely of home students with Slovenian being the language of communication within the team. The majority of the material at their university has been taught in their native language, although the teaching material was in English, exposing the students in English scientific writing. Additionally, their advisors where all Slovenian PhD students that carried the majority of their studies in the native country. It needs to be noted though that when asked, that the team members were able to communicate their projects in English with ease. That could possibly be explained by Slovenia’s high ranking in the PE English Proficiency Index (10th place).<br />
</p><br />
<p>When we spoke to the Asian teams, they painted a different picture. The teams are composed exclusively by home students (in the case of ZJU China, this was because their team was composed mainly by undergraduate students, when most of the international students are postgraduate) and the primary teaching and communication is done in their native language. On the other hand, some of the teaching mediums (textbooks, Powepoint slides) are in English. The exception to this was Peking. In their university material is taught in both Chinese and English, while the students participate in classes of English for academic writing. Finally, the team composition (for this year, at least) is not entirely of home students, as an exchange student from an American university has joint.<br />
In addition to language differences, other contrasting attitudes towards the competition emerged which may also be factors affecting team performance. European teams may start brainstorming throughout their Spring term, but official work in their project is conducted mainly during an intense summer term. On the other hand, for the Asian teams iGEM is a more spread out, year-long endeavor, with the project starting even before registration for some (SYSU China).<br />
</p><br />
<br />
</section><br />
<section id="judges"><br />
<h2>The Judges</h2><br />
<p>Another aspect we have considered this year is the nationality and languages of judges recruited for the competition. As an international competition, it is expected and desired for the judges to reflect this. The majority come from participating universities and of course have a background in Synthetic Biology as scientists, engineers or social scientists in the field.<br />
From 2009 to 2013, approximately 40% of the judges are able to speak one or more languages in addition to English. Although this is generally good, specific languages are often under represented amongst the judges. A good example is the representation of Mandarin, in 2013 less than 5% of the judges were speakers, whereas 20% of the teams (over 40 from China and Taiwan) spoke the language, however the percentage is more balanced in other years .<br />
</p><br />
<p>Over the years, the percentage of multilingual judges has remained relatively constant. The dominant second languages are Mandarin or French with German and Japanese also being well represented. All these languages are spoken in countries with a consistent presence in the competition.</p><br />
<p>A case could be made that the lingual abilities of judges should not be playing a role in the competition. This is partially true, as all of the teams are expected to present their projects in English, up to the standards of the international scientific community. On the other hand we can argue that it is easier for scientists with a foreign background to understand and appreciate the additional challenges for teams where English is not their first language. Like the teams, these scientists are also called to break through language barriers in order to gain their rightful recognition in the field.</p><br />
</section><br />
<section id="recommendations" class="content"><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<h2>Recommendations</h2><br />
<p>Through the data and observations considered here and discussions with linguists and universities that deal with a large influx of international students, we offer a list of recommendations that could reduce the language barrier in iGEM and it could help non-English speaking teams to communicate their projects in a more effective way.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>For the Teams</h3><br />
<ul><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
</ul><br />
<br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>For iGEM</h3><br />
<ul><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<script src="http://code.highcharts.com/mapdata/custom/world-robinson-highres.js"></script><br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/The_i_in_iGEMTeam:Imperial/The i in iGEM2014-10-17T18:31:28Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<html><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:highmaps?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:data?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:exporting?action=raw&ctype=text/js"></script><br />
<script src="http://code.highcharts.com/mapdata/custom/world-robinson-highres.js"></script><br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:maps?action=raw&ctype=text/js"></script><br />
<script><br />
$(document).ready(function () {<br />
$('#bxslider').bxSlider({<br />
<br />
});<br />
});<br />
</script><br />
<body><br />
<!--End of Header section--><br />
<br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>The i in iGEM</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction" >Introduction</a><br />
</li><br />
<li><a data-scroll href="#english" >Lingua Academica</a><br />
</li><br />
<li><a data-scroll href="#methods" >Methods</a><br />
</li><br />
<li><a data-scroll href="#countries" >The Countries</a><br />
</li><br />
<li><a data-scroll href="#language" >The Language</a><br />
</li><br />
<li><a data-scroll href="#judges">The Judges</a><br />
</li><br />
<li><a data-scroll href="#recommendations">Recommendations</a><br />
</li><br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-2"><br />
<h2>Overview</h2><br />
<p>As an international competition, every year iGEM welcomes teams from a great range of countries, with a variety of languages spoken amongst its teams and judges. This part of our Policy & Practices seeks to understand the effect of English as the <em>lingua franca</em> of science on the participation and outcome of the competition. In order to achieve this we have looked into the different nationalities of the teams and finalists and the different lingual backgrounds of teams and finalists over the years. We derived our conclusions by comparing this data with factors such as academic output and impact of their countries of origins, the lingual background of the iGEM judges, the international rankings of their universities and the English Proficiency Index of their countries of origin.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h2>Key Achievements </h2><br />
<ul><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>iGEM stands for ‘International Genetically Engineered Machine” and as the first word of this acronym indicates, countries and universities from all over the world are well represented. The iGEM competition has grown into a diverse community with a great range of nationalities, cultures and languages represented. The competition took its name in 2005, when 14 teams from 4 different countries came together to develop novel ideas based on synthetic biology. At that time, German and English were the only two languages represented. Since then, the competition has grown, reaching the 100 team milestone in 2009 and climbing to a staggering 245 teams from 32 different countries with 20 languages this year, its 10th anniversary. The competition has been expanding in all directions. Different teams compete in different tracks, for different awards and there is now a separation between undergraduate and overgraduate teams.<br />
</p><br />
<p>The language that all the teams communicate their project is English, as per <em>lingua academica</em>. In the spirit of synthetic biology, where standardization and application of the same principals throughout the discipline is promoted, it is certainly essential that all the stakeholders have a common language of communication. Rapid international expansion and the necessity of a single language however present many challenges which need to be addressed.<br />
</p><br />
<div class="bxslider" style="height:500px"><br />
<div id="CitableDocuments" style="max-width: 900px;height:450px"></div><br />
<div id="Citations" style="max-width: 900px"></div><br />
<br />
<div id="EPI" style="max-width: 900px"></div><br />
<div id="Finalists" style="max-width: 900px"></div><br />
<br />
<div id="journalRanking" style="max-width: 900px"></div><br />
<br />
<div id="QS_Biological" style="max-width: 900px"></div><br />
<br />
<div id="QS_Overall" style="max-width: 900px"></div><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<section id="entroduction"><br />
<h2>English as the lingua franca of science</h2><br />
<p>The vast volume of scientific information available in today’s “Information Age” demands effective management and distribution to individuals and institutions. Such communication of ideas across cultures and national borders requires the use of a common language. During the 20th century, English became the primary language for international communication in science and business (Tardy 2006) and English-speaking countries (mainly US and the UK) are the major players in the distribution and generation of knowledge, as demonstrated by their domination in the university and journal rankings.</p> <br />
<p>The status of English as <em>lingua academica</em> does not come without its controversies. In non-English speaking countries, the main role of English is the reporting of professional knowledge, rather than direct communication between scholars. Whilst non-native English speaking scientists may have a good level of competency in jargon and understanding written English they are still at a disadvantage when called to communicate their complex ideas in an international setting. According to SCImago Journal & Country Rankings (SJR 2014), the majority of high impact journals are in English. This forces many non-English speaking scientists and engineers to communicate their science in English, in order to gain status and recognition. This is an additional disadvantage the researchers, who are trying to conduct high impact science from a nation with peripheral status (Tardy 2006).</p><br />
<p>Other effects of the language barrier can be seen in international scientific collaborations. It is well established that the growing importance of international scientific collaborations requires not only common knowledge and understanding of the scientific terminology, but also clear communication. Using a common language is the intuitive way to achieve this and English has been filling that role (Hwang 2012). Again, non-native speakers are at a disadvantage, Babcock and Du-Babcok (2001) explain that “in communication encounters, low proficiency second-language speakers contribute fewer ideas than do fluent second-language speakers or first-language speakers”. Interestingly a study conducted by Ylvanez and Shrum in 2009 showed that a reason behind the collaboration between Philippine and Japanese scientists and engineers was their similar, low levels of English competency (Ylvanez & Shrum 2009), reflecting perhaps a method of compromise so the voices of both sides can be heard equally.<br />
</p><br />
<br />
<br />
<br />
</section><br />
<br />
<br />
</section><br />
<section id="methods"><br />
<h2>Study Methods</h2><br />
<p>Language data was collected as follows: We looked into all the teams that participated in iGEM over the years (iGEM 2004 – 2014) and looked into the country. If the country has only one official language, that is considered the language of the team. For countries with more than one official languages, we looked into the specific language of the institution, as well as the location of the institution within the country (for example, in India and Canada, different languages are spoken in geographical regions). In order to get a better insight in the finalists of previous years, we contacted students of this year’s team from the same university and, when possible, members of the finalist team. That gave us a good insight into the teaching methods of their university, attitude to iGEM and how that reflects on the result of the competition. QS rankings was our university ranking system of choice, because it put a lot of gravity in Academic reputation of the institutions and citations per faculty, while it did not ignore the universities’ diversity, by looking into the international student ratio and the international staff ratio (QS 2014).<br />
</p><br />
