http://2014.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=500&target=Ivllobel&year=&month=
2014.igem.org - User contributions [en]
2024-03-29T12:06:43Z
From 2014.igem.org
MediaWiki 1.16.5
http://2014.igem.org/Team:Valencia_UPV/Project/notebook
Team:Valencia UPV/Project/notebook
2014-10-18T03:53:53Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<html><br />
<style><br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.table_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border: none;<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.td_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border:none;<br />
padding-right: 25px;<br />
}<br />
<br />
.section_notebook{<br />
color: red;<br />
text-align: left;<br />
font-size: 16pt;<br />
}<br />
<br />
.date_notebook {<br />
color: green;<br />
text-align: left;<br />
font-size: 12pt;<br />
}<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.strong_notebook {<br />
color: red;<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
<br />
.img_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.box_above_notebook{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
<br />
.ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
}<br />
<br />
.ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 1.5em;<br />
}<br />
<br />
.ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 3.0em;<br />
}<br />
<br />
.ul_ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 4.5em;<br />
}<br />
<br />
#cn-box-left<br />
{<br />
float: left;<br />
width: 70%;<br />
//padding-right: 20px;<br />
margin-left: 140px;<br />
//background-color: yellow;<br />
}<br />
<br />
#cn-box-right<br />
{<br />
float: right;<br />
width: 18%;<br />
background-color: blue;<br />
}<br />
<br />
.right-col {<br />
float: right;<br />
width: 25%;<br />
padding-left: 20px;<br />
}<br />
<br />
.note-container {<br />
margin-top: 10px;<br />
}<br />
<br />
.note {<br />
padding: 18px 5px;<br />
background: #eee;<br />
text-decoration:none;<br />
background:#ffc;<br />
display:block;<br />
padding: 20px;<br />
width: 200px; <br />
box-shadow: 5px 5px 7px rgba(33,33,33,.7);<br />
-webkit-transform: rotate(-6deg);<br />
-moz-transform: rotate(-6deg);<br />
-ms-transform: rotate(-6deg);<br />
transform: rotate(-6deg);<br />
font-size: 16px;<br />
}<br />
.note h3 {<br />
font-size: 28px;<br />
margin: 0;<br />
}<br />
<br />
/*Thanks to Webpop (http://www.webpop.com) for the code for the pinned note*/<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-18439732-5']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Notebook</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>N</roja>otebook</span> </div><br/><br/><br />
<br />
<br />
<section class="container clearfix"> <br />
<br />
<div class="box_above_notebook"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul><br />
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p><br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"><br />
<br />
<br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p><br />
<br />
<ul class="ul_notebook"><li>Codon optimization</li><br />
<br />
<li>Inner restriction sites eliminations by finding synonymous mutations</li><br />
<br />
<li>Addition of GB endings</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p><br />
<br />
<br />
<br />
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ordered the following gBlocks and primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li><br />
<br />
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li><br />
<br />
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li><br />
<br />
<li>I14Jun04 Atr&Delta;11 R1</li><br />
<br />
</ul><li>FAO1: <i>N. benthamiana</i> primers</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li><br />
<br />
<li>I14Jun02 FAO1 R1</li><br />
<br />
</ul></ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We thought which parts of the GB collection could we use.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy 1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 2:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTAtHSP18.2</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 3:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTTctp</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Pieces to take from GB2.0 colection:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Later we will need:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Prepare plaques with antibiotics Kan, Spm, Amp</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Culture in agar Petri dish. 2 plaques: Amp and Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps with EZNA Plasmid DNA MiniKit I.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Expected digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis analysis.</p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"><br />
<br />
<br />
<br />
<p class="p_notebook">We got the expected bands in all cases.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p><br />
<br />
<p class="p_notebook">We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li><br />
<br />
<li>10 &mu;L HF buffer </li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L Reverse primer</li><br />
<br />
<li>2.5 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L template (Atr&Delta;11 gene)</li><br />
<br />
<li>0.5 &mu;L phusion (polimerase)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png><br />
<br />
<br />
<br />
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product/gblock product </li><br />
<br />
<li>1.2 &mu;L buffer 10x</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Vfinal= 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li><br />
<br />
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After incubation, culture in Petri plates (always in a LAF).</p><br />
<br />
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p><br />
<br />
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li><br />
<br />
<li>2.5 &mu;L buffer</li><br />
<br />
<li>21 &mu;L H20 (miliQ)</li><br />
<br />
<li>1 &mu;L sample</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li><br />
<br />
<li>25 &mu;L Orange</li><br />
<br />
<li>210 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li><br />
<br />
<li>7.5 &mu;L Green</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BanII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Comments:</p><br />
<br />
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li><br />
<br />
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-Gal</li><br />
<br />
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li><br />
<br />
<li>17.5 &mu;L Orange</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li><br />
<br />
<li>10 &mu;L Tango</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li><br />
<br />
<li>10 &mu;L Green</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L terminator 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L CDS 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L vector &alpha;</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Total: 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy Promoter-Terminator:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Adjust concentrations to 75 ng/&mu;L for ligation reaction</p><br />
<br />
<br />
<br />
<p class="p_notebook">Initial concentrations (nanodrop):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reaction</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p><br />
<br />
<br />
<br />
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li><br />
<br />
<li>HarFAR -> Sequencing correct</li><br />
<br />
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Worked in the LAF</li><br />
<br />
<li>Cultivated in a Petri dish with Spm</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li><br />
<br />
<li>Rest of the culture in another (250 &mu;L aprox)</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-gal</li><br />
<br />
<li>3.5 &mu;L IPTG</li><br />
<br />
</ul><li>1 colony from 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p><br />
<br />
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for HindIII</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li><br />
<br />
<li>17.5 &mu;L Red</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li><br />
<br />
<li>2.5 &mu;L Red</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul><li>Mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li><br />
<br />
<li>2.5 &mu;L Green</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Amp</li><br />
<br />
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li><br />
<br />
<li>pEaDAcT (3)</li><br />
<br />
<li>pHarFAR (3)</li><br />
<br />
</ul><li>Kan</li><br />
<br />
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li><br />
<br />
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except P35s:EaDAcT:T35s (2).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation in &Omega; vectors.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Selected tubes: </p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check the transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li><br />
<br />
<li>10 &mu;L Green buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li><br />
<br />
<li>20 &mu;L Red buffer</li><br />
<br />
<li>168 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Candida genome extraction</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cultures measured at 600 nm:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.39</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The absorbance was measured again:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.40</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li><br />
<br />
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li><br />
<br />
<li>Wash once with 1 mL sterile water.</li><br />
<br />
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li><br />
<br />
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li><br />
<br />
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li><br />
<br />
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li><br />
<br />
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li><br />
<br />
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li><br />
<br />
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li><br />
<br />
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li><br />
<br />
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li><br />
<br />
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li><br />
<br />
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Genomic quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis made to check the extraction quality was correct. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked EaDAcT colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We got the Candida genome band, however, the Saccharomyces genome band was not present.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep digestions are going to be done tomorrow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BglII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li><br />
<br />
<li>7.5 &mu;L Red buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL06) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL05) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul><li>FAO1-PCR2</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL08) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL07) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperatures</p><br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li><br />
<br />
<li>FAO1-PCR2: 64 &deg;C</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li><br />
<br />
<li>FAO1-PCR2: 1015 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both FAO1 PCR products were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 25 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p><br />
<br />
<br />
<br />
<p class="p_notebook">EaDAcT Transcriptional Unit (TU) transformation</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of P35s:EaDAcT:T35s in 2&Omega;2 P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> liquid cultures (5 mL LB)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li><br />
<br />
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li><br />
<br />
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li><br />
<br />
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from P35s:Atr&Delta;11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR of FAO1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>35 &mu;L HF buffer (5x)</li><br />
<br />
<li>7 &mu;L dNTPs</li><br />
<br />
<li>8.75 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>8.75 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>1.05 &mu;L Phusion polymerase</li><br />
<br />
<li>112.7 H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140805_PCR_FAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO2-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico to check minipreps:</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook"><i>A. tumefaciens</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li><br />
<br />
<li>12.5 &mu;L Orange buffer</li><br />
<br />
<li>105 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li><br />
<br />
<li>2.5 &mu;L Buffer</li><br />
<br />
<li>5 &mu;L Miniprep sample</li><br />
<br />
<li>17 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">FAO1 PCR product.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration protocol consists of:</p><br />
<br />
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li><br />
<br />
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li><br />
<br />
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li><br />
<br />
<li>Mix the cultures, keeping all of them in the same proportions.</li><br />
<br />
<li>Proceed to agroinfiltration.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Possibility of primer combinations: </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>94&deg;C, 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li><br />
<br />
<li>49 or 52&deg;C, 15 s</li><br />
<br />
<li>72&deg;C, 90 s</li><br />
<br />
</ul><li>72&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCRs wih Taq polimerase:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L Template </li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L Reverse primer</li><br />
<br />
<li>1 &mu;L Taq pol.</li><br />
<br />
<li>5 Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>94&deg;C 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li><br />
<br />
<li>49&deg;C 15 s</li><br />
<br />
<li>72&deg;C 90 s</li><br />
<br />
</ul><li>72&deg;C 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PHEROMONE ANALYSIS</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p><br />
<br />
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
<li>1 leaf from a wild type plant</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p><br />
<br />
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>100,0 mg of wild type leaf</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Then 150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p><br />
<br />
<br />
<br />
<p class="p_notebook">EDTA 500mM preparation:</p><br />
<br />
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p><br />
<br />
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4><br />
<br />
<p class="p_notebook">Analysis was performed overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><a name="day3">First results</a> of the analysis were obtained. <b>The analysis proved that our plant was successfuly producing the desired pheromones in high concentration</b>. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<br />
<br />
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/66/20140812_IMAGEN_cromatogramas_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9a/20140812_IMAGEN_cromatogramas_7.png><br />
<br />
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p><br />
<br />
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Results of the replicae analysis are shown below:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140813_IMAGEN_CROMATOGRAMA_3.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Our happiness reached a peak!! A PEAK!</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p><br />
<br />
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward Primer </li><br />
<br />
<li>1 &mu;L Reverse Primer</li><br />
<br />
<li>1 &mu;L Taq Polimerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p><br />
<br />
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p><br />
<br />
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/9/95/20140814_colony_pcr_y_BBSI_test.png"><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Colony PCR 2:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 4:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400"src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/a7/20140820_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li><br />
<br />
<li>Incubate 15 min at 70&deg;C.</li><br />
<br />
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li><br />
<br />
<li>Centrifuge 3 min at 15000 xg.</li><br />
<br />
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li><br />
<br />
<li>Centrifuge 1 min at 15000 xg. </li><br />
<br />
<li>Recover 1 &mu;L of supernatant. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Control PCR:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L template</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 clone Fw+1 </li><br />
<br />
<li>1 &mu;L HSR1 Rtrv + 1149</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO1 PCR</li><br />
<br />
<li>1 &mu;L template</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li><br />
<br />
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR parameters (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li><br />
<br />
<li>HSR1 RTRv+1149</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li><br />
<br />
<li>HSR1 RTRv+1149 </li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul07 </li><br />
<br />
<li>iGEMJul08</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul09 </li><br />
<br />
<li>iGEMJul10</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/ac/20140825_pcps2_ta29_atr.png><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB parts:</li><br />
<br />
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were not correct. We will keep trying.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Note: Go to 09/16/2014</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li><br />
<br />
<li>Introduce the disks inside the tube.</li><br />
<br />
<li>Introduce the two tubes in liquid nitrogen.</li><br />
<br />
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li><br />
<br />
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li><br />
<br />
<li>Grind the disks.</li><br />
<br />
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li><br />
<br />
<li>Grind the mixture.</li><br />
<br />
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li><br />
<br />
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li><br />
<br />
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li><br />
<br />
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li><br />
<br />
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li><br />
<br />
<li>Repeat the last three steps.</li><br />
<br />
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li><br />
<br />
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li><br />
<br />
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li><br />
<br />
<li>Discard the supernatant by decantation (be carefull with the pellet).</li><br />
<br />
<li>Wash with 600 &mu;L ethanol (80%).</li><br />
<br />
<li>Centrifuge 5 min at 13000 rpm. </li><br />
<br />
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li><br />
<br />
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li><br />
<br />
<li>Store at -20&deg;C. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li><br />
<br />
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ordered primers</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJULO1</li><br />
<br />
<li>IGEMJULO2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li><br />
<br />
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for PCR:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L template</li><br />
<br />
<li>10 &mu;L buffer HF 5x</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo R</li><br />
<br />
<li>2.5 &mu;L oligo F</li><br />
<br />
<li>0.5 &mu;L Pfu</li><br />
<br />
<li>32 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 50 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Parameters:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR with different parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with other parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>49, 52, 55, 60 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with more genomic.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 &deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still without having any amplification.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat the PCR with other enzyme.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li><br />
<br />
<li>1.25 &mu;L forward primer 10 uM</li><br />
<br />
<li>1.25 &mu;L reverse primer 10 uM</li><br />
<br />
<li>0.5 &mu;L template 620 ng/&mu;L</li><br />
<br />
<li>9.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>50, 53, 55, 59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (2 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png><br />
<br />
<br />
<br />
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome promoter PCR product ligation in pUPD.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1.2 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>6.8 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Both minipreps were adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pTnos (GB0037)</li><br />
<br />
<li>pGFP (GB0059)</li><br />
<br />
<li>pLuciferase (GB0096)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Results of sequencing the promoter were obtained:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following table shows ligation details of the trichome promoter:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome Promoter transformation in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for HindIII:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li><br />
<br />
<li>10 &mu;L Red buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: The scientific name has been updated to Rhizobium radiobacter. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11/EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<img class="img_notebook" width="250px" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>1 &mu;L PCPS2:HarFAR:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li><br />
<br />
<li>1 &mu;L PCPS2:EaDAcT:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;2</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico made to check minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li><br />
<br />
<li>PCPS2:GFP:TNos (Rif, Kan)</li><br />
<br />
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li><br />
<br />
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos </li><br />
<br />
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico the check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/f1/20140826_Atr_%2B_Har.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TUs with trichome promoter:</li><br />
<br />
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made a ligation as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>3.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol followed was the same as previously done.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2f/PCPS2_2.png><br />
<br />
<br />
<br />
