http://2014.igem.org/wiki/index.php?title=Special:Contributions/Alrual&feed=atom&limit=50&target=Alrual&year=&month=
2014.igem.org - User contributions [en]
2024-03-28T16:09:14Z
From 2014.igem.org
MediaWiki 1.16.5
http://2014.igem.org/Team:Valencia_UPV/Project/results
Team:Valencia UPV/Project/results
2014-10-18T03:57:55Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Results</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>P</roja>roject <roja>R</roja>esults</span> </div><br/><br/><br />
<br />
<br />
<table align="center"><br />
<tr><br />
<td><br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs"><div class="results" id="Constructs"><br />
</div></a><br />
</td><br />
<td><br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression"><div class="results" id="Trichome_expression"><br />
</div></a><br />
</td><br />
<td><br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/pheromone_analysis"><div class="results" id="Pheromone_analysis"><br />
</div></a><br />
</td><br />
<br />
<br />
</tr><br />
<tr><br />
<td colspan="3"><br />
<div align="center"><br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/eag"><div class="results" id="EAG"><br />
</div></a><br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/biosafety"><div class="results" id="Biosafe"><br />
</div></a></div><br />
</td><br />
</tr><br />
<tr><br />
<td colspan="1"><br/><a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/overview"><strong>&larr; Go to Project Overview</strong></a></td><br />
<td colspan="1" align="center"><br/><a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a></td><br />
<td colspan="1"><br/><a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/notebook"><strong>Go to Notebook &rarr;</strong></a></td><br />
</tr><br />
</table><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/EAG
Team:Valencia UPV/Project/modules/methodology/EAG
2014-10-18T03:55:42Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Electroantennogram</a></h3></p><br/></br><br />
<br />
<div align="center"><span class="coda"><roja>E</roja>lectroantennogram </div><br/><br/><br />
<br />
<br />
<p class="subpart">Sesamia nonagrioides</p><br />
<p><br />
Sesamina nonagrioides (Lepidoptera: Nocturnidae) or the corn stalk borer is an important pest of corn in Mediterranean regions and Central Africa. Feeding habitat of Sesamia larvae is the stem and the ear of a wide range of host plants, which include corn, sorghum, millet, rice, sugar cane, grasses, palms or banana [1]. </p><br/><br />
<p><br />
These moths are nocturnal, which means that their vision is limited, so males are guided to the female from relative large distance by an odour trail opposite to the wind instead of a visual orientation. Females produce and release the sexual pheromone trough a gland present in the apex of the abdomen and the essence is transported by air currents allowing male’s receptors to detect the signal and triggering a sexual motivation response. </p><br/><br />
<p> <br />
The S. Nonagrioides female sex pheromones blend consist of (Z)-11-hexadecenyl acetate, (Z)-11-hexadecen-1-ol, (Z)-11-hexadecenal and dodecyl acetate [2]. Nevertheless, they are not equally present in the female’s trace. The major component is the Z11-16:Ac, which presence is enough to trigger an attraction response in males, even though it is not the optimal chemical signal to draw male moths to the source. </p><br/><br />
<p><br />
We selected this organism to test our pheromone since the major component of the female’s pheromone blend coincides with one of the target component that The Sexy Plant is able to produce<br />
</p><br/><br/><br />
<br />
<p class="subpart">Electroantennogram (EAG)</p><br />
<br />
<pEAG is a detection system that records the potential difference that arises from an exposure to a chemical signal. It detects and measures the quantitative and qualitative response of insect antennal receptor cells to a particular biologically active compound employing a moth antenna. The antenna is the site of olfaction of the moth, composed by antennal receptors which are very sensitive and specific so they enable perception and recognition of particular odours. In this case a male’s moth antenna is used because male moths are capable of receive and process the essence that female emit into the environment. The pheromone stimulus exerts a determined electrical response which is registered and quantified in volts. </p><br/><br/><br/><br />
<br />
<p>EAG consists of a circuit and two electrodes connected to an amplifier which is closed by means of the moth antenna. A continuous clear air flow is blown over the antenna at a constant rate and the samples to be analysed are introduced inside the air stream. Once the stimulus is exerted to the antenna, for example the pheromone, it is locked on the antenna receptors, a signal transduction cascade is initiated and it is converted to an electrical impulse, which is registered [4]. As a result, base line undergoes an up and down or derivation, similar to those shown in an electrocardiogram. Different compounds elicit different electrophysiological responses but concentration could vary the registry, too. The characterization of DNA parts involved in pheromone biosynthesis was made by transient gene expression in <i>N. benthamiana</i> coupled to Electroantennography (NBTE-AEG). The volatiles synthesized by the Sexy Plant were puffed into the odour delivery system and the electrical response was registred.</p><br/><br/><br />
<br />
<br />
<div align="center"><img width="550px" src="https://static.igem.org/mediawiki/2014/e/ef/VUPV_EAG1.png" alt="solid_phase_extraction" title="EAG Diagram"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 1</b>. EAG Diagram</p></div><br/><br />
<br />
<br />
<p>Our moths were immobilized and the antennas were cut or detached from the male. Then, terminal ends of the antenna were cut and the resulting antenna fragment was placed in the electrodes. A small amount of each sample (1 ug) was loaded onto small pieces of filter paper inside the wide section of a Pasteur pipette. </p><br/><br/><br />
<br />
<div align="center"><img width="550px" src="https://static.igem.org/mediawiki/2014/2/2a/VUPV_Eag_foto.png" alt="solid_phase_extraction" title="Antenna in contact with both electrodes "></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 2</b>. Antenna in contact with both electrodes </p></div><br/><br />
<br />
<div align="center"><img width="550px" src="https://static.igem.org/mediawiki/2014/8/89/VUPU_EAGinst.jpg" alt="solid_phase_extraction" title=" EAG instrument. "></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 4</b>. EAG instrument.</p></div><br/><br />
<br />
<br />
<br />
<p>The characterization of DNA parts involved in pheromone biosynthesis was made by transient gene expression in N. benthamiana coupled to Electroantennography (NBTE-AEG). The volatiles synthesized by the Sexy Plant were puffed into a device containing two small electrodes connected by a moth ́s antenna. Specific receptors in the antenna respond to the pheromones producing a measurable electric output. The volatiles in our Sexy Plants induced detectable electric pulses that could indicate a pheromone response, although further testing will be required for confirmation.</p><br/><br/><br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/dynamic_headspace"><strong>&larr; Go to Sampling Technique</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/windtunnel"><strong>Go to Wind Tunnel Assay &rarr;</strong></a></div><br/><br/><br/><br/><br />
<br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Eizaguirre M, Fantinou AA (2011) Abundance of Sesamia nonagrioides (Lef.) (Lepidoptera: Noctuidae) on the Edge of the Mediterranean Basin. Psyche vol. 2012 (ID 854045) 7 pages doi:10.1155/2012/854045 </li><br/><br />
<li>Eizaguirre M, Albajes R, López C, Sans A, Gemeno (2007) Inhibition of pheromone response in Sesamia nonagrioides by the pheromone of the sympatric corn borer, Ostrinia nubilalis. Pest Manag Sci 63:608-614.</li><br />
<li>Howse P, Stevens I, Jones O (2004) Feromonas de insectos y su uso en el control de plagas. Davince (first edition)Traduced by Gil-Ruíz P.</li><br />
<li>Gullan PJ, Cranston S (2014) The insects: An Outline of Enthomology. Wiley-Blackwell.</li> <br />
</ol><br/><br/><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/eag
Team:Valencia UPV/Project/eag
2014-10-18T03:54:25Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results">Results</a> > <a>Electroantennography</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>E</roja>lectroantennography</span> </div><br/><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/f3/VUPVIMG_20141006_135403.jpg" alt="EAG_1"></img><br />
<p>As explained in the methodology section (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/EAG" class="normal-link-page">see Methodology: Electroantennography</a>) we performed an electroantennography (EAG) to test the moth response to pheromones. Insects can detect pheromones through their antennae, then an electrical impulse is transmitted from them to the brain in order to trigger moth response to the pheromones. The EAG allows us to detect these electrical impulses by connecting one insect antenna to two electrodes that will amplify this impulse in order to be detected.</p><br/><br/><br />
<br />
<p>We connected one antenna from a male moth, Sesamia nonagrioides , with the two electrodes. Then , an air current with a leaf extract containing our pheromones was applied (Figure 3. Signal 1). As it can be appreciated, as the extract was applied the antenna transmitted an electrical impulse. This was the moth response to our insect pheromones produced in plant.</p><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 1</span>. Side view of an insect antenna connected to EAG electrodes.</p><br/><br />
<br />
</div><br />
<br />
<div><img style="float:left; margin-right: 15px;" width="300px" src="https://static.igem.org/mediawiki/2014/6/69/VUPVIMG_4156.JPG" alt="EAG_2"></img></div><br/><br />
<br />
<br />
<p><br/><br/>As a control, we also applied an air current with no pheromones in suspension. (Figure 3. Signal 2) The antena did not transmit any electrical signal.</p><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 2</span>. Upper view of an insect antenna connected to EAG electrodes .</p><br/><br />
<br/><br/><br/><br/><br/><br/><br/><br />
<br />
<div align="center"><img width="500px" src="https://static.igem.org/mediawiki/2014/5/53/VUPVEAGi.png" alt="EAG"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 3</span>. Electroantennography analysis of Sesamia nonagroides response to sexual pheromones produced in genetically engineered Nicotiana Benthamiana plants. Signal1: Antennal response to the Sexy Plant leaf extract. Signal 2: Antennal response to an air puff.</p></div><br/><br />
<br />
<p>The volatiles in our Sexy Plants induced detectable electric pulses that could indicate a pheromone response, although further testing will be required for confirmation.</p><br/><br/><br />
<br />
<br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results/pheromone_analysis"><strong>&larr; Go to Pheromone Analysis</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results"><strong>Go to Results</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results/biosafety"><strong>Go to Biosafety &rarr;</strong></a></div></br></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/eag
Team:Valencia UPV/Project/eag
2014-10-18T03:53:50Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results">Results</a> > <a>Electroantennography</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>E</roja>lectroantennography</span> </div><br/><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/f3/VUPVIMG_20141006_135403.jpg" alt="EAG_1"></img><br />
<p>As explained in the methodology section (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology" class="normal-link-page">see Methodology: Electroantennography</a>) we performed an electroantennography (EAG) to test the moth response to pheromones. Insects can detect pheromones through their antennae, then an electrical impulse is transmitted from them to the brain in order to trigger moth response to the pheromones. The EAG allows us to detect these electrical impulses by connecting one insect antenna to two electrodes that will amplify this impulse in order to be detected.</p><br/><br/><br />
<br />
<p>We connected one antenna from a male moth, Sesamia nonagrioides , with the two electrodes. Then , an air current with a leaf extract containing our pheromones was applied (Figure 3. Signal 1). As it can be appreciated, as the extract was applied the antenna transmitted an electrical impulse. This was the moth response to our insect pheromones produced in plant.</p><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 1</span>. Side view of an insect antenna connected to EAG electrodes.</p><br/><br />
<br />
</div><br />
<br />
<div><img style="float:left; margin-right: 15px;" width="300px" src="https://static.igem.org/mediawiki/2014/6/69/VUPVIMG_4156.JPG" alt="EAG_2"></img></div><br/><br />
<br />
<br />
<p><br/><br/>As a control, we also applied an air current with no pheromones in suspension. (Figure 3. Signal 2) The antena did not transmit any electrical signal.</p><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 2</span>. Upper view of an insect antenna connected to EAG electrodes .</p><br/><br />
<br/><br/><br/><br/><br/><br/><br/><br />
<br />
<div align="center"><img width="500px" src="https://static.igem.org/mediawiki/2014/5/53/VUPVEAGi.png" alt="EAG"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 3</span>. Electroantennography analysis of Sesamia nonagroides response to sexual pheromones produced in genetically engineered Nicotiana Benthamiana plants. Signal1: Antennal response to the Sexy Plant leaf extract. Signal 2: Antennal response to an air puff.</p></div><br/><br />
<br />
<p>The volatiles in our Sexy Plants induced detectable electric pulses that could indicate a pheromone response, although further testing will be required for confirmation.</p><br/><br/><br />
<br />
<br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results/pheromone_analysis"><strong>&larr; Go to Pheromone Analysis</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results"><strong>Go to Results</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results/biosafety"><strong>Go to Biosafety &rarr;</strong></a></div></br></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Achievements
Team:Valencia UPV/Achievements
2014-10-18T03:42:26Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Achievements</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>chievements</span> </div><br/><br/><br />
<br />
<p>As it can bee observed surfing our wiki, at the end of this long road we have accomplished many positive results:</p><br />
</br><br />
<p><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A plant able to produce three insect sexual pheromones from moths to produce insects mating disruption, the Sexy Plant.:</a> <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/pheromone_analysis" class="normal-link-page">Results: Pheromone analysis</a><br />
<br />
<ul><br />
<li>Obtained pheromones being among the most abundant plant organic volatile compounds.<span class="red-bold"> (Z)-11-hexadecen-1-ol</span> is certainly the most abundant one.</li><br />
<li>Successful and functional assembly of each of the pheromone biosynthetic genes with the plant constitutive promoter P35S. Also multigenic assembly of all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosyn" class="normal-link-page"> Results: Constructs-Biosynthesis</a></li><br />
<li>Proof of our produced pheromones-insect interaction. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/eag" class="normal-link-page">Results: Electroantennography</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A broad understanding of plant metabolism, by adapting and exploitation of a genome-scale model of Arabidopsis thaliana primary metabolism able to help us theoretically optimize the pheromone production </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/fba" class="normal-link-page"> Modeling: Pheromone Production</a><br />
<ul><br />
<li>Adapting the AraGEM genome-scale model to our pheromone production pathway by branching the flux of our precursor metabolite Palmitic acid (16:0).</li><br />
<li>Identifying the principal: i) cell compartments and scenarios of the plant metabolism, ii) flux bounds and constraints for each scenario, and iii) the interactions between chemical reactions and substrates related to our pheromone. </li><br />
<li>Exploring genetic conditions that could improve our pheromone production by Single gene Knock-out analysis. </li><br />
<li>Obtaining optimal condition for the coupled yield of pheromone and biomass production as a function of photons consumption.</li> <br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<br />
<br />
<p><br />
<ul class="method"><br />
<li><a class="black-bold">A plant potentially able to release the produced pheromones into the environment.</a><br />
<br />
<ul><br />
<li>Successful cloning of a trichome-specific promoter (PCPS2) from the genome of <i>N. tabacum</i> and subsequent assembly with GFP as a reporter. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></li><br />
<li>Proof of the specificity of this promoter by GFP fluorescence detection. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression" class="normal-link-page">Results: Trichome-specific expression</a></li><br />
<li>Assembly of each gene of the pheromones production pathway with PCPS2 promoter and multigenic assembly with all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A Simulation Environment for the pheromone diffusion and moth response behaviour to help us decide where and how much sexy plants we should put in the field. </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/diffusion" class="normal-link-page"> Modeling: Pheromone Diffusion and Moths Response</a><br />
<ul><br />
<li>Implementing an approximation of the diffusion process by the heat diffusion equation and its numerical solution.</li><br />
<li>Incorporating an approximation of the moth response behavior including female pheromone release into the environment, and male pheromone concentration sensitivity (that allows the male to follow the trace of females).</li><br />
<li>Adding our sexy plants that produce and release pheromone triggering <i>mating disruption</i>.</li><br />
<li>Designing a simulation platform available to community that is useful for exploration of parameters and scenarios related with chemical ecology models.</li><br />
</ul><br />
</li><br />
</p><br />
<br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A genetic switch able to control gene expression ready to be implemented in the plant. Results: Constructs-Switch</a><br />
<br />
<ul><br />
<li>Cloning of the coding sequence from the CUP2 transcription factor from S cerevisiae and assembly with the CaMV constitutive promoter P35S. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Creation of the Cupper-responsive chimeric promoter and assembly with Firefly luciferase gene as a reporter, P19 as a gene silencing suppressor, and Renilla luciferase as control for Luciferase expression assay. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Multigenic assembly comprising the CUP2 transcriptional unit with the chimeric promoter and reporter gene assembly. <br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A sterile and dark purple plant safe for living beings and the environment.<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety" class="normal-link-page">Biosafety</a><br />
<br />
<ul><br />
<li>Multigenic assembly of two biosafety devices, comprising the Barnase (male-sterility) with one chromoprotein in each device, AmilCP or AmilGFP (identity preservation). <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosafe" class="normal-link-page"> Results: Constructs-Biosafety</a></li><br />
<li>Purple plant to preserve its identity expressing SlANT1 and SlJAF13 transcription factors. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/biosafety" class="normal-link-page"> Results: Biosafety</a></li><br />
<br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<p><br />
<a class="black-bold">Diffusion and communication of the project with involved experts and stakeholders.<a href="https://2014.igem.org/Team:Valencia_UPV/policy/activities" class="normal-link-page"> Policy and Practices</a></a> <br />
</p><br />
<br />
</p><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Achievements
Team:Valencia UPV/Achievements
2014-10-18T03:41:38Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Achievements</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>chievements</span> </div><br/><br/><br />
<br />
<p>As it can bee observed surfing our wiki, at the end of this long road we have accomplished many positive results:</p><br />
</br><br />
<p><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A plant able to produce three insect sexual pheromones from moths to produce insects mating disruption, the Sexy Plant.:</a> <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/pheromone_analysis" class="normal-link-page">Results: Pheromone analysis</a><br />
<br />
<ul><br />
<li>Obtained pheromones being among the most abundant plant organic volatile compounds.<span class="red-bold"> (Z)-11-hexadecen-1-ol</span> is certainly the most abundant one.</li><br />
<li>Successful and functional assembly of each of the pheromone biosynthetic genes with the plant constitutive promoter P35S. Also multigenic assembly of all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosyn" class="normal-link-page">Results: Constructs-Biosynthesis</a></li><br />
<li>Proof of our produced pheromones-insect interaction. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/eag" class="normal-link-page">Results: Electroantennography</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A broad understanding of plant metabolism, by adapting and exploitation of a genome-scale model of Arabidopsis thaliana primary metabolism able to help us theoretically optimize the pheromone production </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/fba" class="normal-link-page"> Modeling: Pheromone Production</a><br />
<ul><br />
<li>Adapting the AraGEM genome-scale model to our pheromone production pathway by branching the flux of our precursor metabolite Palmitic acid (16:0).</li><br />
<li>Identifying the principal: i) cell compartments and scenarios of the plant metabolism, ii) flux bounds and constraints for each scenario, and iii) the interactions between chemical reactions and substrates related to our pheromone. </li><br />
<li>Exploring genetic conditions that could improve our pheromone production by Single gene Knock-out analysis. </li><br />
<li>Obtaining optimal condition for the coupled yield of pheromone and biomass production as a function of photons consumption.</li> <br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<br />
<br />
<p><br />
<ul class="method"><br />
<li><a class="black-bold">A plant potentially able to release the produced pheromones into the environment.</a><br />
<br />
<ul><br />
<li>Successful cloning of a trichome-specific promoter (PCPS2) from the genome of <i>N. tabacum</i> and subsequent assembly with GFP as a reporter. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></li><br />
<li>Proof of the specificity of this promoter by GFP fluorescence detection. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression" class="normal-link-page">Results: Trichome-specific expression</a></li><br />
<li>Assembly of each gene of the pheromones production pathway with PCPS2 promoter and multigenic assembly with all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A Simulation Environment for the pheromone diffusion and moth response behaviour to help us decide where and how much sexy plants we should put in the field. </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/diffusion" class="normal-link-page"> Modeling: Pheromone Diffusion and Moths Response</a><br />
<ul><br />
<li>Implementing an approximation of the diffusion process by the heat diffusion equation and its numerical solution.</li><br />
<li>Incorporating an approximation of the moth response behavior including female pheromone release into the environment, and male pheromone concentration sensitivity (that allows the male to follow the trace of females).</li><br />
<li>Adding our sexy plants that produce and release pheromone triggering <i>mating disruption</i>.</li><br />
<li>Designing a simulation platform available to community that is useful for exploration of parameters and scenarios related with chemical ecology models.</li><br />
</ul><br />
</li><br />
</p><br />
<br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A genetic switch able to control gene expression ready to be implemented in the plant. Results: Constructs-Switch</a><br />
<br />
<ul><br />
<li>Cloning of the coding sequence from the CUP2 transcription factor from S cerevisiae and assembly with the CaMV constitutive promoter P35S. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Creation of the Cupper-responsive chimeric promoter and assembly with Firefly luciferase gene as a reporter, P19 as a gene silencing suppressor, and Renilla luciferase as control for Luciferase expression assay.<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Multigenic assembly comprising the CUP2 transcriptional unit with the chimeric promoter and reporter gene assembly. <br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A sterile and dark purple plant safe for living beings and the environment.<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety" class="normal-link-page">Biosafety</a><br />
<br />
<ul><br />
<li>Multigenic assembly of two biosafety devices, comprising the Barnase (male-sterility) with one chromoprotein in each device, AmilCP or AmilGFP (identity preservation). <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosafe" class="normal-link-page"> Results: Constructs-Biosafety</a></li><br />
<li>Purple plant to preserve its identity expressing SlANT1 and SlJAF13 transcription factors. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/biosafety" class="normal-link-page"> Results: Biosafety</a></li><br />
<br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<p><br />
<a class="black-bold">Diffusion and communication of the project with involved experts and stakeholders.<a href="https://2014.igem.org/Team:Valencia_UPV/policy/activities" class="normal-link-page"> Policy and Practices</a></a> <br />
</p><br />
<br />
</p><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Achievements
Team:Valencia UPV/Achievements
2014-10-18T03:40:55Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Achievements</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>chievements</span> </div><br/><br/><br />
<br />
<p>As it can bee observed surfing our wiki, at the end of this long road we have accomplished many positive results:</p><br />
</br><br />
<p><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A plant able to produce three insect sexual pheromones from moths to produce insects mating disruption, the Sexy Plant.:</a> <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/pheromone_analysis" class="normal-link-page">Results: Pheromone analysis</a><br />
<br />
<ul><br />
<li>Obtained pheromones being among the most abundant plant organic volatile compounds.<span class="red-bold"> (Z)-11-hexadecen-1-ol</span> is certainly the most abundant one.</li><br />
<li>Successful and functional assembly of each of the pheromone biosynthetic genes with the plant constitutive promoter P35S. Also multigenic assembly of all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosyn" class="normal-link-page">Results: Constructs-Biosynthesis</a></li><br />
<li>Proof of our produced pheromones-insect interaction. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/eag" class="normal-link-page">Results: Electroantennography</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A broad understanding of plant metabolism, by adapting and exploitation of a genome-scale model of Arabidopsis thaliana primary metabolism able to help us theoretically optimize the pheromone production </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/fba" class="normal-link-page"> Modeling: Pheromone Production</a><br />
<ul><br />
<li>Adapting the AraGEM genome-scale model to our pheromone production pathway by branching the flux of our precursor metabolite Palmitic acid (16:0).</li><br />
<li>Identifying the principal: i) cell compartments and scenarios of the plant metabolism, ii) flux bounds and constraints for each scenario, and iii) the interactions between chemical reactions and substrates related to our pheromone. </li><br />
<li>Exploring genetic conditions that could improve our pheromone production by Single gene Knock-out analysis. </li><br />
<li>Obtaining optimal condition for the coupled yield of pheromone and biomass production as a function of photons consumption.</li> <br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<br />
<br />
<p><br />
<ul class="method"><br />
<li><a class="black-bold">A plant potentially able to release the produced pheromones into the environment.</a><br />
<br />
<ul><br />
<li>Successful cloning of a trichome-specific promoter (PCPS2) from the genome of <i>N. tabacum</i> and subsequent assembly with GFP as a reporter. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></li><br />
<li>Proof of the specificity of this promoter by GFP fluorescence detection. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression" class="normal-link-page">Results: Trichome-specific expression</a></li><br />
<li>Assembly of each gene of the pheromones production pathway with PCPS2 promoter and multigenic assembly with all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A Simulation Environment for the pheromone diffusion and moth response behaviour to help us decide where and how much sexy plants we should put in the field. </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/diffusion" class="normal-link-page"> Modeling: Pheromone Diffusion and Moths Response</a><br />
<ul><br />
<li>Implementing an approximation of the diffusion process by the heat diffusion equation and its numerical solution.</li><br />
<li>Incorporating an approximation of the moth response behavior including female pheromone release into the environment, and male pheromone concentration sensitivity (that allows the male to follow the trace of females).</li><br />
<li>Adding our sexy plants that produce and release pheromone triggering <i>mating disruption</i>.</li><br />
<li>Designing a simulation platform available to community that is useful for exploration of parameters and scenarios related with chemical ecology models.</li><br />
</ul><br />
</li><br />
</p><br />
<br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A genetic switch able to control gene expression ready to be implemented in the plant. Results: Constructs-Switch</a><br />
<br />
<ul><br />
<li>Cloning of the coding sequence from the CUP2 transcription factor from S cerevisiae and assembly with the CaMV constitutive promoter P35S. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Creation of the Cupper-responsive chimeric promoter and assembly with Firefly luciferase gene as a reporter, P19 as a gene silencing suppressor, and Renilla luciferase as control for Luciferase expression assay.<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Multigenic assembly comprising the CUP2 transcriptional unit with the chimeric promoter and reporter gene assembly. <br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A sterile and dark purple plant safe for living beings and the environment.<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety" class="normal-link-page">Biosafety</a><br />
<br />
<ul><br />
<li>Multigenic assembly of two biosafety devices, comprising the Barnase (male-sterility) with one chromoprotein in each device, AmilCP or AmilGFP (identity preservation). <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosafe" class="normal-link-page">Results: Constructs-Biosafety</a></li><br />
<li>Purple plant to preserve its identity expressing SlANT1 and SlJAF13 transcription factors. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/biosafety" class="normal-link-page"> Results: Biosafety</a></li><br />
<br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<p><br />
<a class="black-bold">Diffusion and communication of the project with involved experts and stakeholders.<a href="https://2014.igem.org/Team:Valencia_UPV/policy/activities" class="normal-link-page">Policy and Practices</a></a> <br />
</p><br />
<br />
</p><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Achievements
Team:Valencia UPV/Achievements
2014-10-18T03:40:14Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Achievements</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>chievements</span> </div><br/><br/><br />
<br />
<p>As it can bee observed surfing our wiki, at the end of this long road we have accomplished many positive results:</p><br />
</br><br />
<p><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A plant able to produce three insect sexual pheromones from moths to produce insects mating disruption, the Sexy Plant.:</a> <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/pheromone_analysis" class="normal-link-page">Results: Pheromone analysis</a><br />
<br />
<ul><br />
<li>Obtained pheromones being among the most abundant plant organic volatile compounds.<span class="red-bold"> (Z)-11-hexadecen-1-ol</span> is certainly the most abundant one.</li><br />
<li>Successful and functional assembly of each of the pheromone biosynthetic genes with the plant constitutive promoter P35S. Also multigenic assembly of all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosyn" class="normal-link-page">Results: Constructs-Biosynthesis</a></li><br />
<li>Proof of our produced pheromones-insect interaction. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/eag" class="normal-link-page">Results: Electroantennography</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A broad understanding of plant metabolism, by adapting and exploitation of a genome-scale model of Arabidopsis thaliana primary metabolism able to help us theoretically optimize the pheromone production </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/fba" class="normal-link-page"> Modeling: Pheromone Production</a><br />
<ul><br />
<li>Adapting the AraGEM genome-scale model to our pheromone production pathway by branching the flux of our precursor metabolite Palmitic acid (16:0).</li><br />
<li>Identifying the principal: i) cell compartments and scenarios of the plant metabolism, ii) flux bounds and constraints for each scenario, and iii) the interactions between chemical reactions and substrates related to our pheromone. </li><br />
<li>Exploring genetic conditions that could improve our pheromone production by Single gene Knock-out analysis. </li><br />
<li>Obtaining optimal condition for the coupled yield of pheromone and biomass production as a function of photons consumption.</li> <br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<br />
<br />
<p><br />
<ul class="method"><br />
<li><a class="black-bold">A plant potentially able to release the produced pheromones into the environment.</a><br />
<br />
<ul><br />
<li>Successful cloning of a trichome-specific promoter (PCPS2) from the genome of <i>N. tabacum</i> and subsequent assembly with GFP as a reporter. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></li><br />
<li>Proof of the specificity of this promoter by GFP fluorescence detection. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression" class="normal-link-page">Results: Trichome-specific expression</a></li><br />
<li>Assembly of each gene of the pheromones production pathway with PCPS2 promoter and multigenic assembly with all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A Simulation Environment for the pheromone diffusion and moth response behaviour to help us decide where and how much sexy plants we should put in the field. </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/diffusion" class="normal-link-page"> Modeling: Pheromone Diffusion and Moths Response</a><br />
<ul><br />
<li>Implementing an approximation of the diffusion process by the heat diffusion equation and its numerical solution.</li><br />
<li>Incorporating an approximation of the moth response behavior including female pheromone release into the environment, and male pheromone concentration sensitivity (that allows the male to follow the trace of females).</li><br />
<li>Adding our sexy plants that produce and release pheromone triggering <i>mating disruption</i>.</li><br />
<li>Designing a simulation platform available to community that is useful for exploration of parameters and scenarios related with chemical ecology models.</li><br />
</ul><br />
</li><br />
</p><br />
<br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A genetic switch able to control gene expression ready to be implemented in the plant. Results: Constructs-Switch</a><br />
<br />
<ul><br />
<li>Cloning of the coding sequence from the CUP2 transcription factor from S cerevisiae and assembly with the CaMV constitutive promoter P35S. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Creation of the Cupper-responsive chimeric promoter and assembly with Firefly luciferase gene as a reporter, P19 as a gene silencing suppressor, and Renilla luciferase as control for Luciferase expression assay.<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Multigenic assembly comprising the CUP2 transcriptional unit with the chimeric promoter and reporter gene assembly. <br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A sterile and dark purple plant safe for living beings and the environment.<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety" class="normal-link-page">Biosafety</a><br />
<br />
<ul><br />
<li>Multigenic assembly of two biosafety devices, comprising the Barnase (male-sterility) with one chromoprotein in each device, AmilCP or AmilGFP (identity preservation). <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosafe" class="normal-link-page">Results: Constructs-Biosafety</a></li><br />
<li>Purple plant to preserve its identity expressing SlANT1 and SlJAF13 transcription factors. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/biosafety" class="normal-link-page">Results: Biosafety</a></li><br />
<br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<p><br />
<a class="black-bold">Diffusion and communication of the project with involved experts and stakeholders.<a href="https://2014.igem.org/Team:Valencia_UPV/policy/activities" class="normal-link-page">Policy and Practices</a></a> <br />
</p><br />
<br />
</p><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Achievements
Team:Valencia UPV/Achievements
2014-10-18T03:39:47Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Achievements</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>chievements</span> </div><br/><br/><br />
<br />
<p>As it can bee observed surfing our wiki, at the end of this long road we have accomplished many positive results:</p><br />
</br><br />
<p><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A plant able to produce three insect sexual pheromones from moths to produce insects mating disruption, the Sexy Plant.:</a> <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/pheromone_analysis" class="normal-link-page">Results: Pheromone analysis</a><br />
<br />
<ul><br />
<li>Obtained pheromones being among the most abundant plant organic volatile compounds.<span class="red-bold">(Z)-11-hexadecen-1-ol</span> is certainly the most abundant one.</li><br />
<li>Successful and functional assembly of each of the pheromone biosynthetic genes with the plant constitutive promoter P35S. Also multigenic assembly of all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosyn" class="normal-link-page">Results: Constructs-Biosynthesis</a></li><br />
<li>Proof of our produced pheromones-insect interaction. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/eag" class="normal-link-page">Results: Electroantennography</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A broad understanding of plant metabolism, by adapting and exploitation of a genome-scale model of Arabidopsis thaliana primary metabolism able to help us theoretically optimize the pheromone production </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/fba" class="normal-link-page"> Modeling: Pheromone Production</a><br />
<ul><br />
<li>Adapting the AraGEM genome-scale model to our pheromone production pathway by branching the flux of our precursor metabolite Palmitic acid (16:0).</li><br />
<li>Identifying the principal: i) cell compartments and scenarios of the plant metabolism, ii) flux bounds and constraints for each scenario, and iii) the interactions between chemical reactions and substrates related to our pheromone. </li><br />
<li>Exploring genetic conditions that could improve our pheromone production by Single gene Knock-out analysis. </li><br />
<li>Obtaining optimal condition for the coupled yield of pheromone and biomass production as a function of photons consumption.</li> <br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<br />
<br />
<p><br />
<ul class="method"><br />
<li><a class="black-bold">A plant potentially able to release the produced pheromones into the environment.</a><br />
<br />
<ul><br />
<li>Successful cloning of a trichome-specific promoter (PCPS2) from the genome of <i>N. tabacum</i> and subsequent assembly with GFP as a reporter. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></li><br />
<li>Proof of the specificity of this promoter by GFP fluorescence detection. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression" class="normal-link-page">Results: Trichome-specific expression</a></li><br />
<li>Assembly of each gene of the pheromones production pathway with PCPS2 promoter and multigenic assembly with all three transcription units in a single plasmid. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#phero" class="normal-link-page">Results: Constructs-Pheromone release</a></a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A Simulation Environment for the pheromone diffusion and moth response behaviour to help us decide where and how much sexy plants we should put in the field. </a> <a href="https://2014.igem.org/Team:Valencia_UPV/Modeling/diffusion" class="normal-link-page"> Modeling: Pheromone Diffusion and Moths Response</a><br />
<ul><br />
<li>Implementing an approximation of the diffusion process by the heat diffusion equation and its numerical solution.</li><br />
<li>Incorporating an approximation of the moth response behavior including female pheromone release into the environment, and male pheromone concentration sensitivity (that allows the male to follow the trace of females).</li><br />
<li>Adding our sexy plants that produce and release pheromone triggering <i>mating disruption</i>.</li><br />
<li>Designing a simulation platform available to community that is useful for exploration of parameters and scenarios related with chemical ecology models.</li><br />
</ul><br />
</li><br />
</p><br />
<br/><br/><br />
<br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A genetic switch able to control gene expression ready to be implemented in the plant. Results: Constructs-Switch</a><br />
<br />
<ul><br />
<li>Cloning of the coding sequence from the CUP2 transcription factor from S cerevisiae and assembly with the CaMV constitutive promoter P35S. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Creation of the Cupper-responsive chimeric promoter and assembly with Firefly luciferase gene as a reporter, P19 as a gene silencing suppressor, and Renilla luciferase as control for Luciferase expression assay.<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
<li>Multigenic assembly comprising the CUP2 transcriptional unit with the chimeric promoter and reporter gene assembly. <br />
<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#switch" class="normal-link-page">Results: Construct-Switch</a></li><br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<ul class="method"><br />
<li><a class="black-bold">A sterile and dark purple plant safe for living beings and the environment.<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety" class="normal-link-page">Biosafety</a><br />
<br />
<ul><br />
<li>Multigenic assembly of two biosafety devices, comprising the Barnase (male-sterility) with one chromoprotein in each device, AmilCP or AmilGFP (identity preservation). <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/constructs#biosafe" class="normal-link-page">Results: Constructs-Biosafety</a></li><br />
<li>Purple plant to preserve its identity expressing SlANT1 and SlJAF13 transcription factors. <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/biosafety" class="normal-link-page">Results: Biosafety</a></li><br />
<br />
</ul><br />
</li><br />
</p><br/><br/><br />
<br />
<p><br />
<a class="black-bold">Diffusion and communication of the project with involved experts and stakeholders.<a href="https://2014.igem.org/Team:Valencia_UPV/policy/activities" class="normal-link-page">Policy and Practices</a></a> <br />
</p><br />
<br />
</p><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/modules/switch
Team:Valencia UPV/Project/modules/switch
2014-10-18T03:35:05Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Switch</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>witch<roja></span> </div><br/><br />
<br />
<p class="subpart">The Idea</p><br/><br />
<br />
<p>We think it’s illogical to have the <span class="red-bold">Sexy Plant</span> continuously producing sexual pheromones. They are not required during periods with no moth presence or sexual activity, so sending resources during these moments is suboptimal for the plant’s housekeeping metabolism. For that reason, we designed a strategy to have control on the moment when the pheromone is being produced.</p><br/><br/><br />
<br />
<p class="subpart">Our Strategy</p><br/><br />
<br />
<p>We designed a <span class="black-bold">genetic switch</span> to control the <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis">production of sex pheromones</a> . Our inspiration came from previous projects in Synthetic Biology, which had already created genetic elements which resemble elements in electrical circuits, such as oscillators, memory elements or switches [1]. Our switch is only in ON mode when the plant is sprayed with CuSO4, commonly used as a fungicide and fertilizer in agriculture. This switch gives us total control over pheromone production, which will only be activated when mating season is coming.</p><br/><br/><br />
<br />
<p class="subpart">The Design</p><br/><br />
<br />
<p>Unfortunately, we can’t just tell the plant to produce or not to produce the pheromones as we would tell a person to start walking. Molecular mechanisms are required to switch ON of OFF the production. We designed a genetic switch taking the <i>Saccharomyces cerevisiae</i> CUP1 regulatory system [2] as reference. Our copper-based genetic switch is made of two parts (figure 1):</p><br/><br/><br />
<br />
<ul style="list-style: square;"><br />
<li>A first transcriptional unit (TU1) which constitutively expresses a CUP2 - Gal4 Activation Domain fusion protein. <b>CUP2</b> is a metalloresponsive transcription factor which changes conformation in the presence of copper ions and binds Upstream Activating Sequences (<b>UAS</b>) in its presence [3-5]. Gal4 Activation Domain (<b>Gal4AD</b>) stabilizes TFIID and enhances transcription [6].</li><br/><br/><br />
<li>A second transcriptional unit (TU2) expressing the gene of interest (<b>CDS</b>) under the regulation of a designed inducible promoter. The inducible promoter is formed by an <b>UAS</b> followed by the minimal cauliflower mosaic virus promoter P35s promoter (<b>mini35S</b>). A 68bp long untranslated region (<b>UTR</b>) is found between the promote and the CDS to improve mRNA stability and improve translation [7].</li><br/><br/><br />
</ul><br />
<br />
<br />
<p class="subpart">How Does It Work?</p><br/><br />
<br />
<p>CUP2-Gal4AD, the product from TU1, binds to the UAS in TU2 with its CUP2 region in the presence of copper ions due to the conformational change it suffers. Gal4AD is therefore brought close to mini35S in TU2 and enhances transcription. Transcription and therefore pheromone production will only take place at sufficient levels under the presence of copper ions (Operation in figure 1).</p><br/><br/><br />
<br />
<div align="center"><img width="450px" src="https://static.igem.org/mediawiki/2014/1/15/VUPVSwitch_figure_1.png" alt="switch" title="Genetic switch structure and operation"></img></div><br/><br />
<div align="center"><p style="text-align: justify; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 1. Genetic switch structure and operation</span>. TU1 constitutively expresses the fusion protein CUP2-Gal4AD. This protein changes conformation in the presence of copper ions (CU2+) and binds to the Upstream Activation Sequence in TU2 in the CUP2 region. Gal4AD region of the fusion protein enhances transcription in TU2 and leads to the expression of the Gene of Interest.</p></div><br/><br />
<br />
<br />
<p class="subpart">Genetic Switch in Sexy Plant</p><br/><br />
<br />
<p>This easy-to-control genetic switch is the perfect regulation for pheromone production in the Sexy Plant. It enables the user to activate production only when it’s required. Its implementation in the Sexy Plant provides a more optimal use of resources.</p><br/><br/><br/><br/><br />
<br />
<br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/release"><strong>&larr; Go to Release</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Khalil AS, Collins JJ (2010) Synthetic biology: applications come of age. Nat Rev Genet 11: 367-379.</li><br />
<li>Butt TR, Sternberg EJ, Gorman JA, Clark P, Hamer D, et al. (1984) Copper metallothionein of yeast, structure of the gene, and regulation of expression. Proc Natl Acad Sci U S A 81: 3332-3336.</li><br />
<li>Mett VL, Lochhead LP, Reynolds PH (1993) Copper-controllable gene expression system for whole plants. Proc Natl Acad Sci U S A 90: 4567-4571.</li><br />
<br />
<li>Thiele DJ (1988) ACE1 regulates expression of the Saccharomyces cerevisiae metallothionein gene. Mol Cell Biol 8: 2745-2752.</li><br />
<br />
<li>Szczypka MS, Thiele DJ (1989) A cysteine-rich nuclear protein activates yeast metallothionein gene transcription. Mol Cell Biol 9: 421-429.</li><br />
<br />
<li>Chen JL, Attardi LD, Verrijzer CP, Yokomori K, Tjian R (1994) Assembly of recombinant TFIID reveals differential coactivator requirements for distinct transcriptional activators. Cell 79: 93-105.</li><br />
<br />
