User contributions
From 2014.igem.org
- 03:55, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio (top)
- 03:52, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio
- 03:51, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio
- 03:50, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio
- 03:44, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/ELSEI (top)
- 03:43, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project (top)
- 03:41, 18 October 2014 (diff | hist) File:Stages of vc v2.png (uploaded a new version of "File:Stages of vc v2.png") (top)
- 03:37, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/ELSEI
- 03:33, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/ELSEI
- 03:33, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions (top)
- 03:30, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 03:26, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/ELSEI
- 03:20, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 03:18, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 03:09, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook (top)
- 03:06, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 03:02, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 03:01, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/ELSEI
- 02:56, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:56, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/ELSEI
- 02:47, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/ELSEI
- 02:46, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:45, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:42, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/ELSEI
- 02:39, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:39, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:31, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:31, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:27, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio
- 02:21, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/ELSEI
- 02:17, 18 October 2014 (diff | hist) File:20140701081646-vegan cheese team photo enhanced.jpg (uploaded a new version of "File:20140701081646-vegan cheese team photo enhanced.jpg") (top)
- 02:10, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team (top)
- 02:07, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:05, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:03, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 02:01, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 01:47, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Future Plans (top)
- 01:45, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Future Plans
- 01:44, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Future Plans
- 01:43, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Future Plans
- 00:04, 18 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety (fixed typos)
- 23:50, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 23:42, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 23:39, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 23:34, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 23:32, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 23:22, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 23:20, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 23:18, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Attributions
- 20:32, 17 October 2014 (diff | hist) SubmittingFam20COct (top)
- 20:31, 17 October 2014 (diff | hist) N File:Sample details from Sequetech sequence pick-up, 14Oct2014.png (top)
- 20:30, 17 October 2014 (diff | hist) SubmittingPlasmidSequencingOct (top)
- 20:30, 17 October 2014 (diff | hist) N File:600px-Sequencing data summary 10-11-14.png (top)
- 20:29, 17 October 2014 (diff | hist) N File:Sample details from Sequetech sequence pick-up, 10Oct2014.png (top)
- 20:27, 17 October 2014 (diff | hist) RepeadMidiprepsOct (top)
- 20:26, 17 October 2014 (diff | hist) N File:RVC Spec oct.5 - Sheet1.jpg (top)
- 20:22, 17 October 2014 (diff | hist) Submitting10CaesinSept (top)
- 20:21, 17 October 2014 (diff | hist) N File:600px-Screen Shot 2014-10-01 at 4.42.46 PM.png (top)
- 20:20, 17 October 2014 (diff | hist) N File:600px-Samples details from Sequetech sequence pick-up, 30Sep2014.png (top)
- 19:10, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 19:06, 17 October 2014 (diff | hist) CloningBovineBetaCaesinSept (top)
- 19:05, 17 October 2014 (diff | hist) N File:Spec results 29Sep2014 midipreps.png (top)
- 19:01, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/AugustCloning (top)
- 19:00, 17 October 2014 (diff | hist) N File:HumanKap(Kex+) Rev.png (top)
- 18:59, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/AugustCloning
- 18:58, 17 October 2014 (diff | hist) File:PD1214 Map.png (uploaded a new version of "File:PD1214 Map.png") (top)
- 18:56, 17 October 2014 (diff | hist) N File:Human Kappa Casein Map.png (top)
- 18:46, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 18:45, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 18:44, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 18:43, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 18:40, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 18:38, 17 October 2014 (diff | hist) File:Clontech UTF-8'en-us'Quick Easy Yeast Transformation Mix Protocol-At-A-Glance 040214.pdf (uploaded a new version of "File:Clontech UTF-8'en-us'Quick Easy Yeast Transformation Mix Protocol-At-A-Glance 040214.pdf") (top)
- 18:38, 17 October 2014 (diff | hist) File:Zymo E. coli competent cells transformation protocol.pdf (uploaded a new version of "File:Zymo E. coli competent cells transformation protocol.pdf") (top)
- 18:35, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 18:13, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 18:11, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 18:01, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 17:37, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 17:34, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/MediaSequencingAnalysis (top)
- 17:32, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/MediaSequencingAnalysis
- 17:31, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/MediaSequencingAnalysis
- 17:30, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/MediaSequencingAnalysis
- 17:28, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/MediaSequencingAnalysis
- 17:26, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/MediaSequencingAnalysis
- 17:23, 17 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/MediaSequencingAnalysis (Created page with "= Sequencing Analysis = 1. Using Serial Cloner Freeware (2-6-1) open the forward sequencing reaction from the TEF primer. 400px a. Search for ATG...")
- 17:22, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 17:20, 17 October 2014 (diff | hist) N File:400px-Search for ATG.png (top)
- 17:20, 17 October 2014 (diff | hist) N File:400px-Open forward.png (top)
- 17:20, 17 October 2014 (diff | hist) N File:400px-Function Align two seqs.png (top)
- 17:13, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 17:11, 17 October 2014 (diff | hist) N SubmittingFam20COct (Created page with "'''October 14, 2014: DNA pick-up by [http://sequetech.com/ Sequetech] to sequence 2 samples, detailed below''' *'''Location:''' BioCurious *'''Participants:''' Rachel (set up sa...")