<p class="p_notebook"><a name="day2" class="red-bold">We obtained trichome selective expression of GFP!</a> </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="700px" src= https://static.igem.org/mediawiki/2014/b/b5/2014091_BB_y_Ruta_entera.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:GFP:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well using vortex.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>TNos:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="600px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Result analysis:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three gens are placed in the same construction. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/68/20140912_Pathway_complete.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digetions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions that were still pending from 09/12.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/28/20140916_ge_pieces_AcPathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="450" src= https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li><br />
<br />
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Order primers for TA29 and barnase:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29 PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>60&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul><li>Barnase PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>63&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul></ul><br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src="https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="300" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="402" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200" src= https://static.igem.org/mediawiki/2014/e/ef/20140821_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="250" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= ><br />
<br />
<img class="img_notebook" width="100" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png</p><br />
<br />
<br />
<br />
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase product</li><br />
<br />
<li>1.2 &mu;L Buffer Ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/eb/20140817_Ta29_e040.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/27/20140827_ta29.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/e/e5/2014092_Barnasaa_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Master Mix (12 reactions)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li><br />
<br />
<li>12 &mu;L primer R</li><br />
<br />
<li>12 &mu;L primer F</li><br />
<br />
<li>12 &mu;L Taq Polymerase</li><br />
<br />
<li>24 &mu;L Buffer 10X</li><br />
<br />
<li>48 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/7/75/2014092_Barnasa_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">bands were not correct, so we picked another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of barnase's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again Barnase minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140906_Barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct except one of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase</li><br />
<br />
<li>1.2 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 ul T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the PCR product is correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/49/20140918_bar_colony_PCR.png><br />
<br />
<br />
<br />
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li><br />
<br />
<li>Barnase PCR product in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested Barnase ligation with XbaI.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>MoFlippers constructions</li><br />
<br />
<li>Mutated Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="500" src=https://static.igem.org/mediawiki/2014/b/bb/20140922_Omega_under_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation into E.coli:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1</li><br />
<br />
<li>Barnase (XbaI digested) in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
<li>P35S:Yellow:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>Barnase digested with XbaI </li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again chromoproteins ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L Blue/Yellow</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions were run in two different gels</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/6/69/20140922_Blue_Ruta_KanRes_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestions were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Blue digestions were correct</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li><br />
<br />
<li>P35S:Yellow:T35S iin 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/05/20140924_Barnase.png><br />
<br />
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Barnase in pUPD (Mutated)</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 Ligase</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<br />
<br />
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture: </p><br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestion in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/ff/20140926_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a4/20140927_Blue_Agro.png><br />
<br />
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies (E.coli):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (pSB1A3)</li><br />
<br />
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (pSB1A3)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p><br />
<br />
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We send the Biosafety module to Norwich.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/2/27/20141005_Chromoprot_agro.png><br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other approaches that could be used in place of Blue and Yellow chromoproteins. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Ant1:TNos_P35S:JFA13:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's culture did not grow. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook"><a name="day1">10/16/2014</a></h4><br />
<br />
<br />
<br />
<p class="p_notebook">Plant leaves changed its usual green colour. As a result of anthocyanin accumulation, agroinfiltred leaves were purple coloured. We took photos of transient transformation of the two modules.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/25/Purple_Plant.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9f/20140822_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a8/20140827_bb_e0240.png><br />
<br />
<br />
<br />
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Double digestions</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li><br />
<br />
<li>2.5 &mu;L NEBuffer</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L enzyme 1</li><br />
<br />
<li>0.5 &mu;L enzyme 2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 20 &mu;L</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p><br />
<br />
<br />
<br />
<p class="p_notebook">BioBricks ligations</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li><br />
<br />
<li>2 &mu;L part 2 (25 ng)</li><br />
<br />
<li>1 &mu;L T4 buffer 10X</li><br />
<br />
<li>0.5 &mu;L T4</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/thumb/2/26/20140830_bb.png/800px-20140830_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a6/20140901_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/b/b7/20140902_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/0/07/20140904_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p><br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1) </td><td class="td_notebook">1.157 </td><td class="td_notebook">0.38 </td><td class="td_notebook">3.046</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.105 </td><td class="td_notebook">0.35 </td><td class="td_notebook">3.158</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.148 </td><td class="td_notebook">0.39 </td><td class="td_notebook">2.944</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1) </td><td class="td_notebook">5.237 </td><td class="td_notebook">0.36 </td><td class="td_notebook">14.547</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">5.073 </td><td class="td_notebook">0.34 </td><td class="td_notebook">14.92</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">3.729 </td><td class="td_notebook">0.26 </td><td class="td_notebook">14.342</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">61.246 </td><td class="td_notebook">0.43 </td><td class="td_notebook">142.432</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">65.759 </td><td class="td_notebook">0.47 </td><td class="td_notebook">139.913</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">68.295 </td><td class="td_notebook">0.47 </td><td class="td_notebook">145.309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">1.482 </td><td class="td_notebook">0.37 </td><td class="td_notebook">4.006</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.443 </td><td class="td_notebook">0.37 </td><td class="td_notebook">3.901</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.462 </td><td class="td_notebook">0.33 </td><td class="td_notebook">4.430</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr><br />
<br />
</table><br />
<br />
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run PCR with the following templates and primers:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">P35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>67&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">T35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>65&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li><br />
<br />
<li>PCR2: P35S:Atr&Delta;11:T35S template</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/e0/20140819_p35s.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20140819_t35s2C_p35s.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L T35S_BB</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H20 miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li><br />
<br />
<li>HarFAR (2&alpha;2)</li><br />
<br />
<li>Atr&Delta;11 (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the template is not there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">The gel showed that the PCR products were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/aa/20140906_PCR_P35S.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/b/b0/20140907_Barnase_PCR_35S.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any PCR product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng E0040</li><br />
<br />
<li>2.5 &mu;L NEB2</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L XbaI</li><br />
<br />
<li>0.5 &mu;L PstI</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li><br />
<br />
<li>MoFlipper + Atr&Delta;11</li><br />
<br />
<li>MoFlipper + HarFAR</li><br />
<br />
<li>MoFlipper + EaDAcT</li><br />
<br />
<li>MoFlipper + TA29</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="380px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">MoFlipper cultures did not grow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Omega undercover</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover with TA29</li><br />
<br />
<li>MoFlipper with Atr&Delta;11</li><br />
<br />
<li>MoFlipper with HarFAR</li><br />
<br />
<li>MoFlipper with EaDAcT</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="200px"src= https://static.igem.org/mediawiki/2014/7/7d/20140923_Ta29_Moflippers.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p><br />
<br />
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li><br />
<br />
<li>CUP2-PCR2: 348 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both PCR products were correct.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of both parts of CUP2.</p><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Gal4AD</li><br />
<br />
<li>CUP2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Gal4AD piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Quantification </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li><br />
<br />
<li>Gal4: 221.4 ng/&mu;L</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following ligations were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O </li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/1/18/20140815_CUP2_digestion.png><br />
<br />
<br />
<br />
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Gal4AD</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li><br />
<br />
<li>1 &mu;L SF in 1&alpha;1</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol was the same as previously folowed. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<p class="p_notebook">We have to repeat digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the following digestions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We consider to use the miniprep number 2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="280px" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested minipreps made the previous days:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/24/20140909_Digestiones_fallidas_CUP2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction in glycerol, we picked some colonies (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/66/20140910_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained from GB collection the following piece:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png ><br />
<br />
<br />
<br />
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0256</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligate it in pUPD vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L GBlock</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>GBlock in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/0/06/20140925_CUP_promoter_gblock_fail.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions have to be repeated.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/f/fb/20140925_CUP_promoter_GBlock.png><br />
<br />
<p class="p_notebook">Minipreps were correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L colony</li><br />
<br />
<li>1 &mu;L primer F</li><br />
<br />
<li>1 ul primer R</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Taq Polymerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We run a gel with PCR products:</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="355px" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li><br />
<br />
<li>Incorrect possible band: 270 bp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 157</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/9/9e/09012014_Mini35s_GBlock.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li><br />
<br />
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li><br />
<br />
<li>0.75 ul Luciferase (75 ng/&mu;L</li><br />
<br />
<li>0.75 T35S (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L Bsa1</li><br />
<br />
<li>1 &mu;L T4 Ligase </li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Tomorrow we will transform the result.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li><br />
<br />
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li><br />
<br />
<li>1 µl pDGB2?2</li><br />
<br />
<li>1 µl BsaI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl T10x</li><br />
<br />
<li>4.8 µl water</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked two colonies of each construct: </p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/04/2014</h4><br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="475" src= https://static.igem.org/mediawiki/2014/2/2d/20141004_CBSmini35_UTR_Luc.png><br />
<br />
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p><br />
<br />
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p><br />
<br />
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<p class="p_notebook">We made the following binary assembly.</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li><br />
<br />
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li><br />
<br />
<li>1 µl 2&Omega;2</li><br />
<br />
<li>1 µl BsmBI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl Buffer T10x</li><br />
<br />
<li>5.8 µl H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<p class="p_notebook">We picked two colonies of:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Restriction analysis:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20141008_cbsmini35_2omega2.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">11/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday' culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/3/31/20141011_Yellow_chromoprot_CUP_agro.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">13/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/c/c8/20141013_luciferase_mini35.png><br />
<br />
<p class="p_notebook">They were correct.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content-trans" id="goto-left" align="center"></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/interlab"><strong>Go to Interlab Study&rarr;</strong></a></div></br></br></br><br />
<br />
<div class="right-col"><br />
<div class="pinned note-container"><br />
<div class="note"><br />
<h3>Great Days!</h3><br />
<p>Here is our biggest days in the Laboratory</p><br />
<p><a href="#day1">Getting a Purple Plant</a>.</p><br />
<p><a href="#day2">Trichome Expression</a>.</p><br />
<p><a href="#day3">First Results</a>.</p><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</section> <br />
</div><br />
<br />
<div id="space-margin"></div><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.9.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:Valencia_UPV/Templates/sticky-notebook_jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<script><br />
$(".pinned").pin({containerSelector: ".container", minWidth: 940});<br />
</script><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:48:20Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br/><br/><br />
<br />
<div align="center"><br />
<iframe width="650" height="366"<br />
src="http://www.youtube.com/embed/2b3WuCpSZEE"><br />
</iframe><br/><br/></div><br />
<br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:48:10Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br/><br />
<br />
<div align="center"><br />
<iframe width="650" height="366"<br />
src="http://www.youtube.com/embed/2b3WuCpSZEE"><br />
</iframe><br/><br/></div><br />
<br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:47:46Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br />
<br />
<iframe width="650" height="366"<br />
src="http://www.youtube.com/embed/2b3WuCpSZEE"><br />
</iframe><br/><br/><br />
<br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:46:14Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br />
<br />
<iframe width="800" height="450"<br />
src="http://www.youtube.com/embed/2b3WuCpSZEE"><br />
</iframe><br/><br/><br />
<br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:46:01Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br />
<br />
<iframe width="800" height="450"<br />
src="http://www.youtube.com/embed/-2b3WuCpSZEE"><br />
</iframe><br/><br/><br />
<br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:44:56Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br />
<br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/policy/outreach
Team:Valencia UPV/policy/outreach
2014-10-18T03:44:00Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Policy and Practices</a> > <a>Activities</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>O</roja>utreach</span> </div><br/><br/><br />
<br />
<h3>Workshop announcement</h3><br />
</html><br />
[[Image:Igem_plants.png|left|800px]] <br />
<html><br />
<br/><br/><br/><br />
</html><br />
[[Image:VUPV_gene_exp.jpg|350px|left]] <br />
<html><br />
<br/><br/> <br />
<h3><i>“Generación Espontánea UPV” </i></h3><br />
<p><br />
Valencia UPV iGEM team participated in the communication and diffusion activity called <i>Generación Espontánea</i> (translated as Spontaneous Generation). Twenty-four teams of students showed their projects related to different areas: engineering, social, computing, architecture and culture. We presented our <span class="red-bold">Sexy Plant</span>, and made diffusion of Synthetic Biology. <i>Generación Espontánea</i> was organized by UPV and Dr. Larisa Dunai, who was awarded by MIT Technology Review with the <b>MIT Young Innovator under 35 Award</b> of this year. </p><br />
<p align="right"> Valencia, October 2014</p><br />
<br />
<br/><br/><br />
<br />
</html><br />
[[Image:estiu.jpg|500px|right]] <br />
<html><br />
<br />
<br/><br/><br />
<br />
<h3><i>Summer 2014 School courses </i></h3><br />
<p><br />
Valencia UPV iGEM team introduced The Sexy Plant Project to students between 10 -15 years old, during this summer. Besides, we organised an activity for students to learn the pH scale using a natural indicator based on anthocyanins obtained from plants. Around one hundred students extrated anthocyanins from a red cabagge, and created a natural pH indicator. </p> <br />
<br/><br />
<p align="right"> Valencia, from June to July 2014 </p><br />
<br />
<br/><br />
<br/><br />
<div align="left"></div><br />
</br></br></br></br></br></br><br />
<h3>See our Lipdub at IBMCP labs!</h3><br />
<br/><br />
<p>We have organized and participated in a Lipdub. Our team wanted to involve the different groups that are currently working on the institute that is hosting us (IBMCP) in a different manner. We celebrated the 10th anniversary of the iGEM competition and the 20th anniversary of the IBMCP, too. We spend a great time with our colleagues and we promoted social relationships between us. As a result we did not only achieve an awesome video, but found a magnificent way to popularize science in society.</p><br />
<br/><br />
<div><br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/watch?v=2b3WuCpSZEE"><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:30:34Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br />
<div align="center"><br />
<embed align="center" width="600" height="450"<br />
src="https://www.youtube.com/watch?v=2b3WuCpSZEE"><br />
<br />
</div><br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:30:02Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br />
<div><br />
<embed align="center" width="600" height="450"<br />
src="https://www.youtube.com/watch?v=2b3WuCpSZEE"><br />
<br />
</div><br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:29:45Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br />
<div><br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/watch?v=2b3WuCpSZEE"><br />
<br />
</div><br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:29:18Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br />
<div><br />
<embed align="center" width="600" height="450"<br />
src="https://www.youtube.com/watch?v=2b3WuCpSZEE&feature=youtu.be"><br />
<br />
</div><br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression
Team:Valencia UPV/Project/modules/methodology/expression
2014-10-18T03:28:47Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Expression Analysis</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>ransient <roja>E</roja>xpression in <i><roja>N</roja>. benthamiana</i> leaves</span> </div><br/><br/><br />
<br />
<p>A plant life cycle spans months or even years. This makes stable genetic transformation of plants an unaffordable lengthy process for our project. Fortunately, there is a nice shortcut available: <b>Agrobacterium-mediated transient gene expression</b>. Using this technique, large gene constructs can be transferred to somatic cells in the plant and their expression tested and measured in a few days. When transiently transformed, the plant expresses the transgene during a few days or weeks, but they are not transferred to the offspring.</p></br/><br />
<br />
<p>On this project, the transient expression of our constructs in <i>N. benthamiana</i> leaves was the key technique used (1) to produce pheromones on the plant, (2) to check the specificity of the the trichomes promoter, (3) to test the switch regulated activity and to (4) assess the colour production of the biosafety module.</p></br/><br />
<br />