<li>Kovtun AA, Shirokikh NE, Gudkov AT, Spirin AS (2007) The leader sequence of tobacco mosaic virus RNA devoid of Watson-Crick secondary structure possesses a cooperatively melted, compact conformation. Biochem Biophys Res Commun 358: 368-372.</li> <br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis
Team:Valencia UPV/Project/modules/biosynthesis
2014-10-18T03:32:33Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Pheromone Biosynthesis</a> </h3></p><br/></br><br />
<br />
<div align="center"><span class="coda"><roja>P</roja>heromone <roja>B</roja>iosynthesis</span> </div><br/><br/><br />
<br />
<p><strong>Biosynthesis</strong></p><br/><br />
<br />
<p>This is the core of our project. <span class="red-bold">Sexy Plant</span> is a pest control choice based on the production of sexual pheromones, which will confuse male insects and make them unable to find the female. For that reason, engineering the genome of <span class="italic">Nicotiana benthamiana</span> to produce a set of sexual pheromones was our priority.</p><br/><br/><br />
<br />
<p>We wanted to produce pheromones to generate mating disruption in species which cause great damage in crops, so we did some research and consulted experts in the CEQA . We also took into account that they should be species with already identified sexual pheromones as well as their biosynthetic pathways. We found the perfect group of species to fight against, Moths.</p><br/><br/><br />
<br />
<p>Sexual pheromones for a large number of moths have already been identified. Most of these species use type I pheromones. These consist of “straight-chain compounds 10-18 carbons in length with a functional group of a primary alcohol, aldehyde, or acetate ester, and usually with several double bonds” [1]. Moths de novo synthesize these pheromones in the pheromone gland (PG) through modifications of fatty acid biosynthetic pathways” [5] Three of the most commonly found major components compounds are <span class="blue-bold">Z11-16:OAc</span>, <span class="green-bold">Z11-16:Ald</span> and <span class="red-bold">Z11-16:OH</span> [1] (see figure 1). In addition, biosynthetic pathways of these pheromones had already been elucidated in some species [2-5], which was a great help to create our biosynthetic pathways.</p><br/><br/><br/><br />
<br />
<br />
<div align="center"><img width="320px" src="https://static.igem.org/mediawiki/2014/8/80/VUPVBiosynthesis_figure_1.png" alt="pheromone_structures" title="Moths Pheromones Structure"></img></div><br/><br />
<div align="center"><p style="text-align: justify; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 1. Structure of moths sexual pheromones</span>. A: Structure of <span class="red-bold">Z11-16:OH</span>. B:Structure of <span class="green-bold">Z11-16:Ald</span>. C: Structure of <span class="blue-bold">Z11-16:OAc</span>.</p></div><br/><br/><br />
<br />
<br />
<p>In previous transcriptome analysis from the moth <span class="italic">Agrotis ipsilon</span>, specific sets of enzymes were identified to be differentially expressed in the pheromone glands. These enzymes were Acetyl-CoA carboxylases, fatty acid synthases, desaturases, acyl-CoA reductases, alcohol oxidases, aldehyde reductases and acetyltransferases. They were found to be differentially expressed in the moths pheromone glands compared to the rest of the organism [5]. These results mean these enzymes are involved in pheromones biosynthesis.</p><br/><br/><br />
<br />
<p><strong>Previous approaches</strong></p><br/><br />
<br />
<p>Moth sexual pheromones had already been synthesized previously using different approaches: Hagström et al produced <span class="red-bold">Z11-16:OH</span> and <span class="green-bold">Z11-16:Ald</span> in yeast [6]. Ding et al produced <span class="blue-bold">Z11-16:OAc</span> in <span class="italic">Nicotiana benthamiana</span>, our chassis plant, by transient expression of individual enzymes [7]. However, the production of these three pheromones in plant had never been tested using an in cis multigenic construction … until we arrived.</p><br/><br/><br />
<br />
<p><strong>Our system</strong></p><br/><br />
<br />
<p>We created a plant able to synthesize sexual pheromones <span class="blue-bold">Z11-16:OAc</span>, <span class="green-bold">Z11-16:Ald</span> and <span class="red-bold">Z11-16:OH</span>, the most important ones in moths sexual behavior (see the tables 1 to 3 below). Sexy Plant expresses sets of genes which transform Palmitic Acid CoA, an abundant compound in <span class="italic">N. benthamiana</span> leaves, into these three pheromones. Depending on the pheromone to be produced, different pathways are introduced in Biobricks standard and expressed in the plant.</p><br/><br/><br />
<br />
<img width="250px" style="float:right;" src="https://static.igem.org/mediawiki/2014/3/3c/VUPVBiosynthesis_side.png" alt="plants_moths"></img><br/><br />
<br />
<p><br/>As it was done in Ding's work [7], a Δ11 desaturase from <span class="italic">Amyelois transitella</span> (accession number JX964774) and HarFAR_KKYR, an improved version of HarFAR-3 fatty acid reductase from <span class="italic">Helicoverpa armigera</span> (accession number JF709978) were expressed to produce <span class="red-bold">Z11-16:OH</span>. Additionally, 1,2-diacyl-sn-glycerol:acetyl-CoA acetyltransferase from <span class="italic">Euonymus alatus</span> (accession number GU594061) was expressed along with the other two enzymes to produce <span class="blue-bold">Z11-16:OAc</span> [7]. Inspired by Hagström approach [6], production of <span class="green-bold">Z11-16:Ald</span> could be accomplished by over expressing a fatty-acid alcohol oxidase from <span class="italic">Nicotiana benthamiana</span>. The whole biosynthetic pathway is depicted in figure 2.</p><br/><br/><br/><br/><br />
<br />
<br />
<div align="center"><img width="450px" src="https://static.igem.org/mediawiki/2014/f/fd/VUPVBiosynthesis_figure_2.png" alt="pheromone_pathway" title="Pheromones Pathway"></img></div><br/><br />
<div align="center"><p style="text-align: justify; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 2. Biosynthetic pathway of moth sexual pheromones</span>. Sexual pheromones are bordered in purple. Taking Palmitic Acid CoA (16:CoA) as substrate, the expression of the genes AtrΔ11 (Desaturase) and HarFAR (Reductase) leads to the production of <span class="red-bold">Z11-16:OH</span>. By adding the gene EaDAcT (Acetyltransferase) in the previous system, production displaced to obtaining <span class="blue-bold">Z11-16:OAc</span>. If a Alcohol Oxidase (FAO) is included instead of EaDAcT, <span class="green-bold">Z11-16:Ald</span> will be produced.</p></div><br/><br/><br />
<br />
<br />
<p><strong>Finding pests</strong></p><br/><br />
<br />
<p>Complementing our efforts to produce the pheromones, we did a thorough search in the Pherobase database (http://www.pherobase.com) with software we specifically developed for this purpose and checked which insects met the conditions both to have one of the pheromones produced by the Sexy Plant as a major pheromone component and also to be considered a plague. Results from this analysis can be found in the tables below. We can conclude that there is a large number of insects causing plagues that are affected by our pheromones.</p><br/><br/><br />
<br />
<br/><br/><br/><br />
<br />
<p>Insects attracted by <span class="green-bold">Z11-16:Ald</span> and <span class="red-bold">Z11-16:OH</span></p><hr/><br/><br/><br />
<br />
<div align="center"><table class="normal-table"><br />
<br />
<tr><br />
<th>Importance</th><br />
<th>Insect</th><br />
<th>Plague</th><br />
</tr><br />
<br />
<tr><br />
<td>High</td><br />
<td>Helicoverpa armigera</td><br />
<td>Many crops, cotton, ornamentals, fruit trees...</td><br />
</tr><br />
<br />
<tr><br />
<td>High</td><br />
<td>Helicoverpa zea</td><br />
<td>Many crops, cotton, linum...</td><br />
</tr><br />
<br />
<tr><br />
<td>High</td><br />
<td>Heliothis peltigera</td><br />
<td>Cotton</td><br />
</tr><br />
<br />
<tr><br />
<td>High</td><br />
<td>Heliothis virescens</td><br />
<td>Many crops, cotton, tobacco, fruit trees...</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Gortyna xanthenes</td><br />
<td>Artichoke (Comunidad Valenciana)</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Platyptilia carduidactyla</td><br />
<td>Artichoke</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Diatraea considerata</td><br />
<td>Sugar cane</td><br />
</tr><br />
<br />
</table></div><br/><br/><br/><br/><br />
<br />
<p>Insects attracted by <span class="blue-bold">Z11-16:OAc</span> and <span class="red-bold">Z11-16:OH</span></p><hr/><br/><br/><br />
<br />
<div align="center"><table class="normal-table"><br />
<br />
<tr><br />
<th>Importance</th><br />
<th>Insect</th><br />
<th>Plague</th><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Crocidolomia binotalis</td><br />
<td>Cabbage</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Mamestra brassicae</td><br />
<td>Coliflower</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Feltia jaculifera</td><br />
<td>Maize, sorghum</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Euxoa messoria</td><br />
<td>Apple, cultivated vegetables, flowers...</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Sesamia calamistis</td><br />
<td>Sugar cane</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Platyptilia carduidactyla</td><br />
<td>Maize</td><br />
</tr><br />
<br />
</table></div><br/><br/><br/><br/><br />
<br />
<p>Insects attracted by <span class="red-bold">Z11-16:OH</span></p><hr/><br/><br/><br />
<br />
<div align="center"><table class="normal-table"><br />
<br />
<tr><br />
<th>Importance</th><br />
<th>Insect</th><br />
<th>Plague</th><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Chilo zacconius</td><br />
<td>Rice</td><br />
</tr><br />
<br />
</table></div><br/><br/><br/><br/><br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior"><strong>&larr; Go to Moths Behaviour</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/release"><strong>Go to Release &rarr;</strong></a></div></br></br></br><br/><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Matsumoto S (2010) Molecular Mechanisms Underlying Sex Pheromone Production in Moths. Bioscience, Biotechnology, and Biochemistry 74: 223-231.</li><br />
<li>Choi M-Y, Han KS, Boo KS, Jurenka RA (2002) Pheromone biosynthetic pathways in the moths Helicoverpa zea and Helicoverpa assulta. Insect Biochemistry and Molecular Biology 32: 1353-1359.</li><br />
<li>Wang H-L, Zhao C-H, Wang C-Z (2005) Comparative study of sex pheromone composition and biosynthesis in Helicoverpa armigera, H. assulta and their hybrid. Insect Biochemistry and Molecular Biology 35: 575-583.</li><br />
<li>Fu X, Fukuzawa M, Tabata J, Tatsuki S, Ishikawa Y (2005) Sex pheromone biosynthesis in Ostrinia zaguliaevi, a congener of the European corn borer moth O. nubilalis. Insect Biochemistry and Molecular Biology 35: 621-626.</li><br />
<br />
<li>Gu S-H, Wu K-M, Guo Y-Y, Pickett J, Field L, et al. (2013) Identification of genes expressed in the sex pheromone gland of the black cutworm Agrotis ipsilon with putative roles in sex pheromone biosynthesis and transport. BMC Genomics 14: 636.</li><br />
<li>Hagström A, Wang H-L, Lienard M, Lassance J-M, Johansson T, et al. (2013) A moth pheromone brewery: production of (Z)-11-hexadecenol by heterologous co-expression of two biosynthetic genes from a noctuid moth in a yeast cell factory. Microbial Cell Factories 12: 125.</li> <br />
<li>Ding BJ, Hofvander P, Wang HL, Durrett TP, Stymne S, et al. (2014) A plant factory for moth pheromone production. Nat Commun 5: 3353.</li> <br />
</ol><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis
Team:Valencia UPV/Project/modules/biosynthesis
2014-10-18T03:31:56Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Pheromone Biosynthesis</a> </h3></p><br/></br><br />
<br />
<div align="center"><span class="coda"><roja>P</roja>heromone <roja>B</roja>iosynthesis</span> </div><br/><br/><br />
<br />
<p><strong>Biosynthesis</strong></p><br/><br />
<br />
<p>This is the core of our project. <span class="red-bold">Sexy Plant</span> is a pest control choice based on the production of sexual pheromones, which will confuse male insects and make them unable to find the female. For that reason, engineering the genome of <span class="italic">Nicotiana benthamiana</span> to produce a set of sexual pheromones was our priority.</p><br/><br/><br />
<br />
<p>We wanted to produce pheromones to generate mating disruption in species which cause great damage in crops, so we did some research and consulted experts in the CEQA . We also took into account that they should be species with already identified sexual pheromones as well as their biosynthetic pathways. We found the perfect group of species to fight against, Moths.</p><br/><br/><br />
<br />
<p>Sexual pheromones for a large number of moths have already been identified. Most of these species use type I pheromones. These consist of “straight-chain compounds 10-18 carbons in length with a functional group of a primary alcohol, aldehyde, or acetate ester, and usually with several double bonds” [1]. Moths de novo synthesize these pheromones in the pheromone gland (PG) through modifications of fatty acid biosynthetic pathways” [5] Three of the most commonly found major components compounds are <span class="blue-bold">Z11-16:OAc</span>, <span class="green-bold">Z11-16:Ald</span> and <span class="red-bold">Z11-16:OH</span> [1] (see figure 1). In addition, biosynthetic pathways of these pheromones had already been elucidated in some species [2-5], which was a great help to create our biosynthetic pathways.</p><br/><br/><br/><br />
<br />
<br />
<div align="center"><img width="320px" src="https://static.igem.org/mediawiki/2014/8/80/VUPVBiosynthesis_figure_1.png" alt="pheromone_structures" title="Moths Pheromones Structure"></img></div><br/><br />
<div align="center"><p style="text-align: justify; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 1. Structure of moths sexual pheromones</span>. A: Structure of <span class="red-bold">Z11-16:OH</span>. B:Structure of <span class="green-bold">Z11-16:Ald</span>. C: Structure of <span class="blue-bold">Z11-16:OAc</span>.</p></div><br/><br/><br />
<br />
<br />
<p>In previous transcriptome analysis from the moth <span class="italic">Agrotis ipsilon</span>, specific sets of enzymes were identified to be differentially expressed in the pheromone glands. These enzymes were Acetyl-CoA carboxylases, fatty acid synthases, desaturases, acyl-CoA reductases, alcohol oxidases, aldehyde reductases and acetyltransferases. They were found to be differentially expressed in the moths pheromone glands compared to the rest of the organism [5]. These results mean these enzymes are involved in pheromones biosynthesis.</p><br/><br/><br />
<br />
<p><strong>Previous approaches</strong></p><br/><br />
<br />
<p>Moth sexual pheromones had already been synthesized previously using different approaches: Hagström et al produced <span class="red-bold">Z11-16:OH</span> and <span class="green-bold">Z11-16:Ald</span> in yeast [6]. Ding et al produced <span class="blue-bold">Z11-16:OAc</span> in <span class="italic">Nicotiana benthamiana</span>, our chassis plant, by transient expression of individual enzymes [7]. However, the production of these three pheromones in plant had never been tested using an in cis multigenic construction … until we arrived.</p><br/><br/><br />
<br />
<p><strong>Our system</strong></p><br/><br />
<br />
<p>We created a plant able to synthesize sexual pheromones <span class="blue-bold">Z11-16:OAc</span>, <span class="green-bold">Z11-16:Ald</span> and <span class="red-bold">Z11-16:OH</span>, the most important ones in moths sexual behavior (see the tables 1 to 3 below). Sexy Plant expresses sets of genes which transform Palmitic Acid CoA, an abundant compound in <span class="italic">N. benthamiana</span> leafs, into these three pheromones. Depending on the pheromone to be produced, different pathways are introduced in Biobricks standard and expressed in the plant.</p><br/><br/><br />
<br />
<img width="250px" style="float:right;" src="https://static.igem.org/mediawiki/2014/3/3c/VUPVBiosynthesis_side.png" alt="plants_moths"></img><br/><br />
<br />
<p><br/>As it was done in Ding's work [7], a Δ11 desaturase from <span class="italic">Amyelois transitella</span> (accession number JX964774) and HarFAR_KKYR, an improved version of HarFAR-3 fatty acid reductase from <span class="italic">Helicoverpa armigera</span> (accession number JF709978) were expressed to produce <span class="red-bold">Z11-16:OH</span>. Additionally, 1,2-diacyl-sn-glycerol:acetyl-CoA acetyltransferase from <span class="italic">Euonymus alatus</span> (accession number GU594061) was expressed along with the other two enzymes to produce <span class="blue-bold">Z11-16:OAc</span> [7]. Inspired by Hagström approach [6], production of <span class="green-bold">Z11-16:Ald</span> could be accomplished by over expressing a fatty-acid alcohol oxidase from <span class="italic">Nicotiana benthamiana</span>. The whole biosynthetic pathway is depicted in figure 2.</p><br/><br/><br/><br/><br />
<br />
<br />
<div align="center"><img width="450px" src="https://static.igem.org/mediawiki/2014/f/fd/VUPVBiosynthesis_figure_2.png" alt="pheromone_pathway" title="Pheromones Pathway"></img></div><br/><br />
<div align="center"><p style="text-align: justify; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 2. Biosynthetic pathway of moth sexual pheromones</span>. Sexual pheromones are bordered in purple. Taking Palmitic Acid CoA (16:CoA) as substrate, the expression of the genes AtrΔ11 (Desaturase) and HarFAR (Reductase) leads to the production of <span class="red-bold">Z11-16:OH</span>. By adding the gene EaDAcT (Acetyltransferase) in the previous system, production displaced to obtaining <span class="blue-bold">Z11-16:OAc</span>. If a Alcohol Oxidase (FAO) is included instead of EaDAcT, <span class="green-bold">Z11-16:Ald</span> will be produced.</p></div><br/><br/><br />
<br />
<br />
<p><strong>Finding pests</strong></p><br/><br />
<br />
<p>Complementing our efforts to produce the pheromones, we did a thorough search in the Pherobase database (http://www.pherobase.com) with software we specifically developed for this purpose and checked which insects met the conditions both to have one of the pheromones produced by the Sexy Plant as a major pheromone component and also to be considered a plague. Results from this analysis can be found in the tables below. We can conclude that there is a large number of insects causing plagues that are affected by our pheromones.</p><br/><br/><br />
<br />
<br/><br/><br/><br />
<br />
<p>Insects attracted by <span class="green-bold">Z11-16:Ald</span> and <span class="red-bold">Z11-16:OH</span></p><hr/><br/><br/><br />
<br />
<div align="center"><table class="normal-table"><br />
<br />
<tr><br />
<th>Importance</th><br />
<th>Insect</th><br />
<th>Plague</th><br />
</tr><br />
<br />
<tr><br />
<td>High</td><br />
<td>Helicoverpa armigera</td><br />
<td>Many crops, cotton, ornamentals, fruit trees...</td><br />
</tr><br />
<br />
<tr><br />
<td>High</td><br />
<td>Helicoverpa zea</td><br />
<td>Many crops, cotton, linum...</td><br />
</tr><br />
<br />
<tr><br />
<td>High</td><br />
<td>Heliothis peltigera</td><br />
<td>Cotton</td><br />
</tr><br />
<br />
<tr><br />
<td>High</td><br />
<td>Heliothis virescens</td><br />
<td>Many crops, cotton, tobacco, fruit trees...</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Gortyna xanthenes</td><br />
<td>Artichoke (Comunidad Valenciana)</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Platyptilia carduidactyla</td><br />
<td>Artichoke</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Diatraea considerata</td><br />
<td>Sugar cane</td><br />
</tr><br />
<br />
</table></div><br/><br/><br/><br/><br />
<br />
<p>Insects attracted by <span class="blue-bold">Z11-16:OAc</span> and <span class="red-bold">Z11-16:OH</span></p><hr/><br/><br/><br />
<br />
<div align="center"><table class="normal-table"><br />
<br />
<tr><br />
<th>Importance</th><br />
<th>Insect</th><br />
<th>Plague</th><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Crocidolomia binotalis</td><br />
<td>Cabbage</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Mamestra brassicae</td><br />
<td>Coliflower</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Feltia jaculifera</td><br />
<td>Maize, sorghum</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Euxoa messoria</td><br />
<td>Apple, cultivated vegetables, flowers...</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Sesamia calamistis</td><br />
<td>Sugar cane</td><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Platyptilia carduidactyla</td><br />
<td>Maize</td><br />
</tr><br />
<br />
</table></div><br/><br/><br/><br/><br />
<br />
<p>Insects attracted by <span class="red-bold">Z11-16:OH</span></p><hr/><br/><br/><br />
<br />
<div align="center"><table class="normal-table"><br />
<br />
<tr><br />
<th>Importance</th><br />
<th>Insect</th><br />
<th>Plague</th><br />
</tr><br />
<br />
<tr><br />
<td>Medium</td><br />
<td>Chilo zacconius</td><br />
<td>Rice</td><br />
</tr><br />
<br />
</table></div><br/><br/><br/><br/><br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior"><strong>&larr; Go to Moths Behaviour</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/release"><strong>Go to Release &rarr;</strong></a></div></br></br></br><br/><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Matsumoto S (2010) Molecular Mechanisms Underlying Sex Pheromone Production in Moths. Bioscience, Biotechnology, and Biochemistry 74: 223-231.</li><br />
<li>Choi M-Y, Han KS, Boo KS, Jurenka RA (2002) Pheromone biosynthetic pathways in the moths Helicoverpa zea and Helicoverpa assulta. Insect Biochemistry and Molecular Biology 32: 1353-1359.</li><br />
<li>Wang H-L, Zhao C-H, Wang C-Z (2005) Comparative study of sex pheromone composition and biosynthesis in Helicoverpa armigera, H. assulta and their hybrid. Insect Biochemistry and Molecular Biology 35: 575-583.</li><br />
<li>Fu X, Fukuzawa M, Tabata J, Tatsuki S, Ishikawa Y (2005) Sex pheromone biosynthesis in Ostrinia zaguliaevi, a congener of the European corn borer moth O. nubilalis. Insect Biochemistry and Molecular Biology 35: 621-626.</li><br />
<br />
<li>Gu S-H, Wu K-M, Guo Y-Y, Pickett J, Field L, et al. (2013) Identification of genes expressed in the sex pheromone gland of the black cutworm Agrotis ipsilon with putative roles in sex pheromone biosynthesis and transport. BMC Genomics 14: 636.</li><br />
<li>Hagström A, Wang H-L, Lienard M, Lassance J-M, Johansson T, et al. (2013) A moth pheromone brewery: production of (Z)-11-hexadecenol by heterologous co-expression of two biosynthetic genes from a noctuid moth in a yeast cell factory. Microbial Cell Factories 12: 125.</li> <br />
<li>Ding BJ, Hofvander P, Wang HL, Durrett TP, Stymne S, et al. (2014) A plant factory for moth pheromone production. Nat Commun 5: 3353.</li> <br />
</ol><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/modules/release
Team:Valencia UPV/Project/modules/release
2014-10-18T03:28:50Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Pheromone Release</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>P</roja>heromone <roja>R</roja>elease</span> </div><br/><br/><br />
<br />
<br />
<p>We use sex pheromones to avoid sexual encounter in a strategy called mating disruption. However, producing the pheromone is not enough for this strategy to be effective, the pheromone must be released into the air. Sex pheromones concentration in the air has to reach high enough levels to cause mating disruption.</p><br/><br/><br />
<br />
<p>Even though pheromones are volatile compound, they still need to find a way out of the plant. For that reason, we decided to produce pheromones in epidermal organs called <span class="black-bold">glandular trichomes</span> to release volatile compounds into the air [1]. These organs are located in the surface of aerial parts of many higher plant species and contain higher concentration of secondary metabolites than an average cell in the plant (up to 15% of dry weight) [2] (Structure in figure 1). This characteristics make glandular trichomes great organs to release volatile compounds.</p><br/><br/><br />
<br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/7/74/VUPVPheromone_Release_figure_1.png" alt="trichome_release" title="Structure of a glandular trichome"></img></div><br/><br />
<div align="center"><p style="text-align: justify; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 1. Structure of a glandular trichome</span>. Glandular trichomes (right) are formed of a support structure holding one or several glandular cells. A glandular trichome from Digitalis purpurea, which contains only one glandular cell at the tip of the organ, is shown in the picture next to a non-glandular trichome (left).</p></div><br/><br />
<br />
<br />
<p>Specific expression of sex pheromone <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis">biosynthetic pathways</a> in glandular trichomes also decreased the disturbance in the plant’s metabolism. We accomplished specific expression in glandular trichomes under the regulation of the promoter PCPS2, from <i>Nicotiana tabacum</i>. PCPS2 naturally regulates transcription of a terpene synthase in glandular trichome cells with great specificity [3]. Expression in glandular trichomes is an elegant strategy to release pheromones into the air causing the minimum metabolic impact in the plant.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis"><strong>&larr; Go to Biosynthesis</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/switch"><strong>Go to Switch &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Wagner GJ (1991) Secreting glandular trichomes: more than just hairs. Plant Physiol 96: 675-679.</li><br />
<li>CEnnajdaoui H, Vachon G, Giacalone C, Besse I, Sallaud C, et al. (2010) Trichome specific expression of the tobacco (Nicotiana sylvestris) cembratrien-ol synthase genes is controlled by both activating and repressing cis-regions. Plant Mol Biol 73: 673-685.</li><br />
<li>3. Sallaud C, Giacalone C, Topfer R, Goepfert S, Bakaher N, et al. (2012) Characterization of two genes for the biosynthesis of the labdane diterpene Z-abienol in tobacco (Nicotiana tabacum) glandular trichomes. Plant J 72: 1-17.</li> <br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/overview
Team:Valencia UPV/policy/overview
2014-10-18T03:26:15Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a> Overview</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>verview</span> </div><br/><br/><br />
<br />
<p>Policy and Practice is not just the cherry on the cake; it is an essential constituent of Synthetic Biology. Thus, it permeates the whole Sexy Plant project, conceived as a responsible research one. To start with, our motivation was to address a challenge of social relevance: protection of crops is essential for economical and social sustainability in a world with an ever-growing population. We also tried to understand the benefits and risks of our approach. Not only safety and environmental protection drove the biosafety module. To tune our project and ensure its outcome is in line with societal expectations, we engaged a wide range of social actors and stakeholders throughout the whole of it (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/policy/activities">see Activities</a>): bio-farm companies, (eco-)farmers associations, research experts, social researchers, etc. Of course, we are also enthusiast about transmitting the world of plant Synthetic Biology to the iGEM community, next generations and whole society (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/policy/outreach"> see Outreach </a>).</p></br></br><br />
<br />
<p>Major issues that arise when designing and developing the <span class="red-bold">Sexy Plant</span> project are asked and answered below:<br />
</p><br/><br />
<br />
<p><span class="black-bold">Is intercropping a genetically modified plant in the field a safe practice? </span></p><br/><br />
<br />
<p>One of the most frequent concerns when talking about Genetically Modified Organisms (GMOs) is regarding safety. Since the beginning of our project, we thought of our Sexy Plant as not intended for human consumption or animal feed. The Sexy Plant's purpose is to release enough amount of insect sexual pheromone to cause mating disruption among insects in the surroundings, protecting the crops of interest from pests. In this way, our synthetic plant won't produce harm in humans or animals because of ingestion. </p><br/><br />
<br />
<p>Additionaly, our team is very concerned about safety. For this purpose, we developed a <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety"> biosafety module </a> and made it available for all the future iGEM teams (and BioBrick users) that work with plants. It consists of a male sterility submodule, that avoids self-pollinization and hence uncontrolled propagation of the plant in the field, and an identity preservation submodule, which allows an easy and fast way to recognize by sight these genetically engineered plants. </p><br/><br />
<br />
<p>Our whole project is focused on working to bring people closer to accept transgenic plants instead of fighting them. From the feedback that we have received, a transgenic plant that is not intended for nutrition, unable to propagate across the field, easily identifiable in every moment and which avoids the death of the moths that cause the pests is perfectly safe. We are proud of helping society to understand that GMOs and safety are perfectly compatible if the appropiate measures are always considered. </p> <br/><br/><br />
<br />
<br />
<br />
<br />
<p><span class="black-bold">How is the Sexy Plant safer and sustainable than other methods of pest control? </span></p><br/><br />
<br />
<p>The most common pest control methods that are currently used are fumigation with pesticides and the use of chemically synthesized insect sexual pheromones. </p><br/><br />
<br />
<p>Pesticides receive harsh criticism from general public as they are broad-spectrum, so they kill other insects which are not the target, altering the local ecosystem. When they are applied, insects end up becoming resistant to pesticides, so higher doses are needed, which are even more dangerous for the environment and living beings. </p><br/><br />
<br />
<p>Chemically synthesized pheromones can be either used in insect traps that lure the insect into them and mating disruption strategies. These strategies are safer than pesticides but the synthesis process is expensive and requires specialized installations and staff to get rid of the toxic residues that are generated. </p><br/><br />
<br />
<p>Our Sexy Plant is a safe and sustainable alternative to current pest control methods. It is safe because it releases insect sexual pheromones that produce mating disruption among insects without killing them and producing no residues. And it is sustainable because it doesn’t require toxic or expensive products, it only requires palmitic acid as a substrate, which is naturally present in the plant, so it is cheap and available. Furthermore, the aforementioned biosafety module makes it easily distinguishable from wild-type plants and male sterile so it can only be reproduced in vitro. </p><br/><br/><br />
<br />
<br />
<br />
<br />
<p><span class="black-bold">Aside from the opinion of general public, how is the Sexy Plant project received among experts? </span></p><br/><br />
<br />
<p>We would like to thank many experts, both academics and representatives from private enterprises, who gave us their feedback and their support as well as their time to discuss our project. They all got a good impression about our Sexy Plant and desire us luck at the contest. Their names are listed below by alphabetical order: </p><br/><br />
<br />
<ul class="method"><br />
<li>Matilde Eizaguirre Altuna. Full Professor. Department of Crop and Forest Sciences. University of Lleida. </li><br />
<li class="normal-sangría">Nemesio Fernández Martínez. Director of the School of Agricultural Engineering (ETSIAMN). Universitat Politècnica de València (UPV). </li><br />
<li>Jose María García Álvarez-Coque. Director of Sustainable Agriculture Group. Universitat Politècnica de València (UPV) </li><br />
<li>Jorge García-Serra García. Director of the School of Industrial Engineering. Universitat Politècnica de València (UPV). </li><br />
<li>Juan Francisco Giner Gonzálbez. Director of Bayer CropScience Chair. </li><br />
<li>Francisco Girona. Agriculture engineer at Cooperatives for Agrofood industry (FECOAV). </li><br />
<li>Ismael Navarro Fuertes. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
<li>Vicente Navarro Llopis. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
<li>Vicente Pallás Benet. Director of the Institute of Plant Molecular and Cell Biology (IBMCP). </li><br />
<li>José Pío Beltrán. Professor of Research of The Spanish Research Council (CSIC) at the Institute of Plant Molecular and Cell Biology. </li><br />
<li>Jaime Primo Millo. Professor of Organic Chemistry. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
<li>Jorge Silva. Technical Department Manager of Bayer CropScience. </li><br />
<li>Sam Tothill. Professor of Biosensors in Health. Engineering Sciences Division. School of Aerospace, Transport and Manufacturing (SATM). Cranfield University. </li><br />
<li>Sandra Vacas González. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
</ul><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/overview
Team:Valencia UPV/policy/overview
2014-10-18T03:24:28Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a> Overview</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>verview</span> </div><br/><br/><br />
<br />
<p>Policy and Practice is not just the cherry on the cake; it is an essential constituent of Synthetic Biology. Thus, it permeates the whole Sexy Plant project, conceived as a responsible research one. To start with, our motivation was to address a challenge of social relevance: protection of crops is essential for economical and social sustainability in a world with an ever-growing population. We also tried to understand the benefits and risks of our approach. Not only safety and environmental protection drove the biosafety module. To tune our project and ensure its outcome is in line with societal expectations, we engaged a wide range of social actors and stakeholders throughout the whole of it (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/policy/activities">see Activities</a>): bio-farm companies, (eco-)farmers associations, research experts, social researchers, etc. Of course, we are also enthusiast about transmitting the world of plant Synthetic Biology to the iGEM community, next generations and whole society (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/policy/outreach"> see Outreach </a>).</p></br></br><br />
<br />
<p>Major issues that arise when designing and developing the <span class="red-bold">Sexy Plant</span> project are asked and answered below:<br />
</p><br/><br />
<br />
<p><span class="black-bold">Is intercropping a genetically modified plant in the field a safe practice? </span></p><br/><br />
<br />
<p>One of the most frequent concerns when talking about Genetically Modified Organisms (GMOs) is regarding safety. Since the beginning of our project, we thought of our Sexy Plant as not intended for human consumption or animal feed. The Sexy Plant's purpose is to release enough amount of insect sexual pheromone to cause mating disruption among insects in the surroundings, protecting the crops of interest from pests. In this way, our synthetic plant won't produce harm in humans or animals because of ingestion. </p><br/><br />
<br />
<p>Additionaly, our team is very concerned about safety. For this purpose, we developed a <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety"> biosafety module </a> and made it available for all the future iGEM teams (and BioBrick users) that work with plants. It consists of a male sterility submodule, that avoids self-pollinization and hence uncontrolled propagation of the plant in the field, and an identity preservation submodule, which allows an easy and fast way to recognize by sight these genetically engineered plants. </p><br/><br />
<br />
<p>Our whole project is focused on working to bring people closer to accept transgenic plants instead of fighting them. From the feedback that we have received, a transgenic plant that is not intended for nutrition, unable to propagate across the field, easily identifiable in every moment and which avoids the death of the moths that cause the pests is perfectly safe. We are proud of helping society to understand that GMOs and safety are perfectly compatible if the appropiate measures are always considered. </p> <br/><br/><br />
<br />
<br />
<br />
<br />
<p><span class="black-bold">How is the Sexy Plant safer and sustainable than other methods of pest control? </span></p><br/><br />
<br />
<p>The most common pest control methods that are currently used are fumigation with pesticides and the use of chemically synthesized insect sexual pheromones. </p><br/><br />
<br />
<p>Pesticides receive harsh criticism from general public as they are broad-spectrum, so they kill other insects which are not the target, altering the local ecosystem. When they are applied, insects end up becoming resistant to pesticides, so higher doses are needed, which are even more dangerous for the environment and living beings. </p><br/><br />
<br />
<p>Chemically synthesized pheromones can be either used in insect traps that lure the insect into them and mating disruption strategies. These strategies are safer than pesticides but the synthesis process is expensive and requires specialized installations and staff to get rid of the toxic residues that are generated. </p><br/><br />
<br />
<p>Our Sexy Plant is a safe and sustainable alternative to current pest control methods. It is safe because it releases insect sexual pheromones that produce mating disruption among insects without killing them and producing no residues. And it is sustainable because it doesn’t require toxic or expensive products, it only requires palmitic acid as a substrate, which is naturally present in the plant, so it is cheap and available. Furthermore, the aforementioned biosafety module makes it easily distinguishable from wild-type plants and male sterile so it can only be reproduced in vitro. </p><br/><br/><br />
<br />
<br />
<br />
<br />
<p><span class="black-bold">Aside from the opinion of general public, how is the Sexy Plant project received among experts? </span></p><br/><br />
<br />
<p>We would like to thank many experts, both academics and representatives from private enterprises, who gave us their feedback and their support as well as their time to discuss our project. They all got a good impression about our Sexy Plant and desire us luck at the contest. Their names are listed below by alphabetical order: </p><br/><br />
<br />
<ul class="method"><br />
<li>Matilde Eizaguirre Altuna. Full Professor. Department of Crop and Forest Sciences. University of Lleida. </li><br />
<li class="normal-sangría">Nemesio Fernández Martínez. Director of the School of Agricultural Engineering (ETSIAMN). Universitat Politècnica de València (UPV). </li><br />
<li>Jose María García Álvarez-Coque. Director of Sustainable Agriculture Group. Universitat Politècnica de València (UPV) </li><br />
<li>Jorge García-Serra García. Director of the School of Industrial Engineering. Universitat Politècnica de València (UPV). </li><br />
<li>Juan Francisco Giner Gonzálbez. Director of Bayer CropScience Business Chair. </li><br />
<li>Francisco Girona. Agriculture engineer at Cooperatives for Agrofood industry (FECOAV). </li><br />
<li>Ismael Navarro Fuertes. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
<li>Vicente Navarro Llopis. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
<li>Vicente Pallás Benet. Director of the Institute of Plant Molecular and Cell Biology (IBMCP). </li><br />
<li>José Pío Beltrán. Professor of Research of The Spanish Research Council (CSIC) at the Institute of Plant Molecular and Cell Biology. </li><br />
<li>Jaime Primo Millo. Professor of Organic Chemistry. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
<li>Jorge Silva. Technical Department Manager of Bayer CropScience. </li><br />
<li>Sam Tothill. Professor of Biosensors in Health. Engineering Sciences Division. School of Aerospace, Transport and Manufacturing (SATM). Cranfield University. </li><br />
<li>Sandra Vacas González. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
</ul><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/overview
Team:Valencia UPV/policy/overview
2014-10-18T03:21:19Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a> Overview</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>verview</span> </div><br/><br/><br />
<br />
<p>Policy and Practice is not just the cherry on the cake; it is an essential constituent of Synthetic Biology. Thus, it permeates the whole Sexy Plant project, conceived as a responsible research one. To start with, our motivation was to address a challenge of social relevance: protection of crops is essential for economical and social sustainability in a world with an ever-growing population. We also tried to understand the benefits and risks of our approach. Not only safety and environmental protection drove the biosafety module. To tune our project and ensure its outcome is in line with societal expectations, we engaged a wide range of social actors and stakeholders throughout the whole of it (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/policy/activities">see Activities</a>): bio-farm companies, (eco-)farmers associations, research experts, social researchers, etc. Of course, we are also enthusiast about transmitting the world of plant Synthetic Biology to the iGEM community, next generations and whole society (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/policy/outreach"> see Outreach </a>).</p></br></br><br />
<br />
<p>Major issues that arise when designing and developing the <span class="red-bold">Sexy Plant</span> project are asked and answered below:<br />
</p><br/><br />
<br />
<p><span class="black-bold">Is intercropping a genetically modified plant in the field a safe practice? </span></p><br/><br />
<br />
<p>One of the most frequent concerns when talking about Genetically Modified Organisms (GMOs) is regarding safety. Since the beginning of our project, we thought of our Sexy Plant as not intended for human consumption or animal feed. The Sexy Plant's purpose is to release enough amount of insect sexual pheromone to cause mating disruption among insects in the surroundings, protecting the crops of interest from pests. In this way, our synthetic plant won't produce harm in humans or animals because of ingestion. </p><br/><br />
<br />
<p>Additionaly, our team is very concerned about safety. For this purpose, we developed a <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety"> biosafety module </a> and made it available for all the future iGEM teams (and BioBrick users) that work with plants. It consists of a male sterility submodule, that avoids self-pollinization and hence uncontrolled propagation of the plant in the field, and an identity preservation submodule, which allows an easy and fast way to recognize by sight these genetically engineered plants. </p><br/><br />
<br />
<p>Our whole project is focused on working to bring people closer to accept transgenic plants instead of fighting them. From the feedback that we have received, a transgenic plant that is not intended for nutrition, unable to propagate across the field, easily identifiable in every moment and which avoids the death of the moths that cause the pests is perfectly safe. We are proud of helping society to understand that GMOs and safety are perfectly compatible if the appropiate measures are always considered. </p> <br/><br/><br />
<br />
<br />
<br />
<br />
<p><span class="black-bold">How is the Sexy Plant safer and sustainable than other methods of pest control? </span></p><br/><br />
<br />
<p>The most common pest control methods that are currently used are fumigation with pesticides and the use of chemically synthesized insect sexual pheromones. </p><br/><br />
<br />
<p>Pesticides receive harsh criticism from general public as they are broad-spectrum, so they kill other insects which are not the target, altering the local ecosystem. When they are applied, insects end up becoming resistant to pesticides, so higher doses are needed, which are even more dangerous for the environment and living beings. </p><br/><br />
<br />
<p>Chemically synthesized pheromones can be either used in insect traps that lure the insect into them and mating disruption strategies. These strategies are safer than pesticides but the synthesis process is expensive and requires specialized installations and staff to get rid of the toxic residues that are generated. </p><br/><br />
<br />
<p>Our Sexy Plant is a safe and sustainable alternative to current pest control methods. It is safe because it releases insect sexual pheromones that produce mating disruption among insects without killing them and producing no residues. And it is sustainable because it doesn’t require toxic or expensive products, it only requires palmitic acid as a substrate, which is naturally present in the plant, so it is cheap and available. Furthermore, the aforementioned biosafety module makes it easily distinguishable from wild-type plants and male sterile so it can only be reproduced in vitro. </p><br/><br/><br />
<br />
<br />
<br />
<br />
<p><span class="black-bold">Aside from the opinion of general public, how is the Sexy Plant project received among experts? </span></p><br/><br />
<br />
<p>We would like to thank many experts, both academics and representatives from private enterprises, who gave us their feedback and their support as well as their time to discuss our project. They all got a good impression about our Sexy Plant and desire us luck at the contest. Their names are listed below by alphabetical order: </p><br/><br />
<br />
<ul class="method"><br />
<li>Matilde Eizaguirre Altuna. Full Professor. Department of Crop and Forest Sciences. University of Lleida. </li><br />
<li class="normal-sangría">Nemesio Fernández Martínez. Director of the School of Agricultural Engineering (ETSIAMN). Universitat Politècnica de València (UPV). </li><br />
<li>Jose María García Álvarez-Coque. Director of Sustainable Agriculture Group. Universitat Politècnica de València (UPV) </li><br />
<li>Jorge García-Serra García. Director of the School of Industrial Engineering. Universitat Politècnica de València (UPV). </li><br />
<li>Juan Francisco Giner Gonzálbez. Director of Bayer CropScience Chair. </li><br />
<li>Francisco Girona. Agriculture engineer at Cooperatives for Agrofood industry (FECOAV). </li><br />
<li>Ismael Navarro Fuertes. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
<li>Vicente Navarro Llopis. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
<li>Vicente Pallás Benet. Director of the Institute of Plant Molecular and Cell Biology (IBMCP). </li><br />
<li>José Pío Beltrán. Professor of Research of The Spanish Research Council (CSIC) at the Institute of Plant Molecular and Cell Biology. </li><br />
<li>Jaime Primo Millo. Professor of Organic Chemistry. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
<li>Jorge Silva. Technical Department Manager of Bayer CropScience. </li><br />
<li>Sam Tothill. Professor of Biosensors in Health. Engineering Sciences Division. School of Aerospace, Transport and Manufacturing (SATM). Cranfield University. </li><br />
<li>Sandra Vacas González. Centre for Agricultural Chemical Ecology (CEQA). Universitat Politècnica de València (UPV). </li><br />
</ul><br />
<br />
<br/><br/><br/><br/><br/><br/><br/><br />
<br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/outreach
Team:Valencia UPV/policy/outreach
2014-10-18T03:13:59Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>utreach</span> </div><br/><br/><br />
<br />
<h3>Workshop announcement</h3><br />
</html><br />
[[Image:Igem_plants.png|left|800px]] <br />
<html><br />
<br/><br/><br/><br />
</html><br />
[[Image:VUPV_gene_exp.jpg|350px|left]] <br />
<html><br />
<br/><br/> <br />
<h3><i>“Generación Espontánea UPV” </i></h3><br />
<p><br />
Valencia UPV iGEM team participated in the communication and diffusion activity called <i>Generación Espontánea</i> (translated as Spontaneous Generation). Twenty-four teams of students showed their projects related to different areas: engineering, social, computing, architecture and culture. We presented our <span class="red-bold">Sexy Plant</span>, and made diffusion of Synthetic Biology. <i>Generación Espontánea</i> was organized by UPV and Dr. Larisa Dunai, who was awarded by MIT Technology Review with the <b>MIT Young Innovator under 35 Award</b> of this year. </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
</html><br />
[[Image:estiu.jpg|500px|right]] <br />
<html><br />
<br />
<br/><br/><br />
<br />
<h3><i>Summer 2014 School courses </i></h3><br />
<p><br />
Valencia UPV iGEM team introduced The Sexy Plant Project to students between 10 -15 years old, during this summer. Besides, we organised an activity for students to learn the pH scale using a natural indicator based on anthocyanins obtained from plants. Around one hundred students extrated anthocyanins from a red cabagge, and created a natural pH indicator. </p> <br />
<br/><br />
<p align="right"> Valencia, from June to July 2014 </p><br />
<br />
<br/><br />
<br/><br />
<div align="left"></div><br />
</br></br></br></br></br></br><br />
<h3>See our Lipdub at IBMCP labs!</h3><br />
<br/><br />
<p>We have organized and participated in a Lipdub. Our team wanted to involve the different groups that are currently working on the institute that is hosting us (IBMCP) in a different manner. We celebrated the 10th anniversary of the iGEM competition and the 20th anniversary of the IBMCP, too. We spend a great time with our colleagues and we promoted social relationships between us. As a result we did not only achieve an awesome video, but found a magnificent way to popularize science in society.</p><br />
<br/><br />
<div><br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/outreach
Team:Valencia UPV/policy/outreach
2014-10-18T03:11:13Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>utreach</span> </div><br/><br/><br />
<br />
<h3>Workshop announcement</h3><br />
</html><br />
[[Image:Igem_plants.png|left|800px]] <br />
<html><br />
<br/><br/><br/><br />
</html><br />
[[Image:VUPV_gene_exp.jpg|350px|left]] <br />
<html><br />
<br/><br/> <br />
<h3><i>“Generación Espontánea UPV” </i></h3><br />
<p><br />