<p>For data on judges The iGEM organization publishes the names of the participating judges from the year 2009 up to 2013. Between 2011 and 2013, when the regional jamborees occurred, there is a record of judges that were part of the regionals, as well as the championships. Our first assumption was that all judges speak English. We then took each name and tried to match it to an individual and via online CVs, LinkedIn, academic and business profiles we tried to discover the lingual background of the particular individuals. The best case scenario was people listing the languages they can speak (and their level of competency) in their CVs and LinkedIn. If that was not the case, we moved to the university they come from and where they gained their undergraduate degree from. Finally, some judges mentioned their country of origin in their business/ academic profiles and the language was matched. While we recognize that a lot of mistakes could have been made in the process, we tried to be as precise as possible throughout the procedure.</p><br />
<h3>Case Studies</h3><br />
<br />
<br />
</section><br />
<br />
<section id="countries"><br />
<h2>The Countries and Continents</h2><br />
<p>Over the years, 43 different countries have participated in the competition.<br />
North America is home to iGEM and the continent with most participating teams. With 33 of its universities in the top 100 of the QS rankings, it’s arguably the leading continent in academia. Over the years, 453 teams originate from the continent, mostly from the United States. Over the years, the US has had teams in the finalists (top 6), 9 times.<br />
Alongside North America, Europe was one of the initial participants in the competition when it became international in 2005. It has been represented by 343 universities and colleges over the years. Home to 41 of the 100 top universities in the world, according to QS rankings, Europe attracts a large student population from around the world to its academic institutions. Universities in the UK and Germany have had particularly strong presence in iGEM. European teams have been finalists in the competition an amazing 26 times, more than any other continent in the history of the competition. The best year for Europe was 2009, when all the finalists originated from the continent. Last year, all of the Undergraduate finalists and 2 out of the 3 overgraduate finalists where European teams.</p><br />
<p>Asia is the continent whose participation in the competition has seen the most rapid increase. Between 2010 and 2014 the participation of Asian teams has grown 115% percent, compared to the 76% of Europe, 79% of North America and the 91% growth in the competition overall. The key player here is China, which has seen a huge 455% increase in number of teams, significantly more than any other participating country. Despite the growth of the continent in the competition, this has not translated into finalists. Only 12% of finalists come from Asia, a mere 5 out of 41 previous finalists. No more than one Asian team has been a finalist per year.<br />
</p><br />
<br />
<h3>Case Study: China and the USA</h3><br />
<p>Consider two examples: On one hand, we have the USA, visible in the first map as the country with most citable publications (87,600). It keeps its throne in the second map with almost 2 million citations. Here it should be noted that the second country, Germany, ranks to only around half a million.</p><br />
<p>On the other hand, we have China. In the second place, with 37,225 citable documents, it slips to place 6 when it comes to citations. With about 285,000 citations, it falls below countries like the UK and France that occupy the 6th (20,065 publications) and 8th (13,652 publications) place respectively in the citable documents ranking.</p> <br />
<p>For the h-index of both countries, which measures the <em>productivity and impact of published work of a scientist or scholar</em>, the US maintains the top spot, while China slips to 13th. The UK, which only produces around 60% of citable documents compared to China, is placed 3<sup>rd</sup>. Australia, with less than 8,000 citable publications, is ranked just 2 places below China (SJR 2014). It seems language barriers can reduce impact of published work from non-native English speaking countries. Whilst many cultural and socioeconomic factors contribute to the discrepancy between China’s publishing output and h-index rankings language also has a role to play (Moed 2002)</p><br />
<br />
<br />
<h3>University Case studies: Team Members are Multinational</h3><br />
<p>Needs and introductory sentence e.g. iGEM is international between teams but also within teams. The competition attracts top universities and top universities attract students from around the world.</p><br />
<p>In the UK, 18% of the student population comes from outside the country. That translates to about 425,000 students. If we take a look specifically into institutions that have the longest history of participation in iGEM, the numbers are even higher: In our very own Imperial College London, 44% of the students come outside of the UK. Cambridge, the first UK University to participate in the competition has a population of 33% foreign students and the University of Edinburgh includes 35% non-UK students in its body (UKISA 2013).<br />
Moving to Germany, a similar story unfolds: 11.3%, or 282,201 of the students come from outside the country (DAAD 2014). In the two universities with the longest history in the competition, University of Heidelberg and University of Freiburg, 17.1% and 15% of the students respectively come from outside of Germany (NUS International Relations Office 2014) (University of Heidelberg 2014).</p><br />
<p>Finally, the United States of America. In 2013, it was reported that about 820,000 non US nationals were enrolled in US universities. That makes up only 3.3% percent of the population. If we look specifically though into universities that have been participating in iGEM for a while, those percentages shift dramatically. MIT, birthplace of the competition, 28.63% of the students are international (MIT ISO 2014). In Purdue University, another early iGEM participant, the percentage is 15% for undergraduates and 38% for graduate students (Purdue 2012).</p><br />
<p>Currently, there is no way of knowing this however since iGEM does not record the nationality of participants. As a result, the i in iGEM refers only to the origin of the participant universities, rather than the participating individuals. Countries with no representation through teams in the competition are still represented by individuals. Just within the history of Imperial College iGEM there are students from 5 different countries with no official participation in the competition: Cyprus, Estonia, Greece, Pakistan and Slovakia (Imperial iGEM wiki 2008, 2009, 2011, and 2014).</p><br />
<p>Many internationally educated scholars end up returning to their home country or wishing to have an impact on its scientific output. A study conducted by the University of California, Berkeley in 2009 showed that only 10% of Chinese, 6% of Indian and 15% of European students were intending to stay in the US post studies (Wadhwa 2009). A survey conducted in Europe by the ICEF monitor reveals that only 12.5% of the students studying abroad in the UK, France, the Netherlands, Sweden and Germany wish to stay in those countries 5 years after their graduation. The majority of them plan to return back home (SVR 2012). It is likely that when returning home many of these scientists will establish themselves in their field of interest, using the skills they acquired from their studies abroad. In the case of iGEM, people that seek to participate in the competition have a keen interest in Synthetic Biology and it is common for alumni to consider a career in the field. Since Synthetic Biology is such a young and ever expanding discipline, it is not unlikely that iGEM alumni that come from countries with no previous history in the competition, will return home and try to set the scene for the growth of SynBio and even iGEM itself.</p><br />
<p>Although a significant number of countries enters the competition every year, the top 6 is occupied only by very few of them, as demonstrated in the map (Heatmap with top 6).<br />
</p> <br />
<br />
<h3>Case studies</h3><br />
<h4>China</h4><br />
<p>The country with the biggest growth in participation is China. As seen in the figure, the participation of Chinese teams has leaped from 9 in 2010 to a staggering 50 within the last four years. Although the number of Chinese teams is on the rise, this is not reflected in the annual top 6 teams in the competition. There has been only one finalist team in 2013, 2011, 2010 and 2007 and none in any other years. The teams come from some of the highest ranked universities in the country (QS 2013) and as noted previously, China is placed 2<sup>nd</sup> in the citable publications rankings (SJR 2014). Therefore the result seems unexpected for a country with such strong presence in the competition and significant academic reputation. Many factors are at play here but it is certainly a consideration that the country is ranked in place 34 out of 60 in the EF proficiency index (EF English Proficiency Index 2014), classified as ‘low’. This can have a significant impact in the communication of the project which turn affects its competition performance.</p><br />
<br />
<br />
<h4>Case study: Germany, a success story</h4><br />
<p>Germany is a country that frequents the top 6 of the competition, and the non-English speaking country with most finalists in its history. Last year Germany dominated iGEM: 3 out of the 6 finalists came from the country. In Undergrad, the winner and 1<sup>st</sup> runner up were teams from German universities. There are many factors to which the success of Germany can be attributed. With 3 universities in the world top 100 according to QS, it is second only to Switzerland to non-English speaking countries with a strong presence in the rankings. Producing the 5nd highest number of citable publications, it is ranked 2<sup>nd</sup> to publication cites and enjoys the 2<sup>nd</sup> highest H index, it is a major player in the scientific community. It comes as no surprise that it attracts a large number of international students that seek to be educated in one of its institutions. Additionally, it is ranked 13<sup>th</sup> in the EF English Proficiency Index, with classification ‘High Proficiency’. Additionally, before the dawn of English in the 20th century, German held the status of ‘lingua academica’ and a lot of core scientific knowledge is accessible to its speakers. All these facts combined make a strong case for well-rounded teams, that do not only come from a strong scientific background, but can also can effectively communicate their projects.</p><br />
<br />
<br />
<h4>Japan versus the Netherlands</h4><br />
<p>Japan and the Netherlands are two countries with a long history in the competition. Starting in 2007 and 2008 respectively, both have been consistently represented since. Japan has 5 universities in the top 100 (QS 2014) compared to the 6 in the Netherlands (QS, 2014). Japan is the 3<sup>rd </sup>country in the world in citable publications output, while the Netherlands is ranked 12<sup>th </sup>. The gap closed when we look into Cites rankings, where Japan ranks 4<sup>th</sup> and the Netherlands ranks 9<sup>th</sup>. Finally, in terms of H index, the countries are closely comparable with Japan placed 5<sup>th</sup> and the Netherlands 6<sup>th</sup> (SJR 2014).</p><br />
<p>Even though the academic performance of these countries in science/engineering generally, as well as Biotechnology specifically, is similar, their performance in iGEM is not. Japan has averaged 8 teams in the competition every year, while the Netherlands have had only 4 yet Japan has never been a finalist in the competition, while Netherlands has been already a winner (2012) and has been a finalist twice more. Here it is perhaps a contributing factor that the Netherlands are ranked 3<sup>rd</sup> in the EF English Proficiency index, while Japan falls 26<sup>th</sup> out of 60 (EF English Proficiency Index 2014).</p><br />
</section><br />
<br />
<section id="language"><br />
<h2>The Language</h2><br />
<p>Another dimension of the inter-nationality of iGEM is the different languages represented in the competition. In the last 5 years, at least 20 different languages are represented. The usual, widely spoken internationally, are English, Mandarin, Spanish, German and French, while some less widely spoken languages, such as Finnish, Kazakh, Nepalese and Hungarian have made appearances.</p><br />