<p><i>Agrobacterium tumefaciens</i> is a bacterium from the soil that infects plants causing tumor development. The disease is caused because of the transference of a T-DNA (transfer DNA) that contains genes encoding enzymes synthesizing opines and phytohormones from the Ti Agrobacterium plasmid (see Fig. 1) to the plant genome. The synthesis of plant hormones enables the cell to grow uncontrollably forming the typical crown gall tumors (Fig. 2).</p></br/><br />
<br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/4/45/VUPV_M_Expression1.png" alt="" title="Figure 1. Ti Plasmid structure.<br />
Source: http://en.wikipedia.org/<br />
"></img><br />
<img width="300px" src="https://static.igem.org/mediawiki/2014/f/f3/VUPV_M_Expression2.png" alt="pheromone_pathway" title="Figure 2. Galls induced by Agrobacterium sp. on plant roots. Source: http://en.wikipedia.org/"></img></div><br/><br />
<br />
<br />
<p>Figure 1 shows the schema of the Ti plasmid being the genes encoded in the T-DNA, the ones are transferred to the plant genome. The T-DNA is defined and recognized by conserved, flanking T-DNA borders known as the Left (LB) and Right Border (RB). These polarized border sequences serve as the target for the Vir endonucleases which subsequently assist in integration of the T-DNA in the plant genome.</p></br/><br />
<br />
<p>Genes naturally encoded in the T-DNA can be replaced with the gene or genes of interest so <i>Agrobacterium</i> can be used as a vector to deliver them to the plant. After cloning the genes of interest in a single plasmid [see cloning section], this plasmid is transferred to <i>Agrobacterium</i>.</p></br/><br />
<br />
<p>LB medium with the appropriate antibiotics is inoculated with a single <i>Agrobacterium</i> colony and grown to saturation. The saturated culture is used to inoculate fresh LB medium that is grown overnight. After that, cells are pelleted and resuspended into a suitable buffer solution to an optical density of 0.2 at 600nm. This buffer contains acetosyringone, a phenolic compound that induces the expression of the vir genes responsible of the transfer of the T-DNA from the plasmid to the plant genome.</p></br/><br />
<br />
<p>After incubation of the cultures for 2 hours, <i>N. benthamiana</i> leaves of 4-weeks old plants are inoculated with one of the methods described below. In order to check the constructs we used the syringe-agroinfiltration, while for the production of high amounts of pheromone we chose the vacuum method.</p></br/><br />
<br />
<ol class="normal-sangría"><br />
<li>On syringe-agroinfiltration, the <i>Agrobacterium</i> solution is placed in a syringe (without needle) and it is injected into the airspaces inside the leaf by pressing the tip of the syringe against the underside of the leaf while simultaneously applying a counterpressure on the other side.<br />
<div><br />
<embed align="center" width="600" height="450"<br />
src="http://www.youtube.com/v/x_uhzKFNBdk"><br />
<br />
</div><br />
</li><br/><br />
<li>On vacuum infiltration the whole plants are submerged in the solution, and placed into a vacuum chamber. After that, vacuum is applied forcing air out of the stomata. When the vacuum is released, the pressure difference forces solution through the stomata.<br/><br />
<br />
<div align="center"><img width="300px" src="https://static.igem.org/mediawiki/2014/2/26/VUPV_M_Expression3.png" alt="" title="Figure 3. Pictures showing the vacuum infiltration procedure."></img></div><br/><br />
<br />
Once inside the leaf the <i>Agrobacterium</i> transfers the genes of interest in high copy numbers into the plant cells. After 4-7 days depending on the objective leaf samples are collected.</li><br/><br />
<br />
</ol><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>&larr; Go to Parts Construction</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation"><strong>Go to Sample Preparation &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/notebook
Team:Valencia UPV/Project/notebook
2014-10-18T03:11:54Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<html><br />
<style><br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.table_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border: none;<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.td_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border:none;<br />
padding-right: 25px;<br />
}<br />
<br />
.section_notebook{<br />
color: red;<br />
text-align: left;<br />
font-size: 16pt;<br />
}<br />
<br />
.date_notebook {<br />
color: green;<br />
text-align: left;<br />
font-size: 12pt;<br />
}<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.strong_notebook {<br />
color: red;<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
<br />
.img_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.box_above_notebook{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
<br />
.ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
}<br />
<br />
.ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 1.5em;<br />
}<br />
<br />
.ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 3.0em;<br />
}<br />
<br />
.ul_ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 4.5em;<br />
}<br />
<br />
#cn-box-left<br />
{<br />
float: left;<br />
width: 70%;<br />
//padding-right: 20px;<br />
margin-left: 140px;<br />
//background-color: yellow;<br />
}<br />
<br />
#cn-box-right<br />
{<br />
float: right;<br />
width: 18%;<br />
background-color: blue;<br />
}<br />
<br />
.right-col {<br />
float: right;<br />
width: 25%;<br />
padding-left: 20px;<br />
}<br />
<br />
.note-container {<br />
margin-top: 10px;<br />
}<br />
<br />
.note {<br />
padding: 18px 5px;<br />
background: #eee;<br />
text-decoration:none;<br />
background:#ffc;<br />
display:block;<br />
padding: 20px;<br />
width: 200px; <br />
box-shadow: 5px 5px 7px rgba(33,33,33,.7);<br />
-webkit-transform: rotate(-6deg);<br />
-moz-transform: rotate(-6deg);<br />
-ms-transform: rotate(-6deg);<br />
transform: rotate(-6deg);<br />
font-size: 16px;<br />
}<br />
.note h3 {<br />
font-size: 28px;<br />
margin: 0;<br />
}<br />
<br />
/*Thanks to Webpop (http://www.webpop.com) for the code for the pinned note*/<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-18439732-5']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Notebook</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>N</roja>otebook</span> </div><br/><br/><br />
<br />
<br />
<section class="container clearfix"> <br />
<br />
<div class="box_above_notebook"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul><br />
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p><br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"><br />
<br />
<br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p><br />
<br />
<ul class="ul_notebook"><li>Codon optimization</li><br />
<br />
<li>Inner restriction sites eliminations by finding synonymous mutations</li><br />
<br />
<li>Addition of GB endings</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p><br />
<br />
<br />
<br />
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ordered the following gBlocks and primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li><br />
<br />
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li><br />
<br />
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li><br />
<br />
<li>I14Jun04 Atr&Delta;11 R1</li><br />
<br />
</ul><li>FAO1: <i>N. benthamiana</i> primers</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li><br />
<br />
<li>I14Jun02 FAO1 R1</li><br />
<br />
</ul></ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We thought which parts of the GB collection could we use.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy 1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 2:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTAtHSP18.2</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 3:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTTctp</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Pieces to take from GB2.0 colection:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Later we will need:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Prepare plaques with antibiotics Kan, Spm, Amp</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Culture in agar Petri dish. 2 plaques: Amp and Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps with EZNA Plasmid DNA MiniKit I.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Expected digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis analysis.</p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"><br />
<br />
<br />
<br />
<p class="p_notebook">We got the expected bands in all cases.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p><br />
<br />
<p class="p_notebook">We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li><br />
<br />
<li>10 &mu;L HF buffer </li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L Reverse primer</li><br />
<br />
<li>2.5 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L template (Atr&Delta;11 gene)</li><br />
<br />
<li>0.5 &mu;L phusion (polimerase)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png><br />
<br />
<br />
<br />
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product/gblock product </li><br />
<br />
<li>1.2 &mu;L buffer 10x</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Vfinal= 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li><br />
<br />
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After incubation, culture in Petri plates (always in a LAF).</p><br />
<br />
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p><br />
<br />
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li><br />
<br />
<li>2.5 &mu;L buffer</li><br />
<br />
<li>21 &mu;L H20 (miliQ)</li><br />
<br />
<li>1 &mu;L sample</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li><br />
<br />
<li>25 &mu;L Orange</li><br />
<br />
<li>210 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li><br />
<br />
<li>7.5 &mu;L Green</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BanII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Comments:</p><br />
<br />
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li><br />
<br />
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-Gal</li><br />
<br />
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li><br />
<br />
<li>17.5 &mu;L Orange</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li><br />
<br />
<li>10 &mu;L Tango</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li><br />
<br />
<li>10 &mu;L Green</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L terminator 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L CDS 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L vector &alpha;</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Total: 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy Promoter-Terminator:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Adjust concentrations to 75 ng/&mu;L for ligation reaction</p><br />
<br />
<br />
<br />
<p class="p_notebook">Initial concentrations (nanodrop):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reaction</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p><br />
<br />
<br />
<br />
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li><br />
<br />
<li>HarFAR -> Sequencing correct</li><br />
<br />
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Worked in the LAF</li><br />
<br />
<li>Cultivated in a Petri dish with Spm</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li><br />
<br />
<li>Rest of the culture in another (250 &mu;L aprox)</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-gal</li><br />
<br />
<li>3.5 &mu;L IPTG</li><br />
<br />
</ul><li>1 colony from 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p><br />
<br />
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for HindIII</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li><br />
<br />
<li>17.5 &mu;L Red</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li><br />
<br />
<li>2.5 &mu;L Red</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul><li>Mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li><br />
<br />
<li>2.5 &mu;L Green</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Amp</li><br />
<br />
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li><br />
<br />
<li>pEaDAcT (3)</li><br />
<br />
<li>pHarFAR (3)</li><br />
<br />
</ul><li>Kan</li><br />
<br />
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li><br />
<br />
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except P35s:EaDAcT:T35s (2).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation in &Omega; vectors.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Selected tubes: </p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check the transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li><br />
<br />
<li>10 &mu;L Green buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li><br />
<br />
<li>20 &mu;L Red buffer</li><br />
<br />
<li>168 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Candida genome extraction</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cultures measured at 600 nm:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.39</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The absorbance was measured again:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.40</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li><br />
<br />
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li><br />
<br />
<li>Wash once with 1 mL sterile water.</li><br />
<br />
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li><br />
<br />
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li><br />
<br />
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li><br />
<br />
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li><br />
<br />
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li><br />
<br />
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li><br />
<br />
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li><br />
<br />
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li><br />
<br />
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li><br />
<br />
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li><br />
<br />
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Genomic quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis made to check the extraction quality was correct. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked EaDAcT colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We got the Candida genome band, however, the Saccharomyces genome band was not present.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep digestions are going to be done tomorrow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BglII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li><br />
<br />
<li>7.5 &mu;L Red buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL06) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL05) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul><li>FAO1-PCR2</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL08) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL07) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperatures</p><br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li><br />
<br />
<li>FAO1-PCR2: 64 &deg;C</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li><br />
<br />
<li>FAO1-PCR2: 1015 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both FAO1 PCR products were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 25 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p><br />
<br />
<br />
<br />
<p class="p_notebook">EaDAcT Transcriptional Unit (TU) transformation</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of P35s:EaDAcT:T35s in 2&Omega;2 P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> liquid cultures (5 mL LB)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li><br />
<br />
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li><br />
<br />
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li><br />
<br />
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from P35s:Atr&Delta;11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR of FAO1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>35 &mu;L HF buffer (5x)</li><br />
<br />
<li>7 &mu;L dNTPs</li><br />
<br />
<li>8.75 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>8.75 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>1.05 &mu;L Phusion polymerase</li><br />
<br />
<li>112.7 H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140805_PCR_FAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO2-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico to check minipreps:</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook"><i>A. tumefaciens</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li><br />
<br />
<li>12.5 &mu;L Orange buffer</li><br />
<br />
<li>105 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li><br />
<br />
<li>2.5 &mu;L Buffer</li><br />
<br />
<li>5 &mu;L Miniprep sample</li><br />
<br />
<li>17 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">FAO1 PCR product.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration protocol consists of:</p><br />
<br />
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li><br />
<br />
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li><br />
<br />
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li><br />
<br />
<li>Mix the cultures, keeping all of them in the same proportions.</li><br />
<br />
<li>Proceed to agroinfiltration.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Possibility of primer combinations: </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>94&deg;C, 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li><br />
<br />
<li>49 or 52&deg;C, 15 s</li><br />
<br />
<li>72&deg;C, 90 s</li><br />
<br />
</ul><li>72&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCRs wih Taq polimerase:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L Template </li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L Reverse primer</li><br />
<br />
<li>1 &mu;L Taq pol.</li><br />
<br />
<li>5 Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>94&deg;C 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li><br />
<br />
<li>49&deg;C 15 s</li><br />
<br />
<li>72&deg;C 90 s</li><br />
<br />
</ul><li>72&deg;C 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PHEROMONE ANALYSIS</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p><br />
<br />
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
<li>1 leaf from a wild type plant</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p><br />
<br />
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>100,0 mg of wild type leaf</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Then 150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p><br />
<br />
<br />
<br />
<p class="p_notebook">EDTA 500mM preparation:</p><br />
<br />
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p><br />
<br />
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4><br />
<br />
<p class="p_notebook">Analysis was performed overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><a name="day3">First results</a> of the analysis were obtained. <b>The analysis proved that our plant was successfuly producing the desired pheromones in high concentration</b>. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<br />
<br />
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/66/20140812_IMAGEN_cromatogramas_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9a/20140812_IMAGEN_cromatogramas_7.png><br />
<br />
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p><br />
<br />
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Results of the replicae analysis are shown below:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140813_IMAGEN_CROMATOGRAMA_3.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Our happiness reached a peak!! A PEAK!</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p><br />
<br />
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward Primer </li><br />
<br />
<li>1 &mu;L Reverse Primer</li><br />
<br />
<li>1 &mu;L Taq Polimerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p><br />
<br />
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p><br />
<br />
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/9/95/20140814_colony_pcr_y_BBSI_test.png"><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Colony PCR 2:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 4:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400"src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/a7/20140820_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li><br />
<br />
<li>Incubate 15 min at 70&deg;C.</li><br />
<br />
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li><br />
<br />
<li>Centrifuge 3 min at 15000 xg.</li><br />
<br />
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li><br />
<br />
<li>Centrifuge 1 min at 15000 xg. </li><br />
<br />
<li>Recover 1 &mu;L of supernatant. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Control PCR:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L template</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 clone Fw+1 </li><br />
<br />
<li>1 &mu;L HSR1 Rtrv + 1149</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO1 PCR</li><br />
<br />
<li>1 &mu;L template</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li><br />
<br />
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR parameters (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li><br />
<br />
<li>HSR1 RTRv+1149</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li><br />
<br />
<li>HSR1 RTRv+1149 </li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul07 </li><br />
<br />
<li>iGEMJul08</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul09 </li><br />
<br />
<li>iGEMJul10</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/ac/20140825_pcps2_ta29_atr.png><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB parts:</li><br />
<br />
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were not correct. We will keep trying.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Note: Go to 09/16/2014</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li><br />
<br />
<li>Introduce the disks inside the tube.</li><br />
<br />
<li>Introduce the two tubes in liquid nitrogen.</li><br />
<br />
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li><br />
<br />
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li><br />
<br />
<li>Grind the disks.</li><br />
<br />
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li><br />
<br />
<li>Grind the mixture.</li><br />
<br />
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li><br />
<br />
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li><br />
<br />
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li><br />
<br />
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li><br />
<br />
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li><br />
<br />
<li>Repeat the last three steps.</li><br />
<br />
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li><br />
<br />
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li><br />
<br />
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li><br />
<br />
<li>Discard the supernatant by decantation (be carefull with the pellet).</li><br />
<br />
<li>Wash with 600 &mu;L ethanol (80%).</li><br />
<br />
<li>Centrifuge 5 min at 13000 rpm. </li><br />
<br />
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li><br />
<br />
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li><br />
<br />
<li>Store at -20&deg;C. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li><br />
<br />
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ordered primers</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJULO1</li><br />
<br />
<li>IGEMJULO2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li><br />
<br />
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for PCR:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L template</li><br />
<br />
<li>10 &mu;L buffer HF 5x</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo R</li><br />
<br />
<li>2.5 &mu;L oligo F</li><br />
<br />
<li>0.5 &mu;L Pfu</li><br />
<br />