Valencia UPV iGEM team participated in the communication and diffusion activity called <i>Generación Espontánea</i> (translated as Spontaneous Generation). Twenty-four teams of students showed their projects related to different areas: engineering, social, computing, architecture and culture. We presented our <span class="red-bold">Sexy Plant</span>, and made diffusion of Synthetic Biology. <i>Generación Espontánea</i> was organized by UPV and Dr. Larisa Dunai, who was awarded by MIT Technology Review with the <b>MIT Young Innovator under 35 Award</b> of this year. </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
</html><br />
[[Image:estiu.jpg|500px|right]] <br />
<html><br />
<br />
<br/><br/><br />
<br />
<h3><i>Summer 2014 School courses </i></h3><br />
<p><br />
Valencia UPV iGEM team introduced The Sexy Plant Project to students between 10 -15 years old, during this summer. Besides, we organised an activity for students to learn the pH scale using a natural indicator based on anthocyanins obtained from plants. Around one hundred students extrated anthocyanins from a red cabagge, and created a natural pH indicator. </p> <br />
<br/><br />
<p align="right"> Valencia, from June to July 2014 </p><br />
<br />
<br/><br />
<br/><br />
<div align="left"></div><br />
</br></br></br></br></br></br><br />
<h3>See our Lipdub at IBMCP labs!</h3><br />
<br/><br />
<p>We have organized and participated in a Lipdub. Our team wanted to involve the different groups that are currently working on the institute that is hosting us (IBMCP) in a different manner. We celebrated the 10th anniversary of the iGEM competition and the 20th anniversary of the IBMCP, too. We spend a great time with our colleagues and we promoted social relationships between us. As a result we did not only achieve an awesome video, but found a magnificent way to popularize science in society.</p><br />
<br/><br />
<div><br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Students
Team:Valencia UPV/Team/Students
2014-10-18T02:56:10Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Students</a></h3></p></br><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>tudents</span> </div><br />
</br></br><br />
<br />
<table align="center"><br />
<tr><br />
<td><br />
<div class="big-box"><br />
<img alt="Profile_Alba" class="img-profile" title="Alba Rubert" src="https://static.igem.org/mediawiki/2014/e/ec/Profile_Alba.jpg" ></img><br />
<div class="profile-box"><br />
<p><h4>Alba Rubert</h4><br />
Biotechnology<br/><br/><br/><br/><br/><br/>For more details: click <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students/Alba_Rubert">here</a><br />
<br />
</p></div><br />
</div><br />
</td><br />
<td><br />
<div class="big-box"><br />
<img alt="Profile_Alejandra" class="img-profile" title="Alejandra González" src="https://static.igem.org/mediawiki/2014/2/25/Profile_Jana.jpg"></img><br />
<div class="profile-box"><br />
<p><h4>Alejandra González</h4><br />
Engineering<br/><br/><br/><br/><br/><br/>For more details: click <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students/Alejandra_Gonzalez">here</a><br />
<br />
</p></div><br />
</div><br />
</td><br />
</tr><br />
<tr><br />
<td><br />
<div class="big-box"><br />
<img alt="Profile_Alfredo" class="img-profile" title="Alfredo Quijano" src="https://static.igem.org/mediawiki/2014/5/52/Profile_Alfredo.jpg"></img><br />
<div class="profile-box"><br />
<p><h4>Alfredo Quijano</h4><br />
Biotechnology<br/><br/><br/><br/><br/><br/>For more details: click <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students/Alfredo_Quijano">here</a><br />
<br />
</p></div><br />
</div><br />
</td><br />
<td><br />
<div class="big-box"><br />
<img alt="Profile_Ivan" class="img-profile" title="Ivan Llopis" src="https://static.igem.org/mediawiki/2014/4/4b/Valencia_UPV_Profile_Ivan_mod.png"></img><br />
<div class="profile-box"><br />
<p><h4>Ivan Llopis</h4><br />
Engineering<br/><br/><br/><br/><br/><br/>For more details: click <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students/Ivan_Llopis">here</a><br />
<br />
</p></div><br />
</div><br />
</td><br />
</tr><br />
<tr><br />
<td><br />
<div class="big-box"><br />
<img alt="Profile_Jose" class="img-profile" title="Jose Gavaldá" src="https://static.igem.org/mediawiki/2014/8/85/VUPVFoto_Jose.png"></img><br />
<div class="profile-box"><br />
<p><h4>Jose Gavaldá</h4><br />
Biotechnology<br/><br/><br/><br/><br/><br/>For more details: click <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students/Jose_Gavalda">here</a><br />
<br />
</p></div><br />
</div><br />
</td><br />
<td><br />
<div class="big-box"><br />
<img alt="Profile_Lucía" class="img-profile" title="Lucía Estellés" src="https://static.igem.org/mediawiki/2014/a/af/VUPVProfile_Lucia.jpg"></img><br />
<div class="profile-box"><br />
<p><h4>Lucía Estellés</h4><br />
Biotechnology<br/><br/><br/><br/><br/><br/>For more details: click <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students/Lucia_Estelles">here</a><br />
<br />
</p></div><br />
</div><br />
</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td><br/><a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Advisors"><strong>Go to Advisors &rarr;</strong></a></td><br />
</tr><br />
</table><br/><br />
<br />
<div id="space-margin"></div><br />
<br />
</div></br></br></div><br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Students/Lucia_Estelles
Team:Valencia UPV/Team/Students/Lucia Estelles
2014-10-18T02:53:23Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students">Students</a> > <a>Lucía Estellés López</a></h3></p><br />
<div class="big-box-desc" align="justify"><br />
<img alt="Profile_Lucía" title="Lucía Estellés" src="https://static.igem.org/mediawiki/2014/a/af/VUPVProfile_Lucia.jpg" class="img-profile-desc"></img><br />
<br />
<h4 class="title-desc">Lucía Estellés</h4><br/><br />
<p>Lucía is currently undertaking a double degree in Biotechnology BSc at the Polytechnic University of Valencia and Applied Bioinformatics MSc at Cranfield University. She loved participating in the iGEM competition as she had a great opportunity to learn more about Systems Biology.</p><br/><br />
<p><br />
Lucía likes learning new things, the most diverse as possible, and reading. </p><br />
<br />
<br/><br/><br/><br/><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Students"><strong>&larr; Go back to Students</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Attributions#Lucia"><strong>Go to Attributions &rarr;</strong></a></br><br />
</p><br />
</div></div></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Students/Lucia_Estelles
Team:Valencia UPV/Team/Students/Lucia Estelles
2014-10-18T02:53:09Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students">Students</a> > <a>Lucía Estellés López</a></h3></p><br />
<div class="big-box-desc" align="justify"><br />
<img alt="Profile_Lucía" title="Lucía Estellés" src="https://static.igem.org/mediawiki/2014/a/af/VUPVProfile_Lucia.jpg" class="img-profile-desc"></img><br />
<br />
<h4 class="title-desc">Lucía Estellés</h4><br/><br />
<p>Lucía is currently undertaking a double degree in Biotechnology BSc at the Polytechnic University of Valencia and Applied Bioinformatics MSc at Cranfield University. She loved participating in the iGEM competition as she had a great opportunity to learn more about Systems Biology.</p><br/><br />
<p><br />
Lucía likes learning new things, the most diverse as possible, and reading. </p><br />
<br />
<br/><br/><br/><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Students"><strong>&larr; Go back to Students</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Attributions#Lucia"><strong>Go to Attributions &rarr;</strong></a></br><br />
</p><br />
</div></div></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Students/Lucia_Estelles
Team:Valencia UPV/Team/Students/Lucia Estelles
2014-10-18T02:52:25Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students">Students</a> > <a>Lucía Estellés López</a></h3></p><br />
<div class="big-box-desc" align="justify"><br />
<img alt="Profile_Jana" title="Lucía Estellés" src="https://static.igem.org/mediawiki/2014/a/af/VUPVProfile_Lucia.jpg" class="img-profile-desc"></img><br />
<br />
<h4 class="title-desc">Lucía Estellés</h4><br/><br />
<p>Lucía is currently undertaking a double degree in Biotechnology BSc at the Polytechnic University of Valencia and Applied Bioinformatics MSc at Cranfield University. She loved participating in the iGEM competition as she had a great opportunity to learn more about Systems Biology.</p><br/><br />
<p><br />
Lucía likes learning new things, the most diverse as possible, and reading. </p><br />
<br />
<br/><br/><br/><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Students"><strong>&larr; Go back to Students</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Attributions#Lucia"><strong>Go to Attributions &rarr;</strong></a></br><br />
</p><br />
</div></div></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Students/Alba_Rubert
Team:Valencia UPV/Team/Students/Alba Rubert
2014-10-18T02:51:29Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students">Students</a> > <a>Alba Rubert</a></h3></p><br />
<div class="big-box-desc" align="justify"><br />
<img alt="Profile_Alba" title="Alba Rubert" src="https://static.igem.org/mediawiki/2014/e/ec/Profile_Alba.jpg" class="img-profile-desc"></img><br />
<br />
<h4 class="title-desc">Alba Rubert</h4><br/><br />
<p>She’s currently in a state of limbo. Alba is on the verge of finishing her Biotechnology bachelor’s degree in the UPV “Universitat Politècnica de València” as she is working on her Final Degree Project. She’s delighted to participate in the iGEM competition and discover more about Synthetic Biology.</p><br/> <br />
<p>In his free time she enjoys reading and playing the viola. <br />
<br/><br/><br/><br/><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Students"><strong>&larr; Go back to Students</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Attributions#Alba"><strong>Go to Attributions &rarr;</strong></a></br><br />
</p><br />
</div></div></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Students/Alba_Rubert
Team:Valencia UPV/Team/Students/Alba Rubert
2014-10-18T02:51:17Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students">Students</a> > <a>Alba Rubert"</a></h3></p><br />
<div class="big-box-desc" align="justify"><br />
<img alt="Profile_Alba" title="Alba Rubert" src="https://static.igem.org/mediawiki/2014/e/ec/Profile_Alba.jpg" class="img-profile-desc"></img><br />
<br />
<h4 class="title-desc">Alba Rubert</h4><br/><br />
<p>She’s currently in a state of limbo. Alba is on the verge of finishing her Biotechnology bachelor’s degree in the UPV “Universitat Politècnica de València” as she is working on her Final Degree Project. She’s delighted to participate in the iGEM competition and discover more about Synthetic Biology.</p><br/> <br />
<p>In his free time she enjoys reading and playing the viola. <br />
<br/><br/><br/><br/><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Students"><strong>&larr; Go back to Students</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Attributions#Alba"><strong>Go to Attributions &rarr;</strong></a></br><br />
</p><br />
</div></div></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Attributions
Team:Valencia UPV/Team/Attributions
2014-10-18T02:51:04Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Attributions</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>ttributions</span> </div><br/><br/><br />
<br />
<h3>Attributions in a flash</h3><br/><br />
<p><a name="Alba" class="encabezado">Alba Rubert:</a> Pheromone Analysis, Pheromone-Insect Interactions, BioBrick preparation, Policy and Practices.</p><br/><br />
<br />
<br />
<p><a name="Alejandra" class="encabezado">Alejandra González:</a> Pheromone Diffusion modeling, Pheromone Production modeling, Policy and Practices.</p><br/><br />
<br />
<br />
<p><a name="Alfredo" class="encabezado">Alfredo Quijano:</a> Pheromone Release, Switch, Pheromone Analysis, Pheromone-Insect Interactions, Policy and Practices.</p><br/><br />
<br />
<p><a name="Ivan" class="encabezado">Ivan Llopis:</a> Pheromone Production modeling, Wiki, Policy and Practices.</p><br/><br />
<br />
<br />
<p><a name="Jose" class="encabezado">José Gavaldá:</a> Pheromone Biosynthesis design, Pheromone Analysis, Policy and Practices</p><br/><br />
<br />
<br />
<p><a name="Lucia" class="encabezado">Lucía Estellés:</a> Pheromone Biosynthesis design, Biosafety, BioBrick preparation, Policy and Practices.</p><br/><br/><br/><br />
<br />
<br />
<h3>Attributions (Extended Version)</h3><br/><br />
<p><br />
<strong>Project: the idea.</strong><br />
We came to The Sexy Plant project after many brainstorming meetings including all the team. It would be impossible to define authors here: we all contributed to the design of the project.<br />
</p><br/><br />
<p><br />
<strong>Pheromone Biosynthesis.</strong><br />
Design of the biosynthesis pathway fell on <strong>Jose Gavaldá</strong> and <strong>Lucía Estellés</strong>. Pheromone expression analysis by GC-MS was carried out by <strong>Alba Rubert</strong>, <strong>Alfredo Quijano</strong>, <strong>Lucía Estellés</strong> and <strong>Jose Gavaldá</strong>. Pheromone-insect interaction analysis by means of wind tunnel and EAG was made by <strong>Alba Rubert</strong> and <strong>Alfredo Quijano</strong>.<br />
</p><br />
<p><br/><br />
<strong>Pheromone Release and Switch.</strong><br />
<strong>Alfredo Quijano</strong> was the responsible for the design and expression analysis of the trichome specific promoter. Copper inducible switch was designed by <strong>Alfredo Quijano</strong>. <br />
<br />
</p><br />
<p><br/><br />
<strong>Modeling.</strong><br />
<strong>Ivan Llopis</strong>, also supported by <strong>Alejandra González</strong>, worked in the FBA modeling to try to obtain estimation of the pheromone production and to try to optimize it. <strong>Alejandra González</strong> was in charge of the pheromone diffusion and moth behavior modeling to help decide where and how much sexy plants we should put in the field.<br />
<br />
</p><br/><br />
<p><br />
<strong>Biosafety.</strong><br />
Biosafety module was designed by <strong>Lucía Estellés</strong>, and Lucía was also the leader when fulfilling safety requirements: About our lab form (assisted by Alba, Alfredo and Jose), Check-in and Safety form.<br />
</p><br/><br />
<br />
<p><br />
<strong>Policy & Practices.</strong><br />
<strong>Lucía Estellés</strong>, <strong>Jose Gavaldá</strong>, <strong>Alejandra González</strong>, <strong>Alba Rubert</strong> and <strong>Alfredo Quijano</strong> dealed with the organization and execution of interviews with some stakeholders involved in the project. All the students in the team participated in the presentation of the Sexy Plant project to relevant members of the UPV, CSIC (Spanish Research Council) and Bayer CropScience business chair. <strong>Alba Rubert</strong>, <strong>Alfredo Quijano</strong>, <strong>Alejandra González</strong> and <strong>Ivan Llopis</strong> participated in the Generación Espontánea event. Also all the students organized and carry out the Summer School courses. And Lucía, Jose, Alba and Alfredo organized and participated in the lipdub.<br />
</p><br/><br />
<p><br />
<strong>BioBricks.</strong><br />
<strong>Lucía Estellés</strong>, helped by <strong>Alba Rubert</strong>, prepared the BioBricks for sending them to the Registry and documented the parts. <strong>Lucía</strong> was the designer of the Omega undercover part used to translate from GoldenBraid 2.0 to BioBricks standard.<br />
</p><br/><br />
<p><br />
<strong>Interlab Study.</strong><br />
<strong>Lucía Estellés</strong> performed the measurement interlab study.<br />
</p><br/><br />
<p><br />
<strong>Art and Design.</strong><br />
<strong>Alfredo Quijano</strong> was the major designer of the images used at the wiki, the presentation and the poster.<br />
</p><br/><br />
<p><br />
<strong>Wiki. </strong><br />
Performed by <strong>Ivan Llopis</strong>.<br />
</p><br/><br />
<p><br />
<strong>Poster.</strong><br />
<strong>Ivan Llopis</strong> worked in the poster design, all contributed with the concepts.<br />
<br />
</p><br/><br />
<p><br />
<strong>Talk.</strong> <strong>Lucía Estelles, Alfredo Quijano</strong> and <strong>Alejandra González.</strong> Also <strong>Alba Rubert</strong> performed Lucía's part when she was absent. All the team participated in the layout and conceptual flow. <br />
</p><br/><br/><br/><br />
<br />
<h3>Supervision</h3><br/><br />
<p><br />
All the Valencia UPV supervisors and advisors performed outstanding jobs. Their implication in the project is as follows:<br />
</p><br/><br />
<p><br />
<strong>Wetlab work</strong>. It was supervised by <strong>Esferanía Huet</strong> and <strong>Marta Vázquez</strong>. Always under the guidance and supervision of the wetlab director: <strong>Prof. Diego Orzáez.</strong><br />
</p><br/><br />
<p><br />
<strong>Modeling.</strong> FBA analysis was closely supervised by <strong>Yadira Boada</strong>, with the collaboration of <strong>Gabriel Bosque</strong> and <strong>Maria Siurana</strong>. Under the guidance of<strong> Profs. Javier Urchueguía and Jesús Picó. </strong>. Modeling of the Pheromone Diffusion and Moths response was supervised by <strong>Alejandro Vignoni</strong>. All under the guidance of<strong> Profs. Jesús Picó and Alberto Conejero. </strong><br />
</p><br/><br />
<p><br />
<strong>Wiki.</strong> Supervised by <strong>Victor Nina</strong> and <strong>Alejandro Vignoni</strong>.<br />
</p><br/><br />
<p><br />
<strong>Communication and logistics.</strong> <strong>Javier Urchieguía, Alberto Conejero, Maria Siurana, David Fuente</strong> and <strong>Yadira Boada</strong>.<br />
</p><br/><br />
<p><br />
<strong>Poster design and layout</strong> was supervised by<strong> Yadira Boada</strong>.<br />
</p><br/><br/><br/><br />
<br />
<h3>Acknowledgements</h3><br/><br />
<br />
<p>We thank the people who have helped in the project. We sincerely appreciate your contributions because <i>The Sexy Plant</i> project would not have been possible without your invaluable assistance and your enthusiasm: </p><br/><br />
<br />
<ul class="method"><br />
<br />
<li>Asun Fernández del Carmen, Institute for Plant Molecular and Cell Biology (IBMCP, CSIC-UPV): invaluable aid in everything. </li><br />
<li>Jose Luis Rambla Nebot, Institute for Plant Molecular and Cell Biology (IBMCP, CSIC-UPV): aid and advising in sample analysis by CG-MS and other technical advice. </li><br />
<li>Jaime Primo Millo, Ismael Navarro Fuertes, Vicente Navarro Llopis, Sandra Vacas González, Centre for Agricultural Chemical Ecology (CEQA - UPV): technical advice in project approach, insect management, electroantennography, wind tunnel, plant diffusion analysis, facility and technical details provision. </li><br />
<li>Christine Bäuerl, Institute of Automation and Industrial Computing ai2 - UPV: technical advice in the laboratory. </li><br />
<li>Jesús Muñoz Bertomeu, Institute for Plant Molecular and Cellular Biology (IBMCP, CSIC-UPV): <i>Candida tropicalis species</i> and assistance. </li><br />
<li>Lynne Yenush and Mª Carmen Marqués Romero, Institute for Plant Molecular and Cell Biology (IBMCP, CSIC-UPV): <i>Saccharomyces cerevisiae species</i>, genomic extraction protocols and reagents. </li><br />
<li>Alejandro Sarrión Perdigones, Baylor College of Medicine (Houston, Texas): technical advice and RFC development. </li><br />
<li>Matilde Eizaguirre Altuna, Department of Crop and Forest Sciences, University of Lleida (Lleida, Spain): <i>S. nonagrioides species</i> and useful information about moth handling. </li><br />
<li>NRP-UEA-Norwich team: MoFlippers and chromoproteins.. </li><br />
<li>IBMCP (CSIC-UPV) staff: Lipdub participation, hosting us at the Institute. </li><br />
<li>Silvia Michael: Logo design. </li><br />
<br />
</ul><br/><br />
<br />
<br />
<p>We would like to offer our special thanks to the following institutions for their support in the development of <i>The Sexy Plant Project</i>: </p><br/><br />
<br />
<ul class="method"><br />
<br />
<li>Universitat Politècnica de València (UPV) and Vice-rectorate for Student and University Extension, </li><br />
<li>Council of Valencia, </li><br />
<li>Bayer CropScience business chair, </li><br />
<li>Technical School of Industrial Engineering (ETSII - UPV), </li><br />
<li>Technical School of Agricultural Engineering (ETSIAMN - UPV) </li><br />
<br />
</ul><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Students/Alba_Rubert
Team:Valencia UPV/Team/Students/Alba Rubert
2014-10-18T02:49:31Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students">Students</a> > <a>Alba Rubert"</a></h3></p><br />
<div class="big-box-desc" align="justify"><br />
<img alt="Profile_Alba" title="Alba Rubert" src="https://static.igem.org/mediawiki/2014/e/ec/Profile_Alba.jpg" class="img-profile-desc"></img><br />
<br />
<h4 class="title-desc">Alba Rubert</h4><br/><br />
<p>She’s currently in a state of limbo. Alba is on the verge of finishing her Biotechnology bachelor’s degree in the UPV “Universitat Politècnica de València” as she is working on her Final Degree Project. She’s delighted to participate in the iGEM competition and discover more about Synthetic Biology.</p><br/> <br />
<p>In his free time she enjoys reading and playing the viola. <br />
<br/><br/><br/><br/><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Students"><strong>&larr; Go back to Students</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Attributions#Alejandra"><strong>Go to Attributions &rarr;</strong></a></br><br />
</p><br />
</div></div></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Students/Alba_Rubert
Team:Valencia UPV/Team/Students/Alba Rubert
2014-10-18T02:49:06Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students">Students</a> > <a>Alba Rubert"</a></h3></p><br />
<div class="big-box-desc" align="justify"><br />
<img alt="Profile_Alba" title="Alba Rubert" src="https://static.igem.org/mediawiki/2014/e/ec/Profile_Alba.jpg" class="img-profile-desc"></img><br />
<br />
<h4 class="title-desc">Alba Rubert"</h4><br/><br />
<p>She’s currently in a state of limbo. Alba is on the verge of finishing her Biotechnology bachelor’s degree in the UPV “Universitat Politècnica de València” as she is working on her Final Degree Project. She’s delighted to participate in the iGEM competition and discover more about Synthetic Biology.</p><br/> <br />
<p>In his free time she enjoys reading and playing the viola. <br />
<br/><br/><br/><br/><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Students"><strong>&larr; Go back to Students</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Attributions#Alejandra"><strong>Go to Attributions &rarr;</strong></a></br><br />
</p><br />
</div></div></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Team/Students/Alba_Rubert
Team:Valencia UPV/Team/Students/Alba Rubert
2014-10-18T02:48:08Z
<p>Alrual: Created page with "{{:Team:Valencia_UPV/header}} {{:Team:Valencia_UPV/team_css}} <html> <div align="center"><div id="cn-box"> <p><h3 class="hook" align="left"><a>Team</a> > <a href="http://2014.i..."</p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
{{:Team:Valencia_UPV/team_css}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box"><br />
<p><h3 class="hook" align="left"><a>Team</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Team/Students">Students</a> > <a>Alba Rubert"</a></h3></p><br />
<div class="big-box-desc" align="justify"><br />
<img alt="Profile_Alba" title="Alba Rubert" src="https://static.igem.org/mediawiki/2014/2/25/Profile_Jana.jpg" class="img-profile-desc"></img><br />
<br />
<h4 class="title-desc">Alba Rubert"</h4><br/><br />
<p>She’s currently in a state of limbo. Alba is on the verge of finishing her Biotechnology bachelor’s degree in the UPV “Universitat Politècnica de València” as she is working on her Final Degree Project. She’s delighted to participate in the iGEM competition and discover more about Synthetic Biology.</p><br/> <br />
<p>In his free time she enjoys reading and playing the viola. <br />
<br/><br/><br/><br/><br/><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Students"><strong>&larr; Go back to Students</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Team/Attributions#Alejandra"><strong>Go to Attributions &rarr;</strong></a></br><br />
</p><br />
</div></div></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/outreach
Team:Valencia UPV/policy/outreach
2014-10-18T01:46:53Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>utreach</span> </div><br/><br/><br />
<br />
<h3>Workshop announcement</h3><br />
</html><br />
[[Image:Igem_plants.png|left|800px]] <br />
<html><br />
<br/><br/><br/><br />
</html><br />
[[Image:VUPV_gene_exp.jpg|350px|left]] <br />
<html><br />
<br/><br/> <br />
<h3><i>“Generación Espontánea UPV” </i></h3><br />
<p><br />
Valencia UPV iGEM team participated in the communication and diffusion activity called <i>Generación Espontánea</i> (translated as Spontaneous Generation). Twenty-four teams of students showed their projects related to different areas: engineering, social, computing, architecture and culture. We presented our <span class="red-bold">Sexy Plant</span>, and made diffusion of Synthetic Biology. <i>Generación Espontanea</i> was organized by UPV and Dr. Larisa Dunai, who was awarded by MIT Technology Review with the <b>MIT Young Innovator under 35 Award</b> of this year. </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
</html><br />
[[Image:estiu.jpg|500px|right]] <br />
<html><br />
<br />
<br/><br/><br />
<br />
<h3><i>Summer 2014 School courses </i></h3><br />
<p><br />
Valencia UPV iGEM team introduced The Sexy Plant Project to students between 10 -15 years old, during this summer. Besides, we organised an activity for students to learn the pH scale using a natural indicator based on anthocyanins obtained from plants. Around one hundred students extrated anthocyanins from a red cabagge, and created a natural pH indicator. </p> <br />
<p align="right"> Valencia, from June to July 2014 </p><br />
<br />
<br/><br />
<br/><br />
<div align="left"></div><br />
</br></br></br></br></br></br><br />
<h3>See our Lipdub at IBMCP labs!</h3><br />
<br/><br />
<p>We have organized and participated in a Lipdub. Our team wanted to involve the different groups that are currently working on the institute that is hosting us (IBMCP) in a different manner. We celebrated the 10th anniversary of the iGEM competition and the 20th anniversary of the IBMCP, too. We spend a great time with our colleagues and we promoted social relationships between us. As a result we did not only achieve an awesome video, but found a magnificent way to popularize science in society.</p><br />
<br/><br />
<div><br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/outreach
Team:Valencia UPV/policy/outreach
2014-10-18T01:45:22Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>utreach</span> </div><br/><br/><br />
<br />
<h3>Workshop announcement</h3><br />
</html><br />
[[Image:Igem_plants.png|left|800px]] <br />
<html><br />
<br/><br/><br/><br />
</html><br />
[[Image:VUPV_gene_exp.jpg|350px|left]] <br />
<html><br />
<br />
<h3><i>“Generacion Espontánea UPV” </i></h3><br />
<p><br />
Valencia UPV iGEM team participated in the communication and diffusion activity called <i>Generación Espontánea</i> (translated as Spontaneous Generation). Twenty-four teams of students showed their projects related to different areas: engineering, social, computing, architecture and culture. We presented our <span class="red-bold">Sexy Plant</span>, and made diffusion of Synthetic Biology. <i>Generación Espontanea</i> was organized by UPV and Dr. Larisa Dunai, who was awarded by MIT Technology Review with the <b>MIT Young Innovator under 35 Award</b> of this year. </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
</html><br />
[[Image:estiu.jpg|500px|right]] <br />
<html><br />
<br />
<br/><br/><br />
<br />
<h3><i>Summer 2014 School courses </i></h3><br />
<p><br />
Valencia UPV iGEM team introduced The Sexy Plant Project to students between 10 -15 years old, during this summer. Besides, we organised an activity for students to learn the pH scale using a natural indicator based on anthocyanins obtained from plants. Around one hundred students extrated anthocyanins from a red cabagge, and created a natural pH indicator. </p> <br />
<p align="right"> Valencia, from June to July 2014 </p><br />
<br />
<br/><br />
<br/><br />
<div align="left"><br />
</br></br></br></br></br></br><br />
<h3>See our Lipdub at IBMCP labs!</h3><br />
<br/><br />
<p>We have organized and participated in a Lipdub. Our team wanted to involve the different groups that are currently working on the institute that is hosting us (IBMCP) in a different manner. We celebrated the 10th anniversary of the iGEM competition and the 20th anniversary of the IBMCP, too. We spend a great time with our colleagues and we promoted social relationships between us. As a result we did not only achieve an awesome video, but found a magnificent way to popularize science in society.</p><br />
<br/><br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/outreach
Team:Valencia UPV/policy/outreach
2014-10-18T01:44:38Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>utreach</span> </div><br/><br/><br />
<br />
<h3>Workshop announcement</h3><br />
</html><br />
[[Image:Igem_plants.png|left|800px]] <br />
<html><br />
<br/><br/><br/><br />
</html><br />
[[Image:VUPV_gene_exp.jpg|350px|left]] <br />
<html><br />
<br />
<h3><i>“Generacion Espontánea UPV” </i></h3><br />
<p><br />
Valencia UPV iGEM team participated in the communication and diffusion activity called <i>Generación Espontánea</i> (translated as Spontaneous Generation). Twenty-four teams of students showed their projects related to different areas: engineering, social, computing, architecture and culture. We presented our <span class="red-bold">Sexy Plant</span>, and made diffusion of Synthetic Biology. <i>Generación Espontanea</i> was organized by UPV and Dr. Larisa Dunai, who was awarded by MIT Technology Review with the <b>MIT Young Innovator under 35 Award</b> of this year. </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
</html><br />
[[Image:estiu.jpg|500px|right]] <br />
<html><br />
<br />
<br/><br/><br />
<br />
<h3><i>Summer 2014 School courses </i></h3><br />
<p><br />
Valencia UPV iGEM team introduced The Sexy Plant Project to students between 10 -15 years old, during this summer. Besides, we organised an activity for students to learn the pH scale using a natural indicator based on anthocyanins obtained from plants. Around one hundred students extrated anthocyanins from a red cabagge, and created a natural pH indicator. </p> <br />
<p align="right"> Valencia, from June to July 2014 </p><br />
<br />
<br/><br />
<br/><br />
<div align="left"></div><br />
</br></br></br></br></br></br><br />
<h3>See our Lipdub at IBMCP labs!</h3><br />
<br/><br />
<p>We have organized and participated in a Lipdub. Our team wanted to involve the different groups that are currently working on the institute that is hosting us (IBMCP) in a different manner. We celebrated the 10th anniversary of the iGEM competition and the 20th anniversary of the IBMCP, too. We spend a great time with our colleagues and we promoted social relationships between us. As a result we did not only achieve an awesome video, but found a magnificent way to popularize science in society.</p><br />
<br/><br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/outreach
Team:Valencia UPV/policy/outreach
2014-10-18T01:38:35Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>utreach</span> </div><br/><br/><br />
<br />
<h3>Workshop announcement</h3><br />
</html><br />
[[Image:Igem_plants.png|left|800px]] <br />
<html><br />
<br/><br/><br/><br />
</html><br />
[[Image:VUPV_gene_exp.jpg|350px|left]] <br />
<html><br />
<br />
<h3><i>“Generacion Espontánea UPV” </i></h3><br />
<p><br />
Valencia UPV iGEM team participated in the communication and diffusion activity called <i>Generación Espontánea</i> (translated as Spontaneous Generation). Twenty-four teams of students showed their projects related to different areas: engineering, social, computing, architecture and culture. We presented our <span class="red-bold">Sexy Plant</span>, and made diffusion of Synthetic Biology. <i>Generación Espontanea</i> was organized by UPV and Dr. Larisa Dunai, who was awarded by MIT Technology Review with the <b>MIT Young Innovator under 35 Award</b> of this year. </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
</html><br />
[[Image:estiu.jpg|500px|right]] <br />
<html><br />
<br />
<br/><br/><br />
<br />
<h3><i>Summer 2014 School courses </i></h3><br />
<p><br />
Valencia UPV iGEM team introduced The Sexy Plant Project to students between 10 -15 years old, during this summer. Besides, we organised an activity for students to learn the pH scale using a natural indicator based on anthocyanins obtained from plants. Around one hundred students extrated anthocyanins from a red cabagge, and created a natural pH indicator. </p> <br />
<p align="right"> Valencia, from June to July 2014 </p><br />
<br />
<br/><br />
<br/><br />
<div align="left"><br />
</br></br></br></br></br></br><br />
<h3>See our Lipdub at IBMCP labs!</h3><br />
<br/><br />
<p>We have organized and participated in a Lipdub. Our team wanted to involve the different groups that are currently working on the institute that is hosting us (IBMCP) in a different manner. We celebrated the 10th anniversary of the iGEM competition and the 20th anniversary of the IBMCP, too. We spend a great time with our colleagues and we promoted social relationships between us. As a result we did not only achieve an awesome video, but found a magnificent way to popularize science in society.</p><br />
<br/><br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/outreach
Team:Valencia UPV/policy/outreach
2014-10-18T01:35:31Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>utreach</span> </div><br/><br/><br />
<br />
<h3>Workshop announcement</h3><br />
</html><br />
[[Image:Igem_plants.png|left|800px]] <br />
<html><br />
<br/><br/><br/><br />
</html><br />
[[Image:VUPV_gene_exp.jpg|350px|left]] <br />
<html><br />
<br />
<h3><i>“Generacion Espontánea UPV” </i></h3><br />
<p><br />
Valencia UPV iGEM team participated in the communication and diffusion activity called <i>Generación Espontánea</i> (translated as Spontaneous Generation). Twenty-four teams of students showed their projects related to different areas: engineering, social, computing, architecture and culture. We presented our <span class="red-bold">Sexy Plant</span>, and made diffusion of Synthetic Biology. <i>Generación Espontanea</i> was organized by UPV and Dr. Larisa Dunai, who was awarded by MIT Technology Review with the <b>MIT Young Innovator under 35 Award</b> of this year. </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
</html><br />
[[Image:estiu.jpg|500px|right]] <br />
<html><br />
<br />
<br/><br/><br />
<br />
<h3><i>Summer 2014 School courses </i></h3><br />
<p><br />
Valencia UPV iGEM team introduced The Sexy Plant Project to students between 10 -15 years old, during this summer. Besides, we organised an activity for students to learn the pH scale using a natural indicator based on anthocyanins obtained from plants. Around one hundred students extrated anthocyanins from a red cabagge, and created a natural pH indicator. </p> <br />
<p align="right"> Valencia, from June to July 2014 </p><br />
<br />
<br/><br />
<br/><br />
<div align="left"><br />
</br></br></br></br></br></br><br />
<h3>See our Lipdub at IBMCP labs!</h3><br />
<br/><br />
<p>We have organized and participated in a Lipdub. Our team wanted to involve the different groups that are currently working on the institute that is hosting us (IBMCP) in a different manner. We celebrated the 10th anniversary of the iGEM competition and the 20th anniversary of the IBMCP, too. We spend a great time with our colleagues and we promoted social relationships between us. As a result we did not only achieve an awesome video, but found a magnificent way to popularize science in society.</p><br />
<br/><br />
<embed width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/outreach
Team:Valencia UPV/policy/outreach
2014-10-18T01:30:50Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>utreach</span> </div><br/><br/><br />
<br />
<h3>Workshop announcement</h3><br />
</html><br />
[[Image:Igem_plants.png|left|800px]] <br />
<html><br />
<br/><br/><br/><br />
</html><br />
[[Image:VUPV_gene_exp.jpg|350px|left]] <br />
<html><br />
<br />
<h3><i>“Generacion Espontánea UPV” </i></h3><br />
<p><br />
Valencia UPV iGEM team participated in the communication and diffusion activity called <i>Generación Espontánea</i> (translated as Spontaneous Generation). Twenty-four teams of students showed their projects related to different areas: engineering, social, computing, architecture and culture. We presented our <span class="red-bold">Sexy Plant</span>, and made diffusion of Synthetic Biology. <i>Generación Espontanea</i> was organized by UPV and Dr. Larisa Dunai, who was awarded by MIT Technology Review with the <b>MIT Young Innovator under 35 Award</b> of this year. </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
</html><br />
[[Image:estiu.jpg|500px|right]] <br />
<html><br />
<br />
<br/><br/><br />
<br />
<h3><i>Summer 2014 School courses </i></h3><br />
<p><br />
Valencia UPV iGEM team introduced The Sexy Plant Project to students between 10 -15 years old, during this summer. Besides, we organised an activity for students to learn the pH scale using a natural indicator based on anthocyanins obtained from plants. Around one hundred students extrated anthocyanins from a red cabagge, and created a natural pH indicator. </p> <br />
<p align="right"> Valencia, from June to July 2014 </p><br />
<br />
<br/><br />
<br/><br />
<div align="left"><br />
</br></br></br></br></br></br><br />
<h3>See our Lipdub at IBMCP labs!</h3><br />
<br/><br />
<p>We have organized and participated in a Lipdub, . Our team wanted to involve the different groups that are currently working on the institute that is hosting us (IBMCP) in a different manner. We spend a great time with our colleagues and we promoted social relationships between us. As a result we did not only achieve an awesome video, but found a magnificent way to popularize science in society.</p><br />
<br/><br />
<embed width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/activities
Team:Valencia UPV/policy/activities
2014-10-18T01:22:51Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>ctivities</span> </div><br/><br/><br />
<br />
<h3><b>Permanent meetings and activities</b></h3><br />
<br/><br />
<h3> Center for Chemical Ecology (CEQA), Valencia.</h3><br />
<br/><br />
</html><br />
[[File:UPV_CEQA.jpg|500px|right]] <br />
<html><br />
<p><br />
CEQA has expertise in the isolation and identification of semiochemicals, the formulation of pheromone attractants and controlled rate emitters.</p><br />
<p><br />
Jaime Primo Millo is the Director of the Agricultural Center for Chemical Ecology (CEQA), and professor of organic chemistry at UPV. Jaime Primo, Ismael Navarro, Vicente Navarro and Sandra Vacas have continuously advised the Valencia UPV iGEM team since we first met them. They are developing systems to control the principal citrus pests, and their experience on “insects sexual confusion” has been invaluable for us, and has improved the achievements of our <span class="red-bold">Sexy Plant</span> as a new pest management method. <br />
</p><br />
<br />
<br/><br/><br />
<br/><br />
<h3><i>"Projects like The Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture"</i></h3></html><br />
[[File:VUPV Bayer2.png|350px|left]] <br />
<html><br />
<br/><br />
<h3 align="right">Bayer CropScience, Valencia</h3><br />
<br/><br />
<p>Mr. Jorge Silva is the Head of Bayer CropScience Technical Department. Jorge liked <span class="red-bold">Sexy Plant</span> as a system to fight against pests. He highlighted the necessity to find new approaches in sustainable agriculture, and that our project could have future in the market. We discussed the advances in plant synthetic biology and he concluded “projects like Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture”. Jorge gave us invaluable feedback on how to improve certain details to ease the commercialization of Sexy Plant in the future, and asked us to send an executive summary of our project to Bayer CropScience headquarters in Ghent. As result of the meeting, Bayer CropScience wrote an official support letter for our project, and asked to be informed about further developments of the project in the future. </p><p align="right"> Valencia, October 2014</p><br />
<br />
<br />
<br/><br/><br />
<br/><br />
<br/><br />
<h3> Department of Crop and Forest Science, University of Lleida.</h3><br />
<br/><br />
</html><br />
[[File:2014-09-24_Lleida.jpg|350px|right]]<br />
<html><br />
<br/><br />
<p>Matilde Eizaguirre has an expertise in integrated control of agricultural pests, she and her team work with S. nonagrioides moths among other species. She has been working on the effect of other specie pheromones in male response. She and her master students received our visit in the University of Lleida and they kindly accepted to provide us moth individuals which were used in Electroantennography and Wind tunnel assays. She introduced us to their colleagues and they show us their facilities and homemade devices for biologically testing pheromones. All of them were very enthusiastic about the project and they could not wait to find out more about the <span class="red-bold">Sexy Plant</span>.</p><br />
<br />
<br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<h3><b>Interviews</b></h3><br />
<br/><br/><br />
<br />
</html><br />
[[Image:VUPV_Coque.jpg|400px|right]] <br />
<html><br />
<h3><i>“Sexy Plant could be a good approach to reduce the costs of pheromone production” </i></h3><br />
<br />
<p>Jose Maria Garcia Alvarez-Coque is a social researcher and Director of the Sustainable Agriculture group, at the Universitat Politècnica de Valencia (UPV). </p><br />
<p><br />
He considers the currently pheromone synthesis as an expensive method to produce insect pheromones. “Sexy Plant could be a good approach to reduce the costs of pheromone production”. This project is another ecological way to manage pests, such as the production of auxiliary insects to protect crops. In addition, Sexy Plant can be a safe, sustainable and environmentlly friendly method, as far as it respects agricultural and environmental specifications. <span class="red-bold">Sexy Plant</span> modules like Identity Preservation or Sterility are characteristics that assist the long-term use of this plant. </p><br/><br />
<p align="right"> Valencia, September 2014</p><br />
<br/><br/><br />
<br/><br/><br />
</html><br />
[[Image:UPV_Cooperativa.jpg|400px|right]] <br />
<html><br />
<br />
<h3><i>“We have been using sexual confusion as a pest management method in rice crops for the last 20 years” </i></h3><br />
<p><br />
Paco Girona is agriculture engineer at Cooperatives for Agrofood industry (FECOAV). He makes efforts to extend the use of ecological pest methods over some typical crops in Valencia, Spain. </p><br />
<p><br />
Around the Albufera Natural Park in Valencia, the cycle sown rice starts in May when the farmers should start protecting their crops from the <i>Chilo</i> lepidopter (moth) pest. During the first days of May, technicians place pheromone sticks between rice plants to release the Chilo female moth pheromone into the environment. The planted area is around 15,000 Ha of crop, and they are protected by 462,960 pheromone sticks. This technique has been used for the last 20 years, and the economic losses have been cut down to approximately a mere 0.5%. Paco Girona explains that Sexy Plant coul be a wonderful alternative to chemically synthetized pheromone sticks, specially during its assembly, the most hazardous part of its production. “If you get the <span class="red-bold">Sexy Plant</span>, I take my hat off” </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
<p>Our team also talked with Professor Sam Tothill, Professor of Biosensors in Health at Cranfield University, United Kingdom. Her current research mainly focuses in biosensors for microbial contaminants and pathogen's (bacteria, viruses, fungi) and their toxins. We really appreciated her feedback as part of her research consist in the detection of contaminants such as pesticides in food. We discussed about safety issues and how could our project be implemented in agriculture. She really liked the about the <span class="red-bold">Sexy Plant</span> project and wished our team succeeded at iGEM. </p><br />
<p align="right"> Cranfield, October 2014</p><br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/activities
Team:Valencia UPV/policy/activities
2014-10-18T01:20:32Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>ctivities</span> </div><br/><br/><br />
<br />
<h3><b>Permanent meetings and activities</b></h3><br />
<br/><br />
<h3> Center for Chemical Ecology (CEQA), Valencia.</h3><br />
<br/><br />
</html><br />
[[File:UPV_CEQA.jpg|500px|right]] <br />
<html><br />
<p><br />
CEQA has expertise in the isolation and identification of semiochemicals, the formulation of pheromone attractants and controlled rate emitters.</p><br />
<p><br />
Jaime Primo Millo is the Director of the Agricultural Center for Chemical Ecology (CEQA), and professor of organic chemistry at UPV. Jaime Primo, Ismael Navarro, Vicente Navarro and Sandra Vacas have continuously advised the Valencia UPV iGEM team since we first met them. They are developing systems to control the principal citrus pests, and their experience on “insects sexual confusion” has been invaluable for us, and has improved the achievements of our <span class="red-bold">Sexy Plant</span> as a new pest management method. <br />
</p><br />
<br />
<br/><br/><br />
<br/><br />
<h3><i>"Projects like The Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture"</i></h3></html><br />
[[File:VUPV Bayer2.png|350px|left]] <br />
<html><br />
<br/><br />
<h3 align="right">Bayer CropScience, Valencia</h3><br />
<br/><br />
<p>Mr. Jorge Silva is the Head of Bayer CropScience Technical Department. Jorge liked <span class="red-bold">Sexy Plant</span> as a system to fight against pests. He highlighted the necessity to find new approaches in sustainable agriculture, and that our project could have future in the market. We discussed the advances in plant synthetic biology and he concluded “projects like Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture”. Jorge gave us invaluable feedback on how to improve certain details to ease the commercialization of Sexy Plant in the future, and asked us to send an executive summary of our project to Bayer CropScience headquarters in Ghent. As result of the meeting, Bayer CropScience wrote an official support letter for our project, and asked to be informed about further developments of the project in the future. </p><p align="right"> Valencia, October 2014</p><br />
<br />
<br />
<br/><br/><br />
<br/><br />
<br/><br />
<h3> Department of Crop and Forest Science, University of Lleida.</h3><br />
<br/><br />
</html><br />
[[File:2014-09-24_Lleida.jpg|350px|right]]<br />
<html><br />
<br/><br />
<p>Matilde Eizaguirre has an expertise in integrated control of agricultural pests, she and her team work with S. nonagrioides moths among other species. She has been working on the effect of other specie pheromones in male response. She and her master students received our visit in the University of Lleida and they kindly accepted to provide us moth individuals which were used in Electroantennography and Wind tunnel assays. She introduced us to their colleagues and they show us their facilities and homemade devices for biologically testing pheromones. All of them were very enthusiastic about the project and they could not wait to find out more about the <span class="red-bold">Sexy Plant</span>.</p><br />
<br />
<br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<h3><b>Interviews</b></h3><br />
<br/><br/><br />
<br />
</html><br />
[[Image:VUPV_Coque.jpg|400px|right]] <br />
<html><br />
<h3><i>“Sexy Plant could be a good approach to reduce the costs of pheromone production” </i></h3><br />
<br />
<p>Jose Maria Garcia Alvarez-Coque is a social researcher and Director of the Sustainable Agriculture group, at the Universitat Politècnica de Valencia (UPV). </p><br />
<p><br />
He considers the currently pheromone synthesis as an expensive method to produce insect pheromones. “Sexy Plant could be a good approach to reduce the costs of pheromone production”. This project is another ecological way to manage pests, such as the production of auxiliary insects to protect crops. In addition, Sexy Plant can be a safe, sustainable and environmentlly friendly method, as far as it respects agricultural and environmental specifications. <span class="red-bold">Sexy Plant</span> modules like Identity Preservation or Sterility are characteristics that assist the long-term use of this plant. </p><br/><br />
<p align="right"> Valencia, September 2014</p><br />
<br/><br/><br />
<br/><br/><br />
</html><br />
[[Image:UPV_Cooperativa.jpg|400px|right]] <br />
<html><br />
<br />
<h3><i>“We have been using sexual confusion as a pest management method in rice crops for the last 20 years” </i></h3><br />
<p><br />
Paco Girona is agriculture engineer at Cooperatives for Agrofood industry (FECOAV). He makes efforts to extend the use of ecological pest methods over some typical crops in Valencia, Spain. </p><br />
<p><br />
Around the Albufera Natural Park in Valencia, the cycle sown rice starts in May when the farmers should start protecting their crops from the <i>Chilo</i> lepidopter (moth) pest. During the first days of May, technicians place pheromone sticks between rice plants to release the Chilo female moth pheromone into the environment. The planted area is around 15,000 Ha of crop, and they are protected by 462,960 pheromone sticks. This technique has been used for the last 20 years, and the economic losses have been cut down to approximately a mere 0.5%. Paco Girona explains that Sexy Plant coul be a wonderful alternative to chemically synthetized pheromone sticks, specially during its assembly, the most hazardous part of its production. “If you get the <span class="red-bold">Sexy Plant</span>, I take my hat off” </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
<p>Our team also talked with Professor Sam Tothill, Professor of Biosensors in Health at Cranfield University, United Kingdom. Her current research mainly focuses in biosensors for microbial contaminants and pathogen's (bacteria, viruses, fungi) and their toxins. We really appreciated her feedback as part of her research consist in the detection of contaminants such as pesticides in food. We discussed about safety issues and how could our project be implemented in agriculture. She really liked the about the <span class="red-bold">Sexy Plant</span> project and wished our team succeeded at iGEM. </p><br />