- 17:09, 17 October 2014 (diff | hist) N SubmittingPlasmidSequencingOct (Created page with "'''October 10, 2014: DNA pick-up by [http://sequetech.com/ Sequetech] to sequence 8 samples, detailed below''' *'''Location:''' BioCurious *'''Participants:''' Rachel (set up sa...")
- 17:08, 17 October 2014 (diff | hist) N CloningHumanAlphaS1Oct (Created page with "=Cloning human alpha casein S1, plasmid DNA midiprep= ==Overview== During these experiments, we will insert our final IDT gBlock, human alpha casein (received 03Oct2014,) into th...") (top)
- 17:03, 17 October 2014 (diff | hist) N RepeadMidiprepsOct (Created page with "=Midipreps & DNA quant. to select new clones for sequencing of failed 02Oct2014 reactions and culture storage= ==Overview== These experiments are continued from [[Submitting 10...")
- 17:01, 17 October 2014 (diff | hist) N Submitting10CaesinSept (Created page with "'''September 30, 2014: DNA pick-up by [http://sequetech.com/ Sequetech] to sequence 16 samples, detailed below''' *'''Location:''' BioCurious *'''Participants:''' Rachel (set up...")
- 16:57, 17 October 2014 (diff | hist) N CloningBovineBetaCaesinSept (Created page with "<html> <p><b>Cloning bovine beta casein Band Fam20C Kex +/- gBlocks into pD1214, transforming into ''E. coli'' and extracting plasmid DNA<br><br> Overview</b><br><br> During t...")
- 16:31, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 16:30, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 16:28, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 16:27, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 16:27, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 06:32, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 06:15, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 06:13, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 06:06, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 06:02, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 05:47, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 05:46, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 05:44, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 05:12, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 05:12, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 05:10, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 05:04, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 05:02, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 04:51, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 04:49, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 04:45, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 04:44, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 04:43, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 03:17, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:16, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 02:00, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 01:56, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 01:53, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 01:49, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 00:11, 17 October 2014 (diff | hist) N Troubleshooting12.9 (Created page with "<html> <p><b>Troubleshooting failed transformation of P.FAKS.humBeta.S:pD1214 into dH5alpha E. coli<br><br> Overview</b> <br><br> Of the September 12, 2014 transformations (gBl...") (top)
- 23:51, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 23:44, 16 October 2014 (diff | hist) Cloning7caesin (top)
- 23:43, 16 October 2014 (diff | hist) N Cloning7caesin (Created page with "<html> <br><p><b>Cloning 7 casein gBlocks</p><br> Cloning 7 casein gBlocks into pD1214, transforming into E. coli and extracting plasmid DNA</b> <br><br> Overview <br><br> Dur...")
- 23:05, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 22:54, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 22:53, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 22:46, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 22:45, 16 October 2014 (diff | hist) N File:20140701081646-vegan cheese team photo enhanced.jpg
- 21:12, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/AugustGrowthCurve (Created page with "<html> <p><b>GROWTH CURVE EXPERIMENT</b></p> <br> Chemical transformation of yeast requires the organism to be in logarithmic growth phase, so, before we clone our casein genes i...") (top)
- 21:00, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 20:40, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/AugustCloning (Created page with "<html> <p><b>Cloning human kappa casein into pD1214 vector, transforming to E. coli, plasmid preps and sequencing</b><br><br> <b>Experiment 082514_humKappaCasein(Kex+) Cloning</...")
- 20:05, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 19:59, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/NoteBookJune1 (Created page with "<html> <p><b>Experiment CR062214_hKappa Casein Cloning</b></p> The sequence has been delivered!<br> <ul> <li>5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAAC...") (top)
- 18:45, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 18:42, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/NotebookDocumentation (Created page with "<html> <br> <p><b>Real Vegan Cheese Notebook Documentation Guidelines</b><br> As important as it is to do experiments, it's just as important to document them. Not documenting o...") (top)
- 18:19, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Future Plans
- 18:19, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/Future Plans (Created page with "<html> <p><b>Future Plans<b><br> The Real Vegan Cheese team has successfully crowd source fundraised $37K and is committed to continuing the project. For the iGEM competition we...")
- 18:11, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/DNAhandling (Created page with "<html> <p><b>DNA Handling</b><br> Jump to: navigation, search<br> Our cloning strategy requires 20ng of Casein-DNA in 1uL. This means we need a final concentration of DNA for c...") (top)
- 18:08, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 17:31, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 03:38, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 04:47, 15 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 02:29, 15 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 18:33, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 04:23, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 04:06, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 04:03, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 03:54, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 03:52, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 03:41, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:27, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:26, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:10, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:07, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 02:26, 14 October 2014 (diff | hist) N File:Stages of vc v2.png (Horizontal RVC logo)
- 02:18, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team