<li>32 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 50 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Parameters:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR with different parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with other parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>49, 52, 55, 60 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with more genomic.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 &deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still without having any amplification.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat the PCR with other enzyme.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li><br />
<br />
<li>1.25 &mu;L forward primer 10 uM</li><br />
<br />
<li>1.25 &mu;L reverse primer 10 uM</li><br />
<br />
<li>0.5 &mu;L template 620 ng/&mu;L</li><br />
<br />
<li>9.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>50, 53, 55, 59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (2 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png><br />
<br />
<br />
<br />
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome promoter PCR product ligation in pUPD.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1.2 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>6.8 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Both minipreps were adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pTnos (GB0037)</li><br />
<br />
<li>pGFP (GB0059)</li><br />
<br />
<li>pLuciferase (GB0096)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Results of sequencing the promoter were obtained:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following table shows ligation details of the trichome promoter:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome Promoter transformation in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for HindIII:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li><br />
<br />
<li>10 &mu;L Red buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: The scientific name has been updated to Rhizobium radiobacter. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11/EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<img class="img_notebook" width="250px" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>1 &mu;L PCPS2:HarFAR:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li><br />
<br />
<li>1 &mu;L PCPS2:EaDAcT:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;2</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico made to check minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li><br />
<br />
<li>PCPS2:GFP:TNos (Rif, Kan)</li><br />
<br />
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li><br />
<br />
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos </li><br />
<br />
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico the check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/f1/20140826_Atr_%2B_Har.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TUs with trichome promoter:</li><br />
<br />
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made a ligation as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>3.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol followed was the same as previously done.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2f/PCPS2_2.png><br />
<br />
<br />
<br />
<p class="p_notebook"><a name="day2" class="red-bold">We obtained trichome selective expression of GFP!</a> </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="700px" src= https://static.igem.org/mediawiki/2014/b/b5/2014091_BB_y_Ruta_entera.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:GFP:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well using vortex.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>TNos:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="600px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Result analysis:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three gens are placed in the same construction. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/68/20140912_Pathway_complete.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digetions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions that were still pending from 09/12.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/28/20140916_ge_pieces_AcPathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="450" src= https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li><br />
<br />
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Order primers for TA29 and barnase:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29 PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>60&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul><li>Barnase PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>63&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul></ul><br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src="https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="300" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="402" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200" src= https://static.igem.org/mediawiki/2014/e/ef/20140821_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="250" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= ><br />
<br />
<img class="img_notebook" width="100" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png</p><br />
<br />
<br />
<br />
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase product</li><br />
<br />
<li>1.2 &mu;L Buffer Ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/eb/20140817_Ta29_e040.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/27/20140827_ta29.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/e/e5/2014092_Barnasaa_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Master Mix (12 reactions)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li><br />
<br />
<li>12 &mu;L primer R</li><br />
<br />
<li>12 &mu;L primer F</li><br />
<br />
<li>12 &mu;L Taq Polymerase</li><br />
<br />
<li>24 &mu;L Buffer 10X</li><br />
<br />
<li>48 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/7/75/2014092_Barnasa_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">bands were not correct, so we picked another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of barnase's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again Barnase minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140906_Barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct except one of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase</li><br />
<br />
<li>1.2 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 ul T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the PCR product is correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/49/20140918_bar_colony_PCR.png><br />
<br />
<br />
<br />
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li><br />
<br />
<li>Barnase PCR product in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested Barnase ligation with XbaI.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>MoFlippers constructions</li><br />
<br />
<li>Mutated Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="500" src=https://static.igem.org/mediawiki/2014/b/bb/20140922_Omega_under_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation into E.coli:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1</li><br />
<br />
<li>Barnase (XbaI digested) in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
<li>P35S:Yellow:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>Barnase digested with XbaI </li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again chromoproteins ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L Blue/Yellow</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions were run in two different gels</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/6/69/20140922_Blue_Ruta_KanRes_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestions were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Blue digestions were correct</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li><br />
<br />
<li>P35S:Yellow:T35S iin 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/05/20140924_Barnase.png><br />
<br />
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Barnase in pUPD (Mutated)</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 Ligase</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<br />
<br />
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture: </p><br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestion in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/ff/20140926_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a4/20140927_Blue_Agro.png><br />
<br />
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies (E.coli):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (pSB1A3)</li><br />
<br />
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (pSB1A3)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p><br />
<br />
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We send the Biosafety module to Norwich.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/2/27/20141005_Chromoprot_agro.png><br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other approaches that could be used in place of Blue and Yellow chromoproteins. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Ant1:TNos_P35S:JFA13:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's culture did not grow. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook"><a name="day1">10/16/2014</a></h4><br />
<br />
<br />
<br />
<p class="p_notebook">Plant leaves changed its usual green colour. As a result of anthocyanin accumulation, agroinfiltred leaves were purple coloured. We took photos of transient transformation of the two modules.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/25/Purple_Plant.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9f/20140822_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a8/20140827_bb_e0240.png><br />
<br />
<br />
<br />
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Double digestions</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li><br />
<br />
<li>2.5 &mu;L NEBuffer</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L enzyme 1</li><br />
<br />
<li>0.5 &mu;L enzyme 2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 20 &mu;L</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p><br />
<br />
<br />
<br />
<p class="p_notebook">BioBricks ligations</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li><br />
<br />
<li>2 &mu;L part 2 (25 ng)</li><br />
<br />
<li>1 &mu;L T4 buffer 10X</li><br />
<br />
<li>0.5 &mu;L T4</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/thumb/2/26/20140830_bb.png/800px-20140830_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a6/20140901_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/b/b7/20140902_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/0/07/20140904_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p><br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1) </td><td class="td_notebook">1.157 </td><td class="td_notebook">0.38 </td><td class="td_notebook">3.046</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.105 </td><td class="td_notebook">0.35 </td><td class="td_notebook">3.158</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.148 </td><td class="td_notebook">0.39 </td><td class="td_notebook">2.944</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1) </td><td class="td_notebook">5.237 </td><td class="td_notebook">0.36 </td><td class="td_notebook">14.547</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">5.073 </td><td class="td_notebook">0.34 </td><td class="td_notebook">14.92</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">3.729 </td><td class="td_notebook">0.26 </td><td class="td_notebook">14.342</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">61.246 </td><td class="td_notebook">0.43 </td><td class="td_notebook">142.432</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">65.759 </td><td class="td_notebook">0.47 </td><td class="td_notebook">139.913</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">68.295 </td><td class="td_notebook">0.47 </td><td class="td_notebook">145.309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">1.482 </td><td class="td_notebook">0.37 </td><td class="td_notebook">4.006</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.443 </td><td class="td_notebook">0.37 </td><td class="td_notebook">3.901</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.462 </td><td class="td_notebook">0.33 </td><td class="td_notebook">4.430</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr><br />
<br />
</table><br />
<br />
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run PCR with the following templates and primers:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">P35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>67&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">T35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>65&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li><br />
<br />
<li>PCR2: P35S:Atr&Delta;11:T35S template</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/e0/20140819_p35s.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20140819_t35s2C_p35s.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L T35S_BB</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H20 miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li><br />
<br />
<li>HarFAR (2&alpha;2)</li><br />
<br />
<li>Atr&Delta;11 (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the template is not there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">The gel showed that the PCR products were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/aa/20140906_PCR_P35S.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/b/b0/20140907_Barnase_PCR_35S.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any PCR product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng E0040</li><br />
<br />
<li>2.5 &mu;L NEB2</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L XbaI</li><br />
<br />
<li>0.5 &mu;L PstI</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li><br />
<br />
<li>MoFlipper + Atr&Delta;11</li><br />
<br />
<li>MoFlipper + HarFAR</li><br />
<br />
<li>MoFlipper + EaDAcT</li><br />
<br />
<li>MoFlipper + TA29</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="380px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">MoFlipper cultures did not grow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Omega undercover</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover with TA29</li><br />
<br />
<li>MoFlipper with Atr&Delta;11</li><br />
<br />
<li>MoFlipper with HarFAR</li><br />
<br />
<li>MoFlipper with EaDAcT</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="200px"src= https://static.igem.org/mediawiki/2014/7/7d/20140923_Ta29_Moflippers.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p><br />
<br />
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li><br />
<br />
<li>CUP2-PCR2: 348 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both PCR products were correct.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of both parts of CUP2.</p><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Gal4AD</li><br />
<br />
<li>CUP2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Gal4AD piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Quantification </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li><br />
<br />
<li>Gal4: 221.4 ng/&mu;L</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following ligations were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O </li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/1/18/20140815_CUP2_digestion.png><br />
<br />
<br />
<br />
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Gal4AD</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li><br />
<br />
<li>1 &mu;L SF in 1&alpha;1</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol was the same as previously folowed. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<p class="p_notebook">We have to repeat digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the following digestions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We consider to use the miniprep number 2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="280px" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested minipreps made the previous days:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/24/20140909_Digestiones_fallidas_CUP2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction in glycerol, we picked some colonies (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/66/20140910_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained from GB collection the following piece:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png ><br />
<br />
<br />
<br />
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0256</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligate it in pUPD vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L GBlock</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>GBlock in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/0/06/20140925_CUP_promoter_gblock_fail.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions have to be repeated.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/f/fb/20140925_CUP_promoter_GBlock.png><br />
<br />
<p class="p_notebook">Minipreps were correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L colony</li><br />
<br />
<li>1 &mu;L primer F</li><br />
<br />
<li>1 ul primer R</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Taq Polymerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We run a gel with PCR products:</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="355px" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li><br />
<br />
<li>Incorrect possible band: 270 bp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 157</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/9/9e/09012014_Mini35s_GBlock.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li><br />
<br />
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li><br />
<br />
<li>0.75 ul Luciferase (75 ng/&mu;L</li><br />
<br />
<li>0.75 T35S (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L Bsa1</li><br />
<br />
<li>1 &mu;L T4 Ligase </li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Tomorrow we will transform the result.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li><br />
<br />
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li><br />
<br />
<li>1 µl pDGB2?2</li><br />
<br />
<li>1 µl BsaI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl T10x</li><br />
<br />
<li>4.8 µl water</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked two colonies of each construct: </p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/04/2014</h4><br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="475" src= https://static.igem.org/mediawiki/2014/2/2d/20141004_CBSmini35_UTR_Luc.png><br />
<br />
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p><br />
<br />
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p><br />
<br />
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<p class="p_notebook">We made the following binary assembly.</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li><br />
<br />
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li><br />
<br />
<li>1 µl 2&Omega;2</li><br />
<br />
<li>1 µl BsmBI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl Buffer T10x</li><br />
<br />
<li>5.8 µl H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<p class="p_notebook">We picked two colonies of:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Restriction analysis:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20141008_cbsmini35_2omega2.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">11/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday' culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/3/31/20141011_Yellow_chromoprot_CUP_agro.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">13/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/c/c8/20141013_luciferase_mini35.png><br />
<br />
<p class="p_notebook">They were correct.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content-trans" id="goto-left" align="center"></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/interlab"><strong>Go to Interlab Study&rarr;</strong></a></div></br></br></br><br />
<br />
<div class="right-col"><br />
<div class="pinned note-container"><br />
<div class="note"><br />
<h3>Great Days!</h3><br />
<p>Here is our biggest days in the Laboratory</p><br />
<p><a href="#day1">Getting a Purple Plant</a>.</p><br />
<p><a href="#day2">Trichome Expression</a>.</p><br />
<p><a href="#day3">Firsts Results</a>.</p><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</section> <br />
</div><br />
<br />
<div id="space-margin"></div><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.9.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:Valencia_UPV/Templates/sticky-notebook_jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<script><br />
$(".pinned").pin({containerSelector: ".container", minWidth: 940});<br />
</script><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/notebook
Team:Valencia UPV/Project/notebook
2014-10-18T03:01:54Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<html><br />
<style><br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.table_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border: none;<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.td_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border:none;<br />
padding-right: 25px;<br />
}<br />
<br />
.section_notebook{<br />
color: red;<br />
text-align: left;<br />
font-size: 16pt;<br />
}<br />
<br />
.date_notebook {<br />
color: green;<br />
text-align: left;<br />
font-size: 12pt;<br />
}<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.strong_notebook {<br />
color: red;<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
<br />
.img_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.box_above_notebook{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
<br />
.ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
}<br />
<br />
.ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 1.5em;<br />
}<br />
<br />
.ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 3.0em;<br />
}<br />
<br />
.ul_ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 4.5em;<br />
}<br />
<br />
#cn-box-left<br />
{<br />
float: left;<br />
width: 70%;<br />
//padding-right: 20px;<br />
margin-left: 140px;<br />
//background-color: yellow;<br />
}<br />
<br />
#cn-box-right<br />
{<br />
float: right;<br />
width: 18%;<br />
background-color: blue;<br />
}<br />
<br />
.right-col {<br />
float: right;<br />
width: 25%;<br />
padding-left: 20px;<br />
}<br />
<br />
.note-container {<br />
margin-top: 10px;<br />
}<br />
<br />
.note {<br />
padding: 18px 5px;<br />
background: #eee;<br />
text-decoration:none;<br />
background:#ffc;<br />
display:block;<br />
padding: 20px;<br />
width: 200px; <br />
box-shadow: 5px 5px 7px rgba(33,33,33,.7);<br />
-webkit-transform: rotate(-6deg);<br />
-moz-transform: rotate(-6deg);<br />
-ms-transform: rotate(-6deg);<br />
transform: rotate(-6deg);<br />
font-size: 16px;<br />
}<br />
.note h3 {<br />
font-size: 28px;<br />
margin: 0;<br />
}<br />
<br />
/*Thanks to Webpop (http://www.webpop.com) for the code for the pinned note*/<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-18439732-5']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Notebook</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>N</roja>otebook</span> </div><br/><br/><br />
<br />
<br />
<section class="container clearfix"> <br />
<br />
<div class="box_above_notebook"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul><br />
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p><br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"><br />
<br />
<br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p><br />
<br />
<ul class="ul_notebook"><li>Codon optimization</li><br />
<br />
<li>Inner restriction sites eliminations by finding synonymous mutations</li><br />