<p align="right"> Cranfield, October 2014</p><br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/activities
Team:Valencia UPV/policy/activities
2014-10-18T01:19:53Z
<p>Alrual: Undo revision 381315 by Alrual (talk)</p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>ctivities</span> </div><br/><br/><br />
<br />
<h3><b>Permanent meetings and activities</b></h3><br />
<br/><br />
<h3> Center for Chemical Ecology (CEQA), Valencia.</h3><br />
<br/><br />
</html><br />
[[File:UPV_CEQA.jpg|500px|right]] <br />
<html><br />
<p><br />
CEQA has expertise in the isolation and identification of semiochemicals, the formulation of pheromone attractants and controlled rate emitters.</p><br />
<p><br />
Jaime Primo Millo is the Director of the Agricultural Center for Chemical Ecology (CEQA), and professor of organic chemistry at UPV. Jaime Primo, Ismael Navarro, Vicente Navarro and Sandra Vacas have continuously advised the Valencia UPV iGEM team since we first met them. They are developing systems to control the principal citrus pests, and their experience on “insects sexual confusion” has been invaluable for us, and has improved the achievements of our <span class="red-bold">Sexy Plant</span> as a new pest management method. <br />
</p><br />
<br />
<br/><br/><br />
<br/><br />
<h3><i>"Projects like The Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture"</i></h3></html><br />
[[File:VUPV Bayer2.png|350px|left]] <br />
<html><br />
<br/><br />
<h3 align="right">Bayer CropScience, Valencia</h3><br />
<br/><br />
<p>Mr. Jorge Silva is the Head of Bayer CropScience Technical Department. Jorge liked <span class="red-bold">Sexy Plant</span> as a system to fight against pests. He highlighted the necessity to find new approaches in sustainable agriculture, and that our project could have future in the market. We discussed the advances in plant synthetic biology and he concluded “projects like Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture”. Jorge gave us invaluable feedback on how to improve certain details to ease the commercialization of Sexy Plant in the future, and asked us to send an executive summary of our project to Bayer CropScience headquarters in Ghent. As result of the meeting, Bayer CropScience wrote an official support letter for our project, and asked to be informed about further developments of the project in the future. </p><p align="right"> Valencia, October 2014</p><br />
<br />
<br />
<br/><br/><br />
<br/><br />
<br/><br />
<h3> Department of Crop and Forest Science, University of Lleida.</h3><br />
<br/><br />
</html><br />
[[File:2014-09-24_Lleida.jpg|350px|right]]<br />
<html><br />
<br/><br />
<p>Matilde Eizaguirre has an expertise in integrated control of agricultural pests, she and her team work with S. nonagrioides moths among other species. She has been working on the effect of other specie pheromones in male response. She and her master students received our visit in the University of Lleida and they kindly accepted to provide us moth individuals which were used in Electroantennography and Wind tunnel assays. She introduced us to their colleagues and they show us their facilities and homemade devices for biologically testing pheromones. All of them were very enthusiastic about the project and they could not wait to find out more about the <span class="red-bold">Sexy Plant</span>.</p><br />
<br/><br/><br />
<p align="right"> Lleida, September 2014</p><br />
<br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<h3><b>Interviews</b></h3><br />
<br/><br/><br />
<br />
</html><br />
[[Image:VUPV_Coque.jpg|400px|right]] <br />
<html><br />
<h3><i>“Sexy Plant could be a good approach to reduce the costs of pheromone production” </i></h3><br />
<br />
<p>Jose Maria Garcia Alvarez-Coque is a social researcher and Director of the Sustainable Agriculture group, at the Universitat Politècnica de Valencia (UPV). </p><br />
<p><br />
He considers the currently pheromone synthesis as an expensive method to produce insect pheromones. “Sexy Plant could be a good approach to reduce the costs of pheromone production”. This project is another ecological way to manage pests, such as the production of auxiliary insects to protect crops. In addition, Sexy Plant can be a safe, sustainable and environmentlly friendly method, as far as it respects agricultural and environmental specifications. <span class="red-bold">Sexy Plant</span> modules like Identity Preservation or Sterility are characteristics that assist the long-term use of this plant. </p><br/><br />
<p align="right"> Valencia, September 2014</p><br />
<br/><br/><br />
<br/><br/><br />
</html><br />
[[Image:UPV_Cooperativa.jpg|400px|right]] <br />
<html><br />
<br />
<h3><i>“We have been using sexual confusion as a pest management method in rice crops for the last 20 years” </i></h3><br />
<p><br />
Paco Girona is agriculture engineer at Cooperatives for Agrofood industry (FECOAV). He makes efforts to extend the use of ecological pest methods over some typical crops in Valencia, Spain. </p><br />
<p><br />
Around the Albufera Natural Park in Valencia, the cycle sown rice starts in May when the farmers should start protecting their crops from the <i>Chilo</i> lepidopter (moth) pest. During the first days of May, technicians place pheromone sticks between rice plants to release the Chilo female moth pheromone into the environment. The planted area is around 15,000 Ha of crop, and they are protected by 462,960 pheromone sticks. This technique has been used for the last 20 years, and the economic losses have been cut down to approximately a mere 0.5%. Paco Girona explains that Sexy Plant coul be a wonderful alternative to chemically synthetized pheromone sticks, specially during its assembly, the most hazardous part of its production. “If you get the <span class="red-bold">Sexy Plant</span>, I take my hat off” </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
<p>Our team also talked with Professor Sam Tothill, Professor of Biosensors in Health at Cranfield University, United Kingdom. Her current research mainly focuses in biosensors for microbial contaminants and pathogen's (bacteria, viruses, fungi) and their toxins. We really appreciated her feedback as part of her research consist in the detection of contaminants such as pesticides in food. We discussed about safety issues and how could our project be implemented in agriculture. She really liked the about the <span class="red-bold">Sexy Plant</span> project and wished our team succeeded at iGEM. </p><br />
<p align="right"> Cranfield, October 2014</p><br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/activities
Team:Valencia UPV/policy/activities
2014-10-18T01:19:10Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>ctivities</span> </div><br/><br/><br />
<br />
<h3><b>Permanent meetings and activities</b></h3><br />
<br/><br />
<h3> Center for Chemical Ecology (CEQA), Valencia.</h3><br />
<br/><br />
</html><br />
[[File:UPV_CEQA.jpg|500px|right]] <br />
<html><br />
<p><br />
CEQA has expertise in the isolation and identification of semiochemicals, the formulation of pheromone attractants and controlled rate emitters.</p><br />
<p><br />
Jaime Primo Millo is the Director of the Agricultural Center for Chemical Ecology (CEQA), and professor of organic chemistry at UPV. Jaime Primo, Ismael Navarro, Vicente Navarro and Sandra Vacas have continuously advised the Valencia UPV iGEM team since we first met them. They are developing systems to control the principal citrus pests, and their experience on “insects sexual confusion” has been invaluable for us, and has improved the achievements of our <span class="red-bold">Sexy Plant</span> as a new pest management method. <br />
</p><br />
<br />
<br/><br/><br />
<br/><br />
<h3><i>"Projects like The Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture"</i></h3></html><br />
[[File:VUPV Bayer2.png|350px|left]] <br />
<html><br />
<br/><br />
<h3 align="right">Bayer CropScience, Valencia</h3><br />
<br/><br />
<p>Mr. Jorge Silva is the Head of Bayer CropScience Technical Department. Jorge liked <span class="red-bold">Sexy Plant</span> as a system to fight against pests. He highlighted the necessity to find new approaches in sustainable agriculture, and that our project could have future in the market. We discussed the advances in plant synthetic biology and he concluded “projects like Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture”. Jorge gave us invaluable feedback on how to improve certain details to ease the commercialization of Sexy Plant in the future, and asked us to send an executive summary of our project to Bayer CropScience headquarters in Ghent. As result of the meeting, Bayer CropScience wrote an official support letter for our project, and asked to be informed about further developments of the project in the future. </p><p align="right"> Valencia, October 2014</p><br />
<br />
<br />
<br/><br/><br />
<br/><br />
<br/><br />
<h3> Department of Crop and Forest Science, University of Lleida.</h3><br />
<br/><br />
</html><br />
[[File:2014-09-24_Lleida.jpg|350px|right]]<br />
<html><br />
<br/><br />
<p>Matilde Eizaguirre has an expertise in integrated control of agricultural pests, she and her team work with S. nonagrioides moths among other species. She has been working on the effect of other specie pheromones in male response. She and her master students received our visit in the University of Lleida and they kindly accepted to provide us moth individuals which were used in Electroantennography and Wind tunnel assays. She introduced us to their colleagues and they show us their facilities and homemade devices for biologically testing pheromones. All of them were very enthusiastic about the project and they could not wait to find out more about the <span class="red-bold">Sexy Plant</span>.</p><br />
<br/><br/><br />
<p align="right"> Lleida, September 2014</p><br />
<br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<h3><b>Interviews</b></h3><br />
<br/><br/><br />
<br />
</html><br />
[[Image:VUPV_Coque.jpg|400px|right]] <br />
<html><br />
<h3><i>“Sexy Plant could be a good approach to reduce the costs of pheromone production” </i></h3><br />
<br />
<p>Jose Maria Garcia Alvarez-Coque is a social researcher and Director of the Sustainable Agriculture group, at the Universitat Politècnica de Valencia (UPV). </p><br />
<p><br />
He considers the currently pheromone synthesis as an expensive method to produce insect pheromones. “Sexy Plant could be a good approach to reduce the costs of pheromone production”. This project is another ecological way to manage pests, such as the production of auxiliary insects to protect crops. In addition, Sexy Plant can be a safe, sustainable and environmentlly friendly method, as far as it respects agricultural and environmental specifications. <span class="red-bold">Sexy Plant</span> modules like Identity Preservation or Sterility are characteristics that assist the long-term use of this plant. </p><br />
<br/><br/><br />
<br/><br/><br />
</html><br />
[[Image:UPV_Cooperativa.jpg|400px|right]] <br />
<html><br />
<br />
<h3><i>“We have been using sexual confusion as a pest management method in rice crops for the last 20 years” </i></h3><br />
<p><br />
Paco Girona is agriculture engineer at Cooperatives for Agrofood industry (FECOAV). He makes efforts to extend the use of ecological pest methods over some typical crops in Valencia, Spain. </p><br />
<p><br />
Around the Albufera Natural Park in Valencia, the cycle sown rice starts in May when the farmers should start protecting their crops from the <i>Chilo</i> lepidopter (moth) pest. During the first days of May, technicians place pheromone sticks between rice plants to release the Chilo female moth pheromone into the environment. The planted area is around 15,000 Ha of crop, and they are protected by 462,960 pheromone sticks. This technique has been used for the last 20 years, and the economic losses have been cut down to approximately a mere 0.5%. Paco Girona explains that Sexy Plant coul be a wonderful alternative to chemically synthetized pheromone sticks, specially during its assembly, the most hazardous part of its production. “If you get the <span class="red-bold">Sexy Plant</span>, I take my hat off” </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
<p>Our team also talked with Professor Sam Tothill, Professor of Biosensors in Health at Cranfield University, United Kingdom. Her current research mainly focuses in biosensors for microbial contaminants and pathogen's (bacteria, viruses, fungi) and their toxins. We really appreciated her feedback as part of her research consist in the detection of contaminants such as pesticides in food. We discussed about safety issues and how could our project be implemented in agriculture. She really liked the about the <span class="red-bold">Sexy Plant</span> project and wished our team succeeded at iGEM. </p><br />
<p align="right"> Cranfield, October 2014</p><br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/activities
Team:Valencia UPV/policy/activities
2014-10-18T01:17:55Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>ctivities</span> </div><br/><br/><br />
<br />
<h3><b>Permanent meetings and activities</b></h3><br />
<br/><br />
<h3> Center for Chemical Ecology (CEQA), Valencia.</h3><br />
<br/><br />
</html><br />
[[File:UPV_CEQA.jpg|500px|right]] <br />
<html><br />
<p><br />
CEQA has expertise in the isolation and identification of semiochemicals, the formulation of pheromone attractants and controlled rate emitters.</p><br />
<p><br />
Jaime Primo Millo is the Director of the Agricultural Center for Chemical Ecology (CEQA), and professor of organic chemistry at UPV. Jaime Primo, Ismael Navarro, Vicente Navarro and Sandra Vacas have continuously advised the Valencia UPV iGEM team since we first met them. They are developing systems to control the principal citrus pests, and their experience on “insects sexual confusion” has been invaluable for us, and has improved the achievements of our <span class="red-bold">Sexy Plant</span> as a new pest management method. <br />
</p><br />
<br />
<br/><br/><br />
<br/><br />
<h3><i>"Projects like The Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture"</i></h3></html><br />
[[File:VUPV Bayer2.png|350px|left]] <br />
<html><br />
<br/><br />
<h3 align="right">Bayer CropScience, Valencia</h3><br />
<br/><br />
<p>Mr. Jorge Silva is the Head of Bayer CropScience Technical Department. Jorge liked <span class="red-bold">Sexy Plant</span> as a system to fight against pests. He highlighted the necessity to find new approaches in sustainable agriculture, and that our project could have future in the market. We discussed the advances in plant synthetic biology and he concluded “projects like Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture”. Jorge gave us invaluable feedback on how to improve certain details to ease the commercialization of Sexy Plant in the future, and asked us to send an executive summary of our project to Bayer CropScience headquarters in Ghent. As result of the meeting, Bayer CropScience wrote an official support letter for our project, and asked to be informed about further developments of the project in the future. </p><p align="right"> Valencia, October 2014</p><br />
<br />
<br />
<br/><br/><br />
<br/><br />
<br/><br />
<h3> Department of Crop and Forest Science, University of Lleida.</h3><br />
<br/><br />
</html><br />
[[File:2014-09-24_Lleida.jpg|350px|right]]<br />
<html><br />
<br/><br />
<p>Matilde Eizaguirre has an expertise in integrated control of agricultural pests, she and her team work with S. nonagrioides moths among other species. She has been working on the effect of other specie pheromones in male response. She and her master students received our visit in the University of Lleida and they kindly accepted to provide us moth individuals which were used in Electroantennography and Wind tunnel assays. She introduced us to their colleagues and they show us their facilities and homemade devices for biologically testing pheromones. All of them were very enthusiastic about the project and they could not wait to find out more about the <span class="red-bold">Sexy Plant</span>.</p><br />
<br/><br/><br />
<p align="right"> Lleida, September 2014</p><br />
<br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<h3><b>Interviews</b></h3><br />
<br/><br/><br />
<br />
</html><br />
[[Image:VUPV_Coque.jpg|400px|right]] <br />
<html><br />
<h3><i>“Sexy Plant could be a good approach to reduce the costs of pheromone production” </i></h3><br />
<br />
<p>Jose Maria Garcia Alvarez-Coque is a social researcher and Director of the Sustainable Agriculture group, at the Universitat Politècnica de Valencia (UPV). </p><br />
<p><br />
He considers the currently pheromone synthesis as an expensive method to produce insect pheromones. “Sexy Plant could be a good approach to reduce the costs of pheromone production”. This project is another ecological way to manage pests, such as the production of auxiliary insects to protect crops. In addition, Sexy Plant can be a safe, sustainable and environmentlly friendly method, as far as it respects agricultural and environmental specifications. <span class="red-bold">Sexy Plant</span> modules like Identity Preservation or Sterility are characteristics that assist the long-term use of this plant. </p><br/><br />
<p align="right"> Valencia, September 2014</p><br />
<br/><br/><br />
<br/><br/><br />
</html><br />
[[Image:UPV_Cooperativa.jpg|400px|right]] <br />
<html><br />
<br />
<h3><i>“We have been using sexual confusion as a pest management method in rice crops for the last 20 years” </i></h3><br />
<p><br />
Paco Girona is agriculture engineer at Cooperatives for Agrofood industry (FECOAV). He makes efforts to extend the use of ecological pest methods over some typical crops in Valencia, Spain. </p><br />
<p><br />
Around the Albufera Natural Park in Valencia, the cycle sown rice starts in May when the farmers should start protecting their crops from the <i>Chilo</i> lepidopter (moth) pest. During the first days of May, technicians place pheromone sticks between rice plants to release the Chilo female moth pheromone into the environment. The planted area is around 15,000 Ha of crop, and they are protected by 462,960 pheromone sticks. This technique has been used for the last 20 years, and the economic losses have been cut down to approximately a mere 0.5%. Paco Girona explains that Sexy Plant coul be a wonderful alternative to chemically synthetized pheromone sticks, specially during its assembly, the most hazardous part of its production. “If you get the <span class="red-bold">Sexy Plant</span>, I take my hat off” </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
<p>Our team also talked with Professor Sam Tothill, Professor of Biosensors in Health at Cranfield University, United Kingdom. Her current research mainly focuses in biosensors for microbial contaminants and pathogen's (bacteria, viruses, fungi) and their toxins. We really appreciated her feedback as part of her research consist in the detection of contaminants such as pesticides in food. We discussed about safety issues and how could our project be implemented in agriculture. She really liked the about the <span class="red-bold">Sexy Plant</span> project and wished our team succeeded at iGEM. </p><br />
<p align="right"> Cranfield, October 2014</p><br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/activities
Team:Valencia UPV/policy/activities
2014-10-18T01:17:13Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>ctivities</span> </div><br/><br/><br />
<br />
<h3><b>Permanent meetings and activities</b></h3><br />
<br/><br />
<h3> Center for Chemical Ecology (CEQA), Valencia.</h3><br />
<br/><br />
</html><br />
[[File:UPV_CEQA.jpg|500px|right]] <br />
<html><br />
<p><br />
CEQA has expertise in the isolation and identification of semiochemicals, the formulation of pheromone attractants and controlled rate emitters.</p><br />
<p><br />
Jaime Primo Millo is the Director of the Agricultural Center for Chemical Ecology (CEQA), and professor of organic chemistry at UPV. Jaime Primo, Ismael Navarro, Vicente Navarro and Sandra Vacas have continuously advised the Valencia UPV iGEM team since we first met them. They are developing systems to control the principal citrus pests, and their experience on “insects sexual confusion” has been invaluable for us, and has improved the achievements of our <span class="red-bold">Sexy Plant</span> as a new pest management method. <br />
</p><br />
<br />
<br/><br/><br />
<br/><br />
<h3><i>"Projects like The Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture"</i></h3></html><br />
[[File:VUPV Bayer2.png|350px|left]] <br />
<html><br />
<br/><br />
<h3 align="right">Bayer CropScience, Valencia</h3><br />
<br/><br />
<p>Mr. Jorge Silva is the Head of Bayer CropScience Technical Department. Jorge liked <span class="red-bold">Sexy Plant</span> as a system to fight against pests. He highlighted the necessity to find new approaches in sustainable agriculture, and that our project could have future in the market. We discussed the advances in plant synthetic biology and he concluded “projects like Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture”. Jorge gave us invaluable feedback on how to improve certain details to ease the commercialization of Sexy Plant in the future, and asked us to send an executive summary of our project to Bayer CropScience headquarters in Ghent. As result of the meeting, Bayer CropScience wrote an official support letter for our project, and asked to be informed about further developments of the project in the future. </p><p align="right"> Valencia, October 2014</p><br />
<br />
<br />
<br/><br/><br />
<br/><br />
<br/><br />
<h3> Department of Crop and Forest Science, University of Lleida.</h3><br />
<br/><br />
</html><br />
[[File:2014-09-24_Lleida.jpg|350px|right]]<br />
<html><br />
<br/><br />
<p>Matilde Eizaguirre has an expertise in integrated control of agricultural pests, she and her team work with S. nonagrioides moths among other species. She has been working on the effect of other specie pheromones in male response. She and her master students received our visit in the University of Lleida and they kindly accepted to provide us moth individuals which were used in Electroantennography and Wind tunnel assays. She introduced us to their colleagues and they show us their facilities and homemade devices for biologically testing pheromones. All of them were very enthusiastic about the project and they could not wait to find out more about the <span class="red-bold">Sexy Plant</span>.</p><br />
<p align="right"> Lleida, September 2014</p><br />
<br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<h3><b>Interviews</b></h3><br />
<br/><br/><br />
<br />
</html><br />
[[Image:VUPV_Coque.jpg|400px|right]] <br />
<html><br />
<h3><i>“Sexy Plant could be a good approach to reduce the costs of pheromone production” </i></h3><br />
<br />
<p>Jose Maria Garcia Alvarez-Coque is a social researcher and Director of the Sustainable Agriculture group, at the Universitat Politècnica de Valencia (UPV). </p><br />
<p><br />
He considers the currently pheromone synthesis as an expensive method to produce insect pheromones. “Sexy Plant could be a good approach to reduce the costs of pheromone production”. This project is another ecological way to manage pests, such as the production of auxiliary insects to protect crops. In addition, Sexy Plant can be a safe, sustainable and environmentlly friendly method, as far as it respects agricultural and environmental specifications. <span class="red-bold">Sexy Plant</span> modules like Identity Preservation or Sterility are characteristics that assist the long-term use of this plant. </p><br/><br />
<p align="right"> Valencia, September 2014</p><br />
<br/><br/><br />
<br/><br/><br />
</html><br />
[[Image:UPV_Cooperativa.jpg|400px|right]] <br />
<html><br />
<br />
<h3><i>“We have been using sexual confusion as a pest management method in rice crops for the last 20 years” </i></h3><br />
<p><br />
Paco Girona is agriculture engineer at Cooperatives for Agrofood industry (FECOAV). He makes efforts to extend the use of ecological pest methods over some typical crops in Valencia, Spain. </p><br />
<p><br />
Around the Albufera Natural Park in Valencia, the cycle sown rice starts in May when the farmers should start protecting their crops from the <i>Chilo</i> lepidopter (moth) pest. During the first days of May, technicians place pheromone sticks between rice plants to release the Chilo female moth pheromone into the environment. The planted area is around 15,000 Ha of crop, and they are protected by 462,960 pheromone sticks. This technique has been used for the last 20 years, and the economic losses have been cut down to approximately a mere 0.5%. Paco Girona explains that Sexy Plant coul be a wonderful alternative to chemically synthetized pheromone sticks, specially during its assembly, the most hazardous part of its production. “If you get the <span class="red-bold">Sexy Plant</span>, I take my hat off” </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
<p>Our team also talked with Professor Sam Tothill, Professor of Biosensors in Health at Cranfield University, United Kingdom. Her current research mainly focuses in biosensors for microbial contaminants and pathogen's (bacteria, viruses, fungi) and their toxins. We really appreciated her feedback as part of her research consist in the detection of contaminants such as pesticides in food. We discussed about safety issues and how could our project be implemented in agriculture. She really liked the about the <span class="red-bold">Sexy Plant</span> project and wished our team succeeded at iGEM. </p><br />
<p align="right"> Cranfield, October 2014</p><br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Collaboration
Team:Valencia UPV/Collaboration
2014-10-18T01:12:58Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Collaboration</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>C</roja>ollaborations</span> </div><br/><br/><br />
<br />
<h3>Collaboration with other iGEM Plant Teams</h3><br />
<p><br />
The engineering of plant systems provides enormous potential benefits. Plants can be engineered to synthesize all kinds of bioproducts, from the simplest sugar to the most sophisticated recombinant antibody, on the large scale at extremely low cost. We would like to see more and more Plant projects in iGEM, so we decided to share our experiences with other Plant teams: The Cambridge-JIC and the NRP-UEA-Norwich teams. These are the outcomes of our collaboration:<br />
</p><br />
<br/><br />
<br />
<h4>New RFC with Cambridge and NRP-UEA-Norwich teams.</h4><br />
<br/><br />
<p>The Plant chassis presents specific features that engineers need to take into account: plants are multicellular organisms, with eukaryotic gene structure, making use of plant-specific regulatory regions and requiring special T-vectors for transformation, to mention only some of them. Consequently, general SynBio standards and repositories need certain adaptations to facilitate engineering with plant chassis. To discuss the technical requirements of Plant Projects within iGEM and beyond, we have prepared a RFC document on Plant Standards in Synthetic Biology. We expect to discuss this document, together with the implications and perspectives of Plant Synthetic Biology in a Special Workshop that will be held during the 2014 Jamboree. You are all invited to assist!</p><br />
<br/><br />
<br />
<h4>Parts exchange and characterization: </h4><br />
<p><br />
We also collaborated by exchanging parts. <a href="https://2014.igem.org/Team:NRP-UEA-Norwich/HP_Collaborations" class="normal-link-page">NRP-UEA-Norwich</a> provided us with their chromoproteins (AmilCP (Bba_K1467201) and AmilGFP (Bba_K1467202)) so we could test both our system and their parts as we both worked in the same plant chassis (<i>Nicotiana benthamiana</i>). With these parts our team developed two biosafety devices BBa_K1554004 and BBa_K1554005. In addition, the NRP-UEA iGEM Team also provided us with their Module Flipper. We tested them in GoldenBraid standard parts and they worked perfectly. In return, we provided NRP-UEA-Norwich with our Barnase module for male sterility, that they were incorporating to their plant system for enhanced biosecurity.<br />
</p><br />
<br/><br />
<br/><br />
<h3>Other Collaborations</h3><br/><br />
<p><br />
We also collaborated with the <a href="https://2014.igem.org/Team:Paris_Bettencourt" class="normal-link-page">Paris_Bettencourt</a> and the <a href="https://2014.igem.org/Team:Sheffield" class="normal-link-page">Sheffield</a> iGEM Teams.<br />
We participated in four regular issues of the Paris Bettencourt iGEM Team Newsletter and in its <a href="https://2014.igem.org/Team:Paris_Bettencourt/Newsletter#news4" class="normal-link-page">special issue</a>. <br />
We also participated in <a href="http://genius.com/tags/mooc-igem-high-school/all" class="normal-link-page">MOOC iGEM High School</a>.<br />
With the Sheffield iGEM Team we collaborated with their Lab Notation.<br />
</p><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Collaboration
Team:Valencia UPV/Collaboration
2014-10-18T01:09:16Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Collaboration</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>C</roja>ollaborations</span> </div><br/><br/><br />
<br />
<h3>Collaboration with other iGEM Plant Teams</h3><br />
<p><br />
The engineering of plant systems provides enormous potential benefits. Plants can be engineered to synthesize all kinds of bioproducts, from the simplest sugar to the most sophisticated recombinant antibody, on the large scale at extremely low cost. We would like to see more and more Plant projects in iGEM, so we decided to share our experiences with other Plant teams: The Cambridge-JIC and the NRP-UEA-Norwich teams. These are the outcomes of our collaboration:<br />
</p><br />
<br/><br />
<br />
<h4>New RFC with Cambridge and NRP-UEA-Norwich teams.</h4><br />
<br/><br />
<p>The Plant chassis presents specific features that engineers need to take into account: plants are multicellular organisms, with eukaryotic gene structure, making use of plant-specific regulatory regions and requiring special T-vectors for transformation, to mention only some of them. Consequently, general SynBio standards and repositories need certain adaptations to facilitate engineering with plant chassis. To discuss the technical requirements of Plant Projects within iGEM and beyond, we have prepared a RFC document on Plant Standards in Synthetic Biology. We expect to discuss this document, together with the implications and perspectives of Plant Synthetic Biology in a Special Workshop that will be held during the 2014 Jamboree. You are all invited to assist!</p><br />
<br/><br />
<br />
<h4>Parts exchange and characterization: </h4><br />
<p><br />
We also collaborated by exchanging parts. <a href="https://2014.igem.org/Team:NRP-UEA-Norwich/HP_Collaborations" class="normal-link-page">NRP-UEA-Norwich</a> provided us with their chromoproteins (AmilCP (Bba_K1467201) and AmilGFP (Bba_K1467202)) so we could test both our system and their parts as we both worked in the same plant chassis (Nicotiana benthamiana). With these parts our team developed two biosafety devices BBa_K1554004 and BBa_K1554005. In addition, the NRP-UEA IGEM Team also provided us with their Module Flipper. We tested them in GoldenBraid standard parts and they worked perfectly. In return, we provided NRP-UEA with our Barnase module for male sterility, that they were incorporating to their plant system for enhanced biosecurity.<br />
</p><br />
<br/><br />
<br/><br />
<h3>Other Collaborations</h3><br/><br />
<p><br />
We also collaborated with the <a href="https://2014.igem.org/Team:Paris_Bettencourt" class="normal-link-page">Paris_Bettencourt</a> and the <a href="https://2014.igem.org/Team:Sheffield" class="normal-link-page">Sheffield</a> iGEM Teams.<br />
We participated in four regular issues of the Paris Bettencourt iGEM Team Newsletter and in its <a href="https://2014.igem.org/Team:Paris_Bettencourt/Newsletter#news4" class="normal-link-page">special issue</a>. <br />
We also participated in <a href="http://genius.com/tags/mooc-igem-high-school/all" class="normal-link-page">MOOC iGEM High School</a>.<br />
With the Sheffield iGEM Team we collaborated with their Lab Notation.<br />
</p><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Collaboration
Team:Valencia UPV/Collaboration
2014-10-18T01:05:29Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Collaboration</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>C</roja>ollaborations</span> </div><br/><br/><br />
<br />
<h3>Collaboration with other iGEM Plant Teams</h3><br />
<p><br />
The engineering of plant systems provides enormous potential benefits. Plants can be engineered to synthesize all kinds of bioproducts, from the simplest sugar to the most sophisticated recombinant antibody, on the large scale at extremely low cost. We would like to see more and more Plant projects in iGEM, so we decided to share our experiences with other Plant teams: The Cambridge-JIC and the NRP-UEA-Norwich teams. These are the outcomes of our collaboration:<br />
</p><br />
<br/><br />
<br />
<h4>New RFC with Cambridge and NRP-UEA-Norwich teams.</h4><br />
<br/><br />
<p>The Plant chassis presents specific features that engineers need to take into account: plants are multicellular organisms, with eukaryotic gene structure, making use of plant-specific regulatory regions and requiring special T-vectors for transformation, to mention only some of them. Consequently, general SynBio standards and repositories need certain adaptations to facilitate engineering with plant chassis. To discuss the technical requirements of Plant Projects within iGEM and beyond, we have prepared a RFC document on Plant Standards in Synthetic Biology. We expect to discuss this document, together with the implications and perspectives of Plant Synthetic Biology in a Special Workshop that will be held during the 2014 Jamboree. You are all invited to assist!</p><br />
<br/><br />
<br />
<h4>Parts exchange and characterization: </h4><br />
<p><br />
We also collaborated by exchanging parts. NRP-UEA IGEM provided us with their chromoproteins (AmilCP (Bba_K1467201) and AmilGFP (Bba_K1467202)) so we could test both our system and their parts as we both worked in the same plant chassis (Nicotiana benthamiana). With these parts our team developed two biosafety devices BBa_K1554004 and BBa_K1554005. In addition, the NRP-UEA IGEM Team also provided us with their Module Flipper. We tested them in GoldenBraid standard parts and they worked perfectly. In return, we provided NRP-UEA with our Barnase module for male sterility, that they were incorporating to their plant system for enhanced biosecurity.<br />
</p><br />
<br/><br />
<br/><br />
<h3>Other Collaborations</h3><br/><br />
<p><br />
We also collaborated with the <a href="https://2014.igem.org/Team:Paris_Bettencourt" class="normal-link-page">Paris_Bettencourt</a> and the <a href="https://2014.igem.org/Team:Sheffield" class="normal-link-page">Sheffield</a> iGEM Teams.<br />
We participated in four regular issues of the Paris Bettencourt iGEM Team Newsletter and in its <a href="https://2014.igem.org/Team:Paris_Bettencourt/Newsletter#news4" class="normal-link-page">special issue</a>. <br />
We also participated in <a href="http://genius.com/tags/mooc-igem-high-school/all" class="normal-link-page">MOOC iGEM High School</a>.<br />
With the Sheffield iGEM Team we collaborated with their Lab Notation.<br />
</p><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/activities
Team:Valencia UPV/policy/activities
2014-10-18T00:58:20Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>ctivities</span> </div><br/><br/><br />
<br />
<h3><b>Permanent meetings and activities</b></h3><br />
<br/><br />
<h3> Center for Chemical Ecology (CEQA), Valencia.</h3><br />
<br/><br />
</html><br />
[[File:UPV_CEQA.jpg|500px|right]] <br />
<html><br />
<p><br />
CEQA has expertise in the isolation and identification of semiochemicals, the formulation of pheromone attractants and controlled rate emitters.</p><br />
<p><br />
Jaime Primo Millo is the Director of the Agricultural Center for Chemical Ecology (CEQA), and professor of organic chemistry at UPV. Jaime Primo, Ismael Navarro, Vicente Navarro and Sandra Vacas have continuously advised the Valencia UPV iGEM team since we first met them. They are developing systems to control the principal citrus pests, and their experience on “insects sexual confusion” has been invaluable for us, and has improved the achievements of our <span class="red-bold">Sexy Plant</span> as a new pest management method. <br />
</p><br />
<br />
<br/><br/><br />
<br/><br />
<h3><i>"Projects like The Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture"</i></h3></html><br />
[[File:VUPV Bayer2.png|350px|left]] <br />
<html><br />
<br/><br />
<h3 align="right">Bayer CropScience, Valencia</h3><br />
<br/><br />
<p>Mr. Jorge Silva is the Head of Bayer CropScience Technical Department. Jorge liked <span class="red-bold">Sexy Plant</span> as a system to fight against pests. He highlighted the necessity to find new approaches in sustainable agriculture, and that our project could have future in the market. We discussed the advances in plant synthetic biology and he concluded “projects like Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture”. Jorge gave us invaluable feedback on how to improve certain details to ease the commercialization of Sexy Plant in the future, and asked us to send an executive summary of our project to Bayer CropScience headquarters in Ghent. As result of the meeting, Bayer CropScience wrote an official support letter for our project, and asked to be informed about further developments of the project in the future. </p><p align="right"> Valencia, October 2014</p><br />
<br />
<br />
<br/><br/><br />
<br/><br />
<br/><br />
<h3> Department of Crop and Forest Science, University of Lleida.</h3><br />
<br/><br />
</html><br />
[[File:2014-09-24_Lleida.jpg|350px|right]]<br />
<html><br />
<br/><br />
<p>Matilde Eizaguirre has an expertise in integrated control of agricultural pests, she and her team work with S. nonagrioides moths among other species. She has been working on the effect of other specie pheromones in male response. She and her master students received our visit in the University of Lleida and they kindly accepted to provide us moth individuals which were used in Electroantennography and Wind tunnel assays. She introduced us to their colleagues and they show us their facilities and homemade devices for biologically testing pheromones. All of them were very enthusiastic about the project and they could not wait to find out more about the <span class="red-bold">Sexy Plant</span>.</p><br />
<br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<h3><b>Interviews</b></h3><br />
<br/><br/><br />
<br />
</html><br />
[[Image:VUPV_Coque.jpg|400px|right]] <br />
<html><br />
<h3><i>“Sexy Plant could be a good approach to reduce the costs of pheromone production” </i></h3><br />
<br />
<p>Jose Maria Garcia Alvarez-Coque is a social researcher and Director of the Sustainable Agriculture group, at the Universitat Politècnica de Valencia (UPV). </p><br />
<p><br />
He considers the currently pheromone synthesis as an expensive method to produce insect pheromones. “Sexy Plant could be a good approach to reduce the costs of pheromone production”. This project is another ecological way to manage pests, such as the production of auxiliary insects to protect crops. In addition, Sexy Plant can be a safe, sustainable and environmentlly friendly method, as far as it respects agricultural and environmental specifications. <span class="red-bold">Sexy Plant</span> modules like Identity Preservation or Sterility are characteristics that assist the long-term use of this plant. </p><br/><br />
<p align="right"> Valencia, September 2014</p><br />
<br/><br/><br />
<br/><br/><br />
</html><br />
[[Image:UPV_Cooperativa.jpg|400px|right]] <br />
<html><br />
<br />
<h3><i>“We have been using sexual confusion as a pest management method in rice crops for the last 20 years” </i></h3><br />
<p><br />
Paco Girona is agriculture engineer at Cooperatives for Agrofood industry (FECOAV). He makes efforts to extend the use of ecological pest methods over some typical crops in Valencia, Spain. </p><br />
<p><br />
Around the Albufera Natural Park in Valencia, the cycle sown rice starts in May when the farmers should start protecting their crops from the <i>Chilo</i> lepidopter (moth) pest. During the first days of May, technicians place pheromone sticks between rice plants to release the Chilo female moth pheromone into the environment. The planted area is around 15,000 Ha of crop, and they are protected by 462,960 pheromone sticks. This technique has been used for the last 20 years, and the economic losses have been cut down to approximately a mere 0.5%. Paco Girona explains that Sexy Plant coul be a wonderful alternative to chemically synthetized pheromone sticks, specially during its assembly, the most hazardous part of its production. “If you get the <span class="red-bold">Sexy Plant</span>, I take my hat off” </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
<p>Our team also talked with Professor Sam Tothill, Professor of Biosensors in Health at Cranfield University, United Kingdom. Her current research mainly focuses in biosensors for microbial contaminants and pathogen's (bacteria, viruses, fungi) and their toxins. We really appreciated her feedback as part of her research consist in the detection of contaminants such as pesticides in food. We discussed about safety issues and how could our project be implemented in agriculture. She really liked the about the <span class="red-bold">Sexy Plant</span> project and wished our team succeeded at iGEM. </p><br />
<p align="right"> Cranfield, October 2014</p><br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/policy/activities
Team:Valencia UPV/policy/activities
2014-10-18T00:57:00Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>A</roja>ctivities</span> </div><br/><br/><br />
<br />
<h3><b>Permanent meetings and activities</b></h3><br />
<br/><br />
<h3> Center for Chemical Ecology (CEQA), Valencia.</h3><br />
<br/><br />
</html><br />
[[File:UPV_CEQA.jpg|500px|right]] <br />
<html><br />
<p><br />
CEQA has expertise in the isolation and identification of semiochemicals, the formulation of pheromone attractants and controlled rate emitters.</p><br />
<p><br />
Jaime Primo Millo is the Director of the Agricultural Center for Chemical Ecology (CEQA), and professor of organic chemistry at UPV. Jaime Primo, Ismael Navarro, Vicente Navarro and Sandra Vacas have continuously advised the Valencia UPV iGEM team since we first met them. They are developing systems to control the principal citrus pests, and their experience on “insects sexual confusion” has been invaluable for us, and has improved the achievements of our <span class="red-bold">Sexy Plant</span> as a new pest management method. <br />
</p><br />
<br />
<br/><br/><br />
<br/><br />
<h3><i>"Projects like The Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture"</i></h3></html><br />
[[File:VUPV Bayer2.png|350px|left]] <br />
<html><br />
<br/><br />
<h3 align="right">Bayer CropScience, Valencia</h3><br />
<br/><br />
<p>Mr. Jorge Silva is the Head of Bayer CropScience Technical Department. Jorge liked <span class="red-bold">Sexy Plant</span> as a system to fight against pests. He highlighted the necessity to find new approaches in sustainable agriculture, and that our project could have future in the market. We discussed the advances in plant synthetic biology and he concluded “projects like Sexy Plant show us the importance Synthetic Biology may have in the future of agriculture”. Jorge gave us invaluable feedback on how to improve certain details to ease the commercialization of Sexy Plant in the future, and asked us to send an executive summary of our project to Bayer CropScience headquarters in Ghent. As result of the meeting, Bayer CropScience wrote an official support letter for our project, and asked to be informed about further developments of the project in the future. </p><p align="right"> Valencia, October 2014</p><br />
<br />
<br />
<br/><br/><br />
<br/><br />
<h3> Department of Crop and Forest Science, University of Lleida.</h3><br />
<br/><br />
</html><br />
[[File:2014-09-24_Lleida.jpg|350px|right]]<br />
<html><br />
<br/><br />
<p>Matilde Eizaguirre has an expertise in integrated control of agricultural pests, she and her team work with S. nonagrioides moths among other species. She has been working on the effect of other specie pheromones in male response. She and her master students received our visit in the University of Lleida and they kindly accepted to provide us moth individuals which were used in Electroantennography and Wind tunnel assays. She introduced us to their colleagues and they show us their facilities and homemade devices for biologically testing pheromones. All of them were very enthusiastic about the project and they could not wait to find out more about the <span class="red-bold">Sexy Plant</span>.</p><br />
<br />
<br/><br/><br />
<br/><br/><br />
<br/><br/><br />
<h3><b>Interviews</b></h3><br />
<br/><br/><br />
<br />
</html><br />
[[Image:VUPV_Coque.jpg|400px|right]] <br />
<html><br />
<h3><i>“Sexy Plant could be a good approach to reduce the costs of pheromone production” </i></h3><br />
<br />
<p>Jose Maria Garcia Alvarez-Coque is a social researcher and Director of the Sustainable Agriculture group, at the Universitat Politècnica de Valencia (UPV). </p><br />
<p><br />
He considers the currently pheromone synthesis as an expensive method to produce insect pheromones. “Sexy Plant could be a good approach to reduce the costs of pheromone production”. This project is another ecological way to manage pests, such as the production of auxiliary insects to protect crops. In addition, Sexy Plant can be a safe, sustainable and environmentlly friendly method, as far as it respects agricultural and environmental specifications. <span class="red-bold">Sexy Plant</span> modules like Identity Preservation or Sterility are characteristics that assist the long-term use of this plant. </p><br/><br />
<p align="right"> Valencia, September 2014</p><br />
<br/><br/><br />
<br/><br/><br />
</html><br />
[[Image:UPV_Cooperativa.jpg|400px|right]] <br />
<html><br />
<br />
<h3><i>“We have been using sexual confusion as a pest management method in rice crops for the last 20 years” </i></h3><br />
<p><br />
Paco Girona is agriculture engineer at Cooperatives for Agrofood industry (FECOAV). He makes efforts to extend the use of ecological pest methods over some typical crops in Valencia, Spain. </p><br />
<p><br />
Around the Albufera Natural Park in Valencia, the cycle sown rice starts in May when the farmers should start protecting their crops from the <i>Chilo</i> lepidopter (moth) pest. During the first days of May, technicians place pheromone sticks between rice plants to release the Chilo female moth pheromone into the environment. The planted area is around 15,000 Ha of crop, and they are protected by 462,960 pheromone sticks. This technique has been used for the last 20 years, and the economic losses have been cut down to approximately a mere 0.5%. Paco Girona explains that Sexy Plant coul be a wonderful alternative to chemically synthetized pheromone sticks, specially during its assembly, the most hazardous part of its production. “If you get the <span class="red-bold">Sexy Plant</span>, I take my hat off” </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
<p>Our team also talked with Professor Sam Tothill, Professor of Biosensors in Health at Cranfield University, United Kingdom. Her current research mainly focuses in biosensors for microbial contaminants and pathogen's (bacteria, viruses, fungi) and their toxins. We really appreciated her feedback as part of her research consist in the detection of contaminants such as pesticides in food. We discussed about safety issues and how could our project be implemented in agriculture. She really liked the about the <span class="red-bold">Sexy Plant</span> project and wished our team succeeded at iGEM. </p><br />
<p align="right"> Cranfield, October 2014</p><br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/File:2014-09-24_Lleida.jpg
File:2014-09-24 Lleida.jpg
2014-10-18T00:53:01Z
<p>Alrual: </p>
<hr />
<div></div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/notebook
Team:Valencia UPV/Project/notebook
2014-10-17T19:17:19Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<html><br />
<style><br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.table_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border: none;<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.td_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border:none;<br />
padding-right: 25px;<br />
}<br />
<br />
.section_notebook{<br />
color: red;<br />
text-align: left;<br />
font-size: 16pt;<br />
}<br />
<br />
.date_notebook {<br />
color: green;<br />
text-align: left;<br />
font-size: 12pt;<br />
}<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.strong_notebook {<br />
color: red;<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
<br />
.img_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.box_above_notebook{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
<br />
.ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
}<br />
<br />
.ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 1.5em;<br />
}<br />
<br />
.ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 3.0em;<br />
}<br />
<br />
.ul_ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 4.5em;<br />
}<br />
<br />
#cn-box-left<br />
{<br />
float: left;<br />
width: 70%;<br />
//padding-right: 20px;<br />
margin-left: 140px;<br />
//background-color: yellow;<br />
}<br />
<br />
#cn-box-right<br />
{<br />
float: right;<br />
width: 18%;<br />
background-color: blue;<br />
}<br />
<br />
.right-col {<br />
float: right;<br />
width: 25%;<br />
padding-left: 20px;<br />
}<br />
<br />
.note-container {<br />
margin-top: 10px;<br />
}<br />
<br />
.note {<br />
padding: 18px 5px;<br />
background: #eee;<br />
text-decoration:none;<br />
background:#ffc;<br />
display:block;<br />
padding: 20px;<br />
width: 200px; <br />
box-shadow: 5px 5px 7px rgba(33,33,33,.7);<br />
-webkit-transform: rotate(-6deg);<br />
-moz-transform: rotate(-6deg);<br />
-ms-transform: rotate(-6deg);<br />
transform: rotate(-6deg);<br />
font-size: 16px;<br />
}<br />
.note h3 {<br />
font-size: 28px;<br />
margin: 0;<br />
}<br />
<br />
/*Thanks to Webpop (http://www.webpop.com) for the code for the pinned note*/<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-18439732-5']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Notebook</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>N</roja>otebook</span> </div><br/><br/><br />