<p>The dominant language of the competition is English, with about 40% of the participants coming from English-speaking universities. That means that 60% of the participants come from different lingual backgrounds. The second greatest presence is Mandarin (spoken by Chinese and Taiwanese teams) and there is a strong presence of Romance and Germanic languages (Spanish, French, German, Dutch), coming from the European and Latin American participants.</p><br />
<br />
<h3>Insight into the finalists</h3><br />
<p>We had a chance to speak to all but two of the non-English speaking finalists in order to get a better insight into the challenges of the language barrier. The overwhelming majority of the successful European teams (examples include Paris Bettencourt, Groningen, Bielefeld and TU Delft) have noted that their teams include many international students. Additionally classes are taught in both the language native to their university and English, with students offered a choice on the language of their thesis or having to write in English (Valencia). In cases where courses were not taught in English (Bielefeld), seminars that included both home and international students where Anglophone. Additionally, due to the composition of their research labs in some certain cases communication between the team members is in English.<br />
Speaking with a former member of a past team of Slovenia gave us a different picture compared to the rest of the European teams. As explained to us, the team was consisted purely by home students with Slovenian being the language of communication within the team. The majority of the material at their university has been taught in their native language, although the teaching material was in English, exposing the students in English scientific writing. Additionally, their advisors where all Slovenian PhD students that carried the majority of their studies in the native country. It needs to be noted though that when asked, it was noted that the team members were able to communicate their projects in English with ease. That could possibly be explained by Slovenia’s high ranking in the PE English Proficiency Index (10th place).<br />
</p><br />
<p>When we spoke to the Asian teams, they painted a different picture. The teams are composed exclusively by home students (in the case of ZJU China, this was because their team was composed mainly by undergraduate students, when most of the international students are postgraduate) and the primary teaching and communication is done in their native language. On the other hand, some of the teaching mediums (textbooks, Powepoint slides) are in English. The exception to this was Peking. In their university material is taught in both Chinese and English, while the students participate in classes of English for academic writing. Finally, the team composition (for this year, at least) is not entirely of home students, as an exchange student from an American university has joint.<br />
In addition to language differences, other contrasting attitudes towards the competition emerged which may also be factors affecting team performance. European teams may start brainstorming throughout their Spring term, but official work in their project is conducted mainly during an intense summer term. On the other hand, for the Asian teams iGEM is a more spread out, year-long endeavor, with the project starting even before registration for some (SYSU China).<br />
</p><br />
<br />
</section><br />
<section id="judges"><br />
<h2>The Judges</h2><br />
<p>Another aspect we have considered this year is the nationality and languages of judges recruited for the competition. As an international competition, it is expected and desired for the judges to reflect this. The majority come from participating universities and of course have a background in Synthetic Biology as scientists, engineers or social scientists in the field.<br />
From 2009 to 2013, approximately 40% of the judges are able to speak one or more languages in addition to English. Although this is generally good, specific languages are often under represented amongst the judges. A good example is the representation of Mandarin, in 2013 less than 5% of the judges were speakers, whereas 20% of the teams (over 40 from China and Taiwan) were speaking the language, the percentage is more balanced in other years however.<br />
</p><br />
<p>Over the years, the percentage of multilingual judges has remained relatively constant. The dominant second languages are Mandarin or French with German and Japanese also being well represented. All these languages are spoken in countries with a consistent presence in the competition.</p><br />
<p>A case could be made that the lingual abilities of judges should not be playing a role in the competition. This is partially true, as all of the teams are expected to present their projects in English, up to the standards of the international scientific community. On the other hand we can argue that it is easier for scientists with a foreign background to understand and appreciate the additional challenges for teams where English is not their first language. Like the teams, these scientists are also called to break through language barriers in order to gain their rightful recognition in the field.</p><br />
</section><br />
<section id="recommendations" class="content"><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<h2>Recommendations</h2><br />
<p>Through the data and observations considered here and discussions with linguists and universities that deal with a large influx of international students, we offer a list of recommendations that could reduce the language barrier in iGEM and it could help non-English speaking teams to communicate their projects in a more effective way.</p><br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>For the Teams</h3><br />
<ul><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
</ul><br />
<br />
</div><br />
<div class="pure-u-1-2"><br />
<h3>For iGEM</h3><br />
<ul><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<ol><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<li></li><br />
<br />
<br />
<br />
<br />
<br />
</ol><br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<script src="http://code.highcharts.com/mapdata/custom/world-robinson-highres.js"></script><br />
<br />
<br />
</div><br />
</body><br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/Team:Imperial/Water_ReportTeam:Imperial/Water Report2014-10-17T18:05:48Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<br />
<html><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:highcharts?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:data?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:exporting?action=raw&ctype=text/js"></script><br />
<br />
<br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:charts?action=raw&ctype=text/js"></script><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>The Water Report</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#water_stress">Water Stress</a><br />
</li><br />
<br />
<li><a data-scroll href="#sustainable">Sustainability</a><br />
</li><br />
<li><a data-scroll href="#decentralisation">Decentralisation</a><br />
</li><br />
<li><a data-scroll href="#wastewater">Wastewater</a><br />
</li><br />
<li><a data-scroll href="#conclusions">Conclusions</a><br />
</li><br />
<br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<br />
<h2>At a glance</h2><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>All life depends on water. Our Earth, home to all species, remains the only place we know capable of sustaining life. In our search for others amongst the stars, it is water we look for first.</p> <br />
<br />
<p>More than 71% of the planet is covered in this resource, but only a small proportion is suitable for human use. 97.5% percent of the world’s water is salt water and of the 2.5% freshwater, nearly 70% is locked in glaciers and the ice caps. The majority of what remains is inaccessible; either as soil moisture, permafrost or deep beneath the ground. All considered, less than 0.03% of global water is viable for human use (US Geological Survey 2014).</p> <br />
<br />
<p>With the world’s population is rising at a rate of 80 million people a year, water demands are increasing proportionally (Worldometers no date). In order to sustain over seven billion people, we require more than 200 million litres of clean water per second (Waterwise no date). 67% of this is for agriculture, 22% for domestic, and 11% for industrial use.</p><br />
<br />
<p>Our overstretched resources are very unevenly distributed. Areas with high natural resources are rarely near the urban centres of high demand and this is becoming more severe. For example the top countries for fresh water supplies, Brazil, Russia and Canada, with 30% of the world supply between them, are not areas of highest population growth, India, China and Nigeria take the top spots there (Cohen & Siu 2013).</p><br />
<div id="water_use_breakdown" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<br />
<br />
</section><br />
<br />
<section id="water_stress"><br />
<h2>Water Stress - An Increasing Problem</h2><br />
<br />
<p>Water stress occurs when the <em>demand for water exceeds the available amount during a certain period or when poor quality restricts its use</em> (EEA no date). Water stress usually occurs in places with low rainfall and high population density or in areas with intensive agricultural irrigation. It means deterioration of the available freshwater supply both in terms of quantity (from aquifer over-exploitation or drained rivers and lakes) and quality (from eutrophication, saline intrusion, organic matter pollution, heavy metal contamination and other problems).</p><br />
<h3>Causes of water stress and scarcity</h3><br />
<h4>Climate Change</h4><br />
<p>Climate change, due to an increasing greenhouse effect, has a direct impact on the hydrological cycle (IPCC 1996). Increased evaporation from water bodies leads to an overall increase in precipitation, but the changing climate also causes this to be distributed more unevenly. This can alter the durations of wet and dry seasons leading to droughts and floods with severe repercussions for water resources (Arnell 2004) . The changing climate makes our need for sustainable water scarcity solutions ever more pressing. </p><br />
<h4>Pollution</h4><br />
<p>Water sources contaminated from agricultural runoff, domestic wastewater, industrial pollutants and from atmospheric pollutants as a result of burning fossil fuels are at risk of eutrophication. Less dynamic water resources, such as lakes, are more susceptible due to longer water residence and through their action as integration sinks for multiple polluted water sources. The high-nutrient load (mainly nitrogen and phosphorus), causes algal blooms which may be toxic and complicate many methods of water purification.</h4><br />
<br />
<p>Another increasing issue with water quality is the influx of personal care products and pharmaceuticals. Examples of these pollutants include painkillers, antibiotics and female hormonal birth control (UNEP, ERCE, UNESCO. 2008). Certain compounds may be long lived so accumulate in recycled urban wastewater.</p> <br />
<br />
<figure class="content-image image-center"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a4/Water_stress_unep.jpg"><br />
<figcaption>Projected increase of water withdrawals between 2005 and 2025 (<em>unep.org</em>)</figcaption><br />
</figure><br />
<br />
<br />
<h3>Social and Economic Effects</h3><br />
<h4>Water conflict</h4><br />
<p>Water has a long history as a source of conflict and neighboring nations have often been at odds over disputed supplies. As far back as the 3rd millennium BCE, King Lagash, significantly reduced the water flow in the neighboring Umma (modern day Iraq) by building boundary canals around his territory. </p><br />
<br />
<p>There are many types of conflict including but not limited to:</p><br />
<ul><br />
<li><b>Disputes over control and development of water resources</b>: water resources, lakes, rivers and aquifers are valuable, interconnected and do not respect state boundaries.</li><br />
<li><b>Military tools and targets</b>. In the first case, water resources or systems are used as a tool or weapon for military action for example diverting supplies to cause flood or provide defence. In the second case, water resources are targets of military actions, deliberately polluting or destroying enemy supplies.</li><br />
<li><b>Use as a political tool</b>. Water resources or systems are controlled by state or non-state actors as a means to achieve political goals.</li><br />
<li><b>Target for Terrorism</b>. Water resources or systems are targeted or threatened and by non-state actors as means of violence and coercion.</li><br />
</ul><br />
<br />
<p>Notable current sources of water conflicts are demonstrated below:<br />
(Pacific Institute)(Gleick 1994)(Gleick 1998)</p><br />
<h4>In The News</h4><br />