<br />
<li>Addition of GB endings</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p><br />
<br />
<br />
<br />
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ordered the following gBlocks and primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li><br />
<br />
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li><br />
<br />
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li><br />
<br />
<li>I14Jun04 Atr&Delta;11 R1</li><br />
<br />
</ul><li>FAO1: <i>N. benthamiana</i> primers</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li><br />
<br />
<li>I14Jun02 FAO1 R1</li><br />
<br />
</ul></ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We thought which parts of the GB collection could we use.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy 1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 2:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTAtHSP18.2</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 3:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTTctp</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Pieces to take from GB2.0 colection:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Later we will need:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Prepare plaques with antibiotics Kan, Spm, Amp</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Culture in agar Petri dish. 2 plaques: Amp and Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps with EZNA Plasmid DNA MiniKit I.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Expected digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis analysis.</p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"><br />
<br />
<br />
<br />
<p class="p_notebook">We got the expected bands in all cases.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p><br />
<br />
<p class="p_notebook">We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li><br />
<br />
<li>10 &mu;L HF buffer </li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L Reverse primer</li><br />
<br />
<li>2.5 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L template (Atr&Delta;11 gene)</li><br />
<br />
<li>0.5 &mu;L phusion (polimerase)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png><br />
<br />
<br />
<br />
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product/gblock product </li><br />
<br />
<li>1.2 &mu;L buffer 10x</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Vfinal= 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li><br />
<br />
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After incubation, culture in Petri plates (always in a LAF).</p><br />
<br />
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p><br />
<br />
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li><br />
<br />
<li>2.5 &mu;L buffer</li><br />
<br />
<li>21 &mu;L H20 (miliQ)</li><br />
<br />
<li>1 &mu;L sample</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li><br />
<br />
<li>25 &mu;L Orange</li><br />
<br />
<li>210 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li><br />
<br />
<li>7.5 &mu;L Green</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BanII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Comments:</p><br />
<br />
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li><br />
<br />
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-Gal</li><br />
<br />
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li><br />
<br />
<li>17.5 &mu;L Orange</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li><br />
<br />
<li>10 &mu;L Tango</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li><br />
<br />
<li>10 &mu;L Green</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L terminator 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L CDS 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L vector &alpha;</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Total: 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy Promoter-Terminator:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Adjust concentrations to 75 ng/&mu;L for ligation reaction</p><br />
<br />
<br />
<br />
<p class="p_notebook">Initial concentrations (nanodrop):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reaction</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p><br />
<br />
<br />
<br />
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li><br />
<br />
<li>HarFAR -> Sequencing correct</li><br />
<br />
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Worked in the LAF</li><br />
<br />
<li>Cultivated in a Petri dish with Spm</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li><br />
<br />
<li>Rest of the culture in another (250 &mu;L aprox)</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-gal</li><br />
<br />
<li>3.5 &mu;L IPTG</li><br />
<br />
</ul><li>1 colony from 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p><br />
<br />
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for HindIII</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li><br />
<br />
<li>17.5 &mu;L Red</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li><br />
<br />
<li>2.5 &mu;L Red</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul><li>Mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li><br />
<br />
<li>2.5 &mu;L Green</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Amp</li><br />
<br />
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li><br />
<br />
<li>pEaDAcT (3)</li><br />
<br />
<li>pHarFAR (3)</li><br />
<br />
</ul><li>Kan</li><br />
<br />
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li><br />
<br />
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except P35s:EaDAcT:T35s (2).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation in &Omega; vectors.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Selected tubes: </p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check the transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li><br />
<br />
<li>10 &mu;L Green buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li><br />
<br />
<li>20 &mu;L Red buffer</li><br />
<br />
<li>168 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Candida genome extraction</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cultures measured at 600 nm:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.39</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The absorbance was measured again:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.40</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li><br />
<br />
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li><br />
<br />
<li>Wash once with 1 mL sterile water.</li><br />
<br />
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li><br />
<br />
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li><br />
<br />
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li><br />
<br />
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li><br />
<br />
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li><br />
<br />
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li><br />
<br />
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li><br />
<br />
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li><br />
<br />
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li><br />
<br />
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li><br />
<br />
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Genomic quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis made to check the extraction quality was correct. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked EaDAcT colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We got the Candida genome band, however, the Saccharomyces genome band was not present.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep digestions are going to be done tomorrow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BglII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li><br />
<br />
<li>7.5 &mu;L Red buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL06) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL05) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul><li>FAO1-PCR2</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL08) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL07) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperatures</p><br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li><br />
<br />
<li>FAO1-PCR2: 64 &deg;C</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li><br />
<br />
<li>FAO1-PCR2: 1015 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both FAO1 PCR products were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 25 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p><br />
<br />
<br />
<br />
<p class="p_notebook">EaDAcT Transcriptional Unit (TU) transformation</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of P35s:EaDAcT:T35s in 2&Omega;2 P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> liquid cultures (5 mL LB)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li><br />
<br />
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li><br />
<br />
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li><br />
<br />
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from P35s:Atr&Delta;11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR of FAO1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>35 &mu;L HF buffer (5x)</li><br />
<br />
<li>7 &mu;L dNTPs</li><br />
<br />
<li>8.75 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>8.75 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>1.05 &mu;L Phusion polymerase</li><br />
<br />
<li>112.7 H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140805_PCR_FAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO2-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico to check minipreps:</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook"><i>A. tumefaciens</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li><br />
<br />
<li>12.5 &mu;L Orange buffer</li><br />
<br />
<li>105 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li><br />
<br />
<li>2.5 &mu;L Buffer</li><br />
<br />
<li>5 &mu;L Miniprep sample</li><br />
<br />
<li>17 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">FAO1 PCR product.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration protocol consists of:</p><br />
<br />
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li><br />
<br />
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li><br />
<br />
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li><br />
<br />
<li>Mix the cultures, keeping all of them in the same proportions.</li><br />
<br />
<li>Proceed to agroinfiltration.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Possibility of primer combinations: </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>94&deg;C, 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li><br />
<br />
<li>49 or 52&deg;C, 15 s</li><br />
<br />
<li>72&deg;C, 90 s</li><br />
<br />
</ul><li>72&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCRs wih Taq polimerase:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L Template </li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L Reverse primer</li><br />
<br />
<li>1 &mu;L Taq pol.</li><br />
<br />
<li>5 Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>94&deg;C 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li><br />
<br />
<li>49&deg;C 15 s</li><br />
<br />
<li>72&deg;C 90 s</li><br />
<br />
</ul><li>72&deg;C 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PHEROMONE ANALYSIS</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p><br />
<br />
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
<li>1 leaf from a wild type plant</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p><br />
<br />
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>100,0 mg of wild type leaf</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Then 150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p><br />
<br />
<br />
<br />
<p class="p_notebook">EDTA 500mM preparation:</p><br />
<br />
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p><br />
<br />
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4><br />
<br />
<p class="p_notebook">Analysis was performed overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">First results of the analysis were obtained. The analysis proved that our plant was successfuly producing the desired pheromones in high concentration. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<br />
<br />
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/66/20140812_IMAGEN_cromatogramas_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9a/20140812_IMAGEN_cromatogramas_7.png><br />
<br />
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p><br />
<br />
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Results of the replicae analysis are shown below:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140813_IMAGEN_CROMATOGRAMA_3.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Our happiness reached a peak!! A PEAK!</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p><br />
<br />
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward Primer </li><br />
<br />
<li>1 &mu;L Reverse Primer</li><br />
<br />
<li>1 &mu;L Taq Polimerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p><br />
<br />
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p><br />
<br />
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/9/95/20140814_colony_pcr_y_BBSI_test.png"><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Colony PCR 2:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 4:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400"src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/a7/20140820_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li><br />
<br />
<li>Incubate 15 min at 70&deg;C.</li><br />
<br />
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li><br />
<br />
<li>Centrifuge 3 min at 15000 xg.</li><br />
<br />
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li><br />
<br />
<li>Centrifuge 1 min at 15000 xg. </li><br />
<br />
<li>Recover 1 &mu;L of supernatant. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Control PCR:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L template</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 clone Fw+1 </li><br />
<br />
<li>1 &mu;L HSR1 Rtrv + 1149</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO1 PCR</li><br />
<br />
<li>1 &mu;L template</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li><br />
<br />
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR parameters (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li><br />
<br />
<li>HSR1 RTRv+1149</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li><br />
<br />
<li>HSR1 RTRv+1149 </li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul07 </li><br />
<br />
<li>iGEMJul08</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul09 </li><br />
<br />
<li>iGEMJul10</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/ac/20140825_pcps2_ta29_atr.png><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB parts:</li><br />
<br />
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were not correct. We will keep trying.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Note: Go to 09/16/2014</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li><br />
<br />
<li>Introduce the disks inside the tube.</li><br />
<br />
<li>Introduce the two tubes in liquid nitrogen.</li><br />
<br />
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li><br />
<br />
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li><br />
<br />
<li>Grind the disks.</li><br />
<br />
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li><br />
<br />
<li>Grind the mixture.</li><br />
<br />
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li><br />
<br />
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li><br />
<br />
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li><br />
<br />
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li><br />
<br />
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li><br />
<br />
<li>Repeat the last three steps.</li><br />
<br />
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li><br />
<br />
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li><br />
<br />
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li><br />
<br />
<li>Discard the supernatant by decantation (be carefull with the pellet).</li><br />
<br />
<li>Wash with 600 &mu;L ethanol (80%).</li><br />
<br />
<li>Centrifuge 5 min at 13000 rpm. </li><br />
<br />
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li><br />
<br />
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li><br />
<br />
<li>Store at -20&deg;C. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li><br />
<br />
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ordered primers</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJULO1</li><br />
<br />
<li>IGEMJULO2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li><br />
<br />
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for PCR:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L template</li><br />
<br />
<li>10 &mu;L buffer HF 5x</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo R</li><br />
<br />
<li>2.5 &mu;L oligo F</li><br />
<br />
<li>0.5 &mu;L Pfu</li><br />
<br />
<li>32 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 50 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Parameters:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR with different parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with other parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>49, 52, 55, 60 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with more genomic.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 &deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still without having any amplification.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat the PCR with other enzyme.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li><br />
<br />
<li>1.25 &mu;L forward primer 10 uM</li><br />
<br />
<li>1.25 &mu;L reverse primer 10 uM</li><br />
<br />
<li>0.5 &mu;L template 620 ng/&mu;L</li><br />
<br />
<li>9.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>50, 53, 55, 59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (2 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png><br />
<br />
<br />
<br />
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome promoter PCR product ligation in pUPD.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1.2 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>6.8 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Both minipreps were adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pTnos (GB0037)</li><br />
<br />
<li>pGFP (GB0059)</li><br />
<br />
<li>pLuciferase (GB0096)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Results of sequencing the promoter were obtained:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following table shows ligation details of the trichome promoter:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome Promoter transformation in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for HindIII:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li><br />
<br />
<li>10 &mu;L Red buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: The scientific name has been updated to Rhizobium radiobacter. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11/EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<img class="img_notebook" width="250px" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>1 &mu;L PCPS2:HarFAR:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li><br />
<br />
<li>1 &mu;L PCPS2:EaDAcT:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;2</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico made to check minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li><br />
<br />
<li>PCPS2:GFP:TNos (Rif, Kan)</li><br />
<br />
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li><br />
<br />
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos </li><br />
<br />
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico the check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/f1/20140826_Atr_%2B_Har.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TUs with trichome promoter:</li><br />
<br />
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made a ligation as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>3.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol followed was the same as previously done.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2f/PCPS2_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained trichome selective expression of GFP! </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="700px" src= https://static.igem.org/mediawiki/2014/b/b5/2014091_BB_y_Ruta_entera.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:GFP:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well using vortex.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>TNos:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="600px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Result analysis:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three gens are placed in the same construction. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/68/20140912_Pathway_complete.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digetions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions that were still pending from 09/12.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/28/20140916_ge_pieces_AcPathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="450" src= https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li><br />
<br />
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Order primers for TA29 and barnase:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29 PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>60&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul><li>Barnase PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>63&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul></ul><br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src="https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="300" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="402" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200" src= https://static.igem.org/mediawiki/2014/e/ef/20140821_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="250" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= ><br />
<br />
<img class="img_notebook" width="100" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png</p><br />
<br />
<br />
<br />
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase product</li><br />
<br />
<li>1.2 &mu;L Buffer Ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/eb/20140817_Ta29_e040.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/27/20140827_ta29.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/e/e5/2014092_Barnasaa_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Master Mix (12 reactions)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li><br />
<br />
<li>12 &mu;L primer R</li><br />
<br />
<li>12 &mu;L primer F</li><br />
<br />
<li>12 &mu;L Taq Polymerase</li><br />
<br />
<li>24 &mu;L Buffer 10X</li><br />
<br />
<li>48 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/7/75/2014092_Barnasa_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">bands were not correct, so we picked another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of barnase's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again Barnase minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140906_Barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct except one of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase</li><br />
<br />
<li>1.2 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 ul T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the PCR product is correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/49/20140918_bar_colony_PCR.png><br />
<br />
<br />
<br />