<br />
<br />
<section class="container clearfix"> <br />
<br />
<div class="box_above_notebook"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul><br />
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p><br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"><br />
<br />
<br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p><br />
<br />
<ul class="ul_notebook"><li>Codon optimization</li><br />
<br />
<li>Inner restriction sites eliminations by finding synonymous mutations</li><br />
<br />
<li>Addition of GB endings</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p><br />
<br />
<br />
<br />
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ordered the following gBlocks and primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li><br />
<br />
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li><br />
<br />
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li><br />
<br />
<li>I14Jun04 Atr&Delta;11 R1</li><br />
<br />
</ul><li>FAO1: <i>N. benthamiana</i> primers</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li><br />
<br />
<li>I14Jun02 FAO1 R1</li><br />
<br />
</ul></ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We thought which parts of the GB collection could we use.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy 1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 2:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTAtHSP18.2</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 3:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTTctp</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Pieces to take from GB2.0 colection:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Later we will need:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Prepare plaques with antibiotics Kan, Spm, Amp</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Culture in agar Petri dish. 2 plaques: Amp and Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps with EZNA Plasmid DNA MiniKit I.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Expected digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis analysis.</p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"><br />
<br />
<br />
<br />
<p class="p_notebook">We got the expected bands in all cases.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p><br />
<br />
<p class="p_notebook">We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li><br />
<br />
<li>10 &mu;L HF buffer </li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L Reverse primer</li><br />
<br />
<li>2.5 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L template (Atr&Delta;11 gene)</li><br />
<br />
<li>0.5 &mu;L phusion (polimerase)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png><br />
<br />
<br />
<br />
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product/gblock product </li><br />
<br />
<li>1.2 &mu;L buffer 10x</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Vfinal= 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li><br />
<br />
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After incubation, culture in Petri plates (always in a LAF).</p><br />
<br />
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p><br />
<br />
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li><br />
<br />
<li>2.5 &mu;L buffer</li><br />
<br />
<li>21 &mu;L H20 (miliQ)</li><br />
<br />
<li>1 &mu;L sample</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li><br />
<br />
<li>25 &mu;L Orange</li><br />
<br />
<li>210 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li><br />
<br />
<li>7.5 &mu;L Green</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BanII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Comments:</p><br />
<br />
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li><br />
<br />
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-Gal</li><br />
<br />
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li><br />
<br />
<li>17.5 &mu;L Orange</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li><br />
<br />
<li>10 &mu;L Tango</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li><br />
<br />
<li>10 &mu;L Green</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L terminator 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L CDS 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L vector &alpha;</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Total: 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy Promoter-Terminator:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Adjust concentrations to 75 ng/&mu;L for ligation reaction</p><br />
<br />
<br />
<br />
<p class="p_notebook">Initial concentrations (nanodrop):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reaction</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p><br />
<br />
<br />
<br />
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li><br />
<br />
<li>HarFAR -> Sequencing correct</li><br />
<br />
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Worked in the LAF</li><br />
<br />
<li>Cultivated in a Petri dish with Spm</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li><br />
<br />
<li>Rest of the culture in another (250 &mu;L aprox)</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-gal</li><br />
<br />
<li>3.5 &mu;L IPTG</li><br />
<br />
</ul><li>1 colony from 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p><br />
<br />
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for HindIII</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li><br />
<br />
<li>17.5 &mu;L Red</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li><br />
<br />
<li>2.5 &mu;L Red</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul><li>Mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li><br />
<br />
<li>2.5 &mu;L Green</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Amp</li><br />
<br />
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li><br />
<br />
<li>pEaDAcT (3)</li><br />
<br />
<li>pHarFAR (3)</li><br />
<br />
</ul><li>Kan</li><br />
<br />
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li><br />
<br />
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except P35s:EaDAcT:T35s (2).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation in &Omega; vectors.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Selected tubes: </p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check the transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li><br />
<br />
<li>10 &mu;L Green buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li><br />
<br />
<li>20 &mu;L Red buffer</li><br />
<br />
<li>168 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Candida genome extraction</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cultures measured at 600 nm:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.39</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The absorbance was measured again:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.40</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li><br />
<br />
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li><br />
<br />
<li>Wash once with 1 mL sterile water.</li><br />
<br />
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li><br />
<br />
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li><br />
<br />
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li><br />
<br />
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li><br />
<br />
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li><br />
<br />
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li><br />
<br />
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li><br />
<br />
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li><br />
<br />
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li><br />
<br />
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li><br />
<br />
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Genomic quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis made to check the extraction quality was correct. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked EaDAcT colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We got the Candida genome band, however, the Saccharomyces genome band was not present.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep digestions are going to be done tomorrow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BglII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li><br />
<br />
<li>7.5 &mu;L Red buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL06) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL05) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul><li>FAO1-PCR2</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL08) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL07) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperatures</p><br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li><br />
<br />
<li>FAO1-PCR2: 64 &deg;C</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li><br />
<br />
<li>FAO1-PCR2: 1015 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both FAO1 PCR products were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 25 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p><br />
<br />
<br />
<br />
<p class="p_notebook">EaDAcT Transcriptional Unit (TU) transformation</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of P35s:EaDAcT:T35s in 2&Omega;2 P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> liquid cultures (5 mL LB)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li><br />
<br />
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li><br />
<br />
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li><br />
<br />
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from P35s:Atr&Delta;11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR of FAO1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>35 &mu;L HF buffer (5x)</li><br />
<br />
<li>7 &mu;L dNTPs</li><br />
<br />
<li>8.75 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>8.75 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>1.05 &mu;L Phusion polymerase</li><br />
<br />
<li>112.7 H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140805_PCR_FAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO2-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico to check minipreps:</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook"><i>A. tumefaciens</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li><br />
<br />
<li>12.5 &mu;L Orange buffer</li><br />
<br />
<li>105 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li><br />
<br />
<li>2.5 &mu;L Buffer</li><br />
<br />
<li>5 &mu;L Miniprep sample</li><br />
<br />
<li>17 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">FAO1 PCR product.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration protocol consists of:</p><br />
<br />
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li><br />
<br />
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li><br />
<br />
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li><br />
<br />
<li>Mix the cultures, keeping all of them in the same proportions.</li><br />
<br />
<li>Proceed to agroinfiltration.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Possibility of primer combinations: </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>94&deg;C, 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li><br />
<br />
<li>49 or 52&deg;C, 15 s</li><br />
<br />
<li>72&deg;C, 90 s</li><br />
<br />
</ul><li>72&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCRs wih Taq polimerase:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L Template </li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L Reverse primer</li><br />
<br />
<li>1 &mu;L Taq pol.</li><br />
<br />
<li>5 Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>94&deg;C 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li><br />
<br />
<li>49&deg;C 15 s</li><br />
<br />
<li>72&deg;C 90 s</li><br />
<br />
</ul><li>72&deg;C 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PHEROMONE ANALYSIS</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p><br />
<br />
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
<li>1 leaf from a wild type plant</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p><br />
<br />
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>100,0 mg of wild type leaf</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Then 150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p><br />
<br />
<br />
<br />
<p class="p_notebook">EDTA 500mM preparation:</p><br />
<br />
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p><br />
<br />
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4><br />
<br />
<p class="p_notebook">Analysis was performed overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">First results of the analysis were obtained. The analysis proved that our plant was successfuly producing the desired pheromones in high concentration. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<br />
<br />
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/66/20140812_IMAGEN_cromatogramas_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9a/20140812_IMAGEN_cromatogramas_7.png><br />
<br />
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p><br />
<br />
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Results of the replicae analysis are shown below:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140813_IMAGEN_CROMATOGRAMA_3.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Our happiness reached a peak!! A PEAK!</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p><br />
<br />
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward Primer </li><br />
<br />
<li>1 &mu;L Reverse Primer</li><br />
<br />
<li>1 &mu;L Taq Polimerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p><br />
<br />
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p><br />
<br />
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/9/95/20140814_colony_pcr_y_BBSI_test.png"><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Colony PCR 2:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 4:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400"src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/a7/20140820_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li><br />
<br />
<li>Incubate 15 min at 70&deg;C.</li><br />
<br />
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li><br />
<br />
<li>Centrifuge 3 min at 15000 xg.</li><br />
<br />
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li><br />
<br />
<li>Centrifuge 1 min at 15000 xg. </li><br />
<br />
<li>Recover 1 &mu;L of supernatant. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Control PCR:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L template</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 clone Fw+1 </li><br />
<br />
<li>1 &mu;L HSR1 Rtrv + 1149</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO1 PCR</li><br />
<br />
<li>1 &mu;L template</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li><br />
<br />
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR parameters (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li><br />
<br />
<li>HSR1 RTRv+1149</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li><br />
<br />
<li>HSR1 RTRv+1149 </li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul07 </li><br />
<br />
<li>iGEMJul08</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul09 </li><br />
<br />
<li>iGEMJul10</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/ac/20140825_pcps2_ta29_atr.png><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB parts:</li><br />
<br />
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were not correct. We will keep trying.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Note: Go to 09/16/2014</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li><br />
<br />
<li>Introduce the disks inside the tube.</li><br />
<br />
<li>Introduce the two tubes in liquid nitrogen.</li><br />
<br />
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li><br />
<br />
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li><br />
<br />
<li>Grind the disks.</li><br />
<br />
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li><br />
<br />
<li>Grind the mixture.</li><br />
<br />
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li><br />
<br />
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li><br />
<br />
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li><br />
<br />
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li><br />
<br />
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li><br />
<br />
<li>Repeat the last three steps.</li><br />
<br />
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li><br />
<br />
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li><br />
<br />
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li><br />
<br />
<li>Discard the supernatant by decantation (be carefull with the pellet).</li><br />
<br />
<li>Wash with 600 &mu;L ethanol (80%).</li><br />
<br />
<li>Centrifuge 5 min at 13000 rpm. </li><br />
<br />
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li><br />
<br />
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li><br />
<br />
<li>Store at -20&deg;C. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li><br />
<br />
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ordered primers</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJULO1</li><br />
<br />
<li>IGEMJULO2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li><br />
<br />
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for PCR:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L template</li><br />
<br />
<li>10 &mu;L buffer HF 5x</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo R</li><br />
<br />
<li>2.5 &mu;L oligo F</li><br />
<br />
<li>0.5 &mu;L Pfu</li><br />
<br />
<li>32 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 50 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Parameters:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR with different parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with other parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>49, 52, 55, 60 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with more genomic.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 &deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still without having any amplification.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat the PCR with other enzyme.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li><br />
<br />
<li>1.25 &mu;L forward primer 10 uM</li><br />
<br />
<li>1.25 &mu;L reverse primer 10 uM</li><br />
<br />
<li>0.5 &mu;L template 620 ng/&mu;L</li><br />
<br />
<li>9.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>50, 53, 55, 59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (2 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png><br />
<br />
<br />
<br />
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome promoter PCR product ligation in pUPD.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1.2 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>6.8 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Both minipreps were adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pTnos (GB0037)</li><br />
<br />
<li>pGFP (GB0059)</li><br />
<br />
<li>pLuciferase (GB0096)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Results of sequencing the promoter were obtained:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following table shows ligation details of the trichome promoter:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome Promoter transformation in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for HindIII:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li><br />
<br />
<li>10 &mu;L Red buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: The scientific name has been updated to Rhizobium radiobacter. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11/EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<img class="img_notebook" width="250px" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>1 &mu;L PCPS2:HarFAR:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li><br />
<br />
<li>1 &mu;L PCPS2:EaDAcT:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;2</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico made to check minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li><br />
<br />
<li>PCPS2:GFP:TNos (Rif, Kan)</li><br />
<br />
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li><br />
<br />
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos </li><br />
<br />
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico the check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/f1/20140826_Atr_%2B_Har.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TUs with trichome promoter:</li><br />
<br />
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made a ligation as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>3.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol followed was the same as previously done.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2f/PCPS2_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained trichome selective expression of GFP! </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="700px" src= https://static.igem.org/mediawiki/2014/b/b5/2014091_BB_y_Ruta_entera.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:GFP:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well using vortex.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>TNos:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="600px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Result analysis:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three gens are placed in the same construction. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/68/20140912_Pathway_complete.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digetions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions that were still pending from 09/12.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/28/20140916_ge_pieces_AcPathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="450" src= https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li><br />
<br />
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Order primers for TA29 and barnase:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29 PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>60&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul><li>Barnase PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>63&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul></ul><br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src="https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="300" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="402" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200" src= https://static.igem.org/mediawiki/2014/e/ef/20140821_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="250" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= ><br />
<br />
<img class="img_notebook" width="100" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png</p><br />
<br />
<br />
<br />
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase product</li><br />
<br />
<li>1.2 &mu;L Buffer Ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/eb/20140817_Ta29_e040.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/27/20140827_ta29.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/e/e5/2014092_Barnasaa_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Master Mix (12 reactions)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li><br />
<br />
<li>12 &mu;L primer R</li><br />
<br />
<li>12 &mu;L primer F</li><br />
<br />
<li>12 &mu;L Taq Polymerase</li><br />
<br />
<li>24 &mu;L Buffer 10X</li><br />
<br />
<li>48 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/7/75/2014092_Barnasa_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">bands were not correct, so we picked another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of barnase's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again Barnase minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140906_Barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct except one of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase</li><br />
<br />
<li>1.2 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 ul T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the PCR product is correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/49/20140918_bar_colony_PCR.png><br />
<br />
<br />
<br />
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li><br />
<br />
<li>Barnase PCR product in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested Barnase ligation with XbaI.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>MoFlippers constructions</li><br />
<br />
<li>Mutated Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="500" src=https://static.igem.org/mediawiki/2014/b/bb/20140922_Omega_under_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation into E.coli:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1</li><br />
<br />
<li>Barnase (XbaI digested) in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
<li>P35S:Yellow:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>Barnase digested with XbaI </li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again chromoproteins ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L Blue/Yellow</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions were run in two different gels</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/6/69/20140922_Blue_Ruta_KanRes_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestions were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Blue digestions were correct</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li><br />
<br />
<li>P35S:Yellow:T35S iin 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/05/20140924_Barnase.png><br />
<br />
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Barnase in pUPD (Mutated)</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 Ligase</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<br />
<br />
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture: </p><br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestion in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/ff/20140926_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a4/20140927_Blue_Agro.png><br />
<br />
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies (E.coli):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (pSB1A3)</li><br />
<br />
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (pSB1A3)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p><br />
<br />
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We send the Biosafety module to Norwich.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/2/27/20141005_Chromoprot_agro.png><br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other approaches that could be used in place of Blue and Yellow chromoproteins. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Ant1:TNos_P35S:JFA13:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's culture did not grow. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Plant leaves changed its usual green colour. As a result of anthocyanin accumulation, agroinfiltred leaves were purple coloured. We took photos of transient transformation of the two modules.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/25/Purple_Plant.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9f/20140822_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a8/20140827_bb_e0240.png><br />
<br />
<br />
<br />
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Double digestions</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li><br />
<br />
<li>2.5 &mu;L NEBuffer</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L enzyme 1</li><br />
<br />
<li>0.5 &mu;L enzyme 2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 20 &mu;L</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p><br />
<br />
<br />
<br />
<p class="p_notebook">BioBricks ligations</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li><br />
<br />
<li>2 &mu;L part 2 (25 ng)</li><br />
<br />
<li>1 &mu;L T4 buffer 10X</li><br />
<br />
<li>0.5 &mu;L T4</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/thumb/2/26/20140830_bb.png/800px-20140830_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a6/20140901_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/b/b7/20140902_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/0/07/20140904_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p><br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1) </td><td class="td_notebook">1.157 </td><td class="td_notebook">0.38 </td><td class="td_notebook">3.046</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.105 </td><td class="td_notebook">0.35 </td><td class="td_notebook">3.158</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.148 </td><td class="td_notebook">0.39 </td><td class="td_notebook">2.944</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1) </td><td class="td_notebook">5.237 </td><td class="td_notebook">0.36 </td><td class="td_notebook">14.547</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">5.073 </td><td class="td_notebook">0.34 </td><td class="td_notebook">14.92</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">3.729 </td><td class="td_notebook">0.26 </td><td class="td_notebook">14.342</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">61.246 </td><td class="td_notebook">0.43 </td><td class="td_notebook">142.432</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">65.759 </td><td class="td_notebook">0.47 </td><td class="td_notebook">139.913</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">68.295 </td><td class="td_notebook">0.47 </td><td class="td_notebook">145.309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">1.482 </td><td class="td_notebook">0.37 </td><td class="td_notebook">4.006</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.443 </td><td class="td_notebook">0.37 </td><td class="td_notebook">3.901</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.462 </td><td class="td_notebook">0.33 </td><td class="td_notebook">4.430</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr><br />
<br />
</table><br />
<br />
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run PCR with the following templates and primers:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">P35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>67&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">T35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>65&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li><br />
<br />
<li>PCR2: P35S:Atr&Delta;11:T35S template</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/e0/20140819_p35s.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20140819_t35s2C_p35s.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L T35S_BB</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H20 miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li><br />
<br />
<li>HarFAR (2&alpha;2)</li><br />
<br />
<li>Atr&Delta;11 (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the template is not there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">The gel showed that the PCR products were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/aa/20140906_PCR_P35S.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/b/b0/20140907_Barnase_PCR_35S.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any PCR product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng E0040</li><br />
<br />
<li>2.5 &mu;L NEB2</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L XbaI</li><br />
<br />
<li>0.5 &mu;L PstI</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li><br />
<br />
<li>MoFlipper + Atr&Delta;11</li><br />
<br />
<li>MoFlipper + HarFAR</li><br />
<br />
<li>MoFlipper + EaDAcT</li><br />
<br />
<li>MoFlipper + TA29</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="380px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">MoFlipper cultures did not grow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Omega undercover</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover with TA29</li><br />
<br />
<li>MoFlipper with Atr&Delta;11</li><br />
<br />
<li>MoFlipper with HarFAR</li><br />
<br />
<li>MoFlipper with EaDAcT</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="200px"src= https://static.igem.org/mediawiki/2014/7/7d/20140923_Ta29_Moflippers.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p><br />
<br />
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li><br />
<br />
<li>CUP2-PCR2: 348 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both PCR products were correct.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of both parts of CUP2.</p><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Gal4AD</li><br />
<br />
<li>CUP2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Gal4AD piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Quantification </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li><br />
<br />
<li>Gal4: 221.4 ng/&mu;L</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following ligations were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O </li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/1/18/20140815_CUP2_digestion.png><br />
<br />
<br />
<br />
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Gal4AD</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li><br />
<br />
<li>1 &mu;L SF in 1&alpha;1</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol was the same as previously folowed. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<p class="p_notebook">We have to repeat digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the following digestions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We consider to use the miniprep number 2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="280px" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested minipreps made the previous days:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/24/20140909_Digestiones_fallidas_CUP2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction in glycerol, we picked some colonies (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/66/20140910_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained from GB collection the following piece:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png ><br />
<br />
<br />
<br />
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0256</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligate it in pUPD vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L GBlock</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>GBlock in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/0/06/20140925_CUP_promoter_gblock_fail.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions have to be repeated.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/f/fb/20140925_CUP_promoter_GBlock.png><br />
<br />
<p class="p_notebook">Minipreps were correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L colony</li><br />
<br />
<li>1 &mu;L primer F</li><br />
<br />
<li>1 ul primer R</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Taq Polymerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We run a gel with PCR products:</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="355px" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li><br />
<br />
<li>Incorrect possible band: 270 bp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 157</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/9/9e/09012014_Mini35s_GBlock.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li><br />
<br />
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li><br />
<br />
<li>0.75 ul Luciferase (75 ng/&mu;L</li><br />
<br />
<li>0.75 T35S (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L Bsa1</li><br />
<br />
<li>1 &mu;L T4 Ligase </li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Tomorrow we will transform the result.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li><br />
<br />
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li><br />
<br />
<li>1 µl pDGB2?2</li><br />
<br />
<li>1 µl BsaI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl T10x</li><br />
<br />
<li>4.8 µl water</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked two colonies of each construct: </p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/04/2014</h4><br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="475" src= https://static.igem.org/mediawiki/2014/2/2d/20141004_CBSmini35_UTR_Luc.png><br />
<br />
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p><br />
<br />
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p><br />
<br />
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<p class="p_notebook">We made the following binary assembly.</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li><br />
<br />
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li><br />
<br />
<li>1 µl 2&Omega;2</li><br />
<br />
<li>1 µl BsmBI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl Buffer T10x</li><br />
<br />
<li>5.8 µl H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<p class="p_notebook">We picked two colonies of:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Restriction analysis:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20141008_cbsmini35_2omega2.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">11/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday' culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/3/31/20141011_Yellow_chromoprot_CUP_agro.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">13/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/c/c8/20141013_luciferase_mini35.png><br />
<br />
<p class="p_notebook">They were correct.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content-trans" id="goto-left" align="center"></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/interlab"><strong>Go to Interlab Study&rarr;</strong></a></div></br></br></br><br />
<br />
<div class="right-col"><br />
<div class="pinned note-container"><br />
<div class="note"><br />
<h3>Great Days!</h3><br />
<p>Here is our biggest days in the Laboratory</p><br />
<p><a href="#">Day 1</a>.</p><br />
<p><a href="#">Day 2</a>.</p><br />
<p><a href="#">Day 3</a>.</p><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</section> <br />
</div><br />
<br />
<div id="space-margin"></div><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.9.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:Valencia_UPV/Templates/sticky-notebook_jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<script><br />
$(".pinned").pin({containerSelector: ".container", minWidth: 940});<br />
</script><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/notebook
Team:Valencia UPV/Project/notebook
2014-10-17T19:14:03Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<html><br />
<style><br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.table_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border: none;<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.td_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border:none;<br />
padding-right: 25px;<br />
}<br />
<br />
.section_notebook{<br />
color: red;<br />
text-align: left;<br />
font-size: 16pt;<br />
}<br />
<br />
.date_notebook {<br />
color: green;<br />
text-align: left;<br />
font-size: 12pt;<br />
}<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.strong_notebook {<br />
color: red;<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
<br />
.img_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.box_above_notebook{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
<br />
.ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
}<br />
<br />
.ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 1.5em;<br />
}<br />
<br />
.ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 3.0em;<br />
}<br />
<br />
.ul_ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 4.5em;<br />
}<br />
<br />
#cn-box-left<br />
{<br />
float: left;<br />
width: 70%;<br />
//padding-right: 20px;<br />
margin-left: 140px;<br />
//background-color: yellow;<br />
}<br />
<br />
#cn-box-right<br />
{<br />
float: right;<br />
width: 18%;<br />
background-color: blue;<br />
}<br />
<br />
.right-col {<br />
float: right;<br />
width: 25%;<br />
padding-left: 20px;<br />
}<br />
<br />
.note-container {<br />
margin-top: 10px;<br />
}<br />
<br />
.note {<br />
padding: 18px 5px;<br />
background: #eee;<br />
text-decoration:none;<br />
background:#ffc;<br />
display:block;<br />
padding: 20px;<br />
width: 200px; <br />
box-shadow: 5px 5px 7px rgba(33,33,33,.7);<br />
-webkit-transform: rotate(-6deg);<br />
-moz-transform: rotate(-6deg);<br />
-ms-transform: rotate(-6deg);<br />
transform: rotate(-6deg);<br />
font-size: 16px;<br />
}<br />
.note h3 {<br />
font-size: 28px;<br />
margin: 0;<br />
}<br />
<br />
/*Thanks to Webpop (http://www.webpop.com) for the code for the pinned note*/<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-18439732-5']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Notebook</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>N</roja>otebook</span> </div><br/><br/><br />
<br />
<br />
<section class="container clearfix"> <br />
<br />
<div class="box_above_notebook"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul><br />
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p><br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"><br />
<br />
<br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p><br />
<br />
<ul class="ul_notebook"><li>Codon optimization</li><br />
<br />
<li>Inner restriction sites eliminations by finding synonymous mutations</li><br />
<br />
<li>Addition of GB endings</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p><br />
<br />
<br />
<br />
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ordered the following gBlocks and primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li><br />
<br />
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li><br />
<br />
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li><br />
<br />
<li>I14Jun04 Atr&Delta;11 R1</li><br />
<br />
</ul><li>FAO1: <i>N. benthamiana</i> primers</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li><br />
<br />
<li>I14Jun02 FAO1 R1</li><br />
<br />
</ul></ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We thought which parts of the GB collection could we use.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy 1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 2:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTAtHSP18.2</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 3:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTTctp</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Pieces to take from GB2.0 colection:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Later we will need:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Prepare plaques with antibiotics Kan, Spm, Amp</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Culture in agar Petri dish. 2 plaques: Amp and Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps with EZNA Plasmid DNA MiniKit I.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Expected digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis analysis.</p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"><br />
<br />
<br />
<br />
<p class="p_notebook">We got the expected bands in all cases.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p><br />
<br />
<p class="p_notebook">We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li><br />
<br />
<li>10 &mu;L HF buffer </li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L Reverse primer</li><br />
<br />
<li>2.5 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L template (Atr&Delta;11 gene)</li><br />
<br />
<li>0.5 &mu;L phusion (polimerase)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png><br />
<br />
<br />
<br />
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product/gblock product </li><br />
<br />
<li>1.2 &mu;L buffer 10x</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Vfinal= 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li><br />
<br />
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After incubation, culture in Petri plates (always in a LAF).</p><br />
<br />
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p><br />
<br />
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li><br />
<br />
<li>2.5 &mu;L buffer</li><br />
<br />
<li>21 &mu;L H20 (miliQ)</li><br />
<br />
<li>1 &mu;L sample</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li><br />
<br />
<li>25 &mu;L Orange</li><br />
<br />
<li>210 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li><br />
<br />
<li>7.5 &mu;L Green</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BanII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Comments:</p><br />
<br />
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li><br />
<br />
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-Gal</li><br />
<br />
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li><br />
<br />
<li>17.5 &mu;L Orange</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li><br />
<br />
<li>10 &mu;L Tango</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li><br />
<br />
<li>10 &mu;L Green</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L terminator 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L CDS 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L vector &alpha;</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Total: 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy Promoter-Terminator:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Adjust concentrations to 75 ng/&mu;L for ligation reaction</p><br />
<br />
<br />
<br />
<p class="p_notebook">Initial concentrations (nanodrop):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reaction</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p><br />
<br />
<br />
<br />
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li><br />
<br />
<li>HarFAR -> Sequencing correct</li><br />
<br />
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Worked in the LAF</li><br />
<br />
<li>Cultivated in a Petri dish with Spm</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li><br />
<br />
<li>Rest of the culture in another (250 &mu;L aprox)</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-gal</li><br />
<br />
<li>3.5 &mu;L IPTG</li><br />
<br />
</ul><li>1 colony from 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p><br />
<br />
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for HindIII</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li><br />
<br />
<li>17.5 &mu;L Red</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li><br />
<br />
<li>2.5 &mu;L Red</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul><li>Mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li><br />
<br />
<li>2.5 &mu;L Green</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Amp</li><br />
<br />
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li><br />
<br />
<li>pEaDAcT (3)</li><br />
<br />
<li>pHarFAR (3)</li><br />
<br />
</ul><li>Kan</li><br />
<br />
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li><br />
<br />
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except P35s:EaDAcT:T35s (2).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation in &Omega; vectors.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Selected tubes: </p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check the transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li><br />
<br />
<li>10 &mu;L Green buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li><br />
<br />
<li>20 &mu;L Red buffer</li><br />
<br />
<li>168 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Candida genome extraction</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cultures measured at 600 nm:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.39</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The absorbance was measured again:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.40</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li><br />
<br />
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li><br />
<br />
<li>Wash once with 1 mL sterile water.</li><br />
<br />
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li><br />
<br />
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li><br />
<br />
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li><br />
<br />
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li><br />
<br />
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li><br />
<br />
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li><br />
<br />
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li><br />
<br />
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li><br />
<br />
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li><br />
<br />
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li><br />
<br />
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Genomic quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis made to check the extraction quality was correct. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked EaDAcT colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We got the Candida genome band, however, the Saccharomyces genome band was not present.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep digestions are going to be done tomorrow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BglII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li><br />
<br />
<li>7.5 &mu;L Red buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL06) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL05) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul><li>FAO1-PCR2</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL08) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL07) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperatures</p><br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li><br />
<br />
<li>FAO1-PCR2: 64 &deg;C</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li><br />
<br />
<li>FAO1-PCR2: 1015 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both FAO1 PCR products were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 25 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p><br />
<br />
<br />
<br />
<p class="p_notebook">EaDAcT Transcriptional Unit (TU) transformation</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of P35s:EaDAcT:T35s in 2&Omega;2 P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> liquid cultures (5 mL LB)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li><br />
<br />
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li><br />