<h5>Middle East</h5><br />
<p>Recent developments in the Middle East highlight the importance of water in conflict. Islamic State militants are using water as a weapon against villages that resist their advance by cutting off the supplies. Currently, IS control major parts of Tigris and Euphrates, on which all of Iraq and a large part of Syria rely for food, water and industry (Cunningham 2014) (Vidal 2014). Matthew Machowski, a Middle East security researcher for the UK Parliament and Queen Mary University notes that “It is already being used as an instrument of war by all sides. It can be claimed that controlling water resources in Iraq is strategically more important than controlling oil refineries… cut it off and you create great sanitation and health crises” (Vidal 2014).</p><br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/7e/Iraq_post_ISIS.jpeg"><br />
<figcaption>Iraqi men move a boat that was stuck on the banks of the Euphrates River after supplies were blocked by anti-government fighters who control a dam further upstream(<em>guardian.com</em>)</figcaption><br />
</figure><br />
<br />
<br />
<h5>Brazil</h5><br />
<p>One of the world’s most rapidly expanding economies has been affected by droughts this past summer. A major affected area was Sao Paulo, the southern hemisphere’s largest city. Reservoirs of the Cantareira system that supply 45% of the city fell to 9.7% capacity, an unprecedented low. Conflict ignited between Sao Paulo, Rio de Janeiro and Minas Gerais, the country’s three most prosperous – and most severely water stressed – states. Sao Paulo controversially diverted water from the Paraiba de Sul in order to supply the Cantareira system, by reducing the flow of the Jaguari River (a tributary to the Paraiba de Sul). Paraiba de Sul is one of the major water and energy supplies of Rio de Janeiro.</p><br />
<p>This move violated a federal pact between the three states, made due to fears water transfer to the Cantaneira system may have adverse effect on the environmental, economic and social balance of all three states.</p><br />
<p>The disagreement recently reached the Supreme Court and eventually concluded with Sao Paulo reducing water flow in two of its dams and Rio de Janeiro reducing water capture from the Paraiba de Sul river basin (International Law Office 2014).</p><br />
<br />
<figure class="content-image image-left image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/d/d4/Cantaneira_system_current_state.jpg"><br />
<figcaption>The Cantaneira system that supplies 45% of Sao Paulo with water, here seen after the recent droughts (<em>guardian.com</em>)</figcaption><br />
</figure><br />
<br />
<p>Many conflicts stem from large areas and communities relying on a single, shared water supply. In addition to preventing overexploitation it is helpful to provide communities with alternative, more local purification solutions to empower them and give control of their own resources (Faeth and Weinthal 2012)<br />
<br />
<figure class="content-image image-center"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/3/3b/WATER_war_and_peace_2.jpg"><br />
<figcaption><br />
The map displays nearly 2,000 incidents, involving conflict and collaboration alike, over shared river basins from 1990 to 2008. The circles in the sidebar compare about 2,200 events—including another 200 disputes over resources other than shared rivers—from the same period.<br />
<em>Data Visualization by Pitch Interactive; River locations courtesy The Global Runoff Data Centre, 56068 Koblenz, Germany</em>(<em>popsci.com</em>) </figcaption><br />
</figure><br />
<br />
<br />
<h4>Social implications</h4><br />
<p>It is predicted that within the next 15 years, more than half of the world’s population will be living under severe water stress (OECD 2012). So far, water scarcity has been an issue for individuals and families living in poverty, while most in the developed world enjoy reliable, plentiful access to safe water. As the stress increases, it will hit many of us who were previously unaffected but the majority of the hardship will continue to fall on the worlds poorest.</p> <br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/4/49/India_women_water.jpg"><br />
<figcaption>Women in India walking through dry land to access a water supply.</figcaption><br />
</figure><br />
<p>There are further issues arising from water accessibility and sanitation regarding gender inequality. In developing countries significant responsibility for acquisition and distribution of water is placed upon women and children of the family. Difficulties in access result in many hours lost that could instead be used for income generation, caring for family members or education (UNDP 2006). This reinforces the cycle of gender disempowerment and inequality. In rural parts of eastern Africa, women and girls spend significant amounts of their day trying to access water sources. Their journey may take them through treacherous places and increases risk of violence and sexual abuse. Women are more likely to voice concerns regarding water and sanitation compared to their male counterparts, however due to their inferior social standing such concerns often go unheard. (Mengistu 2012).</p> <br />
<br />
<p>Water stress can reinforce or increase inequality. Solutions to the water crisis are necessary not just for a healthier, more peaceful world, but also a fairer one. </p><br />
<br />
<h4>Economic Implications</h4><br />
<p>Water is a key input in the smallest of businesses and the largest of corporations alike. Without water it is impossible to generate energy or produce goods. Therefore the economic welfare of a state relies on its water resources, it sustains the backbone of the economy. Corporations are increasingly forced to take water availability into account. For example the Coca Cola plant in Mehdiganj, India, chose to close due to the increasing water stress in the region (Guardian 2014). The socioeconomic impacts of water stress are considered in case studies below.</p><br />
<div id="freshwater_breakdown" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<div id="freshwater_per_capita" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<div id="freshwater_per_capita_withdraw" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<br />
<h5>Case Study: BRICs</h5><br />
<p>The BRIC countries (Brazil, India, China and Russia) are large, developing economies, distinguished from other emerging markets by their demographic and developmental potential. These four countries are home to more than 2.5 billion people, 40% of the world’s population, cover 25% of the world’s area, and account for 25% of the global GDP. </p><br />
<br />
<p>Expanding economies such as these require increased energy production which in turn relies significantly on water. One third of global energy needs are currently met by oil, an immensely water-expensive fuel source. Natural gas is currently the most popular alternative to oil due to the “shale gas revolution” and is cleaner in terms of emissions. Shale gas is even more water intensive however and prospective shale-producing countries like China and India will face constraints due to inadequate water supplies (Cohen & Siu 2013).</p><br />
<br />
<p>Additionally, an expanding middle class in these countries causes shifts in dietary preference that have a significant impact on water use and management. Vegetable-oriented diets are turning into meat and dairy-oriented ones that are significantly more water intensive increasing stress on water-scarce nations (Cohen & Siu 2013).</p><br />
<br />
<p>Disparities in water also exist on more local levels within these countries. In China, the southern part of the country experiences sufficient precipitation and rich groundwater supplies but the North is particularly drought-prone. With large cities like Beijing and Tianjin situated in the North, water distribution is a pressing concern.</p> <br />
<br />
<p>Pollution of water supplies is also a significant issue faced by countries. According to the UN, only 28% of wastewater is Russia is properly treated and just 20% in Brazil. This contaminates freshwater supplies and can make otherwise safe water non-potable. A recent survey by the Chinese Ministry of Land and Resources states that only 22% of the countries groundwater supply is safe for human consumption (CMLR 2013) (Cohen & Siu 2013).</p> <br />
<br />
<figure class="content-image image-left image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/a/a1/California_before_1.jpg"><br />
<figcaption>The marina at Oroville lake in 2011(<em>Getty Images</em>)</figcaption><br />
</figure><br />
<br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/7/7d/California_after_1.jpg"><br />
<figcaption>The marina at Oroville lake in 2014(<em>Getty Images</em>)</figcaption><br />
</figure><br />
<br />
<h5>Case Study: California</h5><br />
<p>California is the USA’s most populous state containing one eighth of American people. More than 90% of the region is under severe water stress (US Drought Monitor 2014).</p><br />
<p>The widespread drought is likely to worsen due to climate change, Diffenbaugh (2014) notes: “Research finds that extreme atmospheric high pressure in this region – which is strongly linked to unusually low precipitation in California – is much more likely to occur today than prior to the human emission of greenhouse gases that began during the Industrial Revolution in the 1800s”.</p><br />
<p>The ramifications could be severe. The drought is estimated to cost more than $2.2 billion to the Californian economy, with 17,100 part-time and seasonal jobs being lost (Howit 2014).</p><br />
<p>At present, California relies on groundwater reserves in order to replace surface water losses. If the drought continues for more than 2 years it will lead to significant groundwater depletion. and increasing costs of groundwater. This increase is not predicted to impact the prices of commodities and so would be translated as loss of revenue for farmers (Howitt et al 2014).</p><br />
<br />
<br />
<br />
<h5>Case Study: London</h5><br />
<p>With 164 days of precipitation per year, one might not imagine our home city, London as suffering water stress. Yet it ranks as the 15th most water stressed city in the world (edieWater 2014). With a population of more than 8.3 million, water demand is high and supply is tightly regulated. The situation is again predicted to become more severe as climate change causes rainfall to become more seasonal with summers being drier and winters wetter.</p> <br />
<br />
<p>The London sewage system is old, having been constructed in the mid-1800s. Emergency overflows into the Rivers Thames prevent overflowing into the cities streets and with around 60 such discharges every year, the water quality of the river is particularly poor (Greater London Authority no date).</p><br />
<br />
<br />
</section><br />
<br />
<section id="sustainable"><br />
<h2>Sustainable Water Management</h2><br />
<p>Sustainable Water Management (SWM) is the considered use and distribution of water resources accounting for the needs of both present and all future users.<br />
During the international Conference on Water and the Environment (ICWE) the following principles were devised to frame discussion on SWM</p><br />
<ol><br />
<li><em>Freshwater is a finite and valuable resource that is essential to sustain life, the environment and development</em></li><br />
<li><em>The development and management of our water resources should be based on a participatory approach, involving users, planners and policy makers at all levels</em></li><br />
<li><em>Women play a central role in the provision, management and safeguarding of water resources.<br />
</em></li><br />
<li><em>Water has an economic value and should therefore be seen as an economic good.</em></li><br />
</ol><br />
<br />
<p>Concepts emerging from a SWM approach include:<br />
</p><br />
<br />
<h3>Management of Water and Wastewater at Source<br />
</h3><br />
<p>Water purification can be implemented at community scale and industrial wastewater treatment can occur on site. Focus should be on treatment as close to the site of origin or use as possible, rather than transferring water and wastewater long distances, making the methods more sustainable and environmentally friendly (Abra & Simms no date).</p><br />
<h3>Low Impact Wastewater Treatment<br />
</h3><br />
<p>Recycling wastewater is essential for sustainable management of water supplies. Effort should be made however to reduce the input of chemicals and fossil-fuel energy into these processes (Abra & Simms no date).</p><br />
<br />
<br />
<br />
</section><br />
<br />
<section id="decentralisation"><br />
<h2>Decentralising the Water Supply</h2><br />