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li><br />
<br />
<li>Barnase PCR product in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested Barnase ligation with XbaI.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>MoFlippers constructions</li><br />
<br />
<li>Mutated Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="500" src=https://static.igem.org/mediawiki/2014/b/bb/20140922_Omega_under_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation into E.coli:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1</li><br />
<br />
<li>Barnase (XbaI digested) in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
<li>P35S:Yellow:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>Barnase digested with XbaI </li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again chromoproteins ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L Blue/Yellow</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions were run in two different gels</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/6/69/20140922_Blue_Ruta_KanRes_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestions were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Blue digestions were correct</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li><br />
<br />
<li>P35S:Yellow:T35S iin 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/05/20140924_Barnase.png><br />
<br />
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Barnase in pUPD (Mutated)</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 Ligase</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<br />
<br />
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture: </p><br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestion in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/ff/20140926_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a4/20140927_Blue_Agro.png><br />
<br />
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies (E.coli):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (pSB1A3)</li><br />
<br />
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (pSB1A3)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p><br />
<br />
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We send the Biosafety module to Norwich.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/2/27/20141005_Chromoprot_agro.png><br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other approaches that could be used in place of Blue and Yellow chromoproteins. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Ant1:TNos_P35S:JFA13:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's culture did not grow. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Plant leaves changed its usual green colour. As a result of anthocyanin accumulation, agroinfiltred leaves were purple coloured. We took photos of transient transformation of the two modules.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/25/Purple_Plant.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9f/20140822_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a8/20140827_bb_e0240.png><br />
<br />
<br />
<br />
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Double digestions</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li><br />
<br />
<li>2.5 &mu;L NEBuffer</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L enzyme 1</li><br />
<br />
<li>0.5 &mu;L enzyme 2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 20 &mu;L</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p><br />
<br />
<br />
<br />
<p class="p_notebook">BioBricks ligations</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li><br />
<br />
<li>2 &mu;L part 2 (25 ng)</li><br />
<br />
<li>1 &mu;L T4 buffer 10X</li><br />
<br />
<li>0.5 &mu;L T4</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/thumb/2/26/20140830_bb.png/800px-20140830_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a6/20140901_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/b/b7/20140902_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/0/07/20140904_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p><br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1) </td><td class="td_notebook">1.157 </td><td class="td_notebook">0.38 </td><td class="td_notebook">3.046</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.105 </td><td class="td_notebook">0.35 </td><td class="td_notebook">3.158</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.148 </td><td class="td_notebook">0.39 </td><td class="td_notebook">2.944</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1) </td><td class="td_notebook">5.237 </td><td class="td_notebook">0.36 </td><td class="td_notebook">14.547</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">5.073 </td><td class="td_notebook">0.34 </td><td class="td_notebook">14.92</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">3.729 </td><td class="td_notebook">0.26 </td><td class="td_notebook">14.342</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">61.246 </td><td class="td_notebook">0.43 </td><td class="td_notebook">142.432</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">65.759 </td><td class="td_notebook">0.47 </td><td class="td_notebook">139.913</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">68.295 </td><td class="td_notebook">0.47 </td><td class="td_notebook">145.309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">1.482 </td><td class="td_notebook">0.37 </td><td class="td_notebook">4.006</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.443 </td><td class="td_notebook">0.37 </td><td class="td_notebook">3.901</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.462 </td><td class="td_notebook">0.33 </td><td class="td_notebook">4.430</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr><br />
<br />
</table><br />
<br />
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run PCR with the following templates and primers:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">P35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>67&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">T35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>65&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li><br />
<br />
<li>PCR2: P35S:Atr&Delta;11:T35S template</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/e0/20140819_p35s.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20140819_t35s2C_p35s.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L T35S_BB</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H20 miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li><br />
<br />
<li>HarFAR (2&alpha;2)</li><br />
<br />
<li>Atr&Delta;11 (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the template is not there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">The gel showed that the PCR products were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/aa/20140906_PCR_P35S.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/b/b0/20140907_Barnase_PCR_35S.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any PCR product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng E0040</li><br />
<br />
<li>2.5 &mu;L NEB2</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L XbaI</li><br />
<br />
<li>0.5 &mu;L PstI</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li><br />
<br />
<li>MoFlipper + Atr&Delta;11</li><br />
<br />
<li>MoFlipper + HarFAR</li><br />
<br />
<li>MoFlipper + EaDAcT</li><br />
<br />
<li>MoFlipper + TA29</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="380px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">MoFlipper cultures did not grow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Omega undercover</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover with TA29</li><br />
<br />
<li>MoFlipper with Atr&Delta;11</li><br />
<br />
<li>MoFlipper with HarFAR</li><br />
<br />
<li>MoFlipper with EaDAcT</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="200px"src= https://static.igem.org/mediawiki/2014/7/7d/20140923_Ta29_Moflippers.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p><br />
<br />
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li><br />
<br />
<li>CUP2-PCR2: 348 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both PCR products were correct.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of both parts of CUP2.</p><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Gal4AD</li><br />
<br />
<li>CUP2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Gal4AD piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Quantification </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li><br />
<br />
<li>Gal4: 221.4 ng/&mu;L</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following ligations were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O </li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/1/18/20140815_CUP2_digestion.png><br />
<br />
<br />
<br />
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Gal4AD</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li><br />
<br />
<li>1 &mu;L SF in 1&alpha;1</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol was the same as previously folowed. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<p class="p_notebook">We have to repeat digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the following digestions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We consider to use the miniprep number 2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="280px" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested minipreps made the previous days:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/24/20140909_Digestiones_fallidas_CUP2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction in glycerol, we picked some colonies (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/66/20140910_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained from GB collection the following piece:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png ><br />
<br />
<br />
<br />
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0256</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligate it in pUPD vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L GBlock</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>GBlock in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/0/06/20140925_CUP_promoter_gblock_fail.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions have to be repeated.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/f/fb/20140925_CUP_promoter_GBlock.png><br />
<br />
<p class="p_notebook">Minipreps were correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L colony</li><br />
<br />
<li>1 &mu;L primer F</li><br />
<br />
<li>1 ul primer R</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Taq Polymerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We run a gel with PCR products:</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="355px" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li><br />
<br />
<li>Incorrect possible band: 270 bp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 157</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/9/9e/09012014_Mini35s_GBlock.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li><br />
<br />
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li><br />
<br />
<li>0.75 ul Luciferase (75 ng/&mu;L</li><br />
<br />
<li>0.75 T35S (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L Bsa1</li><br />
<br />
<li>1 &mu;L T4 Ligase </li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Tomorrow we will transform the result.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li><br />
<br />
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li><br />
<br />
<li>1 µl pDGB2?2</li><br />
<br />
<li>1 µl BsaI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl T10x</li><br />
<br />
<li>4.8 µl water</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked two colonies of each construct: </p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/04/2014</h4><br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="475" src= https://static.igem.org/mediawiki/2014/2/2d/20141004_CBSmini35_UTR_Luc.png><br />
<br />
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p><br />
<br />
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p><br />
<br />
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<p class="p_notebook">We made the following binary assembly.</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li><br />
<br />
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li><br />
<br />
<li>1 µl 2&Omega;2</li><br />
<br />
<li>1 µl BsmBI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl Buffer T10x</li><br />
<br />
<li>5.8 µl H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<p class="p_notebook">We picked two colonies of:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Restriction analysis:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20141008_cbsmini35_2omega2.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">11/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday' culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/3/31/20141011_Yellow_chromoprot_CUP_agro.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">13/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/c/c8/20141013_luciferase_mini35.png><br />
<br />
<p class="p_notebook">They were correct.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content-trans" id="goto-left" align="center"></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/interlab"><strong>Go to Interlab Study&rarr;</strong></a></div></br></br></br><br />
<br />
<div class="right-col"><br />
<div class="pinned note-container"><br />
<div class="note"><br />
<h3>Great Days!</h3><br />
<p>Here is our biggest days in the Laboratory</p><br />
<p><a href="#">Day 1</a>.</p><br />
<p><a href="#">Day 2</a>.</p><br />
<p><a href="#">Day 3</a>.</p><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</section> <br />
</div><br />
<br />
<div id="space-margin"></div><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.9.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:Valencia_UPV/Templates/sticky-notebook_jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<script><br />
$(".pinned").pin({containerSelector: ".container", minWidth: 940});<br />
</script><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/notebook
Team:Valencia UPV/Project/notebook
2014-10-18T03:01:36Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<html><br />
<style><br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.table_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border: none;<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.td_notebook{<br />
background:transparent;<br />
white-space:nowrap;<br />
border:none;<br />
padding-right: 25px;<br />
}<br />
<br />
.section_notebook{<br />
color: red;<br />
text-align: left;<br />
font-size: 16pt;<br />
}<br />
<br />
.date_notebook {<br />
color: green;<br />
text-align: left;<br />
font-size: 12pt;<br />
}<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.strong_notebook {<br />
color: red;<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
<br />
.img_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.box_above_notebook{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
<br />
.ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
}<br />
<br />
.ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 1.5em;<br />
}<br />
<br />
.ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 3.0em;<br />
}<br />
<br />
.ul_ul_ul_ul_notebook {<br />
list-style: square;<br />
list-style-position: inside;<br />
margin-left: 4.5em;<br />
}<br />
<br />
#cn-box-left<br />
{<br />
float: left;<br />
width: 70%;<br />
//padding-right: 20px;<br />
margin-left: 140px;<br />
//background-color: yellow;<br />
}<br />
<br />
#cn-box-right<br />
{<br />
float: right;<br />
width: 18%;<br />
background-color: blue;<br />
}<br />
<br />
.right-col {<br />
float: right;<br />
width: 25%;<br />
padding-left: 20px;<br />
}<br />
<br />
.note-container {<br />
margin-top: 10px;<br />
}<br />
<br />
.note {<br />
padding: 18px 5px;<br />
background: #eee;<br />
text-decoration:none;<br />
background:#ffc;<br />
display:block;<br />
padding: 20px;<br />
width: 200px; <br />
box-shadow: 5px 5px 7px rgba(33,33,33,.7);<br />
-webkit-transform: rotate(-6deg);<br />
-moz-transform: rotate(-6deg);<br />
-ms-transform: rotate(-6deg);<br />
transform: rotate(-6deg);<br />
font-size: 16px;<br />
}<br />
.note h3 {<br />
font-size: 28px;<br />
margin: 0;<br />
}<br />
<br />
/*Thanks to Webpop (http://www.webpop.com) for the code for the pinned note*/<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var _gaq = _gaq || [];<br />
_gaq.push(['_setAccount', 'UA-18439732-5']);<br />
_gaq.push(['_trackPageview']);<br />
<br />
(function() {<br />
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;<br />
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';<br />
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);<br />
})();<br />
<br />
</script><br />
<br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a>Notebook</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>N</roja>otebook</span> </div><br/><br/><br />
<br />
<br />
<section class="container clearfix"> <br />
<br />
<div class="box_above_notebook"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#Biosynthesis_under_constitutive_promoter">Biosynthesis under constitutive promoter</a></li> <li> <a href="#Expression_in_trichomes">Expression in trichomes</a></li> <li> <a href="#Biosafety_module">Biosafety module</a></li> <li> <a href="#Measurement_Interlab_Study">Measurement Interlab Study</a></li> <li> <a href="#Translator_to_BioBricks_and_omega_undercover_vector">Translator to BioBricks and omega undercover vector</a></li> <li> <a href="#Switch">Switch</a></li></ul><br />
</div><a name="Biosynthesis_under_constitutive_promoter"></a></br></br><h3 class="section_notebook">Biosynthesis under constitutive promoter</h3></br><h4 class="date_notebook">06/09/2014a</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The enzymes involved in the biosynthesis pathways are Atr&Delta;11, HarFAR, FAO1, EaDAcT.</p><br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/thumb/0/0f/UPV_rutas-biosintesis_feromonas.png/547px-UPV_rutas-biosintesis_feromonas.png width="273" height="300"><br />
<br />
<br />
<br />
<p class="p_notebook"></br></p><br />
<br />
<br />
<br />
<p class="p_notebook">The design of the GBlocks was performed taking into account the following considerations:</p><br />
<br />
<ul class="ul_notebook"><li>Codon optimization</li><br />
<br />
<li>Inner restriction sites eliminations by finding synonymous mutations</li><br />
<br />
<li>Addition of GB endings</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Codes for IDT known. MEGAGEM2014 - 25% off one order, up to 800 USD</p><br />
<br />
<br />
<br />
<p class="p_notebook">GBlocks designed to be compatible with BioBricks and GoldenBraid (GB).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ordered the following gBlocks and primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT: <i>Eunymus alatus</i> (adapted for GB) 1127 bp</li><br />
<br />
<li>HarFAR: <i>Helicoverpa armigera</i> (adapted for GB) 1400 bp</li><br />
<br />
<li>Atr&Delta;11: <i>Amyelois transitella</i> (order primers for GB) 1000 bp</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun03 Atr&Delta;11 F1</li><br />
<br />
<li>I14Jun04 Atr&Delta;11 R1</li><br />
<br />
</ul><li>FAO1: <i>N. benthamiana</i> primers</li><br />
<br />
<ul class="ul_ul_notebook"><li>I14Jun01 FAO1 F1</li><br />
<br />
<li>I14Jun02 FAO1 R1</li><br />
<br />
</ul></ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">Lenght</td><td class="td_notebook">Tm (NTI)</td><td class="td_notebook">Tm (Phusion)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun01_FAO1_F1</td><td class="td_notebook">cgccgtctcgctcgaatggagaaaaagagccatcc</td><td class="td_notebook">35</td><td class="td_notebook">49.9</td><td class="td_notebook">62.4</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun02_FAO1_R1</td><td class="td_notebook">cgccgtctcgctcgaagcttatcttgagaatttgccttcttttatc</td><td class="td_notebook">46</td><td class="td_notebook">54.5</td><td class="td_notebook">63.7</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun03Atr_D11_F1</td><td class="td_notebook">gcgccgtctcgctcgaatggttcctaataag</td><td class="td_notebook">31</td><td class="td_notebook">54.5</td><td class="td_notebook">65.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Jun04Atr_D11_R1</td><td class="td_notebook">gcgccgtctcgctcgaagctcaacgtttc</td><td class="td_notebook">29</td><td class="td_notebook">57</td><td class="td_notebook">69.1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We thought which parts of the GB collection could we use.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy 1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s (x2)</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 2:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTAtHSP18.2</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Strategy 3:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pP35S, pT35s</li><br />
<br />
<li>pP35s, pTTctp</li><br />
<br />
<li>pAtUbq10, pTAtHSP18.2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Pieces to take from GB2.0 colection:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;1</td><td class="td_notebook">GB0483</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&alpha;2</td><td class="td_notebook">GB0484</td><td class="td_notebook">Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s</td><td class="td_notebook">GB0030</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s</td><td class="td_notebook">GB0036</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10</td><td class="td_notebook">GB0223</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2</td><td class="td_notebook">GB0035</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp</td><td class="td_notebook">GB0081</td><td class="td_notebook">Amp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pUPD</td><td class="td_notebook">GB0317</td><td class="td_notebook">Amp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Later we will need:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;1</td><td class="td_notebook">GB0487</td><td class="td_notebook">Smp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pDGB2&Omega;2</td><td class="td_notebook">GB0488</td><td class="td_notebook">Smp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Prepare plaques with antibiotics Kan, Spm, Amp</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the selected pieces from the GB collection in liquid medium (performed in laminar air flow cabinet).</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">06/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Culture in agar Petri dish. 2 plaques: Amp and Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps with EZNA Plasmid DNA MiniKit I.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Expected digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pP35s </td><td class="td_notebook">GB0030</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 1105</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pT35s </td><td class="td_notebook">GB0036</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 304</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pAtUbq10 </td><td class="td_notebook">GB0223</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 714</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTAtHSP18.2 </td><td class="td_notebook">GB0035</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 328</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTTctp </td><td class="td_notebook">GB0081</td><td class="td_notebook">NotI</td><td class="td_notebook">Buffer: Orange</td><td class="td_notebook">2981, 487</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis analysis.</p><br />
<br />
<br />
<br />
<img class="img_notebook"src=https://static.igem.org/mediawiki/2014/d/d9/20140626_piezas_coleccion.png width="212" height="388"><br />
<br />
<br />
<br />