<br />
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li><br />
<br />
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from P35s:Atr&Delta;11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR of FAO1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>35 &mu;L HF buffer (5x)</li><br />
<br />
<li>7 &mu;L dNTPs</li><br />
<br />
<li>8.75 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>8.75 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>1.05 &mu;L Phusion polymerase</li><br />
<br />
<li>112.7 H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140805_PCR_FAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO2-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico to check minipreps:</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook"><i>A. tumefaciens</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li><br />
<br />
<li>12.5 &mu;L Orange buffer</li><br />
<br />
<li>105 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li><br />
<br />
<li>2.5 &mu;L Buffer</li><br />
<br />
<li>5 &mu;L Miniprep sample</li><br />
<br />
<li>17 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">FAO1 PCR product.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration protocol consists of:</p><br />
<br />
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li><br />
<br />
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li><br />
<br />
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li><br />
<br />
<li>Mix the cultures, keeping all of them in the same proportions.</li><br />
<br />
<li>Proceed to agroinfiltration.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Possibility of primer combinations: </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>94&deg;C, 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li><br />
<br />
<li>49 or 52&deg;C, 15 s</li><br />
<br />
<li>72&deg;C, 90 s</li><br />
<br />
</ul><li>72&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCRs wih Taq polimerase:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L Template </li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L Reverse primer</li><br />
<br />
<li>1 &mu;L Taq pol.</li><br />
<br />
<li>5 Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>94&deg;C 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li><br />
<br />
<li>49&deg;C 15 s</li><br />
<br />
<li>72&deg;C 90 s</li><br />
<br />
</ul><li>72&deg;C 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PHEROMONE ANALYSIS</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p><br />
<br />
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
<li>1 leaf from a wild type plant</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p><br />
<br />
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>100,0 mg of wild type leaf</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Then 150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p><br />
<br />
<br />
<br />
<p class="p_notebook">EDTA 500mM preparation:</p><br />
<br />
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p><br />
<br />
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4><br />
<br />
<p class="p_notebook">Analysis was performed overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">First results of the analysis were obtained. The analysis proved that our plant was successfuly producing the desired pheromones in high concentration. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<br />
<br />
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/66/20140812_IMAGEN_cromatogramas_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9a/20140812_IMAGEN_cromatogramas_7.png><br />
<br />
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p><br />
<br />
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Results of the replicae analysis are shown below:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140813_IMAGEN_CROMATOGRAMA_3.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Our happiness reached a peak!! A PEAK!</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p><br />
<br />
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward Primer </li><br />
<br />
<li>1 &mu;L Reverse Primer</li><br />
<br />
<li>1 &mu;L Taq Polimerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p><br />
<br />
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p><br />
<br />
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/9/95/20140814_colony_pcr_y_BBSI_test.png"><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Colony PCR 2:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 4:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400"src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/a7/20140820_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li><br />
<br />
<li>Incubate 15 min at 70&deg;C.</li><br />
<br />
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li><br />
<br />
<li>Centrifuge 3 min at 15000 xg.</li><br />
<br />
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li><br />
<br />
<li>Centrifuge 1 min at 15000 xg. </li><br />
<br />
<li>Recover 1 &mu;L of supernatant. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Control PCR:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L template</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 clone Fw+1 </li><br />
<br />
<li>1 &mu;L HSR1 Rtrv + 1149</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO1 PCR</li><br />
<br />
<li>1 &mu;L template</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li><br />
<br />
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR parameters (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li><br />
<br />
<li>HSR1 RTRv+1149</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li><br />
<br />
<li>HSR1 RTRv+1149 </li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul07 </li><br />
<br />
<li>iGEMJul08</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul09 </li><br />
<br />
<li>iGEMJul10</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/ac/20140825_pcps2_ta29_atr.png><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB parts:</li><br />
<br />
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were not correct. We will keep trying.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Note: Go to 09/16/2014</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li><br />
<br />
<li>Introduce the disks inside the tube.</li><br />
<br />
<li>Introduce the two tubes in liquid nitrogen.</li><br />
<br />
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li><br />
<br />
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li><br />
<br />
<li>Grind the disks.</li><br />
<br />
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li><br />
<br />
<li>Grind the mixture.</li><br />
<br />
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li><br />
<br />
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li><br />
<br />
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li><br />
<br />
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li><br />
<br />
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li><br />
<br />
<li>Repeat the last three steps.</li><br />
<br />
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li><br />
<br />
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li><br />
<br />
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li><br />
<br />
<li>Discard the supernatant by decantation (be carefull with the pellet).</li><br />
<br />
<li>Wash with 600 &mu;L ethanol (80%).</li><br />
<br />
<li>Centrifuge 5 min at 13000 rpm. </li><br />
<br />
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li><br />
<br />
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li><br />
<br />
<li>Store at -20&deg;C. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li><br />
<br />
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ordered primers</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJULO1</li><br />
<br />
<li>IGEMJULO2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li><br />
<br />
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for PCR:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L template</li><br />
<br />
<li>10 &mu;L buffer HF 5x</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo R</li><br />
<br />
<li>2.5 &mu;L oligo F</li><br />
<br />
<li>0.5 &mu;L Pfu</li><br />
<br />
<li>32 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 50 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Parameters:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR with different parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with other parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>49, 52, 55, 60 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with more genomic.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 &deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still without having any amplification.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat the PCR with other enzyme.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li><br />
<br />
<li>1.25 &mu;L forward primer 10 uM</li><br />
<br />
<li>1.25 &mu;L reverse primer 10 uM</li><br />
<br />
<li>0.5 &mu;L template 620 ng/&mu;L</li><br />
<br />
<li>9.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>50, 53, 55, 59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (2 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png><br />
<br />
<br />
<br />
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome promoter PCR product ligation in pUPD.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1.2 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>6.8 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Both minipreps were adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pTnos (GB0037)</li><br />
<br />
<li>pGFP (GB0059)</li><br />
<br />
<li>pLuciferase (GB0096)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Results of sequencing the promoter were obtained:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following table shows ligation details of the trichome promoter:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome Promoter transformation in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for HindIII:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li><br />
<br />
<li>10 &mu;L Red buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: The scientific name has been updated to Rhizobium radiobacter. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11/EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<img class="img_notebook" width="250px" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>1 &mu;L PCPS2:HarFAR:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li><br />
<br />
<li>1 &mu;L PCPS2:EaDAcT:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;2</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico made to check minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li><br />
<br />
<li>PCPS2:GFP:TNos (Rif, Kan)</li><br />
<br />
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li><br />
<br />
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos </li><br />
<br />
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico the check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/f1/20140826_Atr_%2B_Har.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TUs with trichome promoter:</li><br />
<br />
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made a ligation as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>3.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol followed was the same as previously done.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2f/PCPS2_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained trichome selective expression of GFP! </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="700px" src= https://static.igem.org/mediawiki/2014/b/b5/2014091_BB_y_Ruta_entera.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:GFP:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well using vortex.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>TNos:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="600px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Result analysis:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three gens are placed in the same construction. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/68/20140912_Pathway_complete.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digetions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions that were still pending from 09/12.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/28/20140916_ge_pieces_AcPathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="450" src= https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li><br />
<br />
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Order primers for TA29 and barnase:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29 PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>60&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul><li>Barnase PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>63&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul></ul><br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src="https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="300" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="402" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200" src= https://static.igem.org/mediawiki/2014/e/ef/20140821_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="250" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= ><br />
<br />
<img class="img_notebook" width="100" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png</p><br />
<br />
<br />
<br />
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase product</li><br />
<br />
<li>1.2 &mu;L Buffer Ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/eb/20140817_Ta29_e040.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/27/20140827_ta29.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/e/e5/2014092_Barnasaa_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Master Mix (12 reactions)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li><br />
<br />
<li>12 &mu;L primer R</li><br />
<br />
<li>12 &mu;L primer F</li><br />
<br />
<li>12 &mu;L Taq Polymerase</li><br />
<br />
<li>24 &mu;L Buffer 10X</li><br />
<br />
<li>48 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/7/75/2014092_Barnasa_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">bands were not correct, so we picked another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of barnase's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again Barnase minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140906_Barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct except one of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase</li><br />
<br />
<li>1.2 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 ul T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the PCR product is correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/49/20140918_bar_colony_PCR.png><br />
<br />
<br />
<br />
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li><br />
<br />
<li>Barnase PCR product in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested Barnase ligation with XbaI.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>MoFlippers constructions</li><br />
<br />
<li>Mutated Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="500" src=https://static.igem.org/mediawiki/2014/b/bb/20140922_Omega_under_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation into E.coli:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1</li><br />
<br />
<li>Barnase (XbaI digested) in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
<li>P35S:Yellow:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>Barnase digested with XbaI </li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again chromoproteins ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L Blue/Yellow</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions were run in two different gels</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/6/69/20140922_Blue_Ruta_KanRes_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestions were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Blue digestions were correct</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li><br />
<br />
<li>P35S:Yellow:T35S iin 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/05/20140924_Barnase.png><br />
<br />
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Barnase in pUPD (Mutated)</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 Ligase</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<br />
<br />
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture: </p><br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestion in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/ff/20140926_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a4/20140927_Blue_Agro.png><br />
<br />
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies (E.coli):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (pSB1A3)</li><br />
<br />
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (pSB1A3)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p><br />
<br />
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We send the Biosafety module to Norwich.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/2/27/20141005_Chromoprot_agro.png><br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other approaches that could be used in place of Blue and Yellow chromoproteins. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Ant1:TNos_P35S:JFA13:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's culture did not grow. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Plant leaves changed its usual green colour. As a result of anthocyanin accumulation, agroinfiltred leaves were purple coloured. We took photos of transient transformation of the two modules.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/25/Purple_Plant.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9f/20140822_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a8/20140827_bb_e0240.png><br />
<br />
<br />
<br />
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Double digestions</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li><br />
<br />
<li>2.5 &mu;L NEBuffer</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L enzyme 1</li><br />
<br />
<li>0.5 &mu;L enzyme 2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 20 &mu;L</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p><br />
<br />
<br />
<br />
<p class="p_notebook">BioBricks ligations</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li><br />
<br />
<li>2 &mu;L part 2 (25 ng)</li><br />
<br />
<li>1 &mu;L T4 buffer 10X</li><br />
<br />
<li>0.5 &mu;L T4</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/thumb/2/26/20140830_bb.png/800px-20140830_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a6/20140901_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/b/b7/20140902_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/0/07/20140904_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1)</td><td class="td_notebook">1.085</td><td class="td_notebook">0.38</td><td class="td_notebook">2.854</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.036</td><td class="td_notebook">0.35</td><td class="td_notebook">2.959</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.076</td><td class="td_notebook">0.39</td><td class="td_notebook">2.759</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1)</td><td class="td_notebook">4.907</td><td class="td_notebook">0.36</td><td class="td_notebook">13.632</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">4.754</td><td class="td_notebook">0.34</td><td class="td_notebook">13.981</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">3.494</td><td class="td_notebook">0.26</td><td class="td_notebook">13.439</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">57.393</td><td class="td_notebook">0.43</td><td class="td_notebook">133.471</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">61.622</td><td class="td_notebook">0.47</td><td class="td_notebook">131.110</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">63.999</td><td class="td_notebook">0.47</td><td class="td_notebook">136.167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">1.389</td><td class="td_notebook">0.37</td><td class="td_notebook">3.754</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.353</td><td class="td_notebook">0.37</td><td class="td_notebook">3.656</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.370</td><td class="td_notebook">0.33</td><td class="td_notebook">4.151</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr><br />
<br />
</table><br />
<br />
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run PCR with the following templates and primers:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">P35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>67&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">T35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>65&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li><br />
<br />
<li>PCR2: P35S:Atr&Delta;11:T35S template</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/e0/20140819_p35s.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20140819_t35s2C_p35s.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L T35S_BB</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H20 miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li><br />
<br />
<li>HarFAR (2&alpha;2)</li><br />
<br />
<li>Atr&Delta;11 (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the template is not there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">The gel showed that the PCR products were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/aa/20140906_PCR_P35S.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/b/b0/20140907_Barnase_PCR_35S.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any PCR product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng E0040</li><br />
<br />
<li>2.5 &mu;L NEB2</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L XbaI</li><br />
<br />
<li>0.5 &mu;L PstI</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li><br />
<br />
<li>MoFlipper + Atr&Delta;11</li><br />
<br />
<li>MoFlipper + HarFAR</li><br />
<br />
<li>MoFlipper + EaDAcT</li><br />
<br />
<li>MoFlipper + TA29</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="380px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">MoFlipper cultures did not grow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Omega undercover</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover with TA29</li><br />
<br />
<li>MoFlipper with Atr&Delta;11</li><br />
<br />
<li>MoFlipper with HarFAR</li><br />
<br />
<li>MoFlipper with EaDAcT</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="200px"src= https://static.igem.org/mediawiki/2014/7/7d/20140923_Ta29_Moflippers.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p><br />
<br />
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li><br />
<br />
<li>CUP2-PCR2: 348 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both PCR products were correct.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of both parts of CUP2.</p><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Gal4AD</li><br />
<br />
<li>CUP2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Gal4AD piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Quantification </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li><br />
<br />
<li>Gal4: 221.4 ng/&mu;L</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following ligations were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O </li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/1/18/20140815_CUP2_digestion.png><br />
<br />
<br />
<br />
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Gal4AD</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li><br />
<br />
<li>1 &mu;L SF in 1&alpha;1</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol was the same as previously folowed. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<p class="p_notebook">We have to repeat digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the following digestions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We consider to use the miniprep number 2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="280px" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested minipreps made the previous days:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/24/20140909_Digestiones_fallidas_CUP2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction in glycerol, we picked some colonies (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/66/20140910_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained from GB collection the following piece:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png ><br />
<br />
<br />
<br />
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0256</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligate it in pUPD vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L GBlock</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>GBlock in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/0/06/20140925_CUP_promoter_gblock_fail.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions have to be repeated.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/f/fb/20140925_CUP_promoter_GBlock.png><br />
<br />
<p class="p_notebook">Minipreps were correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L colony</li><br />
<br />
<li>1 &mu;L primer F</li><br />
<br />
<li>1 ul primer R</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Taq Polymerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We run a gel with PCR products:</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="355px" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li><br />
<br />
<li>Incorrect possible band: 270 bp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 157</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/9/9e/09012014_Mini35s_GBlock.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li><br />
<br />
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li><br />
<br />
<li>0.75 ul Luciferase (75 ng/&mu;L</li><br />
<br />
<li>0.75 T35S (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L Bsa1</li><br />
<br />
<li>1 &mu;L T4 Ligase </li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Tomorrow we will transform the result.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li><br />
<br />
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li><br />
<br />
<li>1 µl pDGB2?2</li><br />
<br />
<li>1 µl BsaI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl T10x</li><br />
<br />
<li>4.8 µl water</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked two colonies of each construct: </p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/04/2014</h4><br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="475" src= https://static.igem.org/mediawiki/2014/2/2d/20141004_CBSmini35_UTR_Luc.png><br />
<br />
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p><br />
<br />
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p><br />
<br />
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<p class="p_notebook">We made the following binary assembly.</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li><br />
<br />
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li><br />
<br />
<li>1 µl 2&Omega;2</li><br />
<br />
<li>1 µl BsmBI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl Buffer T10x</li><br />
<br />
<li>5.8 µl H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<p class="p_notebook">We picked two colonies of:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Restriction analysis:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20141008_cbsmini35_2omega2.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">11/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday' culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/3/31/20141011_Yellow_chromoprot_CUP_agro.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">13/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/c/c8/20141013_luciferase_mini35.png><br />
<br />
<p class="p_notebook">They were correct.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content-trans" id="goto-left" align="center"></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/interlab"><strong>Go to Interlab Study&rarr;</strong></a></div></br></br></br><br />
<br />
<div class="right-col"><br />
<div class="pinned note-container"><br />
<div class="note"><br />
<h3>Great Days!</h3><br />
<p>Here is our biggest days in the Laboratory</p><br />
<p><a href="#">Day 1</a>.</p><br />
<p><a href="#">Day 2</a>.</p><br />
<p><a href="#">Day 3</a>.</p><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</section> <br />
</div><br />
<br />
<div id="space-margin"></div><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.9.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:Valencia_UPV/Templates/sticky-notebook_jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<script><br />
$(".pinned").pin({containerSelector: ".container", minWidth: 940});<br />
</script><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/notebook
Team:Valencia UPV/Project/notebook
2014-10-17T19:08:59Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<html><br />
<style><br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.table_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border: none;<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.td_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border:none;<br />
padding-right: 25px;<br />
}<br />
<br />
.section_notebook{<br />
color: red;<br />
text-align: left;<br />
font-size: 16pt;<br />
}<br />
<br />
.date_notebook {<br />
color: green;<br />
text-align: left;<br />
font-size: 12pt;<br />
}<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.strong_notebook {<br />
color: red;<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
<br />
.img_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.box_above_notebook{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
<br />
.ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
}<br />
<br />
.ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 1.5em;<br />
}<br />
<br />
.ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 3.0em;<br />
}<br />
<br />
.ul_ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 4.5em;<br />
}<br />
<br />
#cn-box-left<br />
{<br />
float: left;<br />
width: 70%;<br />
//padding-right: 20px;<br />
margin-left: 140px;<br />
//background-color: yellow;<br />
}<br />
<br />
#cn-box-right<br />
{<br />
float: right;<br />
width: 18%;<br />
background-color: blue;<br />
}<br />
<br />
.right-col {<br />
float: right;<br />
width: 25%;<br />
padding-left: 20px;<br />
}<br />
<br />
.note-container {<br />
margin-top: 10px;<br />
}<br />
<br />
.note {<br />
padding: 18px 5px;<br />
background: #eee;<br />
text-decoration:none;<br />
background:#ffc;<br />
display:block;<br />
padding: 20px;<br />
width: 200px; <br />
box-shadow: 5px 5px 7px rgba(33,33,33,.7);<br />
-webkit-transform: rotate(-6deg);<br />
-moz-transform: rotate(-6deg);<br />
-ms-transform: rotate(-6deg);<br />
transform: rotate(-6deg);<br />
font-size: 16px;<br />
}<br />
.note h3 {<br />
font-size: 28px;<br />
margin: 0;<br />
}<br />
<br />
/*Thanks to Webpop (http://www.webpop.com) for the code for the pinned note*/<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-18439732-5']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Notebook</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>N</roja>otebook</span> </div><br/><br/><br />
<br />
<br />
<section class="container clearfix"> <br />
<br />
<div class="box_above_notebook"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul><br />
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p><br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"><br />
<br />
<br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p><br />
<br />
<ul class="ul_notebook"><li>Codon optimization</li><br />
<br />
<li>Inner restriction sites eliminations by finding synonymous mutations</li><br />
<br />
<li>Addition of GB endings</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p><br />
<br />
<br />
<br />
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ordered the following gBlocks and primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li><br />
<br />
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li><br />
<br />
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li><br />
<br />
<li>I14Jun04 Atr&Delta;11 R1</li><br />
<br />
</ul><li>FAO1: <i>N. benthamiana</i> primers</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li><br />
<br />
<li>I14Jun02 FAO1 R1</li><br />
<br />
</ul></ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We thought which parts of the GB collection could we use.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy 1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 2:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTAtHSP18.2</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 3:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTTctp</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Pieces to take from GB2.0 colection:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Later we will need:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Prepare plaques with antibiotics Kan, Spm, Amp</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Culture in agar Petri dish. 2 plaques: Amp and Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps with EZNA Plasmid DNA MiniKit I.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Expected digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis analysis.</p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"><br />
<br />
<br />
<br />
<p class="p_notebook">We got the expected bands in all cases.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p><br />
<br />
<p class="p_notebook">We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li><br />
<br />
<li>10 &mu;L HF buffer </li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L Reverse primer</li><br />
<br />
<li>2.5 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L template (Atr&Delta;11 gene)</li><br />
<br />
<li>0.5 &mu;L phusion (polimerase)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png><br />
<br />
<br />
<br />
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product/gblock product </li><br />
<br />
<li>1.2 &mu;L buffer 10x</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Vfinal= 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li><br />
<br />
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After incubation, culture in Petri plates (always in a LAF).</p><br />
<br />
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p><br />
<br />
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li><br />
<br />
<li>2.5 &mu;L buffer</li><br />
<br />
<li>21 &mu;L H20 (miliQ)</li><br />
<br />
<li>1 &mu;L sample</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li><br />
<br />
<li>25 &mu;L Orange</li><br />
<br />
<li>210 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li><br />
<br />
<li>7.5 &mu;L Green</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BanII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Comments:</p><br />
<br />
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li><br />
<br />
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-Gal</li><br />
<br />
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li><br />
<br />
<li>17.5 &mu;L Orange</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li><br />
<br />
<li>10 &mu;L Tango</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li><br />
<br />
<li>10 &mu;L Green</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L terminator 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L CDS 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L vector &alpha;</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Total: 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy Promoter-Terminator:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Adjust concentrations to 75 ng/&mu;L for ligation reaction</p><br />
<br />
<br />
<br />
<p class="p_notebook">Initial concentrations (nanodrop):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reaction</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p><br />
<br />
<br />
<br />
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li><br />
<br />
<li>HarFAR -> Sequencing correct</li><br />
<br />
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Worked in the LAF</li><br />
<br />
<li>Cultivated in a Petri dish with Spm</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li><br />
<br />
<li>Rest of the culture in another (250 &mu;L aprox)</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-gal</li><br />
<br />
<li>3.5 &mu;L IPTG</li><br />
<br />
</ul><li>1 colony from 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p><br />
<br />
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for HindIII</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li><br />
<br />
<li>17.5 &mu;L Red</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li><br />
<br />
<li>2.5 &mu;L Red</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul><li>Mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li><br />
<br />
<li>2.5 &mu;L Green</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Amp</li><br />
<br />
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li><br />
<br />
<li>pEaDAcT (3)</li><br />
<br />
<li>pHarFAR (3)</li><br />
<br />
</ul><li>Kan</li><br />
<br />
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li><br />
<br />
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except P35s:EaDAcT:T35s (2).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation in &Omega; vectors.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Selected tubes: </p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check the transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li><br />
<br />
<li>10 &mu;L Green buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li><br />
<br />
<li>20 &mu;L Red buffer</li><br />
<br />
<li>168 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Candida genome extraction</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cultures measured at 600 nm:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.39</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The absorbance was measured again:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.40</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li><br />
<br />
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li><br />
<br />
<li>Wash once with 1 mL sterile water.</li><br />
<br />
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li><br />
<br />
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li><br />
<br />
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li><br />
<br />
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li><br />
<br />
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li><br />
<br />
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li><br />
<br />
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li><br />
<br />
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li><br />
<br />
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li><br />
<br />
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li><br />
<br />
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Genomic quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis made to check the extraction quality was correct. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked EaDAcT colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We got the Candida genome band, however, the Saccharomyces genome band was not present.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep digestions are going to be done tomorrow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BglII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li><br />
<br />
<li>7.5 &mu;L Red buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL06) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL05) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul><li>FAO1-PCR2</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL08) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL07) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperatures</p><br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li><br />
<br />
<li>FAO1-PCR2: 64 &deg;C</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li><br />
<br />
<li>FAO1-PCR2: 1015 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both FAO1 PCR products were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 25 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p><br />
<br />
<br />
<br />
<p class="p_notebook">EaDAcT Transcriptional Unit (TU) transformation</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of P35s:EaDAcT:T35s in 2&Omega;2 P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> liquid cultures (5 mL LB)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li><br />
<br />
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li><br />
<br />
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li><br />
<br />
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from P35s:Atr&Delta;11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR of FAO1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>35 &mu;L HF buffer (5x)</li><br />
<br />
<li>7 &mu;L dNTPs</li><br />
<br />
<li>8.75 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>8.75 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>1.05 &mu;L Phusion polymerase</li><br />
<br />
<li>112.7 H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140805_PCR_FAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO2-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico to check minipreps:</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook"><i>A. tumefaciens</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li><br />
<br />
<li>12.5 &mu;L Orange buffer</li><br />
<br />
<li>105 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li><br />
<br />
<li>2.5 &mu;L Buffer</li><br />
<br />
<li>5 &mu;L Miniprep sample</li><br />
<br />
<li>17 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">FAO1 PCR product.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration protocol consists of:</p><br />
<br />
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li><br />
<br />
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li><br />
<br />
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li><br />
<br />
<li>Mix the cultures, keeping all of them in the same proportions.</li><br />
<br />
<li>Proceed to agroinfiltration.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Possibility of primer combinations: </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>94&deg;C, 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li><br />
<br />
<li>49 or 52&deg;C, 15 s</li><br />
<br />
<li>72&deg;C, 90 s</li><br />
<br />
</ul><li>72&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCRs wih Taq polimerase:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L Template </li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L Reverse primer</li><br />
<br />
<li>1 &mu;L Taq pol.</li><br />
<br />
<li>5 Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>94&deg;C 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li><br />
<br />
<li>49&deg;C 15 s</li><br />
<br />
<li>72&deg;C 90 s</li><br />
<br />
</ul><li>72&deg;C 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PHEROMONE ANALYSIS</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p><br />
<br />
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
<li>1 leaf from a wild type plant</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p><br />
<br />
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>100,0 mg of wild type leaf</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Then 150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p><br />
<br />
<br />
<br />
<p class="p_notebook">EDTA 500mM preparation:</p><br />
<br />
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p><br />
<br />
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4><br />
<br />
<p class="p_notebook">Analysis was performed overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">First results of the analysis were obtained. The analysis proved that our plant was successfuly producing the desired pheromones in high concentration. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<br />
<br />
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/66/20140812_IMAGEN_cromatogramas_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9a/20140812_IMAGEN_cromatogramas_7.png><br />
<br />
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p><br />
<br />
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Results of the replicae analysis are shown below:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140813_IMAGEN_CROMATOGRAMA_3.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Our happiness reached a peak!! A PEAK!</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p><br />
<br />
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward Primer </li><br />
<br />
<li>1 &mu;L Reverse Primer</li><br />
<br />
<li>1 &mu;L Taq Polimerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p><br />
<br />
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p><br />
<br />
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/9/95/20140814_colony_pcr_y_BBSI_test.png"><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Colony PCR 2:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 4:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400"src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/a7/20140820_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li><br />
<br />
<li>Incubate 15 min at 70&deg;C.</li><br />
<br />
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li><br />
<br />
<li>Centrifuge 3 min at 15000 xg.</li><br />
<br />
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li><br />
<br />
<li>Centrifuge 1 min at 15000 xg. </li><br />
<br />
<li>Recover 1 &mu;L of supernatant. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Control PCR:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L template</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 clone Fw+1 </li><br />
<br />
<li>1 &mu;L HSR1 Rtrv + 1149</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO1 PCR</li><br />
<br />
<li>1 &mu;L template</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li><br />
<br />
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR parameters (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li><br />
<br />
<li>HSR1 RTRv+1149</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li><br />
<br />
<li>HSR1 RTRv+1149 </li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul07 </li><br />
<br />
<li>iGEMJul08</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul09 </li><br />
<br />
<li>iGEMJul10</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/ac/20140825_pcps2_ta29_atr.png><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB parts:</li><br />
<br />
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were not correct. We will keep trying.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Note: Go to 09/16/2014</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li><br />
<br />
<li>Introduce the disks inside the tube.</li><br />
<br />
<li>Introduce the two tubes in liquid nitrogen.</li><br />
<br />
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li><br />
<br />
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li><br />
<br />
<li>Grind the disks.</li><br />
<br />
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li><br />
<br />
<li>Grind the mixture.</li><br />
<br />
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li><br />
<br />
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li><br />
<br />
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li><br />
<br />
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li><br />
<br />
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li><br />
<br />
<li>Repeat the last three steps.</li><br />
<br />
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li><br />
<br />
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li><br />
<br />
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li><br />
<br />
<li>Discard the supernatant by decantation (be carefull with the pellet).</li><br />
<br />
<li>Wash with 600 &mu;L ethanol (80%).</li><br />
<br />
<li>Centrifuge 5 min at 13000 rpm. </li><br />
<br />
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li><br />
<br />
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li><br />
<br />
<li>Store at -20&deg;C. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li><br />
<br />
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ordered primers</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJULO1</li><br />
<br />
<li>IGEMJULO2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li><br />
<br />
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for PCR:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L template</li><br />
<br />
<li>10 &mu;L buffer HF 5x</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo R</li><br />
<br />
<li>2.5 &mu;L oligo F</li><br />
<br />
<li>0.5 &mu;L Pfu</li><br />
<br />
<li>32 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 50 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Parameters:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR with different parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with other parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>49, 52, 55, 60 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with more genomic.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 &deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still without having any amplification.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat the PCR with other enzyme.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li><br />
<br />
<li>1.25 &mu;L forward primer 10 uM</li><br />
<br />
<li>1.25 &mu;L reverse primer 10 uM</li><br />
<br />
<li>0.5 &mu;L template 620 ng/&mu;L</li><br />
<br />
<li>9.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>50, 53, 55, 59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (2 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png><br />
<br />
<br />
<br />
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome promoter PCR product ligation in pUPD.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1.2 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>6.8 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Both minipreps were adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pTnos (GB0037)</li><br />
<br />