<p>Centralised water and wastewater treatment have been of critical importance for water resource management in the development of societies since the 1800s. Although centralised systems have served us cheaply and reliably so far, recent socioeconomic developments - population growth, increasing use of water for agricultural irrigation, increasing need for sustainable water management - call for new approaches (Gikas & Tchobanoglous 2009). Decentralised water and wastewater management can play an important role in the future of water resource management. Factors driving this change include:<br />
</p><br />
<br />
<h3>Capacity Limitations</h3><br />
<p>The continuous growth of urban areas has exerted increasing pressure on their water management systems. Whilst treatment facilities might have been initially located in remote areas, residential and commercial development has often started enveloping them. That makes potential for expansion limited to impossible. <br />
</p><br />
<br />
<h3>Rapid Growth<br />
</h3><br />
<p>Population growth equates to increased demand for potable water. Current surface and groundwater resources are stretched thin so new urban developments depend on new water purification and recycling systems. Decentralised facilities can more rapidly and adaptably meet changing demand. </p><br />
<br />
<h3>Homeland Security and Disaster Mitigation<br />
</h3><br />
<p>As previously discussed, centralised water systems are attractive target for potential terrorist activities. Damage can impact the lives of the many people residing in the large areas dependent on them. Additionally, natural disasters such as floods and earthquakes can knock out centralised facilities causing huge disruption. Decentralised water management systems are more resilient. Disruption is likely to affect a smaller area and temporary supplies can be diverted from nearby functioning facilities.</p><br />
</section><br />
<br />
<section id="wastewater"><br />
<h2>Wastewater Recycling</h2><br />
<p><em><strong>Society no longer has the luxury of using water only once</strong></em> (Levine 2004).<br />
</p><br />
<br />
<p>Water supply sustainability implies a balance between the rate of withdrawal and the rate of water replenishment. Additionally, the water returned should be of the same quality as the water withdrawn. Due to the huge water demand however, it is difficult to replenish supplies by natural means. Additionally, the distribution of water by use of dams, reservoirs alongside "<em>other shifts in land-use patterns alters the rate, extent and spatial distribution of freshwater consumption and replenishment</em>" (Levine 2004).</p><br />
<br />
<p>In order to achieve sustainable water use it is necessary to turn to methods that ensure that we replenish the water we use, for fresh - and groundwater replenishment this means water recycling via wastewater reclamation and treatment (Dolnicar 2009).</p><br />
<br />
<br />
<figure class="content-image image-right image-small"><br />
<img class="image-full" src="https://static.igem.org/mediawiki/2014/8/8f/Florida_water_reuse_for_citrus_irrigation.jpg"><br />
<figcaption>Reclaimed water processing system for citrus irrigation in Florida(<em>waterencyclopedia.com</em>)</figcaption><br />
</figure><br />
<br />
<p>Wastewater recycling has been on the rise for the past two decades as our societies become increasingly urbanised. There are two different categories of water reuse: direct and indirect. As an example of indirect water reuse, Oxford and Reading are upstream of London on the River Thames. Sewage originating from these cities mixes with the water that ends up in the London water supply. Direct reuse is more controversial and has been mainly employed to provide water for irrigation. For example in the state of Florida, more than 56000 acres of golf courses, 200,000 residencies, 500 parks and 250 schools are irrigated by reclaimed water. St. Petersburg, FL is home to one of the largest dual distribution systems in the world, operating since the 70’s it provides water for landscape irrigation for cooling and other industrial applications. The state also reuses water for agricultural irrigation. The Water Conserv II project irrigates 3,000 acres of citrus orchard every year. Reused water provides great advantages for the growers, containing the correct amounts of boron and phosphorous to give optimum soil pH.</p><br />
<br />
<h3>Considerations</h3><br />
<p>Wastewater treatment and recycling can be challenging and controversial to implement. From a survey of industry experts by the Global Water Research Coalition, Miller (2005) describes “key factors of success” to be considered in design and implementation of water recycling systems. These include:<br />
</p><br />
<br />
<ul><br />
<br />
<li>A particularly clear definition of the project objectives and limitations. <br />
</li><br />
<li>Cost competitive pricing. Recycled water must be carefully priced to be viewed as a viable alternative. Cheaper, more efficient technologies in water recycling are desperately needed.<br />
</li><br />
<li>Chemical and microbiological safety. It is important to have technologies that ensure the removal of chemical contaminants, particularly endocrine disruptors such as pesticides, <strong>heavy metals</strong> and pharmaceuticals and removal or inactivation of microbiological pathogens. Water utilities must be able to reassure the public that the recycled water is completely safe for its intended use.<br />
</li><br />
<li>Public perception and acceptance. While the public is generally accepting of recycled water as a mean for landscape irrigation, for potable use, reactions are more negative.</li><br />
<br />
<br />
</ul><br />
<br />
<br />
<h3>Improving Public Acceptance</h3><br />
<p>Many studies have charted the perception and acceptance of recycled water over the years (Bruvold and Ward 1970; Bruvold 1972, 1979 and 1988, Nancarrow 2003, Dolnicar and Schäfer 2006, 2007 and 2009; Dolnicar and Hurlimann 2010; Hurlimann and Dolnicar 2010). Whilst levels of acceptance vary with time and location a few conclusions are consistently drawn:<br />
</p><br />
<ol><br />
<li>In general, public knowledge on the subject of water treatment and the advantages and disadvantages of different processes is relatively low.</li><br />
<li>General perception of recycled water is that, whilst it is an environmentally friendly solution, there are public health concerns.<br />
</li><br />
<li>Recycled water is considered acceptable for tasks such as gardening and car washing. When it comes to close body use (bathing and showering) there are reservations due to fears of residual wastewater in the recycled water.<br />
</li><br />
<li>Perception is very dependant on the particular source and treatment of the water.<br />
</li><br />
<li>Choice matters: in places where alternative sources of water were available, people were more sceptical of water reuse than in regions with water shortages.<br />
</li><br />
</ol><br />
<p>Education about the necessity and safety of recycled water is paramount for improving public perception and must accompany the technological implementation. A recent survey conducted by Guardian, posted alongside an article about Thames Water plans to introduce recycled water for potable use to meet demand by 2040, revealed a promising 63% of Londoners would be happy drinking recycled water (Saner 2014). As 100% of Londoners need to be drinking it by that date however, perception must catch up. <br />
</p><br />
<br />
</section><br />
<section id="conclusions"><br />
<h2>Conclusions</h2><br />
<p>Our planet’s natural water resources continue to be unsustainably exploited; as a result, we are faced with the challenges of water stress and scarcity. Climate change, population growth and urbanisation fuel the worsening crisis. To avert disaster we must rethink the way we process and use our water supplies. Promisingly, solutions are emerging but significant technological and sociological issues need to be addressed. Water treatment systems are becoming decentralised which makes the system more reliable and adaptable. Supply can be better expanded to meet changing demands and systems can be more tailored to local supplies though improvements are needed to make smaller scale plants more cost effective. Recycled wastewater is becoming an increasingly important component of our water supplies, indirect reuse is common and direct reuse, whilst initially confined to irrigation, is becoming more common. Innovations are needed to improve quality and cost as well as public confidence in the process. </p><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<br />
<div class="accordion"><br />
<h3></h3><br />
<ul><br />
<li>Abby Josef Cohen, Rachel Siu (2013) <em>Sustainable Growth Taking a Deep Dive into Water</em> ONLINE Available at <href ="http//www.goldmansachs.com/our-thinking/clean-technology-and-renewables/cohen/report.pdf"><br />
</li><br />
<li>Abra J & Simms T (no date). <em>Low Impact Water and Wastewater Treatment</em>. [ONLINE] Available at: <href=”https://connect.innovateuk.org/web/low-impact-wate</li><br />
<li>Abra J & Simms T (no date). <em>Management of Water and Wastewater at Source</em>. [ONLINE] Available at: <href=”https://connect.innovateuk.org/web/managing-water-and-wastewater-at-source/at-a-glance>.<br />
</li><br />
<li>Agence France-Presse (2014). <em>Nobel laureates call for a revolutionary shift in how humans use resources</em>. [ONLINE] Available at: <href=”http://www.theguardian.com/science/2014/oct/07/nobel-laureates-call-for-a-revolutionary-shift-in-how-humans-use-resources”>.</li><br />
<li>Anderson, J., Arblaster, K., Bartley, J., Cooper, T., Kettunen, M., Kaphengst, T., ... & Holmberg, M. (2006). Climate change-induced water stress and its impact on natural and managed ecosystems. <em>Climate change-induced water stress and its impact on natural and managed ecosystems</em>.</li><br />
<li>Arnell N W 1999 <em>Climate change and global water resources</em> Global environmental change 9 S31-S4</li><br />
<li>Arnell, N. W. (2004). Climate change and global water resources: SRES emissions and socio-economic scenarios. <em>Global environmental chang</em>e, 14(1), 31-52</li><br />
<li>Bruvold W & Ward P (1970) <em>Public Attitudes Toward Uses of Reclaimed Wastewater</em> Water & Sewage Works 120<br />
</li><br />
<li>Bruvold W (1972) <em> Public Attitudes Towards Reuse of Reclaimed Water</em> USA Univ of California</li><br />
<li>Bruvold W (1979) <em>Public Attitudes Towards Wastewater Reclamation and Reuse Options </em>USA Univ of California</li><br />
<li>Bruvold W (1988)<em> Public Opinion on Water Reuse Option</em>s Journal WPCF 60 1 45</li><br />
<li>Cunningham E (2014). <em>Islamic State jihadists are using water as a weapon in Iraq</em>. [ONLINE] Available at: <href=”http://www.washingtonpost.com/world/middle_east/islamic-state-jihadists-are-using-water-as-a-weapon-in-iraq/2014/10/06/aead6792-79ec-4c7c-8f2f-fd7b95765d09_story.html”</li><br />
<li>Deutsche Borse Group (2013). <em>Focus On: BRICS Economic Growth </em>. [ONLINE] Available at: <href=”http://www.mni-indicators.com/files/focus_on_brics_economic_growth.pdf”>.<br />
</li><br />
<li>Dishman C, Sherrard J & Rebhun M (1989) Gaining Public Support for Direct Potable Water Reuse Journal of Professional Issues in Engineering 115 2 154<br />
</li><br />
<li>Dolnicar S & Hurlimann A (2009) <em>Drinking water from alternative water sources differences in beliefs social norms and factors of perceived behavioural control across eight Australian locations</em>, Water Science & Technology 60 6 1433-144</li><br />
<li>Dolnicar S & Hurlimann A (2010) <em>Desalinated Versus Recycled Water – What Does the Public Think In Escobar</em></li><br />
<li>Dolnicar S & Schäfer A I (2007) <em>Australians Raise Health Environment and Cost Concerns</em> Desalination & Water Reuse 16 4 10-15</li><br />
<li>Dolnicar S & Schäfer A I (2009) <em>Desalinated Versus Recycled Water — Public Perceptions and Profiles of the Accepters</em> Journal of Environmental Management 90 888-9</li><br />
<li>Dolnicar S, Hurlimann A & Nghiem L (2010) <em>The effect of information on public acceptance - The case of water from alternative sources</em>, Journal of Environmental Management 91 1288-1293 AVAILABLE FOR FREE AT http //ro uow edu au/commpapers/713/<br />
edie/. <br />
</li><br />
<li>Economics, P. (2013). <em>World in 2050. The BRICs and Beyond: Prospects, challenges and opportunities</em>.</li><br />
<li>Gikas P & Tchobanoglous G (2009)<em> The role of satellite and decentralized strategies in water resources managemen</em>t, Journal of Environmental Management 90 1 144-15</li><br />
<li>Gleeson T, Wada Y, Bierkens M F & van Beek L P (2012) ,em>Water balance of global aquifers revealed by groundwater footprint</em> Nature 488 7410 197-20</li><br />
<li>Gleick P H (1994) “Water, war and peace in the Middle East ” <em>Environment</em> Vol 36 No 3 pp 6-on Heldref Publishers Washington</li><br />