<p class="p_notebook">We got the expected bands in all cases.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Atr&Delta;11 amplification by PCR with primers that contain extra nucleotides to introduce them in the sequence. </p><br />
<br />
<p class="p_notebook">We made a PCR amplification using the Atr&Delta;11 gene as a template and the oligos: R +F</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>32.5 &mu;L of H2O miliQ</li><br />
<br />
<li>10 &mu;L HF buffer </li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L Reverse primer</li><br />
<br />
<li>2.5 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L template (Atr&Delta;11 gene)</li><br />
<br />
<li>0.5 &mu;L phusion (polimerase)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR parameters: The annealing temperature was 60&deg;C and the extension temperature was 65&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis performed to check the PCR product, which was expected to be around 1 kb. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/6a/20140701_pcr_gblock_atrd11.png><br />
<br />
<br />
<br />
<p class="p_notebook">pUPD ligation of EaDAcT, HarFar and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product/gblock product </li><br />
<br />
<li>1.2 &mu;L buffer 10x</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Vfinal= 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Termocycler parameters: The ligase temperature was 16&deg;C and the BsmBI temperature was 37&deg;C. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As a result, there are obtained three different pUPD plasmids containing the genes EaDAcT, HarFAR and Atr&Delta;11.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> transformation. This step is performed in a laminar air flow cabinet (LAF). We have used an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and a sample from each product of ligation made in the previous step (three pUPD plasmids, each of them containing one of the three genes), so transformation is made three times.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>E. coli</i> aliquot</li><br />
<br />
<li>1.5 &mu;L of ligation in pUPD (for each gene: EaDAcT, HarFAR, Atr&Delta;11)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each mix is introduced in a electroporation vial and electroporated at 1500 V, then 300 &mu;L of SOC are added to each vial. All of them were incubated at 37&deg;C for 1 hour.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After incubation, culture in Petri plates (always in a LAF).</p><br />
<br />
<p class="p_notebook">2 cell-culture dishes per transformation (with Ampicillin), one with 50 &mu;L and the other with the remaining volume. </p><br />
<br />
<p class="p_notebook">Petri plates are incubated at 37&deg;C for 16 h.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformed colonies selection. The white ones are recultured in liquid medium. One colony of each transformation is picked and cultured in 3.5 mL LB and 7 &mu;L Amp. This step is repeated three times:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3x 1 colony of EaDAcT in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of HarFAR in pUPD + LB + Amp</li><br />
<br />
<li>3x 1 colony of Atr&Delta;11 in pUPD + LB + Amp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">All tubes are incubated at 37&deg;C overnight in agitation.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico using Vector NTI to check after minipreps if ligations are correct.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BanII</td><td class="td_notebook">2570, 803, 351, 314</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L restriction enzyme</li><br />
<br />
<li>2.5 &mu;L buffer</li><br />
<br />
<li>21 &mu;L H20 (miliQ)</li><br />
<br />
<li>1 &mu;L sample</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>5 &mu;L NotI</li><br />
<br />
<li>25 &mu;L Orange</li><br />
<br />
<li>210 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L RsaI</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L PvuII</li><br />
<br />
<li>7.5 &mu;L Green</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BanII</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L BanII</li><br />
<br />
<li>7.5 &mu;L Tango</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Perform electrophoresis to check if the size of the fragments from the digestions is correct.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d5/20140704_digestiones_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Comments:</p><br />
<br />
<ul class="ul_notebook"><li>We picked blue colonies instead of white by mistake. We need to pick colonies again but this time make sure we pick white colonies.</li><br />
<br />
<li>For the repetition we must find another enzyme instead of BanII as we found out that it doesn't cut very well.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked again 3 colonies for each construction, and we made sure that we picked the WHITE ones. We cultivated them in a "double check" (name invented by us) liquid medium. Those tubes contain:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-Gal</li><br />
<br />
<li>3.5 &mu;L IPTG (turns the tube blue if the colonies picked were blue)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes HarFAR 1, 2, 3; EaDAcT 3 and Atr&Delta;11 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Once we had the minipreps, we perform the digestions to check which were correct and send them to sequencing. This time we selected RsaI instead of BanII. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1167</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1876, 1343, 532, 306, 91</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1440</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 1394, 463</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">RsaI</td><td class="td_notebook">1879, 1310, 467, 327, 54</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L NotI</li><br />
<br />
<li>17.5 &mu;L Orange</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L RsaI</li><br />
<br />
<li>10 &mu;L Tango</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for PvuII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L PvuII</li><br />
<br />
<li>10 &mu;L Green</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140707_digestiones_ligaciones2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK. We sent Atr&Delta;11 (3), HarFAR (3) and EaDAcT (3) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Now, while we wait for sequencing results, we go on as they were going to be correct in order to save time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The next step is to build a transciptional unit (TU) with our sequences. A transcriptional unit is a structure composed by promoter, coding sequence (CDS) and terminator in an &alpha; or &Omega; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L promoter 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L terminator 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L CDS 75 ng/&mu;L</li><br />
<br />
<li>1 &mu;L vector &alpha;</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Total: 12 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Take into account that if we want to make binary constructions later (merge 2 TU in a same vector), we need to clone each TU in a different &alpha; vector.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Strategy Promoter-Terminator:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">P35s</td><td class="td_notebook">T35s</td><td class="td_notebook">40.41</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">P35s</td><td class="td_notebook">TatHSP</td><td class="td_notebook">39.68</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">PAtUbq</td><td class="td_notebook">TatHSP</td><td class="td_notebook">32.27</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Adjust concentrations to 75 ng/&mu;L for ligation reaction</p><br />
<br />
<br />
<br />
<p class="p_notebook">Initial concentrations (nanodrop):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentrations</td><td class="td_notebook">Volume</td><td class="td_notebook">Volume of H20 to add</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUpb</td><td class="td_notebook">442.6 ng/&mu;L</td><td class="td_notebook">34 &mu;L</td><td class="td_notebook">166.6 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pTatHSP</td><td class="td_notebook">235.4 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">77 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">194.9 ng/&mu;L</td><td class="td_notebook">37.5 &mu;L</td><td class="td_notebook">60 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">454.7 ng/&mu;L</td><td class="td_notebook">36 &mu;L</td><td class="td_notebook">182 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;1</td><td class="td_notebook">57.1 ng/&mu;L</td><td class="td_notebook">-</td><td class="td_notebook">We will need to put 1.5 &mu;L of this one</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&alpha;2</td><td class="td_notebook">104.0 ng/&mu;L</td><td class="td_notebook">38 &mu;L</td><td class="td_notebook">14.7 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">359.3 ng/&mu;L</td><td class="td_notebook">20 &mu;L</td><td class="td_notebook">75.8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HarFAR</td><td class="td_notebook">404.4 ng/&mu;L</td><td class="td_notebook">15 &mu;L</td><td class="td_notebook">65.9 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EaDAcT</td><td class="td_notebook">155.6 ng/&mu;L</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10.7 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reaction</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>P35s:HarFAR:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PAtUbq:EaDAcT:TatHSP in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PAtUbq</li><br />
<br />
<li>1 &mu;L TatHSP</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of constructions in <i>E. coli</i></p><br />
<br />
<br />
<br />
<p class="p_notebook">We finally got the sequencing results from 07/07/2014.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Mutation in Atr&Delta;11 -> We threw away the colonies and transformed cells. We picked again white colonies.</li><br />
<br />
<li>HarFAR -> Sequencing correct</li><br />
<br />
<li>EaDAcT -> Synonim mutation in 601 (A -> T). This is a gBlock!</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We took vectors 2&Omega;1 (GB0487) and 2&Omega;2 (GB0488) parts from the GB colection.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Worked in the LAF</li><br />
<br />
<li>Cultivated in a Petri dish with Spm</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultivate transformated cells in two Kan plaques (Kan matches vector &alpha;)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>50 mL transformation in one plaque</li><br />
<br />
<li>Rest of the culture in another (250 &mu;L aprox)</li><br />
<br />
<li>Let them grow for one day</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in liquid medium.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>6 from Atr&Delta;11 (repetition because of mutation)</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Amp</li><br />
<br />
<li>7 &mu;L X-gal</li><br />
<br />
<li>3.5 &mu;L IPTG</li><br />
<br />
</ul><li>1 colony from 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>1 colony from 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Spm</li><br />
<br />
</ul><li>3 colonies from P35s:HarFAR:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul><li>3 colonies from PAtUbq:EaDAcT:TatHSP</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 mL LB</li><br />
<br />
<li>7 &mu;L Kan</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Grow at 37&deg;C in agitation overnight.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have checked the promoters and terminators are both compatible with GB and BioBricks.</p><br />
<br />
<p class="p_notebook">Only P35s and T35s work for both. pPnos could also work.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:HarFAR:THsp and PAtUbq:EaDAcT:THsp. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Thanks to our "double check" medium we found which colonies were well picked. Finally we had minipreps of tubes Atr&Delta;11 3 and 6; 2&Omega;1; 2&Omega;2; constructions P35s:HarFAR:TatHSP 1, 2, 3 and PAtUbq:EaDAcT:TatHSP 1, 2, 3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have cultured each of the colonies named above to store them.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We tested the minipreps made last friday by digestion. Once they were checked, we send the correct ones to sequencing. The in silico digestions were as follows.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Parts</td><td class="td_notebook">Retriction enzyme</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PAtUbq:EaDAcT:TatHSP in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1722, 736, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:TatHSP in 2 &alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1794, 221</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Atr&Delta;11</td><td class="td_notebook">NotI</td><td class="td_notebook">2961, 1056</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 382, 239</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 621</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of master mixes</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for HindIII</li><br />
<br />
<ul class="ul_ul_notebook"><li>3.5 &mu;L HindIII</li><br />
<br />
<li>17.5 &mu;L Red</li><br />
<br />
<li>147 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L EcoRV</li><br />
<br />
<li>2.5 &mu;L Red</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul><li>Mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L PvuII</li><br />
<br />
<li>2.5 &mu;L Green</li><br />
<br />
<li>21 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">We run the electrophoresis gel to check if this time we have done it correctly.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7a/20140714_digestion_ligaciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">Everything was OK except the Atr&Delta;11 (3), which had some partial digestion. It was the reason we sent Atr&Delta;11 (6) to sequence.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We got the sequencing results from yesterday and everything was OK, so we made the transcriptional units ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for the reaction of ligation (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s in 2&alpha;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3.7 &mu;L H20</li><br />
<br />
</ul><li>P35s:HarFAR:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L HarFAR</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&alpha;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s</li><br />
<br />
<li>1 &mu;L T35s</li><br />
<br />
<li>1 &mu;L EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1.2 &mu;L ligase buffer 10x</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>4.2 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Concentrations were previously adjusted to 75 ng/&mu;L. Only the Atr&Delta;11 was adjusted from 250.2 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we prepared liquid cultures in order to store in glicerol. The tubes we used and their respective antibiotics were:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Amp</li><br />
<br />
<ul class="ul_ul_notebook"><li>pAtr&Delta;11 (6)</li><br />
<br />
<li>pEaDAcT (3)</li><br />
<br />
<li>pHarFAR (3)</li><br />
<br />
</ul><li>Kan</li><br />
<br />
<ul class="ul_ul_notebook"><li>P35:HarFAR:TatHSP in 2&alpha;2 (3)</li><br />
<br />
<li>PPAtUbq:EaDAcT:TatHSP in 2apha2 (3)</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">07/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Storage in glycerol of the HarFAR (GB1018), Atr&Delta;11 (GB1019), EaDAcT (GB1020), P35s:HarFAR:TatHSP in 2&alpha;2 (GB1021) and PAtUbq:EaDAcT:TatHSP in 2&alpha;2 (GB1022). We made 3 tubes: one for us, one for the GB collenction and one for reserve. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The procedure is to mix 700 &mu;L of culture with 300 &mu;L of glycerol 50%, spin it and store it in the -80&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 3 colonies of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Culture in liquid medium with Kan.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzymes</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2269</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">390, 8202</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 6322, 1722</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8587, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2366</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">683, 8021</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Preparation of reagents needed for genomic extraction of <i>Candida tropicalis</i> for FAO1.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Mistake in P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s minipreps. Repeat tomorrow.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s. Concentration measuments with nanodrop.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional unit </td><td class="td_notebook">DNA concentration</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (1)</td><td class="td_notebook">164 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (2)</td><td class="td_notebook">168 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:Atr&Delta;11:T35s (3)</td><td class="td_notebook">147.4 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (1)</td><td class="td_notebook">125.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (2)</td><td class="td_notebook">114.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:HarFAR:T35s (3)</td><td class="td_notebook">140.3 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (1)</td><td class="td_notebook">144.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (2)</td><td class="td_notebook">137.9 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s:EaDAcT:T35s (3)</td><td class="td_notebook">128.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Stuffer fragment</td><td class="td_notebook">135.5 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;1</td><td class="td_notebook">196.8 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2&Omega;2</td><td class="td_notebook">175.4 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions of P35s:Atr&Delta;11:T35s, P35s:HarFAR:T35s and P35s:EaDAcT:T35s and gel electrophoresis to check if transciptional units have been assembled OK.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3c/20140719_digestiones_TU.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except P35s:EaDAcT:T35s (2).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation in &Omega; vectors.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:Atr&Delta;11:T35s + P35s:HarFAR:T35s in 2&Omega;1</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:HarFAR:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;1 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><li>P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L stuffer fragment (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&Omega;2 (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Omega vectors include a resistance to spectinomycin.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligations: P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 and P35S:EaDAcT:T35S in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1 (3) and P35S:EaDAcT:T35S in 2&Omega;2 (2).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Selected tubes: </p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1(Tubes 1, 2 and 3)</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2 (Tubes 1 and 2)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check the transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Transcriptional units</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S+P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NotI</li><br />
<br />
<li>7.5 &mu;L Orange buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BamHI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BamHI</li><br />
<br />
<li>10 &mu;L Green buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>4 &mu;L EcoRV</li><br />
<br />
<li>20 &mu;L Red buffer</li><br />
<br />
<li>168 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: Trichome promoter digestion preparation included. </p><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except the transcriptional unit of EaDAcT in 2&Omega;2 (P35s:EaDAcT:T35S). </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/83/20140722_digestiones_atr%2Bhar_Ea_y_p_tricomas.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">350.7</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">271.1</td><td class="td_notebook">33</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">306.3</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">296.6</td><td class="td_notebook">28</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">246.0</td><td class="td_notebook">33</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">All of the pieces named above were adjusted at 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece </td><td class="td_notebook">Tube number</td><td class="td_notebook">Final Volume (&mu;L)</td><td class="td_notebook">Volume to be added (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">1</td><td class="td_notebook">154.30</td><td class="td_notebook">121.3</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2</td><td class="td_notebook">119.30</td><td class="td_notebook">86.30</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">1</td><td class="td_notebook">126.60</td><td class="td_notebook">95.60</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">2</td><td class="td_notebook">110.70</td><td class="td_notebook">82.70</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S in 2&Omega;1</td><td class="td_notebook">3</td><td class="td_notebook">108.24</td><td class="td_notebook">75.20</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">As the digestions of the transcriptional unit (TU) of EaDAcT were incorrect, we repeated the process from the ligation step. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the same TU in a <i>E. coli</i> competent strain (DH5&alpha;). Then, the transformants were cultured in LB media and Spm and stored at 37&deg;C overnight. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, in order to obtain the FAO1 gene, we want to extract the <i>Candida tropicalis</i> genome, so we have picked a colony of <i>C. tropicalis</i>. To check the extraction protocol, we used a yeast previously tested, <i>Saccharomyces cerevisiae</i>. We have cultured <i>C. tropicalis</i> in YPD media and <i>S. cerevisiae</i> in YPDA media at 28 &deg;C (5 mL).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Candida genome extraction</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Saccharomyces cerevisiae</i> is used as a control in order to see if we followed the protocol correctly. We aren't really sure if this protocol is going to work in Candida.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cultures measured at 600 nm:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 1.07 </li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.39</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook"><i>S. cerevisiae</i> is recultured with new media (1:2) because the previous media was saturated. 2.25 mL of YPD media were mixed with 2.25 mL of <i>S. cerevisiae</i> culture. The mix has to grow at 28 &deg;C until the exponential phase is reached. </p><br />
<br />
<br />
<br />
<p class="p_notebook">The absorbance was measured again:</p><br />
<br />
<ul class="ul_notebook"><li><i>S. cerevisiae</i> Abs = 0.52</li><br />
<br />
<li><i>C. tropicalis</i> Abs = 0.40</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Buffers needed for the genome extraction were prepared freshly.The genome of both strains of yeast were extracted following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Grow yeast in 2 or 5 mL YPD to exponential phase. </li><br />