<li>pGFP (GB0059)</li><br />
<br />
<li>pLuciferase (GB0096)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Results of sequencing the promoter were obtained:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following table shows ligation details of the trichome promoter:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome Promoter transformation in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for HindIII:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li><br />
<br />
<li>10 &mu;L Red buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: The scientific name has been updated to Rhizobium radiobacter. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11/EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<img class="img_notebook" width="250px" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>1 &mu;L PCPS2:HarFAR:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li><br />
<br />
<li>1 &mu;L PCPS2:EaDAcT:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;2</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico made to check minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li><br />
<br />
<li>PCPS2:GFP:TNos (Rif, Kan)</li><br />
<br />
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li><br />
<br />
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos </li><br />
<br />
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico the check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/f1/20140826_Atr_%2B_Har.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TUs with trichome promoter:</li><br />
<br />
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made a ligation as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>3.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol followed was the same as previously done.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2f/PCPS2_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained trichome selective expression of GFP! </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="700px" src= https://static.igem.org/mediawiki/2014/b/b5/2014091_BB_y_Ruta_entera.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:GFP:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well using vortex.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>TNos:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="600px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Result analysis:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three gens are placed in the same construction. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/68/20140912_Pathway_complete.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digetions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions that were still pending from 09/12.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/28/20140916_ge_pieces_AcPathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="450" src= https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li><br />
<br />
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Order primers for TA29 and barnase:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29 PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>60&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul><li>Barnase PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>63&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul></ul><br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src="https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="300" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="402" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200" src= https://static.igem.org/mediawiki/2014/e/ef/20140821_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="250" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= ><br />
<br />
<img class="img_notebook" width="100" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png</p><br />
<br />
<br />
<br />
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase product</li><br />
<br />
<li>1.2 &mu;L Buffer Ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/eb/20140817_Ta29_e040.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/27/20140827_ta29.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/e/e5/2014092_Barnasaa_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Master Mix (12 reactions)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li><br />
<br />
<li>12 &mu;L primer R</li><br />
<br />
<li>12 &mu;L primer F</li><br />
<br />
<li>12 &mu;L Taq Polymerase</li><br />
<br />
<li>24 &mu;L Buffer 10X</li><br />
<br />
<li>48 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/7/75/2014092_Barnasa_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">bands were not correct, so we picked another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of barnase's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again Barnase minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140906_Barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct except one of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase</li><br />
<br />
<li>1.2 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 ul T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the PCR product is correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/49/20140918_bar_colony_PCR.png><br />
<br />
<br />
<br />
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li><br />
<br />
<li>Barnase PCR product in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested Barnase ligation with XbaI.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>MoFlippers constructions</li><br />
<br />
<li>Mutated Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="500" src=https://static.igem.org/mediawiki/2014/b/bb/20140922_Omega_under_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation into E.coli:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1</li><br />
<br />
<li>Barnase (XbaI digested) in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
<li>P35S:Yellow:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>Barnase digested with XbaI </li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again chromoproteins ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L Blue/Yellow</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions were run in two different gels</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/6/69/20140922_Blue_Ruta_KanRes_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestions were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Blue digestions were correct</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li><br />
<br />
<li>P35S:Yellow:T35S iin 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/05/20140924_Barnase.png><br />
<br />
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Barnase in pUPD (Mutated)</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 Ligase</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<br />
<br />
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture: </p><br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestion in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/ff/20140926_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a4/20140927_Blue_Agro.png><br />
<br />
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies (E.coli):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (2&omega;2)</li><br />
<br />
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (2&omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p><br />
<br />
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We send the Biosafety module to Norwich.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/2/27/20141005_Chromoprot_agro.png><br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other approaches that could be used in place of Blue and Yellow chromoproteins. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Ant1:TNos_P35S:JFA13:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's culture did not grow. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Plant leaves changed its usual green colour. As a result of anthocyanin accumulation, agroinfiltred leaves were purple coloured. We took photos of transient transformation of the two modules.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/25/Purple_Plant.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9f/20140822_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a8/20140827_bb_e0240.png><br />
<br />
<br />
<br />
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Double digestions</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li><br />
<br />
<li>2.5 &mu;L NEBuffer</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L enzyme 1</li><br />
<br />
<li>0.5 &mu;L enzyme 2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 20 &mu;L</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p><br />
<br />
<br />
<br />
<p class="p_notebook">BioBricks ligations</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li><br />
<br />
<li>2 &mu;L part 2 (25 ng)</li><br />
<br />
<li>1 &mu;L T4 buffer 10X</li><br />
<br />
<li>0.5 &mu;L T4</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/thumb/2/26/20140830_bb.png/800px-20140830_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a6/20140901_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/b/b7/20140902_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/0/07/20140904_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1)</td><td class="td_notebook">1.085</td><td class="td_notebook">0.38</td><td class="td_notebook">2.854</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.036</td><td class="td_notebook">0.35</td><td class="td_notebook">2.959</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.076</td><td class="td_notebook">0.39</td><td class="td_notebook">2.759</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1)</td><td class="td_notebook">4.907</td><td class="td_notebook">0.36</td><td class="td_notebook">13.632</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">4.754</td><td class="td_notebook">0.34</td><td class="td_notebook">13.981</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">3.494</td><td class="td_notebook">0.26</td><td class="td_notebook">13.439</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">57.393</td><td class="td_notebook">0.43</td><td class="td_notebook">133.471</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">61.622</td><td class="td_notebook">0.47</td><td class="td_notebook">131.110</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">63.999</td><td class="td_notebook">0.47</td><td class="td_notebook">136.167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">1.389</td><td class="td_notebook">0.37</td><td class="td_notebook">3.754</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.353</td><td class="td_notebook">0.37</td><td class="td_notebook">3.656</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.370</td><td class="td_notebook">0.33</td><td class="td_notebook">4.151</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr><br />
<br />
</table><br />
<br />
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run PCR with the following templates and primers:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">P35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>67&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">T35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>65&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li><br />
<br />
<li>PCR2: P35S:Atr&Delta;11:T35S template</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/e0/20140819_p35s.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20140819_t35s2C_p35s.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L T35S_BB</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H20 miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li><br />
<br />
<li>HarFAR (2&alpha;2)</li><br />
<br />
<li>Atr&Delta;11 (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the template is not there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">The gel showed that the PCR products were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/aa/20140906_PCR_P35S.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/b/b0/20140907_Barnase_PCR_35S.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any PCR product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng E0040</li><br />
<br />
<li>2.5 &mu;L NEB2</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L XbaI</li><br />
<br />
<li>0.5 &mu;L PstI</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li><br />
<br />
<li>MoFlipper + Atr&Delta;11</li><br />
<br />
<li>MoFlipper + HarFAR</li><br />
<br />
<li>MoFlipper + EaDAcT</li><br />
<br />
<li>MoFlipper + TA29</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="380px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">MoFlipper cultures did not grow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Omega undercover</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover with TA29</li><br />
<br />
<li>MoFlipper with Atr&Delta;11</li><br />
<br />
<li>MoFlipper with HarFAR</li><br />
<br />
<li>MoFlipper with EaDAcT</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="200px"src= https://static.igem.org/mediawiki/2014/7/7d/20140923_Ta29_Moflippers.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p><br />
<br />
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li><br />
<br />
<li>CUP2-PCR2: 348 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both PCR products were correct.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of both parts of CUP2.</p><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Gal4AD</li><br />
<br />
<li>CUP2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Gal4AD piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Quantification </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li><br />
<br />
<li>Gal4: 221.4 ng/&mu;L</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following ligations were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O </li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/1/18/20140815_CUP2_digestion.png><br />
<br />
<br />
<br />
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Gal4AD</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li><br />
<br />
<li>1 &mu;L SF in 1&alpha;1</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol was the same as previously folowed. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<p class="p_notebook">We have to repeat digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the following digestions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We consider to use the miniprep number 2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="280px" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested minipreps made the previous days:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/24/20140909_Digestiones_fallidas_CUP2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction in glycerol, we picked some colonies (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/66/20140910_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained from GB collection the following piece:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png ><br />
<br />
<br />
<br />
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0256</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligate it in pUPD vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L GBlock</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>GBlock in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/0/06/20140925_CUP_promoter_gblock_fail.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions have to be repeated.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/f/fb/20140925_CUP_promoter_GBlock.png><br />
<br />
<p class="p_notebook">Minipreps were correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L colony</li><br />
<br />
<li>1 &mu;L primer F</li><br />
<br />
<li>1 ul primer R</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Taq Polymerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We run a gel with PCR products:</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="355px" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li><br />
<br />
<li>Incorrect possible band: 270 bp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 157</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/9/9e/09012014_Mini35s_GBlock.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li><br />
<br />
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li><br />
<br />
<li>0.75 ul Luciferase (75 ng/&mu;L</li><br />
<br />
<li>0.75 T35S (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L Bsa1</li><br />
<br />
<li>1 &mu;L T4 Ligase </li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Tomorrow we will transform the result.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li><br />
<br />
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li><br />
<br />
<li>1 µl pDGB2?2</li><br />
<br />
<li>1 µl BsaI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl T10x</li><br />
<br />
<li>4.8 µl water</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked two colonies of each construct: </p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/04/2014</h4><br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="475" src= https://static.igem.org/mediawiki/2014/2/2d/20141004_CBSmini35_UTR_Luc.png><br />
<br />
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p><br />
<br />
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p><br />
<br />
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<p class="p_notebook">We made the following binary assembly.</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li><br />
<br />
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li><br />
<br />
<li>1 µl 2&Omega;2</li><br />
<br />
<li>1 µl BsmBI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl Buffer T10x</li><br />
<br />
<li>5.8 µl H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<p class="p_notebook">We picked two colonies of:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Restriction analysis:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20141008_cbsmini35_2omega2.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">11/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday' culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/3/31/20141011_Yellow_chromoprot_CUP_agro.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">13/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/c/c8/20141013_luciferase_mini35.png><br />
<br />
<p class="p_notebook">They were correct.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content-trans" id="goto-left" align="center"></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/interlab"><strong>Go to Interlab Study&rarr;</strong></a></div></br></br></br><br />
<br />
<div class="right-col"><br />
<div class="pinned note-container"><br />
<div class="note"><br />
<h3>Great Days!</h3><br />
<p>Here is our biggest days in the Laboratory</p><br />
<p><a href="#">Day 1</a>.</p><br />
<p><a href="#">Day 2</a>.</p><br />
<p><a href="#">Day 3</a>.</p><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</section> <br />
</div><br />
<br />
<div id="space-margin"></div><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.9.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:Valencia_UPV/Templates/sticky-notebook_jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<script><br />
$(".pinned").pin({containerSelector: ".container", minWidth: 940});<br />
</script><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/notebook
Team:Valencia UPV/Project/notebook
2014-10-17T19:05:54Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<html><br />
<style><br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.table_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border: none;<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.td_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border:none;<br />
padding-right: 25px;<br />
}<br />
<br />
.section_notebook{<br />
color: red;<br />
text-align: left;<br />
font-size: 16pt;<br />
}<br />
<br />
.date_notebook {<br />
color: green;<br />
text-align: left;<br />
font-size: 12pt;<br />
}<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.strong_notebook {<br />
color: red;<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
<br />
.img_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.box_above_notebook{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
<br />
.ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
}<br />
<br />
.ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 1.5em;<br />
}<br />
<br />
.ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 3.0em;<br />
}<br />
<br />
.ul_ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 4.5em;<br />
}<br />
<br />
#cn-box-left<br />
{<br />
float: left;<br />
width: 70%;<br />
//padding-right: 20px;<br />
margin-left: 140px;<br />
//background-color: yellow;<br />
}<br />
<br />
#cn-box-right<br />
{<br />
float: right;<br />
width: 18%;<br />
background-color: blue;<br />
}<br />
<br />
.right-col {<br />
float: right;<br />
width: 25%;<br />
padding-left: 20px;<br />
}<br />
<br />
.note-container {<br />
margin-top: 10px;<br />
}<br />
<br />
.note {<br />
padding: 18px 5px;<br />
background: #eee;<br />
text-decoration:none;<br />
background:#ffc;<br />
display:block;<br />
padding: 20px;<br />
width: 200px; <br />
box-shadow: 5px 5px 7px rgba(33,33,33,.7);<br />
-webkit-transform: rotate(-6deg);<br />
-moz-transform: rotate(-6deg);<br />
-ms-transform: rotate(-6deg);<br />
transform: rotate(-6deg);<br />
font-size: 16px;<br />
}<br />
.note h3 {<br />
font-size: 28px;<br />
margin: 0;<br />
}<br />
<br />
/*Thanks to Webpop (http://www.webpop.com) for the code for the pinned note*/<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-18439732-5']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Notebook</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>N</roja>otebook</span> </div><br/><br/><br />
<br />
<br />
<section class="container clearfix"> <br />
<br />
<div class="box_above_notebook"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul><br />
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p><br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"><br />
<br />
<br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p><br />
<br />
<ul class="ul_notebook"><li>Codon optimization</li><br />
<br />
<li>Inner restriction sites eliminations by finding synonymous mutations</li><br />
<br />
<li>Addition of GB endings</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p><br />
<br />
<br />
<br />
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ordered the following gBlocks and primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li><br />
<br />
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li><br />
<br />
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li><br />
<br />
<li>I14Jun04 Atr&Delta;11 R1</li><br />
<br />
</ul><li>FAO1: <i>N. benthamiana</i> primers</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li><br />
<br />
<li>I14Jun02 FAO1 R1</li><br />
<br />
</ul></ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We thought which parts of the GB collection could we use.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy 1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 2:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTAtHSP18.2</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 3:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTTctp</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Pieces to take from GB2.0 colection:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Later we will need:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Prepare plaques with antibiotics Kan, Spm, Amp</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Culture in agar Petri dish. 2 plaques: Amp and Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps with EZNA Plasmid DNA MiniKit I.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Expected digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis analysis.</p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"><br />
<br />
<br />
<br />
<p class="p_notebook">We got the expected bands in all cases.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p><br />
<br />
<p class="p_notebook">We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li><br />
<br />
<li>10 &mu;L HF buffer </li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L Reverse primer</li><br />
<br />
<li>2.5 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L template (Atr&Delta;11 gene)</li><br />
<br />
<li>0.5 &mu;L phusion (polimerase)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png><br />
<br />
<br />
<br />
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product/gblock product </li><br />
<br />
<li>1.2 &mu;L buffer 10x</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Vfinal= 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li><br />
<br />
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After incubation, culture in Petri plates (always in a LAF).</p><br />
<br />
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p><br />
<br />
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li><br />
<br />
<li>2.5 &mu;L buffer</li><br />
<br />
<li>21 &mu;L H20 (miliQ)</li><br />
<br />
<li>1 &mu;L sample</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li><br />
<br />
<li>25 &mu;L Orange</li><br />
<br />
<li>210 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li><br />
<br />
<li>7.5 &mu;L Green</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BanII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Comments:</p><br />
<br />
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li><br />
<br />
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-Gal</li><br />
<br />
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li><br />
<br />
<li>17.5 &mu;L Orange</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li><br />
<br />
<li>10 &mu;L Tango</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li><br />
<br />
<li>10 &mu;L Green</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L terminator 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L CDS 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L vector &alpha;</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Total: 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy Promoter-Terminator:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Adjust concentrations to 75 ng/&mu;L for ligation reaction</p><br />
<br />
<br />
<br />
<p class="p_notebook">Initial concentrations (nanodrop):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reaction</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p><br />
<br />
<br />
<br />
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li><br />
<br />
<li>HarFAR -> Sequencing correct</li><br />
<br />
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Worked in the LAF</li><br />
<br />
<li>Cultivated in a Petri dish with Spm</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li><br />
<br />
<li>Rest of the culture in another (250 &mu;L aprox)</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-gal</li><br />
<br />
<li>3.5 &mu;L IPTG</li><br />
<br />
</ul><li>1 colony from 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p><br />
<br />
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for HindIII</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li><br />
<br />
<li>17.5 &mu;L Red</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li><br />
<br />
<li>2.5 &mu;L Red</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul><li>Mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li><br />
<br />
<li>2.5 &mu;L Green</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Amp</li><br />
<br />
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li><br />
<br />
<li>pEaDAcT (3)</li><br />
<br />
<li>pHarFAR (3)</li><br />
<br />
</ul><li>Kan</li><br />
<br />
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li><br />
<br />
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except P35s:EaDAcT:T35s (2).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation in &Omega; vectors.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Selected tubes: </p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check the transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li><br />
<br />
<li>10 &mu;L Green buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li><br />
<br />
<li>20 &mu;L Red buffer</li><br />
<br />
<li>168 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Candida genome extraction</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cultures measured at 600 nm:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.39</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The absorbance was measured again:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.40</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li><br />
<br />
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li><br />
<br />
<li>Wash once with 1 mL sterile water.</li><br />
<br />
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li><br />
<br />
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li><br />
<br />
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li><br />
<br />
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li><br />
<br />
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li><br />
<br />
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li><br />
<br />
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li><br />
<br />
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li><br />
<br />
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li><br />
<br />
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li><br />
<br />
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Genomic quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis made to check the extraction quality was correct. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked EaDAcT colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We got the Candida genome band, however, the Saccharomyces genome band was not present.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep digestions are going to be done tomorrow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BglII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li><br />
<br />
<li>7.5 &mu;L Red buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL06) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL05) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul><li>FAO1-PCR2</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL08) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL07) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperatures</p><br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li><br />
<br />
<li>FAO1-PCR2: 64 &deg;C</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li><br />
<br />
<li>FAO1-PCR2: 1015 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both FAO1 PCR products were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 25 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p><br />
<br />
<br />
<br />
<p class="p_notebook">EaDAcT Transcriptional Unit (TU) transformation</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of P35s:EaDAcT:T35s in 2&Omega;2 P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> liquid cultures (5 mL LB)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li><br />
<br />
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li><br />
<br />
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li><br />
<br />
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from P35s:Atr&Delta;11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR of FAO1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>35 &mu;L HF buffer (5x)</li><br />
<br />
<li>7 &mu;L dNTPs</li><br />
<br />
<li>8.75 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>8.75 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>1.05 &mu;L Phusion polymerase</li><br />
<br />
<li>112.7 H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140805_PCR_FAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO2-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico to check minipreps:</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook"><i>A. tumefaciens</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li><br />
<br />
<li>12.5 &mu;L Orange buffer</li><br />
<br />
<li>105 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li><br />
<br />
<li>2.5 &mu;L Buffer</li><br />
<br />
<li>5 &mu;L Miniprep sample</li><br />
<br />
<li>17 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">FAO1 PCR product.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration protocol consists of:</p><br />
<br />
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li><br />
<br />
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li><br />
<br />
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li><br />
<br />
<li>Mix the cultures, keeping all of them in the same proportions.</li><br />
<br />
<li>Proceed to agroinfiltration.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Possibility of primer combinations: </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>94&deg;C, 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li><br />
<br />
<li>49 or 52&deg;C, 15 s</li><br />
<br />
<li>72&deg;C, 90 s</li><br />
<br />
</ul><li>72&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCRs wih Taq polimerase:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L Template </li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L Reverse primer</li><br />
<br />
<li>1 &mu;L Taq pol.</li><br />
<br />
<li>5 Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>94&deg;C 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li><br />
<br />
<li>49&deg;C 15 s</li><br />
<br />
<li>72&deg;C 90 s</li><br />
<br />
</ul><li>72&deg;C 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PHEROMONE ANALYSIS</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p><br />
<br />
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
<li>1 leaf from a wild type plant</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p><br />
<br />
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>100,0 mg of wild type leaf</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Then 150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p><br />
<br />
<br />
<br />
<p class="p_notebook">EDTA 500mM preparation:</p><br />
<br />
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p><br />
<br />
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4><br />
<br />
<p class="p_notebook">Analysis was performed overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">First results of the analysis were obtained. The analysis proved that our plant was successfuly producing the desired pheromones in high concentration. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<br />
<br />
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/66/20140812_IMAGEN_cromatogramas_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9a/20140812_IMAGEN_cromatogramas_7.png><br />
<br />
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p><br />
<br />
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Results of the replicae analysis are shown below:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140813_IMAGEN_CROMATOGRAMA_3.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Our happiness reached a peak!! A PEAK!</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p><br />
<br />
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward Primer </li><br />
<br />
<li>1 &mu;L Reverse Primer</li><br />
<br />
<li>1 &mu;L Taq Polimerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p><br />
<br />
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p><br />
<br />
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/9/95/20140814_colony_pcr_y_BBSI_test.png"><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Colony PCR 2:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 4:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400"src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/a7/20140820_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li><br />
<br />
<li>Incubate 15 min at 70&deg;C.</li><br />
<br />
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li><br />
<br />
<li>Centrifuge 3 min at 15000 xg.</li><br />
<br />
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li><br />
<br />
<li>Centrifuge 1 min at 15000 xg. </li><br />
<br />
<li>Recover 1 &mu;L of supernatant. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Control PCR:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L template</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 clone Fw+1 </li><br />
<br />
<li>1 &mu;L HSR1 Rtrv + 1149</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO1 PCR</li><br />
<br />
<li>1 &mu;L template</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li><br />
<br />
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR parameters (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li><br />
<br />
<li>HSR1 RTRv+1149</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li><br />
<br />
<li>HSR1 RTRv+1149 </li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul07 </li><br />
<br />
<li>iGEMJul08</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul09 </li><br />
<br />
<li>iGEMJul10</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/ac/20140825_pcps2_ta29_atr.png><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB parts:</li><br />
<br />
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were not correct. We will keep trying.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Note: Go to 09/16/2014</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li><br />
<br />
<li>Introduce the disks inside the tube.</li><br />
<br />
<li>Introduce the two tubes in liquid nitrogen.</li><br />
<br />
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li><br />
<br />
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li><br />
<br />
<li>Grind the disks.</li><br />
<br />
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li><br />
<br />
<li>Grind the mixture.</li><br />
<br />
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li><br />
<br />
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li><br />
<br />
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li><br />
<br />
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li><br />
<br />
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li><br />
<br />
<li>Repeat the last three steps.</li><br />
<br />
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li><br />
<br />
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li><br />
<br />
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li><br />
<br />
<li>Discard the supernatant by decantation (be carefull with the pellet).</li><br />
<br />
<li>Wash with 600 &mu;L ethanol (80%).</li><br />
<br />
<li>Centrifuge 5 min at 13000 rpm. </li><br />
<br />
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li><br />
<br />
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li><br />
<br />
<li>Store at -20&deg;C. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li><br />
<br />
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ordered primers</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJULO1</li><br />
<br />
<li>IGEMJULO2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li><br />
<br />
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for PCR:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L template</li><br />
<br />
<li>10 &mu;L buffer HF 5x</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo R</li><br />
<br />
<li>2.5 &mu;L oligo F</li><br />
<br />
<li>0.5 &mu;L Pfu</li><br />
<br />
<li>32 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 50 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Parameters:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR with different parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with other parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>49, 52, 55, 60 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with more genomic.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 &deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still without having any amplification.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat the PCR with other enzyme.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li><br />
<br />
<li>1.25 &mu;L forward primer 10 uM</li><br />
<br />
<li>1.25 &mu;L reverse primer 10 uM</li><br />
<br />
<li>0.5 &mu;L template 620 ng/&mu;L</li><br />
<br />
<li>9.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>50, 53, 55, 59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (2 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png><br />
<br />
<br />
<br />
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome promoter PCR product ligation in pUPD.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1.2 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>6.8 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Both minipreps were adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pTnos (GB0037)</li><br />
<br />
<li>pGFP (GB0059)</li><br />
<br />
<li>pLuciferase (GB0096)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Results of sequencing the promoter were obtained:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following table shows ligation details of the trichome promoter:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome Promoter transformation in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for HindIII:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li><br />
<br />
<li>10 &mu;L Red buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: The scientific name has been updated to Rhizobium radiobacter. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11/EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<img class="img_notebook" width="250px" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>1 &mu;L PCPS2:HarFAR:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li><br />
<br />
<li>1 &mu;L PCPS2:EaDAcT:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;2</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico made to check minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li><br />
<br />
<li>PCPS2:GFP:TNos (Rif, Kan)</li><br />
<br />
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li><br />
<br />
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos </li><br />
<br />
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico the check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/f1/20140826_Atr_%2B_Har.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TUs with trichome promoter:</li><br />
<br />
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made a ligation as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>3.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol followed was the same as previously done.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2f/PCPS2_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained trichome selective expression of GFP! </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="700px" src= https://static.igem.org/mediawiki/2014/b/b5/2014091_BB_y_Ruta_entera.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:GFP:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well using vortex.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>TNos:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="600px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Result analysis:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three gens are placed in the same construction. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/68/20140912_Pathway_complete.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digetions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions that were still pending from 09/12.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/28/20140916_ge_pieces_AcPathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="450" src= https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li><br />
<br />
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Order primers for TA29 and barnase:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29 PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>60&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul><li>Barnase PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>63&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul></ul><br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src="https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="300" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="402" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200" src= https://static.igem.org/mediawiki/2014/e/ef/20140821_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="250" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= ><br />
<br />
<img class="img_notebook" width="100" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png</p><br />
<br />
<br />
<br />
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase product</li><br />
<br />
<li>1.2 &mu;L Buffer Ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/eb/20140817_Ta29_e040.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/27/20140827_ta29.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/e/e5/2014092_Barnasaa_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Master Mix (12 reactions)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li><br />
<br />
<li>12 &mu;L primer R</li><br />
<br />
<li>12 &mu;L primer F</li><br />
<br />
<li>12 &mu;L Taq Polymerase</li><br />
<br />
<li>24 &mu;L Buffer 10X</li><br />
<br />
<li>48 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/7/75/2014092_Barnasa_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">bands were not correct, so we picked another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of barnase's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again Barnase minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140906_Barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct except one of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase</li><br />
<br />
<li>1.2 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 ul T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the PCR product is correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/49/20140918_bar_colony_PCR.png><br />
<br />
<br />
<br />
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li><br />
<br />
<li>Barnase PCR product in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested Barnase ligation with XbaI.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>MoFlippers constructions</li><br />
<br />
<li>Mutated Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="500" src=https://static.igem.org/mediawiki/2014/b/bb/20140922_Omega_under_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation into E.coli:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1</li><br />
<br />
<li>Barnase (XbaI digested) in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
<li>P35S:Yellow:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>Barnase digested with XbaI </li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again chromoproteins ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L Blue/Yellow</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions were run in two different gels</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/6/69/20140922_Blue_Ruta_KanRes_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestions were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Blue digestions were correct</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li><br />
<br />
<li>P35S:Yellow:T35S iin 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/05/20140924_Barnase.png><br />
<br />
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Barnase in pUPD (Mutated)</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 Ligase</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<br />
<br />
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture: </p><br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestion in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/ff/20140926_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a4/20140927_Blue_Agro.png><br />
<br />
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies (E.coli):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (2&omega;2)</li><br />
<br />
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (2&omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p><br />
<br />
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We send the Biosafety module to Norwich.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/2/27/20141005_Chromoprot_agro.png><br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other approaches that could be used in place of Blue and Yellow chromoproteins. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Ant1:TNos_P35S:JFA13:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's culture did not grow. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Plant leaves changed its usual green colour. As a result of anthocyanin accumulation, agroinfiltred leaves were purple coloured. We took photos of transient transformation of the two modules.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/25/Purple_Plant.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9f/20140822_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a8/20140827_bb_e0240.png><br />
<br />
<br />
<br />
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Double digestions</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li><br />
<br />
<li>2.5 &mu;L NEBuffer</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L enzyme 1</li><br />
<br />
<li>0.5 &mu;L enzyme 2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 20 &mu;L</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p><br />
<br />
<br />
<br />
<p class="p_notebook">BioBricks ligations</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li><br />
<br />
<li>2 &mu;L part 2 (25 ng)</li><br />
<br />
<li>1 &mu;L T4 buffer 10X</li><br />
<br />