<li>Gleick P H 1998 “,em>Water and conflict</em> ” See Chronologies A and B In P H</li><br />
<li>Gleick The World’s Water( 1998-1999) Island Press Washington D C pp 105-13</li><br />
<li>Greater London Authority (no date). <em>Making every drop count</em>. [ONLINE] Available at: <href=”https://www.london.gov.uk/priorities/environment/looking-after-londons-water/water-demand”>.</li><br />
<li>Guardian (2014). <em>Indian officials order Coca-Cola plant to close for using too much water </em>. [ONLINE] Available at: <href = “http://www.theguardian.com/environment/2014/jun/18/indian-officals-coca-cola-plant-water-mehdiganj”>.</li><br />
<li>Hofstedt, T. (2010). China's water scarcity and its implications for domestic and international stability. <em>Asian Affairs: An American Review</em>, 37(2), 71-83</li><br />
<li>Howitt R, Medellín-Azuara J, MacEwan D, Lund J, Sumner D (2014). <em>Economic Analysis of the 2014 Drought for California Agriculture</em>. [ONLINE] Available at: <href = “https://watershed.ucdavis.edu/files/content/news/Economic_Impact_of_the_2014_California_Water_Drought.pdf”>.</li><br />
<li>Hurlimann A & Dolnicar S (2010), Acceptance of Water Alternatives in Australia, <em>Water Science and Technology</em>, 61 (8), 2137-214</li><br />
<li>Hurlimann A & Dolnicar S (2010) When Public Opposition Defeats Alternative Water Projects - the Case of Toowoomba, Australia Water Research 44 287-29</li><br />
<li> I C & Schäfer A Eds <em>Sustainable Water for the Future Water Recycling Versus Desalination</em> Amsterdam Elsevier 375-388</li><br />
<li>Levine, A. D., & Asano, T. (2004). Peer reviewed: recovering sustainable water from wastewater. <em>Environmental science & technology</em>, 38(11), 201A-208A</li><br />
<li>Marks J S, Martin B & Zadoroznyj M (2006) <em>Acceptance of Water Recycling In Australia</em> National Baseline Data Water Journal of the Australian Water Association 33 (2) 151<br />
</li><br />
<li>Mascarelli A (2012), <em> Demand for water outstrips supply </em>, Nature</li><br />
<li>Masgon M. A. & Gensch R. (e.g. 2011). <em>Water, Sanitation and Gender</em>. [ONLINE] Available at: <href="http://www.sswm.info/content/water-sanitation-and-gender.pdf"></li><br />
<li>Mengistu B. (2012). <em>Empowering women and girls. How water, sanitation and hygiene deliver gender equality </em>. [ONLINE] Available at: <href="www.wateraid.org/~/media/Publications/empowering-women-girls-water-sanitation-hygiene-gender-equality.ash"x</li><br />
<li>Micklin, P. P. (1988).<em> Dessication of the Aral Sea: A water management disaster in the Soviet Union<e/em>. Science 241: 1170-7</li><br />
<li>Miller W G (2006)<em> Integrated concepts in water reuse managing global water needs </em>Desalination 187 1 65-75</li><br />
<li>Nancarrow, B Kaercher J & Po M (2002) <em>Community Attitudes to Water Restrictions Policies and Alternative Sources: A longitudinal Analysis</em> 1988-2002 Perth CSIRO Land and Water Consultancy Report November 2002<br />
</li><br />
<li>Organisation for Economic Co-operation and Development. (2008). <em>OECD environmental outlook to 2030</em>. Organisation for Economic Co-operation and Development.<br />
</li><br />
<li>Pacific Institute, Water conflict chronology timeline ONLINE Available at <href ="http //www2 worldwater org/conflict/timeline/>Pacific Institute Water conflict ONLINE Available at <href =”http //worldwater org/water-conflict/”></li><br />
<li>Po M, Nancarrow B E & Kaercher J D (2003) <em>Literature review of factors influencing public perceptions of water reuse</em> pp 1-39 Victoria CSIRO Land and Wat</li><br />
<li>Pedley D (no date).<em> Environmental Measurement </em>. [ONLINE] Available at: <href = "https://connect.innovateuk.org/web/environmental-measurement/at-a-glance”></li><br />
<li>Principles, D. (1992, January). The Dublin statement on water and sustainable development. In <em>International conference on water and the environment</em>.<br />
</li><br />
<li>Secretary of State for Environment, Food and Rural Affairs (2008). <em>Future Water The Government’s water strategy for England</em>. [ONLINE] Available at: <href =”https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/69346/pb13562-future-water-080204.pdf”>.</li><br />
<li>State of California, The Resources Agency, Department of Water Resources (2014). <em>Public Update for Drought Response Groundwater Basins with Potential Water Shortages and Gaps in Groundwater Monitoring</em>. [ONLINE] Available at: <href="http://www.water.ca.gov/waterconditions/docs/Drought_Response-Groundwater_Basins_April30_Final_BC.pdf"></li><br />
<li>Svoda M (2014). <em>US Drought Monitor</em>. [ONLINE] Available at: <href = “http://droughtmonitor.unl.edu/Home.aspx”>.</li><br />
<li>United Nations Development Programme (UNDP). (2006). <em>Human Development Report 2006, Beyond Scarcity: Power, poverty and the global water crisis</em></li><br />
<li>UN (2004). Sanitation Country Profile, Russian Federation. [ONLINE] Available at: <href="http://www.un.org/esa/agenda21/natlinfo/countr/russia/RussiaSanitation04f.pdf."> </li><br />
<li>UN Water (2014). <em>The united nations world water development report 2014 </em>. [ONLINE] Available at: <href=”http://unesdoc.unesco.org/images/0022/002257/225741E.pdf”>.</li><br />
<li>US Geological Survey (2014) <em>How much water is there on in and above the Earth</em> ONLINE Available at <href = “http //water usgs gov/edu/earthhowmuch.html”></li><br />
<li>Vidal J (2014). <em>Water supply key to outcome of conflicts in Iraq and Syria, experts warn.</em> [ONLINE] Available at: <href="http://www.theguardian.com/environment/2014/jul/02/water-key-conflict-iraq-syria-isis."> </li><br />
<li>Water Quality for Ecosystems and Human Health 2nd edition UNEP ERCE UNESCO 2008</li><br />
<li>Water, U. N. (2007). Coping with water scarcity: challenge of the twenty-first century. <em>2007 World Water Day.</em></li><br />
<li>WHO/UNICEF Joint Monitoring Programme (JMP) for Water Supply and Sanitation. (2012). Progress on Sanitation and Drinking-Water, 2012 Update<br />
</li><br />
<li>World Health Organization (WHO). (2008). Safer Water, Better Health: Costs, benefits, and sustainability of interventions to protect and promote health; Updated Table 1: WSH deaths by region, 2004.<br />
</li><br />
<br />
<br />
</ul><br />
<br />
</div><br />
<br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
<br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geobenhttp://2014.igem.org/File:IMG_20141017_190324.jpgFile:IMG 20141017 190324.jpg2014-10-17T18:05:36Z<p>Geoben: </p>
<hr />
<div></div>Geobenhttp://2014.igem.org/File:IMG_20141017_132653.jpgFile:IMG 20141017 132653.jpg2014-10-17T17:43:36Z<p>Geoben: </p>
<hr />
<div></div>Geobenhttp://2014.igem.org/Team:Imperial/Water_ReportTeam:Imperial/Water Report2014-10-17T04:17:07Z<p>Geoben: </p>
<hr />
<div>{{:Team:Imperial/Templates:header}}<br />
<br />
<html><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:highcharts?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:data?action=raw&ctype=text/js"></script><br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:exporting?action=raw&ctype=text/js"></script><br />
<br />
<br />
<br />
<script src="https://2014.igem.org/Team:Imperial/Resources/JS:charts?action=raw&ctype=text/js"></script><br />
<br />
<body><br />
<div class="content-wrapper"><br />
<br />
<div class="pure-g"><br />
<br />
<div class="pure-u-1-1 main"><br />
<h1>The Water Report</h1><br />
<div id="navWrap"><br />
<div id="subNav"><br />
<ul><br />
<li><a data-scroll href="#introduction">Introduction</a><br />
</li><br />
<li><a data-scroll href="#water_stress">Water Stress</a><br />
</li><br />
<li><a data-scroll href="#socioeconmic">Socioeconomics</a><br />
</li><br />
<li><a data-scroll href="#sustainable">Sustainability</a><br />
</li><br />
<li><a data-scroll href="#decentralisation">Decentralisation</a><br />
</li><br />
<li><a data-scroll href="#wastewater">Wastewater</a><br />
</li><br />
<li><a data-scroll href="#conclusions">Conclusions</a><br />
</li><br />
<br />
<li><a data-scroll href="#references">References</a><br />
</li><br />
</ul><br />
<br class="clearLeft" /><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
<section id="overview"><br />
<div class="pure-g"><br />
<div class="pure-u-1-1"><br />
<br />
<h2>At a glance</h2><br />
<ul><br />
<br />
<li>Growing population, development and urbanisation make water shortages increasingly severe</li><br />
<li>Beyond public health implications, water shortages cause conflict and social issues throughout the world</li><br />
<li>Decentralisation of water treatment systems is necessary to increase resilience and adapt to changing demand</li><br />
<li>Wastewater recycling is increasingly essential but has technical and social hurdles to overcome</li><br />
<li>Innovative solutions for cost effective, decentralised water recycling are desperately needed</li><br />
<br />
<br />
</ul><br />
</div><br />
<br />
<br />
</div><br />
<br />
</section><br />
<section id="introduction"><br />
<h2>Introduction</h2><br />
<p>All life depends on water. Our Earth, home to all species, remains the only place we know capable of sustaining life. In our search for others amongst the stars, it is water we look for first. <br />
<br />
More than 71% of the planet is covered in this resource, but only a small proportion is suitable for human use. 97.5% percent of the world’s water is salt water and of the 2.5% freshwater, nearly 70% is locked in glaciers and the ice caps. The majority of what remains is inaccessible; either as soil moisture, permafrost or deep beneath the ground. All considered, less than 0.03% of global water is viable for human use (US Geological Survey 2014). <br />
<br />
With the world’s population is rising at a rate of 80 million people a year, water demands are increasing proportionally (Worldometers no date). In order to sustain over seven billion people, we require more than 200 million litres of clean water per second (Waterwise no date). 67% of this is for agriculture, 22% for domestic, and 11% for industrial use.<br />
<br />
Our overstretched resources are very unevenly distributed. Areas with high natural resources are rarely near the urban centres of high demand and this is becoming more severe. For example the top countries for fresh water supplies, Brazil, Russia and Canada, with 30% of the world supply between them, are not areas of highest population growth, India, China and Nigeria take the top spots there (Cohen & Siu 2013).</p><br />
<div id="water_use_breakdown" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<div id="freshwater_breakdown" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<div id="freshwater_per_capita" style="min-width: 310px; height: 400px; max-width: 900px; margin: 0 auto"></div><br />
<br />
</section><br />
<br />
<section id="water_stress"><br />
<h2>Water Stress - An Increasing Problem</h2><br />
<p><br />
Water stress occurs when the demand for water exceeds the available amount during a certain period or when poor quality restricts its use (EEA no date). Water stress usually occurs in places with low rainfall and high population density or in areas with intensive agricultural irrigation. It means deterioration of the available freshwater supply both in terms of quantity (from aquifer over-exploitation or drained rivers and lakes) and quality (from eutrophication, saline intrusion, organic matter pollution, heavy metal contamination and other problems).<br />
Causes of water stress and scarcity:<br />
<b>Climate Change</b><br />
Climate change, due to an increasing greenhouse effect, has a direct impact on the hydrological cycle (IPCC 1996). Increased evaporation from water bodies leads to an overall increase in precipitation, but the changing climate also causes this to be distributed more unevenly. This can alter the durations of wet and dry seasons leading to droughts and floods with severe repercussions for water resources (Arnell 2004) . The changing climate makes our need for sustainable water scarcity solutions ever more pressing. <br />
Pollution<br />
Water sources contaminated from agricultural runoff, domestic wastewater, industrial pollutants and from atmospheric pollutants as a result of burning fossil fuels are at risk of eutrophication. Less dynamic water resources, such as lakes, are more susceptible due to longer water residence and through their action as integration sinks for multiple polluted water sources. The high-nutrient load (mainly nitrogen and phosphorus), causes algal blooms which may be toxic and complicate many methods of water purification.<br />
<br />
Another increasing issue with water quality is the influx of personal care products and pharmaceuticals. Examples of these pollutants include painkillers, antibiotics and female hormonal birth control (UNEP, ERCE, UNESCO. 2008). Certain compounds may be long lived so accumulate in recycled urban wastewater. <br />
<br />
<h3>Social and Economic Effects</h3> <br />
<h4>Water conflict</h4><br />
<p>Water has a long history as a source of conflict and neighboring nations have often been at odds over disputed supplies. As far back as the 3rd millennium BCE, King Lagash, significantly reduced the water flow in the neighboring Umma (modern day Iraq) by building boundary canals around his territory. </p><br />
<br />
<p>There are many types of conflict including but not limited to:</p><br />
<ul><br />
<li>Disputes over control and development of water resources: water resources, lakes, rivers and aquifers are valuable, interconnected and do not respect state boundaries.</li><br />
<li>Military tools and targets. In the first case, water resources or systems are used as a tool or weapon for military action for example diverting supplies to cause flood or provide defence. In the second case, water resources are targets of military actions, deliberately polluting or destroying enemy supplies.</li><br />
<li>Use as a Political tool. Water resources or systems are controlled by state or non-state actors as a means to achieve political goals.</li><br />
<li>Target for Terrorism. Water resources or systems are targeted or threatened and by non-state actors as means of violence and coercion.</li><br />
</ul><br />
<br />
Notable current sources of water conflicts are demonstrated in the map below:<br />
(Pacific Institute)(Gleick 1994)(Gleick 1998)<br />
In The News<br />
Middle East<br />
Recent developments in the Middle East highlight the importance of water in conflict. Islamic State militants are using water as a weapon against villages that resist their advance by cutting off the supplies. Currently, IS control major parts of Tigris and Euphrates, on which all of Iraq and a large part of Syria rely for food, water and industry (Cunningham 2014) (Vidal 2014). Matthew Machowski, a Middle East security researcher for the UK Parliament and Queen Mary University notes that “It is already being used as an instrument of war by all sides. It can be claimed that controlling water resources in Iraq is strategically more important than controlling oil refineries… cut it off and you create great sanitation and health crises” (Vidal 2014).<br />
Brazil<br />
One of the world’s most rapidly expanding economies has been affected by droughts this past summer. A major affected area was Sao Paulo, the southern hemisphere’s largest city. Reservoirs of the Cantareira system that supply 45% of the city fell to 9.7% capacity, an unprecedented low. Conflict ignited between Sao Paulo, Rio de Janeiro and Minas Gerais, the country’s three most prosperous – and most severely water stressed – states. Sao Paulo controversially diverted water from the Paraiba de Sul in order to supply the Cantareira system, by reducing the flow of the Jaguari River (a tributary to the Paraiba de Sul). Paraiba de Sul is one of the major water and energy supplies of Rio de Janeiro.<br />
This move violated a federal pact between the three states, made due to fears water transfer to the Cantaneira system may have adverse effect on the environmental, economic and social balance of all three states.<br />
The disagreement recently reached the Supreme Court and eventually concluded with Sao Paulo reducing water flow in two of its dams and Rio de Janeiro reducing water capture from the Paraiba de Sul river basin (International Law Office 2014).<br />
<br />
Many conflicts stem from large areas and communities relying on a single, shared water supply. In addition to preventing overexploitation it is helpful to provide communities with alternative, more local purification solutions to empower them and give control of their own resources (Faeth and Weinthal 2012) here: http://www.thesolutionsjournal.com/node/1037<br />
<br />
<br />
Social implications<br />
It is predicted that within the next 15 years, more than half of the world’s population will be living under severe water stress (OECD 2012). So far, water scarcity has been an issue for individuals and families living in poverty, while most in the developed world enjoy reliable, plentiful access to safe water. As the stress increases, it will hit many of us who were previously unaffected but the majority of the hardship will continue to fall on the worlds poorest. <br />
<br />
There are further equality issues of equality arising from water accessibility and sanitation. In developing countries significant responsibility for acquisition and distribution of water is placed upon women and children of the family. Difficulties in access result in many hours lost that could instead be used for income generation, caring for family members or education (UNDP 2006). This reinforces the cycle of gender disempowerment and inequality. In rural parts of eastern Africa, women and girls spend significant amounts of their day trying to access water sources. Their journey may take them through treacherous places and increases risk of violence and sexual abuse. Women are more likely to voice concerns regarding water and sanitation compared to their male counterparts. However due to their inferior social standing such concerns often go unheard. (Mengistu 2012). <br />
<br />
Water stress can reinforce or increase inequality. Solutions to the water crisis are necessary not just for a healthier, more peaceful world, but also a fairer one. <br />
<br />
Economic Implications<br />
Water is a key input in the smallest of businesses and the largest of corporations alike. Without water it is impossible to generate energy or produce goods. Therefore the economic welfare of a state relies on its water resources, it sustains the backbone of the economy. Corporations are increasingly forced to take water availability into account. For example the Coca Cola plant in Mehdiganj, India, chose to close due to the increasing water stress in the region (Guardian 2014). The socioeconomic impacts of water stress are considered in case studies below.<br />
<br />
Case Study: BRICs<br />
The BRIC countries (Brazil, India, China and Russia) are large, developing economies, distinguished from other emerging markets by their demographic and developmental potential. These four countries are home to more than 2.5 billion people, 40% of the world’s population, cover 25% of the world’s area, and account for 25% of the global GDP. <br />
<br />
Expanding economies such as these require increased energy production which in turn relies significantly on water. One third of global energy needs are currently met by oil, an immensely water-expensive fuel source. Natural gas is currently the most popular alternative to oil due to the “shale gas revolution” and is cleaner in terms of emissions. Shale gas is even more water intensive however and prospective shale-producing countries like China and India will face constraints due to inadequate water supplies (Cohen & Siu 2013).<br />
<br />
Additionally, an expanding middle class in these countries causes shifts in dietary preference that have a significant impact on water use and management. Vegetable-oriented diets turn into meat and dairy-oriented ones that are significantly more water intensive increasing stress on water-scarce nations (Cohen & Siu 2013).<br />
<br />
Disparities in water also exist on more local levels within these countries. In China, the southern part of the country experiences sufficient precipitation and rich groundwater supplies but the North is particularly drought-prone. With large cities like Beijing and Tianjin situated in the North, water distribution is a pressing concern. <br />
<br />
Pollution of water supplies is also a significant issue faced by countries. According to the UN, only 28% of wastewater is Russia is properly treated and just 20% in Brazil. This contaminates freshwater supplies and can make otherwise safe water non-potable. A recent survey by the Chinese Ministry of Land and Resources states that only 22% of the countries groundwater supply is safe for human consumption (CMLR 2013) (Cohen & Siu 2013). <br />
<br />
<br />
Case Study: California<br />
California is the USA’s most populous state containing one eighth of American people. More than 90% of the region is under severe water stress (US Drought Monitor 2014).<br />
The widespread drought is likely to worsen due to climate change, Diffenbaugh (2014) notes: “Research finds that extreme atmospheric high pressure in this region – which is strongly linked to unusually low precipitation in California – is much more likely to occur today than prior to the human emission of greenhouse gases that began during the Industrial Revolution in the 1800s”.<br />
The ramifications could be severe. The drought is estimated to cost more than $2.2 billion to the Californian economy, with 17,100 part-time and seasonal jobs being lost (Howit 2014).<br />
At present, California relies on groundwater reserves in order to replace surface water losses. If the drought continues for more than 2 years it will lead to significant groundwater depletion. and increasing costs of groundwater. This increase is not predicted to impact the prices of commodities and so would be translated as loss of revenue for farmers (Howitt et al 2014).<br />
Case Study: London<br />
With 164 days of precipitation per year, one might not imagine our home city, London as suffering water stress. Yet it ranks as the 15th most water stressed city in the world (edieWater 2014). With a population of more than 8.3 million, water demand is high and supply is tightly regulated. The situation is again predicted to become more severe as climate change causes rainfall to become more seasonal with summers being drier and winters wetter. <br />
<br />
The London sewage system is old, having been constructed in the mid-1800s. Emergency overflows into the Rivers Thames prevent overflowing into the cities streets and with around 60 such discharges every year, the water quality of the river is particularly poor (Greater London Authority no date).</p><br />
<br />
</section><br />
<br />
<section id="socioeconomic"><br />
<h2>Social and Economic Effects</h2><br />
<p>TEXT HERE</p><br />
<br />
</section><br />
<br />
<section id="sustainable"><br />
<h2>Sustainable Water Management</h2><br />
<p>TEXT HERE</p><br />
<br />
</section><br />
<br />
<section id="decentralisation"><br />
<h2>Decentralising the Water Supply</h2><br />
<p>TEXT HERE</p><br />
<br />
</section><br />
<br />
<section id="wastewater"><br />
<h2>Wastewater Recycling</h2><br />
<p>Wastewater treatment and recycling can be challenging and controversial to implement. From a survey of industry experts by the Global Water Research Coalition, Miller (2005) describes “key factors of success” to be considered in design and implementation of water recycling systems. These include:<br />
</p><br />
<br />
<ul><br />
<br />
<li>A particularly clear definition of the project objectives and limitations. <br />
</li><br />
<li>Cost competitive pricing. Recycled water must be carefully priced to be viewed as a viable alternative. Cheaper, more efficient technologies in water recycling are desperately needed.<br />
</li><br />
<li>Chemical and microbiological safety. It is important to have technologies that ensure the removal of chemical contaminants, particularly endocrine disruptors such as pesticides, <strong>heavy metals</strong> and pharmaceuticals and removal or inactivation of microbiological pathogens. Water utilities must be able to reassure the public that the recycled water is completely safe for its intended use.<br />
</li><br />
<li>Public perception and acceptance. While the public is generally accepting of recycled water as a mean for landscape irrigation, for potable use, reactions are more negative.</li><br />
<br />
<br />
</ul><br />
<br />
<br />
<h3>Improving Public Acceptance</h3><br />
<p>Many studies have charted the perception and acceptance of recycled water over the years (Bruvold and Ward 1970; Bruvold 1972, 1979 and 1988, Nancarrow 2003, Dolnicar and Schäfer 2006, 2007 and 2009; Dolnicar and Hurlimann 2010; Hurlimann and Dolnicar 2010). Whilst levels of acceptance vary with time and location a few conclusions are consistently drawn:<br />
</p><br />
<ol><br />
<li>In general, public knowledge on the subject of water treatment and the advantages and disadvantages of different processes is relatively low.</li><br />
<li>General perception of recycled water is that, whilst it is an environmentally friendly solution, there are public health concerns.<br />
</li><br />
<li>Recycled water is considered acceptable for tasks such as gardening and car washing. When it comes to close body use (bathing and showering) there are reservations due to fears of residual wastewater in the recycled water.<br />