<li>0.5 &mu;L T4</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/thumb/2/26/20140830_bb.png/800px-20140830_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a6/20140901_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/b/b7/20140902_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/0/07/20140904_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1)</td><td class="td_notebook">1.085</td><td class="td_notebook">0.38</td><td class="td_notebook">2.854</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.036</td><td class="td_notebook">0.35</td><td class="td_notebook">2.959</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.076</td><td class="td_notebook">0.39</td><td class="td_notebook">2.759</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1)</td><td class="td_notebook">4.907</td><td class="td_notebook">0.36</td><td class="td_notebook">13.632</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">4.754</td><td class="td_notebook">0.34</td><td class="td_notebook">13.981</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">3.494</td><td class="td_notebook">0.26</td><td class="td_notebook">13.439</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">57.393</td><td class="td_notebook">0.43</td><td class="td_notebook">133.471</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">61.622</td><td class="td_notebook">0.47</td><td class="td_notebook">131.110</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">63.999</td><td class="td_notebook">0.47</td><td class="td_notebook">136.167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">1.389</td><td class="td_notebook">0.37</td><td class="td_notebook">3.754</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.353</td><td class="td_notebook">0.37</td><td class="td_notebook">3.656</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.370</td><td class="td_notebook">0.33</td><td class="td_notebook">4.151</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr><br />
<br />
</table><br />
<br />
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run PCR with the following templates and primers:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">P35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>67&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">T35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>65&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li><br />
<br />
<li>PCR2: P35S:Atr&Delta;11:T35S template</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/e0/20140819_p35s.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20140819_t35s2C_p35s.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L T35S_BB</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H20 miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li><br />
<br />
<li>HarFAR (2&alpha;2)</li><br />
<br />
<li>Atr&Delta;11 (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the template is not there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">The gel showed that the PCR products were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/aa/20140906_PCR_P35S.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/b/b0/20140907_Barnase_PCR_35S.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any PCR product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng E0040</li><br />
<br />
<li>2.5 &mu;L NEB2</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L XbaI</li><br />
<br />
<li>0.5 &mu;L PstI</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li><br />
<br />
<li>MoFlipper + Atr&Delta;11</li><br />
<br />
<li>MoFlipper + HarFAR</li><br />
<br />
<li>MoFlipper + EaDAcT</li><br />
<br />
<li>MoFlipper + TA29</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="380px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">MoFlipper cultures did not grow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Omega undercover</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover with TA29</li><br />
<br />
<li>MoFlipper with Atr&Delta;11</li><br />
<br />
<li>MoFlipper with HarFAR</li><br />
<br />
<li>MoFlipper with EaDAcT</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="200px"src= https://static.igem.org/mediawiki/2014/7/7d/20140923_Ta29_Moflippers.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p><br />
<br />
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li><br />
<br />
<li>CUP2-PCR2: 348 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both PCR products were correct.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of both parts of CUP2.</p><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Gal4AD</li><br />
<br />
<li>CUP2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Gal4AD piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Quantification </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li><br />
<br />
<li>Gal4: 221.4 ng/&mu;L</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following ligations were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O </li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/1/18/20140815_CUP2_digestion.png><br />
<br />
<br />
<br />
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Gal4AD</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li><br />
<br />
<li>1 &mu;L SF in 1&alpha;1</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol was the same as previously folowed. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<p class="p_notebook">We have to repeat digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the following digestions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We consider to use the miniprep number 2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="280px" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested minipreps made the previous days:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/24/20140909_Digestiones_fallidas_CUP2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction in glycerol, we picked some colonies (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/66/20140910_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained from GB collection the following piece:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png ><br />
<br />
<br />
<br />
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0256</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligate it in pUPD vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L GBlock</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>GBlock in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/0/06/20140925_CUP_promoter_gblock_fail.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions have to be repeated.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/f/fb/20140925_CUP_promoter_GBlock.png><br />
<br />
<p class="p_notebook">Minipreps were correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L colony</li><br />
<br />
<li>1 &mu;L primer F</li><br />
<br />
<li>1 ul primer R</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Taq Polymerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We run a gel with PCR products:</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="355px" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li><br />
<br />
<li>Incorrect possible band: 270 bp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 157</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/9/9e/09012014_Mini35s_GBlock.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li><br />
<br />
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li><br />
<br />
<li>0.75 ul Luciferase (75 ng/&mu;L</li><br />
<br />
<li>0.75 T35S (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L Bsa1</li><br />
<br />
<li>1 &mu;L T4 Ligase </li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Tomorrow we will transform the result.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li><br />
<br />
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li><br />
<br />
<li>1 µl pDGB2?2</li><br />
<br />
<li>1 µl BsaI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl T10x</li><br />
<br />
<li>4.8 µl water</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked two colonies of each construct: </p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/04/2014</h4><br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="475" src= https://static.igem.org/mediawiki/2014/2/2d/20141004_CBSmini35_UTR_Luc.png><br />
<br />
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p><br />
<br />
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p><br />
<br />
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<p class="p_notebook">We made the following binary assembly.</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li><br />
<br />
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li><br />
<br />
<li>1 µl 2&Omega;2</li><br />
<br />
<li>1 µl BsmBI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl Buffer T10x</li><br />
<br />
<li>5.8 µl H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<p class="p_notebook">We picked two colonies of:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Restriction analysis:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20141008_cbsmini35_2omega2.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">11/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday' culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/31/20141011_Yellow_chromoprot_CUP_agro.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">13/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/c/c8/20141013_luciferase_mini35.png><br />
<br />
<p class="p_notebook">They were correct.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content-trans" id="goto-left" align="center"></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/interlab"><strong>Go to Interlab Study&rarr;</strong></a></div></br></br></br><br />
<br />
<div class="right-col"><br />
<div class="pinned note-container"><br />
<div class="note"><br />
<h3>Great Days!</h3><br />
<p>Here is our biggest days in the Laboratory</p><br />
<p><a href="#">Day 1</a>.</p><br />
<p><a href="#">Day 2</a>.</p><br />
<p><a href="#">Day 3</a>.</p><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</section> <br />
</div><br />
<br />
<div id="space-margin"></div><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.9.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:Valencia_UPV/Templates/sticky-notebook_jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<script><br />
$(".pinned").pin({containerSelector: ".container", minWidth: 940});<br />
</script><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual
http://2014.igem.org/Team:Valencia_UPV/Project/notebook
Team:Valencia UPV/Project/notebook
2014-10-17T18:40:51Z
<p>Alrual: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<html><br />
<style><br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.table_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border: none;<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.td_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border:none;<br />
padding-right: 25px;<br />
}<br />
<br />
.section_notebook{<br />
color: red;<br />
text-align: left;<br />
font-size: 16pt;<br />
}<br />
<br />
.date_notebook {<br />
color: green;<br />
text-align: left;<br />
font-size: 12pt;<br />
}<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.strong_notebook {<br />
color: red;<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
<br />
.img_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.box_above_notebook{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
<br />
.ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
}<br />
<br />
.ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 1.5em;<br />
}<br />
<br />
.ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 3.0em;<br />
}<br />
<br />
.ul_ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 4.5em;<br />
}<br />
<br />
#cn-box-left<br />
{<br />
float: left;<br />
width: 70%;<br />
//padding-right: 20px;<br />
margin-left: 140px;<br />
//background-color: yellow;<br />
}<br />
<br />
#cn-box-right<br />
{<br />
float: right;<br />
width: 18%;<br />
background-color: blue;<br />
}<br />
<br />
.right-col {<br />
float: right;<br />
width: 25%;<br />
padding-left: 20px;<br />
}<br />
<br />
.note-container {<br />
margin-top: 10px;<br />
}<br />
<br />
.note {<br />
padding: 18px 5px;<br />
background: #eee;<br />
text-decoration:none;<br />
background:#ffc;<br />
display:block;<br />
padding: 20px;<br />
width: 200px; <br />
box-shadow: 5px 5px 7px rgba(33,33,33,.7);<br />
-webkit-transform: rotate(-6deg);<br />
-moz-transform: rotate(-6deg);<br />
-ms-transform: rotate(-6deg);<br />
transform: rotate(-6deg);<br />
font-size: 16px;<br />
}<br />
.note h3 {<br />
font-size: 28px;<br />
margin: 0;<br />
}<br />
<br />
/*Thanks to Webpop (http://www.webpop.com) for the code for the pinned note*/<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-18439732-5']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Notebook</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>N</roja>otebook</span> </div><br/><br/><br />
<br />
<br />
<section class="container clearfix"> <br />
<br />
<div class="box_above_notebook"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul><br />
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p><br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"><br />
<br />
<br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p><br />
<br />
<ul class="ul_notebook"><li>Codon optimization</li><br />
<br />
<li>Inner restriction sites eliminations by finding synonymous mutations</li><br />
<br />
<li>Addition of GB endings</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p><br />
<br />
<br />
<br />
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ordered the following gBlocks and primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li><br />
<br />
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li><br />
<br />
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li><br />
<br />
<li>I14Jun04 Atr&Delta;11 R1</li><br />
<br />
</ul><li>FAO1: <i>N. benthamiana</i> primers</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li><br />
<br />
<li>I14Jun02 FAO1 R1</li><br />
<br />
</ul></ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We thought which parts of the GB collection could we use.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy 1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 2:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTAtHSP18.2</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 3:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTTctp</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Pieces to take from GB2.0 colection:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Later we will need:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Prepare plaques with antibiotics Kan, Spm, Amp</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Culture in agar Petri dish. 2 plaques: Amp and Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps with EZNA Plasmid DNA MiniKit I.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Expected digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis analysis.</p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"><br />
<br />
<br />
<br />
<p class="p_notebook">We got the expected bands in all cases.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p><br />
<br />
<p class="p_notebook">We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li><br />
<br />
<li>10 &mu;L HF buffer </li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L Reverse primer</li><br />
<br />
<li>2.5 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L template (Atr&Delta;11 gene)</li><br />
<br />
<li>0.5 &mu;L phusion (polimerase)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png><br />
<br />
<br />
<br />
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product/gblock product </li><br />
<br />
<li>1.2 &mu;L buffer 10x</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Vfinal= 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li><br />
<br />
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After incubation, culture in Petri plates (always in a LAF).</p><br />
<br />
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p><br />
<br />
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li><br />
<br />
<li>2.5 &mu;L buffer</li><br />
<br />
<li>21 &mu;L H20 (miliQ)</li><br />
<br />
<li>1 &mu;L sample</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li><br />
<br />
<li>25 &mu;L Orange</li><br />
<br />
<li>210 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li><br />
<br />
<li>7.5 &mu;L Green</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BanII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Comments:</p><br />
<br />
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li><br />
<br />
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-Gal</li><br />
<br />
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li><br />
<br />
<li>17.5 &mu;L Orange</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li><br />
<br />
<li>10 &mu;L Tango</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li><br />
<br />
<li>10 &mu;L Green</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L terminator 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L CDS 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L vector &alpha;</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Total: 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy Promoter-Terminator:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Adjust concentrations to 75 ng/&mu;L for ligation reaction</p><br />
<br />
<br />
<br />
<p class="p_notebook">Initial concentrations (nanodrop):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reaction</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p><br />
<br />
<br />
<br />
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li><br />
<br />
<li>HarFAR -> Sequencing correct</li><br />
<br />
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Worked in the LAF</li><br />
<br />
<li>Cultivated in a Petri dish with Spm</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li><br />
<br />
<li>Rest of the culture in another (250 &mu;L aprox)</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-gal</li><br />
<br />
<li>3.5 &mu;L IPTG</li><br />
<br />
</ul><li>1 colony from 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p><br />
<br />
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for HindIII</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li><br />
<br />
<li>17.5 &mu;L Red</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li><br />
<br />
<li>2.5 &mu;L Red</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul><li>Mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li><br />
<br />
<li>2.5 &mu;L Green</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Amp</li><br />
<br />
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li><br />
<br />
<li>pEaDAcT (3)</li><br />
<br />
<li>pHarFAR (3)</li><br />
<br />
</ul><li>Kan</li><br />
<br />
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li><br />
<br />
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except P35s:EaDAcT:T35s (2).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation in &Omega; vectors.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Selected tubes: </p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check the transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li><br />
<br />
<li>10 &mu;L Green buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li><br />
<br />
<li>20 &mu;L Red buffer</li><br />
<br />
<li>168 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Candida genome extraction</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cultures measured at 600 nm:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.39</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The absorbance was measured again:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.40</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li><br />
<br />
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li><br />
<br />
<li>Wash once with 1 mL sterile water.</li><br />
<br />
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li><br />
<br />
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li><br />
<br />
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li><br />
<br />
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li><br />
<br />
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li><br />
<br />
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li><br />
<br />
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li><br />
<br />
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li><br />
<br />
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li><br />
<br />
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li><br />
<br />
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Genomic quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis made to check the extraction quality was correct. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked EaDAcT colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We got the Candida genome band, however, the Saccharomyces genome band was not present.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep digestions are going to be done tomorrow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BglII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li><br />
<br />
<li>7.5 &mu;L Red buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL06) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL05) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul><li>FAO1-PCR2</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL08) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL07) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperatures</p><br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li><br />
<br />
<li>FAO1-PCR2: 64 &deg;C</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li><br />
<br />
<li>FAO1-PCR2: 1015 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both FAO1 PCR products were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 25 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p><br />
<br />
<br />
<br />
<p class="p_notebook">EaDAcT Transcriptional Unit (TU) transformation</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of P35s:EaDAcT:T35s in 2&Omega;2 P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> liquid cultures (5 mL LB)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li><br />
<br />
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li><br />
<br />
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li><br />
<br />
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from P35s:Atr&Delta;11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR of FAO1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>35 &mu;L HF buffer (5x)</li><br />
<br />
<li>7 &mu;L dNTPs</li><br />
<br />
<li>8.75 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>8.75 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>1.05 &mu;L Phusion polymerase</li><br />
<br />
<li>112.7 H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140805_PCR_FAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO2-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico to check minipreps:</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook"><i>A. tumefaciens</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li><br />
<br />
<li>12.5 &mu;L Orange buffer</li><br />
<br />
<li>105 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li><br />
<br />
<li>2.5 &mu;L Buffer</li><br />
<br />
<li>5 &mu;L Miniprep sample</li><br />
<br />
<li>17 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">FAO1 PCR product.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration protocol consists of:</p><br />
<br />
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li><br />
<br />
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li><br />
<br />
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li><br />
<br />
<li>Mix the cultures, keeping all of them in the same proportions.</li><br />
<br />
<li>Proceed to agroinfiltration.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Possibility of primer combinations: </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>94&deg;C, 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li><br />
<br />
<li>49 or 52&deg;C, 15 s</li><br />
<br />
<li>72&deg;C, 90 s</li><br />
<br />
</ul><li>72&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCRs wih Taq polimerase:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L Template </li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L Reverse primer</li><br />
<br />
<li>1 &mu;L Taq pol.</li><br />
<br />
<li>5 Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>94&deg;C 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li><br />
<br />
<li>49&deg;C 15 s</li><br />
<br />
<li>72&deg;C 90 s</li><br />
<br />
</ul><li>72&deg;C 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PHEROMONE ANALYSIS</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p><br />
<br />
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
<li>1 leaf from a wild type plant</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p><br />
<br />
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>100,0 mg of wild type leaf</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Then 150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p><br />
<br />
<br />
<br />
<p class="p_notebook">EDTA 500mM preparation:</p><br />
<br />
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p><br />
<br />
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4><br />
<br />
<p class="p_notebook">Analysis was performed overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">First results of the analysis were obtained. The analysis proved that our plant was successfuly producing the desired pheromones in high concentration. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<br />
<br />
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/66/20140812_IMAGEN_cromatogramas_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9a/20140812_IMAGEN_cromatogramas_7.png><br />
<br />
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p><br />
<br />
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Results of the replicae analysis are shown below:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140813_IMAGEN_CROMATOGRAMA_3.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Our happiness reached a peak!! A PEAK!</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p><br />
<br />
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward Primer </li><br />
<br />
<li>1 &mu;L Reverse Primer</li><br />
<br />
<li>1 &mu;L Taq Polimerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p><br />
<br />
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p><br />
<br />
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/9/95/20140814_colony_pcr_y_BBSI_test.png"><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Colony PCR 2:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 4:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400"src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/a7/20140820_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li><br />
<br />
<li>Incubate 15 min at 70&deg;C.</li><br />
<br />
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li><br />
<br />
<li>Centrifuge 3 min at 15000 xg.</li><br />
<br />
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li><br />
<br />
<li>Centrifuge 1 min at 15000 xg. </li><br />
<br />
<li>Recover 1 &mu;L of supernatant. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Control PCR:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L template</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 clone Fw+1 </li><br />
<br />
<li>1 &mu;L HSR1 Rtrv + 1149</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO1 PCR</li><br />
<br />
<li>1 &mu;L template</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li><br />
<br />
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR parameters (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li><br />
<br />
<li>HSR1 RTRv+1149</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li><br />
<br />
<li>HSR1 RTRv+1149 </li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul07 </li><br />
<br />
<li>iGEMJul08</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul09 </li><br />
<br />
<li>iGEMJul10</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/ac/20140825_pcps2_ta29_atr.png><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB parts:</li><br />
<br />
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were not correct. We will keep trying.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Note: Go to 09/16/2014</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li><br />
<br />
<li>Introduce the disks inside the tube.</li><br />
<br />
<li>Introduce the two tubes in liquid nitrogen.</li><br />
<br />
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li><br />
<br />
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li><br />
<br />
<li>Grind the disks.</li><br />
<br />
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li><br />
<br />
<li>Grind the mixture.</li><br />
<br />
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li><br />
<br />
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li><br />
<br />
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li><br />
<br />
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li><br />
<br />
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li><br />
<br />
<li>Repeat the last three steps.</li><br />
<br />
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li><br />
<br />
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li><br />
<br />
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li><br />
<br />
<li>Discard the supernatant by decantation (be carefull with the pellet).</li><br />
<br />
<li>Wash with 600 &mu;L ethanol (80%).</li><br />
<br />
<li>Centrifuge 5 min at 13000 rpm. </li><br />
<br />
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li><br />
<br />
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li><br />
<br />
<li>Store at -20&deg;C. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li><br />
<br />
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ordered primers</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJULO1</li><br />
<br />
<li>IGEMJULO2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li><br />
<br />
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for PCR:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L template</li><br />
<br />
<li>10 &mu;L buffer HF 5x</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo R</li><br />
<br />
<li>2.5 &mu;L oligo F</li><br />
<br />
<li>0.5 &mu;L Pfu</li><br />
<br />
<li>32 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 50 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Parameters:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR with different parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with other parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>49, 52, 55, 60 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with more genomic.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 &deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still without having any amplification.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat the PCR with other enzyme.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li><br />
<br />
<li>1.25 &mu;L forward primer 10 uM</li><br />
<br />
<li>1.25 &mu;L reverse primer 10 uM</li><br />
<br />
<li>0.5 &mu;L template 620 ng/&mu;L</li><br />
<br />
<li>9.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>50, 53, 55, 59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (2 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png><br />
<br />
<br />
<br />
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome promoter PCR product ligation in pUPD.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1.2 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>6.8 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Both minipreps were adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pTnos (GB0037)</li><br />
<br />
<li>pGFP (GB0059)</li><br />
<br />
<li>pLuciferase (GB0096)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Results of sequencing the promoter were obtained:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following table shows ligation details of the trichome promoter:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome Promoter transformation in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for HindIII:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li><br />
<br />
<li>10 &mu;L Red buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: The scientific name has been updated to Rhizobium radiobacter. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11/EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<img class="img_notebook" width="250px" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>1 &mu;L PCPS2:HarFAR:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li><br />
<br />
<li>1 &mu;L PCPS2:EaDAcT:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;2</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico made to check minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li><br />
<br />
<li>PCPS2:GFP:TNos (Rif, Kan)</li><br />
<br />
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li><br />
<br />
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos </li><br />
<br />
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico the check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/f1/20140826_Atr_%2B_Har.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TUs with trichome promoter:</li><br />
<br />
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made a ligation as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>3.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol followed was the same as previously done.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2f/PCPS2_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained trichome selective expression of GFP! </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="700px" src= https://static.igem.org/mediawiki/2014/b/b5/2014091_BB_y_Ruta_entera.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:GFP:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well using vortex.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>TNos:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="600px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Result analysis:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three gens are placed in the same construction. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/68/20140912_Pathway_complete.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digetions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions that were still pending from 09/12.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/28/20140916_ge_pieces_AcPathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="450" src= https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li><br />
<br />
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Order primers for TA29 and barnase:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29 PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>60&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul><li>Barnase PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>63&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul></ul><br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src="https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="300" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="402" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200" src= https://static.igem.org/mediawiki/2014/e/ef/20140821_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="250" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= ><br />
<br />
<img class="img_notebook" width="100" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png</p><br />
<br />
<br />
<br />
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase product</li><br />
<br />
<li>1.2 &mu;L Buffer Ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/eb/20140817_Ta29_e040.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/27/20140827_ta29.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/e/e5/2014092_Barnasaa_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Master Mix (12 reactions)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li><br />
<br />
<li>12 &mu;L primer R</li><br />
<br />
<li>12 &mu;L primer F</li><br />
<br />
<li>12 &mu;L Taq Polymerase</li><br />
<br />
<li>24 &mu;L Buffer 10X</li><br />
<br />
<li>48 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/7/75/2014092_Barnasa_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">bands were not correct, so we picked another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of barnase's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again Barnase minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140906_Barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct except one of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase</li><br />
<br />
<li>1.2 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 ul T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the PCR product is correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/49/20140918_bar_colony_PCR.png><br />
<br />
<br />
<br />
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li><br />
<br />
<li>Barnase PCR product in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested Barnase ligation with XbaI.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>MoFlippers constructions</li><br />
<br />
<li>Mutated Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="500" src=https://static.igem.org/mediawiki/2014/b/bb/20140922_Omega_under_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation into E.coli:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1</li><br />
<br />
<li>Barnase (XbaI digested) in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
<li>P35S:Yellow:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>Barnase digested with XbaI </li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again chromoproteins ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L Blue/Yellow</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions were run in two different gels</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/6/69/20140922_Blue_Ruta_KanRes_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestions were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Blue digestions were correct</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li><br />
<br />
<li>P35S:Yellow:T35S iin 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/05/20140924_Barnase.png><br />
<br />
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Barnase in pUPD (Mutated)</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 Ligase</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<br />
<br />
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture: </p><br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestion in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/ff/20140926_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a4/20140927_Blue_Agro.png><br />
<br />
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies (E.coli):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p><br />
<br />
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We send the Biosafety module to Norwich.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/2/27/20141005_Chromoprot_agro.png><br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other approaches that could be used in place of Blue and Yellow chromoproteins. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Ant1:TNos_P35S:JFA13:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's culture did not grow. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Plant leaves changed its usual green colour. As a result of anthocyanin accumulation, agroinfiltred leaves were purple coloured. We took photos of transient transformation of the two modules.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/25/Purple_Plant.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9f/20140822_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a8/20140827_bb_e0240.png><br />
<br />
<br />
<br />
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Double digestions</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li><br />
<br />
<li>2.5 &mu;L NEBuffer</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L enzyme 1</li><br />
<br />
<li>0.5 &mu;L enzyme 2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 20 &mu;L</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p><br />
<br />
<br />
<br />
<p class="p_notebook">BioBricks ligations</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li><br />
<br />
<li>2 &mu;L part 2 (25 ng)</li><br />
<br />
<li>1 &mu;L T4 buffer 10X</li><br />
<br />
<li>0.5 &mu;L T4</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/thumb/2/26/20140830_bb.png/800px-20140830_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a6/20140901_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/b/b7/20140902_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/0/07/20140904_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1)</td><td class="td_notebook">1.085</td><td class="td_notebook">0.38</td><td class="td_notebook">2.854</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.036</td><td class="td_notebook">0.35</td><td class="td_notebook">2.959</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.076</td><td class="td_notebook">0.39</td><td class="td_notebook">2.759</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1)</td><td class="td_notebook">4.907</td><td class="td_notebook">0.36</td><td class="td_notebook">13.632</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">4.754</td><td class="td_notebook">0.34</td><td class="td_notebook">13.981</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">3.494</td><td class="td_notebook">0.26</td><td class="td_notebook">13.439</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">57.393</td><td class="td_notebook">0.43</td><td class="td_notebook">133.471</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">61.622</td><td class="td_notebook">0.47</td><td class="td_notebook">131.110</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">63.999</td><td class="td_notebook">0.47</td><td class="td_notebook">136.167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1)</td><td class="td_notebook">1.389</td><td class="td_notebook">0.37</td><td class="td_notebook">3.754</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2)</td><td class="td_notebook">1.353</td><td class="td_notebook">0.37</td><td class="td_notebook">3.656</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3)</td><td class="td_notebook">1.370</td><td class="td_notebook">0.33</td><td class="td_notebook">4.151</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr><br />
<br />
</table><br />
<br />
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run PCR with the following templates and primers:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">P35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>67&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">T35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>65&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li><br />
<br />
<li>PCR2: P35S:Atr&Delta;11:T35S template</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/e0/20140819_p35s.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20140819_t35s2C_p35s.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L T35S_BB</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H20 miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li><br />
<br />
<li>HarFAR (2&alpha;2)</li><br />
<br />
<li>Atr&Delta;11 (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the template is not there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">The gel showed that the PCR products were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/aa/20140906_PCR_P35S.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/b/b0/20140907_Barnase_PCR_35S.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any PCR product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng E0040</li><br />
<br />
<li>2.5 &mu;L NEB2</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L XbaI</li><br />
<br />
<li>0.5 &mu;L PstI</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li><br />
<br />
<li>MoFlipper + Atr&Delta;11</li><br />
<br />
<li>MoFlipper + HarFAR</li><br />
<br />
<li>MoFlipper + EaDAcT</li><br />
<br />
<li>MoFlipper + TA29</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="380px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">MoFlipper cultures did not grow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Omega undercover</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover with TA29</li><br />
<br />
<li>MoFlipper with Atr&Delta;11</li><br />
<br />
<li>MoFlipper with HarFAR</li><br />
<br />
<li>MoFlipper with EaDAcT</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="200px"src= https://static.igem.org/mediawiki/2014/7/7d/20140923_Ta29_Moflippers.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p><br />
<br />
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li><br />
<br />
<li>CUP2-PCR2: 348 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both PCR products were correct.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of both parts of CUP2.</p><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Gal4AD</li><br />
<br />
<li>CUP2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Gal4AD piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Quantification </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li><br />
<br />
<li>Gal4: 221.4 ng/&mu;L</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following ligations were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O </li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/1/18/20140815_CUP2_digestion.png><br />
<br />
<br />
<br />
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Gal4AD</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li><br />
<br />
<li>1 &mu;L SF in 1&alpha;1</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol was the same as previously folowed. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<p class="p_notebook">We have to repeat digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the following digestions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We consider to use the miniprep number 2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="280px" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested minipreps made the previous days:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/24/20140909_Digestiones_fallidas_CUP2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction in glycerol, we picked some colonies (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/66/20140910_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained from GB collection the following piece:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png ><br />
<br />
<br />
<br />
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0256</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligate it in pUPD vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L GBlock</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>GBlock in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/0/06/20140925_CUP_promoter_gblock_fail.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions have to be repeated.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/f/fb/20140925_CUP_promoter_GBlock.png><br />
<br />
<p class="p_notebook">Minipreps were correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L colony</li><br />
<br />
<li>1 &mu;L primer F</li><br />
<br />
<li>1 ul primer R</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Taq Polymerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We run a gel with PCR products:</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="355px" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li><br />
<br />
<li>Incorrect possible band: 270 bp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 157</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/9/9e/09012014_Mini35s_GBlock.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li><br />
<br />
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li><br />
<br />
<li>0.75 ul Luciferase (75 ng/&mu;L</li><br />
<br />
<li>0.75 T35S (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L Bsa1</li><br />
<br />
<li>1 &mu;L T4 Ligase </li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Tomorrow we will transform the result.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li><br />
<br />
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li><br />
<br />
<li>1 µl pDGB2?2</li><br />
<br />
<li>1 µl BsaI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl T10x</li><br />
<br />
<li>4.8 µl water</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked two colonies of each construct: </p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/04/2014</h4><br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2d/20141004_CBSmini35_UTR_Luc.png><br />
<br />
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p><br />
<br />
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p><br />
<br />
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<p class="p_notebook">We made the following binary assembly.</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li><br />
<br />
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li><br />
<br />
<li>1 µl 2&Omega;2</li><br />
<br />
<li>1 µl BsmBI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl Buffer T10x</li><br />
<br />
<li>5.8 µl H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<p class="p_notebook">We picked two colonies of:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Restriction analysis:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20141008_cbsmini35_2omega2.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">11/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday' culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/31/20141011_Yellow_chromoprot_CUP_agro.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">13/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/c8/20141013_luciferase_mini35.png><br />
<br />
<p class="p_notebook">They were correct.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content-trans" id="goto-left" align="center"></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/interlab"><strong>Go to Interlab Study&rarr;</strong></a></div></br></br></br><br />
<br />
<div class="right-col"><br />
<div class="pinned note-container"><br />
<div class="note"><br />
<h3>Great Days!</h3><br />
<p>Here is our biggest days in the Laboratory</p><br />
<p><a href="#">Day 1</a>.</p><br />
<p><a href="#">Day 2</a>.</p><br />
<p><a href="#">Day 3</a>.</p><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</section> <br />
</div><br />
<br />
<div id="space-margin"></div><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.9.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:Valencia_UPV/Templates/sticky-notebook_jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<script><br />
$(".pinned").pin({containerSelector: ".container", minWidth: 940});<br />
</script><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Alrual