</li><br />
<li>Perception is very dependant on the particular source and treatment of the water.<br />
</li><br />
<li>Choice matters: in places where alternative sources of water were available, people were more sceptical of water reuse than in regions with water shortages.<br />
</li><br />
</ol><br />
<p>Education about the necessity and safety of recycled water is paramount for improving public perception and must accompany the technological implementation. A recent survey conducted by Guardian, posted alongside an article about Thames Water plans to introduce recycled water for potable use to meet demand by 2040, revealed a promising 63% of Londoners would be happy drinking recycled water (Saner 2014). As 100% of Londoners need to be drinking it by that date however, perception must catch up. <br />
</p><br />
<br />
</section><br />
<section id="conclusions"><br />
<h2>Conclusions</h2><br />
<p>Our planet’s natural water resources continue to be unsustainably exploited; as a result, we are faced with the challenges of water stress and scarcity. Climate change, population growth and urbanisation fuel the worsening crisis. To avert disaster we must rethink the way we process and use our water supplies. Promisingly, solutions are emerging but significant technological and sociological issues need to be addressed. Water treatment systems are becoming decentralised which makes the system more reliable and adaptable. Supply can be better expanded to meet changing demands and systems can be more tailored to local supplies though improvements are needed to make smaller scale plants more cost effective. Recycled wastewater is becoming an increasingly important component of our water supplies, indirect reuse is common and direct reuse, whilst initially confined to irrigation, is becoming more common. Innovations are needed to improve quality and cost as well as public confidence in the process. </p><br />
<br />
</section><br />
<br />
<section id="references"><br />
<h2>References</h2><br />
<br />
<div class="accordion"><br />
<h2></h2><br />
<ul><br />
<li>Abby Josef Cohen, Rachel Siu (2013) <em>Sustainable Growth Taking a Deep Dive into Water</em> ONLINE Available at <href ="http//www.goldmansachs.com/our-thinking/clean-technology-and-renewables/cohen/report.pdf"><br />
</li><br />
<li>Abra J & Simms T (no date). <em>Low Impact Water and Wastewater Treatment</em>. [ONLINE] Available at: <href=”https://connect.innovateuk.org/web/low-impact-wate</li><br />
<li>Abra J & Simms T (no date). <em>Management of Water and Wastewater at Source</em>. [ONLINE] Available at: <href=”https://connect.innovateuk.org/web/managing-water-and-wastewater-at-source/at-a-glance>.<br />
</li><br />
<li>Agence France-Presse (2014). <em>Nobel laureates call for a revolutionary shift in how humans use resources</em>. [ONLINE] Available at: <href=”http://www.theguardian.com/science/2014/oct/07/nobel-laureates-call-for-a-revolutionary-shift-in-how-humans-use-resources”>.</li><br />
<li>Anderson, J., Arblaster, K., Bartley, J., Cooper, T., Kettunen, M., Kaphengst, T., ... & Holmberg, M. (2006). Climate change-induced water stress and its impact on natural and managed ecosystems. <em>Climate change-induced water stress and its impact on natural and managed ecosystems</em>.</li><br />
<li>Arnell N W 1999 <em>Climate change and global water resources</em> Global environmental change 9 S31-S4</li><br />
<li>Arnell, N. W. (2004). Climate change and global water resources: SRES emissions and socio-economic scenarios. <em>Global environmental chang</em>e, 14(1), 31-52</li><br />
<li>Bruvold W & Ward P (1970) <em>Public Attitudes Toward Uses of Reclaimed Wastewater</em> Water & Sewage Works 120<br />
</li><br />
<li>Bruvold W (1972) <em> Public Attitudes Towards Reuse of Reclaimed Water</em> USA Univ of California</li><br />
<li>Bruvold W (1979) <em>Public Attitudes Towards Wastewater Reclamation and Reuse Options </em>USA Univ of California</li><br />
<li>Bruvold W (1988)<em> Public Opinion on Water Reuse Option</em>s Journal WPCF 60 1 45</li><br />
<li>Cunningham E (2014). <em>Islamic State jihadists are using water as a weapon in Iraq</em>. [ONLINE] Available at: <href=”http://www.washingtonpost.com/world/middle_east/islamic-state-jihadists-are-using-water-as-a-weapon-in-iraq/2014/10/06/aead6792-79ec-4c7c-8f2f-fd7b95765d09_story.html”</li><br />
<li>Deutsche Borse Group (2013). <em>Focus On: BRICS Economic Growth </em>. [ONLINE] Available at: <href=”http://www.mni-indicators.com/files/focus_on_brics_economic_growth.pdf”>.<br />
</li><br />
<li>Dishman C, Sherrard J & Rebhun M (1989) Gaining Public Support for Direct Potable Water Reuse Journal of Professional Issues in Engineering 115 2 154<br />
</li><br />
<li>Dolnicar S & Hurlimann A (2009) <em>Drinking water from alternative water sources differences in beliefs social norms and factors of perceived behavioural control across eight Australian locations</em>, Water Science & Technology 60 6 1433-144</li><br />
<li>Dolnicar S & Hurlimann A (2010) <em>Desalinated Versus Recycled Water – What Does the Public Think In Escobar</em></li><br />
<li>Dolnicar S & Schäfer A I (2007) <em>Australians Raise Health Environment and Cost Concerns</em> Desalination & Water Reuse 16 4 10-15</li><br />
<li>Dolnicar S & Schäfer A I (2009) <em>Desalinated Versus Recycled Water — Public Perceptions and Profiles of the Accepters</em> Journal of Environmental Management 90 888-9</li><br />
<li>Dolnicar S, Hurlimann A & Nghiem L (2010) <em>The effect of information on public acceptance - The case of water from alternative sources</em>, Journal of Environmental Management 91 1288-1293 AVAILABLE FOR FREE AT http //ro uow edu au/commpapers/713/<br />
edie/. <br />
</li><br />
<li>Economics, P. (2013). <em>World in 2050. The BRICs and Beyond: Prospects, challenges and opportunities</em>.</li><br />
<li>Gikas P & Tchobanoglous G (2009)<em> The role of satellite and decentralized strategies in water resources managemen</em>t, Journal of Environmental Management 90 1 144-15</li><br />
<li>Gleeson T, Wada Y, Bierkens M F & van Beek L P (2012) ,em>Water balance of global aquifers revealed by groundwater footprint</em> Nature 488 7410 197-20</li><br />
<li>Gleick P H (1994) “Water, war and peace in the Middle East ” <em>Environment</em> Vol 36 No 3 pp 6-on Heldref Publishers Washington</li><br />
<li>Gleick P H 1998 “,em>Water and conflict</em> ” See Chronologies A and B In P H</li><br />
<li>Gleick The World’s Water( 1998-1999) Island Press Washington D C pp 105-13</li><br />
<li>Greater London Authority (no date). <em>Making every drop count</em>. [ONLINE] Available at: <href=”https://www.london.gov.uk/priorities/environment/looking-after-londons-water/water-demand”>.</li><br />
<li>Guardian (2014). <em>Indian officials order Coca-Cola plant to close for using too much water </em>. [ONLINE] Available at: <href = “http://www.theguardian.com/environment/2014/jun/18/indian-officals-coca-cola-plant-water-mehdiganj”>.</li><br />
<li>Hofstedt, T. (2010). China's water scarcity and its implications for domestic and international stability. <em>Asian Affairs: An American Review</em>, 37(2), 71-83</li><br />
<li>Howitt R, Medellín-Azuara J, MacEwan D, Lund J, Sumner D (2014). <em>Economic Analysis of the 2014 Drought for California Agriculture</em>. [ONLINE] Available at: <href = “https://watershed.ucdavis.edu/files/content/news/Economic_Impact_of_the_2014_California_Water_Drought.pdf”>.</li><br />
<li>Hurlimann A & Dolnicar S (2010), Acceptance of Water Alternatives in Australia, <em>Water Science and Technology</em>, 61 (8), 2137-214</li><br />
<li>Hurlimann A & Dolnicar S (2010) When Public Opposition Defeats Alternative Water Projects - the Case of Toowoomba, Australia Water Research 44 287-29</li><br />
<li> I C & Schäfer A Eds <em>Sustainable Water for the Future Water Recycling Versus Desalination</em> Amsterdam Elsevier 375-388</li><br />
<li>Levine, A. D., & Asano, T. (2004). Peer reviewed: recovering sustainable water from wastewater. <em>Environmental science & technology</em>, 38(11), 201A-208A</li><br />
<li>Marks J S, Martin B & Zadoroznyj M (2006) <em>Acceptance of Water Recycling In Australia</em> National Baseline Data Water Journal of the Australian Water Association 33 (2) 151<br />
</li><br />
<li>Mascarelli A (2012), <em> Demand for water outstrips supply </em>, Nature</li><br />
<li>Masgon M. A. & Gensch R. (e.g. 2011). <em>Water, Sanitation and Gender</em>. [ONLINE] Available at: <href="http://www.sswm.info/content/water-sanitation-and-gender.pdf"></li><br />
<li>Mengistu B. (2012). <em>Empowering women and girls. How water, sanitation and hygiene deliver gender equality </em>. [ONLINE] Available at: <href="www.wateraid.org/~/media/Publications/empowering-women-girls-water-sanitation-hygiene-gender-equality.ash"x</li><br />
<li>Micklin, P. P. (1988).<em> Dessication of the Aral Sea: A water management disaster in the Soviet Union<e/em>. Science 241: 1170-7</li><br />
<li>Miller W G (2006)<em> Integrated concepts in water reuse managing global water needs </em>Desalination 187 1 65-75</li><br />
<li>Nancarrow, B Kaercher J & Po M (2002) <em>Community Attitudes to Water Restrictions Policies and Alternative Sources: A longitudinal Analysis</em> 1988-2002 Perth CSIRO Land and Water Consultancy Report November 2002<br />
</li><br />
<li>Organisation for Economic Co-operation and Development. (2008). <em>OECD environmental outlook to 2030</em>. Organisation for Economic Co-operation and Development.<br />
</li><br />
<li>Pacific Institute, Water conflict chronology timeline ONLINE Available at <href ="http //www2 worldwater org/conflict/timeline/>Pacific Institute Water conflict ONLINE Available at <href =”http //worldwater org/water-conflict/”></li><br />
<li>Po M, Nancarrow B E & Kaercher J D (2003) <em>Literature review of factors influencing public perceptions of water reuse</em> pp 1-39 Victoria CSIRO Land and Wat</li><br />
<li>Pedley D (no date).<em> Environmental Measurement </em>. [ONLINE] Available at: <href = "https://connect.innovateuk.org/web/environmental-measurement/at-a-glance”></li><br />
<li>Principles, D. (1992, January). The Dublin statement on water and sustainable development. In <em>International conference on water and the environment</em>.<br />
</li><br />
<li>Secretary of State for Environment, Food and Rural Affairs (2008). <em>Future Water The Government’s water strategy for England</em>. [ONLINE] Available at: <href =”https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/69346/pb13562-future-water-080204.pdf”>.</li><br />
<li>State of California, The Resources Agency, Department of Water Resources (2014). <em>Public Update for Drought Response Groundwater Basins with Potential Water Shortages and Gaps in Groundwater Monitoring</em>. [ONLINE] Available at: <href="http://www.water.ca.gov/waterconditions/docs/Drought_Response-Groundwater_Basins_April30_Final_BC.pdf"></li><br />
<li>Svoda M (2014). <em>US Drought Monitor</em>. [ONLINE] Available at: <href = “http://droughtmonitor.unl.edu/Home.aspx”>.</li><br />
<li>United Nations Development Programme (UNDP). (2006). <em>Human Development Report 2006, Beyond Scarcity: Power, poverty and the global water crisis</em></li><br />
<li>UN (2004). Sanitation Country Profile, Russian Federation. [ONLINE] Available at: <href="http://www.un.org/esa/agenda21/natlinfo/countr/russia/RussiaSanitation04f.pdf."> </li><br />
<li>UN Water (2014). <em>The united nations world water development report 2014 </em>. [ONLINE] Available at: <href=”http://unesdoc.unesco.org/images/0022/002257/225741E.pdf”>.</li><br />
<li>US Geological Survey (2014) <em>How much water is there on in and above the Earth</em> ONLINE Available at <href = “http //water usgs gov/edu/earthhowmuch.html”></li><br />
<li>Vidal J (2014). <em>Water supply key to outcome of conflicts in Iraq and Syria, experts warn.</em> [ONLINE] Available at: <href="http://www.theguardian.com/environment/2014/jul/02/water-key-conflict-iraq-syria-isis."> </li><br />
<li>Water Quality for Ecosystems and Human Health 2nd edition UNEP ERCE UNESCO 2008</li><br />
<li>Water, U. N. (2007). Coping with water scarcity: challenge of the twenty-first century. <em>2007 World Water Day.</em></li><br />
<li>WHO/UNICEF Joint Monitoring Programme (JMP) for Water Supply and Sanitation. (2012). Progress on Sanitation and Drinking-Water, 2012 Update<br />
</li><br />
<li>World Health Organization (WHO). (2008). Safer Water, Better Health: Costs, benefits, and sustainability of interventions to protect and promote health; Updated Table 1: WSH deaths by region, 2004.<br />
</li><br />
<br />
<br />
</ul><br />
<br />
</div><br />
<br />
</section><br />
</div><br />
<br />
<br />
<br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</body><br />
<br />
</html><br />
{{:Team:Imperial/Templates:footer}}</div>Geoben