<br />
<li>Collect cells in 1.5 mL eppendorf-cup (centrifugation 20 s, 6000 rpm).</li><br />
<br />
<li>Wash once with 1 mL sterile water.</li><br />
<br />
<li>Resuspend cells in 200 &mu;L protoplast-buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1000 units Zymolyase/mL, 10 &mu;L beta-mercaptoethanol/mL; prepare freshly!). Incubate at 37&deg;C for 1-2 h and finally resuspend by turning the cups. </li><br />
<br />
<li>Add 200 &mu;L of Lysis-Mix (0.2 M NaOH, 1% SDS) an mix carefully (Don't vortex!).</li><br />
<br />
<li>Incubate at 65 &deg;C for 20 min and cool inmediately on ice.</li><br />
<br />
<li>Add 200 &mu;L of 5 M KAc (pH 5.4) and mix carefully (Don't vortex!) and incubate 15 min on ice. </li><br />
<br />
<li>Centrifuge (13,000 rpm, 3 min) and transfer supernatant in a fresh cup.</li><br />
<br />
<li>Add 2 &mu;L RNase A (10 mg/mL) and incubate at 37 &deg;C for 30 min.</li><br />
<br />
<li>Add 600 &mu;L isopropanol and mix carefully (Don't vortex!). Incubate at room temperature for 5 min ad centrifuge (13,000 rpm, 30 s). </li><br />
<br />
<li>Remove the supernatant and wash with 70% ethanol (10 min at room temperature). </li><br />
<br />
<li>Centrifuge (13,000 rpm, 30 s) and remove the supernatant.</li><br />
<br />
<li>Dry DNA pellet in a speed-vacuum (not longer than 3 min!) and resuspend in 50 &mu;L TE-buffer. </li><br />
<br />
<li>Store chromosomal DNA at 4 &deg;C (Don't freeze!). Concentration and quality can be checked in an agarose gel (loading 1/10 of the volume).</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Genomic quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Organism</td><td class="td_notebook">Concentration </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>S. cerevisiae</i></td><td class="td_notebook">72.2 ng/&mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i></td><td class="td_notebook">1397.1 ng/&mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Electrophoresis made to check the extraction quality was correct. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/64/20140723_genomico_candida.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not observe genomic from Candida because we used a very diluted sample. We will repeat the gel tomorrow.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked EaDAcT colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The genomic quality of both organisms (<i>C. tropicalis</i> and <i>S. cerevisiae</i>) was checked in an agarose gel again.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d8/20140724_genomico_candida_y_sac_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We got the Candida genome band, however, the Saccharomyces genome band was not present.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, minipreps of the liquid culture made yesterday were made and also recultured in solid agar plate. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep digestions are going to be done tomorrow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NotI</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for BglII</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L BglII</li><br />
<br />
<li>10 &mu;L Orange buffer</li><br />
<br />
<li>84 &mu;L H20</li><br />
<br />
</ul><li>Master mix for EcoRV</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L EcoRV</li><br />
<br />
<li>7.5 &mu;L Red buffer</li><br />
<br />
<li>63 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit and the other pieces:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/4c/20140725_Minipreps_piezas_y_construcciones.png><br />
<br />
<br />
<br />
<p class="p_notebook">All pieces were correct except the TU corresponding to P35:EaDAcT:T35S.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Once the <i>Candida tropicalis</i> genome DNA is obtained, the FAO1 gene can be amplified by PCR.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL06) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL05) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul><li>FAO1-PCR2</li><br />
<br />
<ul class="ul_ul_notebook"><li>Genomic 0.5 &mu;L</li><br />
<br />
<li>Buffer HF (5X) 10.0 &mu;L</li><br />
<br />
<li>dNTPs 2.0 &mu;L</li><br />
<br />
<li>Oligo R (JUL08) 2.5 &mu;L</li><br />
<br />
<li>Oligo F (JUL07) 2.5 &mu;L</li><br />
<br />
<li>Phusion polymerase 0.5 &mu;L</li><br />
<br />
<li>H2O 32.0 &mu;L</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperatures</p><br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 59 &deg;C</li><br />
<br />
<li>FAO1-PCR2: 64 &deg;C</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 1157 bp</li><br />
<br />
<li>FAO1-PCR2: 1015 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both FAO1 PCR products were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">As the EaDAcT TU was not correct, ligation reaction was done again. The following table shows ligation details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the FAO1 PCR was not correct, we repeated the reaction. Below is a table showing the details:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">FAO1-PCR1</td><td class="td_notebook">FAO1-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HF Buffer</td><td class="td_notebook">30 &mu;L</td><td class="td_notebook">30 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">1.5 &mu;L</td><td class="td_notebook">1.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">181 &mu;L</td><td class="td_notebook">181 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 25 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50, 55, 60, 65</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake preparing the FAO1-PCR1 adding the wrong template, so we do not expect the correct FAO11-PCR1 product. </p><br />
<br />
<br />
<br />
<p class="p_notebook">EaDAcT Transcriptional Unit (TU) transformation</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (P35s:EaDAcT:T35s in 2&Omega;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37&deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 and P35s:EaDAcT:T35s (in 2&alpha;2) in <i><i>Agrobacterium</i> tumefaciens</i> strain C58. Introduce 1 &mu;L of construction in a C58 aliquot. Electroporate at 1440V. Add 500 &mu;L of LB in the LAF. Keep 2 hours in agitation at 28&deg;C. Grow 20 &mu;L and 200 &mu;L in solid medium containing kanamicin and rifampicin. Incubate overnight at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of P35s:EaDAcT:T35s in 2&Omega;2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from <i><i>Agrobacterium</i> tumefaciens</i> and grow them in liquid medium for two days at 28&deg;C. Liquid medium is composed by 5 mL LB, Rif (1:1000) and Kan (1:1000) for &alpha; vectors and 5 mL LB, Rif (1:1000) and Spm (1:1000) for &Omega; vectors.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: P35S:EaDAcT:T35S in 2&Omega;2 </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Spm).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">NcoI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817, 683</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for NcoI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.5 &mu;L NcoI</li><br />
<br />
<li>7.5 &mu;L Tango buffer</li><br />
<br />
<li>63 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the trichome promoter part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit.</p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35s:EaDAcT:T35s in 2&Omega;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">(1)</td><td class="td_notebook">141.4</td><td class="td_notebook">35</td><td class="td_notebook">31</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S in 2&Omega;2</td><td class="td_notebook">2)</td><td class="td_notebook">3.9</td><td class="td_notebook">33</td><td class="td_notebook">(Discarded)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of P35s:EaDAcT:T35s in 2&Omega;2 with P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1</li><br />
<br />
<li>1 &mu;L P35s:EaDAcT:T35s in 2&Omega;2</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation of P35s:EaDAcT:T35s in 2&Omega;2 P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> liquid cultures (5 mL LB)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35s:GFP:p19:Tnos (Spm, Tet, Rif)</li><br />
<br />
<li>Empty C58 <i><i>Agrobacterium</i> tumefaciens</i> (Rif)</li><br />
<br />
<li>2x P35s:EaDAcT:T35s in 2&alpha;2 (Rif, Kan)</li><br />
<br />
<li>2x P35s:Atr&Delta;11:T35+P35s:HarFAR:T35 in 2&Omega;1 (Rif, Spm)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from P35s:Atr&Delta;11:T35+P35s:HarFAR:T35+P35s:EaDAcT:T35s in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR of FAO1.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: 3 reactions at different temperatures (54, 59, 64&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>1.75 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>35 &mu;L HF buffer (5x)</li><br />
<br />
<li>7 &mu;L dNTPs</li><br />
<br />
<li>8.75 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>8.75 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>1.05 &mu;L Phusion polymerase</li><br />
<br />
<li>112.7 H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">54, 59, 64</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR2: touchdown PCR</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">5 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">69.5 (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140805_PCR_FAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is not working yet. For the next time we are going to repeat the dilutions in case they weren't correctly done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR + TU EaDAcT</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we made <i>Agrobacterium</i>' culture minipreps using a different kit (We used the QIAgen Miniprep kit 250, 27106)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">FAO1 PCR was repeated (this time using a different primers aliquot). </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>FAO1-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul07)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul08)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO2-PCR1: </li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L <i>Candida tropicalis</i> genomic</li><br />
<br />
<li>10 &mu;L HF buffer (5x)</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo forward (Jul09)</li><br />
<br />
<li>2.5 &mu;L oligo reverse (Jul10)</li><br />
<br />
<li>0.5 &mu;L Phusion polymerase</li><br />
<br />
<li>32 &mu;L H20</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR temperatures, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">59 (PCR1)/ 64 (PCR2) (descending 0.5 per cycle) </td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">55 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico to check minipreps:</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">EcoRI</td><td class="td_notebook">Orange</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1</td><td class="td_notebook">BglII</td><td class="td_notebook">Orange</td><td class="td_notebook">11175, 2576</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook"><i>A. tumefaciens</i></p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">9307, 2251</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + TU HarFAR in 2&Omega;1</td><td class="td_notebook">BamHI</td><td class="td_notebook">Green</td><td class="td_notebook">6652, 4906</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">8021, 683</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU EaDAcT in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2382</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion master mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for NotI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2.5 &mu;L NotI</li><br />
<br />
<li>12.5 &mu;L Orange buffer</li><br />
<br />
<li>105 &mu;L H20</li><br />
<br />
</ul><li>Master mix for RsaI:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L NcoI</li><br />
<br />
<li>10 &mu;L Tango buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the switch part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made different mixes for <i>Agrobacterium</i> samples because we think that minipreps are not as good as it is expected.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> sample mix:</li><br />
<br />
<ul class="ul_ul_notebook"><li>0.5 &mu;L Restriction enzyme</li><br />
<br />
<li>2.5 &mu;L Buffer</li><br />
<br />
<li>5 &mu;L Miniprep sample</li><br />
<br />
<li>17 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in <i>A. tumefaciens</i>.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">FAO1 PCR product.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions and TU Atr&Delta;11+ TU HarFAR + TU EaDAcT in 2&alpha;1 were correct. PCR products were not correct or absent again. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As digestions were correct, we recultured <i>Agrobacterium</i> in new media (LB) in order to have cultures in exponential phase for tomorrow. We mix in each tube 5 mL of LB with 40 &mu;L of inoculum, XGal (2:1000), IPTG (1:1000)and the corresponding antibiotic (1:1000). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Culture</td><td class="td_notebook">Antibiotic</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:GFP:P19:TNos</td><td class="td_notebook">Spm, Tet, Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"><i>Agrobacterium</i> (as a control)</td><td class="td_notebook">Rif</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:EaDAcT:T35S</td><td class="td_notebook"> Rif, Kan</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S + P35S:HarFAR:T35S</td><td class="td_notebook">Rif, Spm</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Recultured media was grown at 28 &deg;C overnight (around 16 h).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration in <i>Nicotiana benthamiana</i>.</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
<li>TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos (x2 forth true leaves)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltration protocol consists of:</p><br />
<br />
<ul class="ul_notebook"><li>Centrifuge the cultures 15 min 3000 rpm and discard supernatant.</li><br />
<br />
<li>5 mL of agroinfiltration solution per culture. 100 mL of agroinfiltration solution were composed of 10 mL MES 100mM (pH 5.6), 1 mL MgCl2 1M and 100 &mu;L acetosyringone solution 200 mM (19.62 mg, DMSO 500 &mu;L; prepare freshly). Mix it with the vortex. If the culture is still turbid, add a bit more of agroinfiltration sollution. Put it in the (rodillos) for two hours.</li><br />
<br />
<li>Measure the OD. The optimum OD for agroinfiltration is 0.2. If it is too high adjust the concentration with more agroinfiltration solution.</li><br />
<br />
<li>Mix the cultures, keeping all of them in the same proportions.</li><br />
<br />
<li>Proceed to agroinfiltration.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In order to have a control for the FAO1 PCR, which hasn't been very successful, Jesus Munoz provided us with 4 primers and 2 clones of <i>Candida tropicalis</i> (C981 ng/&mu;L and pYEP C98 28.2 ng/&mu;L). These primers amplify for the gene HSR1.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name </td><td class="td_notebook">Sequence </td><td class="td_notebook">Tm</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">TTTGTCTTGCAACAGGTCCA</td><td class="td_notebook">56&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">ATGAGTAAGAAAAGCAACAGTACC</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">GCTGGATCCTTAGTAGTAGTGGATCAAGGAAT</td><td class="td_notebook">49&deg;C (annealing)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">CTAATTTTCTTCTTTTTCAATAGTAACTATCC</td><td class="td_notebook">51&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Possibility of primer combinations: </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">A</td><td class="td_notebook">HSR1 fw-BamHI+480</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">687</td><td class="td_notebook">49&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">C</td><td class="td_notebook">HSR1 clone Fw+1</td><td class="td_notebook">HSR1 clone RV+stop</td><td class="td_notebook">2187</td><td class="td_notebook">-</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">B</td><td class="td_notebook">HSR1 RTRv+1149</td><td class="td_notebook">HSR1 clone Fw+1 </td><td class="td_notebook">1168</td><td class="td_notebook">54&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We amplified the genomic of <i>C. tropicalis</i> and the two clones (C98 and C98 pYep)with the primer combinations A and B with Taq polymerase at 2 different temperatures (49 and 52&deg;C). C primer combination was not used due to the length of the spected band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>94&deg;C, 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C, 30 s</li><br />
<br />
<li>49 or 52&deg;C, 15 s</li><br />
<br />
<li>72&deg;C, 90 s</li><br />
<br />
</ul><li>72&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/21/20140808_pcr_HSR1%28control%29_y_genomico_C_tropicalis.png><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR products were not present. It probably did not work because we added to much buffer. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained a different plasmid (pUbiquitina HSRI-CDS col.6) as a positive control of PCR to check the quality of our Candida genome. We diluted them to obtain a final concentration of 30 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCRs wih Taq polimerase:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L Template </li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward primer</li><br />
<br />
<li>1 &mu;L Reverse primer</li><br />
<br />
<li>1 &mu;L Taq pol.</li><br />
<br />
<li>5 Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Template</td><td class="td_notebook">F primer</td><td class="td_notebook">R primer</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 RTRev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">pUbiquitina HSRI-CDS col.6</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">3</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSRI-CDS col.6</td><td class="td_notebook">HSR1 BamHI + 480</td><td class="td_notebook">HSR1 Rtrev + 1149</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">4</td><td class="td_notebook"><i>C. tropicalis</i> genome</td><td class="td_notebook">HSR1 RTRv + 1149</td><td class="td_notebook">HSR1 Fw + 1</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>94&deg;C 3 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>94&deg;C 30 s</li><br />
<br />
<li>49&deg;C 15 s</li><br />
<br />
<li>72&deg;C 90 s</li><br />
<br />
</ul><li>72&deg;C 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">We had amplification in our positive controls. Our <i>C. tropicalis</i> genome may be wrong. Therefore Jes&uacute;s Mu&ntilde;oz provided us with a new <i>Candida tropicalis</i> (NCYC 2512) culture and also a culture from a Candida tropicales genoteque made in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PHEROMONE ANALYSIS</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">PONER ENLACE DE LA WIKI</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To begin with samples were obtained from the agroinfiltrated plants after 5 days. We collected 9 samples:</p><br />
<br />
<ul class="ul_notebook"><li>2 leaves from P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>2 leaves from TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
<li>1 leaf from a wild type plant</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Each sample was stored in a vial and kept in liquid nitrogen. Leaves were mashed using a mortar and liquid nitrogen until powder from each leaf is obtained and stored in a vial .Samples must be always kept in liquid nitrogen or in a -80&deg;C freezer . Afterwards the leaf powder was weighted and introduced in a 10 mL screwcap headspace vial.</p><br />
<br />
<ul class="ul_notebook"><li>94,6 mg of P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>97,0 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>118,7 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>100,0 mg of wild type leaf</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Then 150 &mu;L of EDTA 500mM and 1 mL of a saturated solution of CaCl2 (5,7M) were added to each vial.</p><br />
<br />
<br />
<br />
<p class="p_notebook">EDTA 500mM preparation:</p><br />
<br />
<p class="p_notebook">Stock of solid EDTA Di-Sodium 372,24 Mw and a final solution of 50 mL, 500mM. 372,24*0,5*0,05=9,306 g in 50 mL.</p><br />
<br />
<br />
<br />
<p class="p_notebook">After the addition of EDTA and CaCl2 the samples were sonicated dutring 5 minutes to disgregate the tissue and release the volatile compounds. Afterwards the samples were analysed by GC-MC following this procedure.</p><br />
<br />
</br><h4 class="date_notebook">PONER LOS PASOS QUE SIGUE EL PARATO, provided by JOSE LUIS MAS ADELANTE: el protocolo entero est\E1 en la carpeta de protocolos como volatile analysis protocol</h4><br />
<br />
<p class="p_notebook">Analysis was performed overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">First results of the analysis were obtained. The analysis proved that our plant was successfuly producing the desired pheromones in high concentration. As expected z-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate were being produced and also unexpectedly the z-11-hexadecenal. </p><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<br />
<br />
<p class="p_notebook">As shown in the figure, the leaf agroinfiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (represented in black) shows a successful production of (Z)-11-hexadecen-1-ol compared with the negative control that only has P35s:GFP:P19:Tnos (represented in blue) and shows no expression. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/6/66/20140812_IMAGEN_cromatogramas_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this figure, expression of (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate is proved. The expression in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos is represented in black, and the negative control with P35s:GFP:P19:Tnos is represented in blue.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9a/20140812_IMAGEN_cromatogramas_7.png><br />
<br />
<p class="p_notebook">In this figure, an unexprected peak present in the leaf infiltrated with TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos (black) can be observed. Comparing its spectrum with the one provided from the database seems to be (z)-11-hexadecenal, a desired pheromone, which is being produced by the plant itself using an endogenous alcohol oxidase. Nevertheless as it is produced with a low yield, the FAO1 of <i>C. tropicalis</i> search is still in progress.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The rest of the samples were prepared for the GC-MS analysis.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The samples were weighted, introduced in the vial and added with EDTA and CaCl2.</p><br />
<br />
<ul class="ul_notebook"><li>94,0 mg of P35s:GFP:P19:Tnos leaf (replica 2)</li><br />
<br />
<li>102,4 mg of TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos leaf (replica 1)</li><br />
<br />
<li>92,0 mg of TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos leaf(replica 2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Results of the replicae analysis are shown below:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/48/20140812_IMAGEN_cromatogramas_1.png><br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and P35s:GFP:P19:Tnos construction shows a huge production of (z)-11-hexadecen-1-ol.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/fa/20140813_IMAGEN_CROMATOGRAMA_3.png><br />
<br />
<br />
<br />
<p class="p_notebook">In this replica, the sample with the TU Atr&Delta;11+TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos shows a higher abundance of (z)-11-hexadecen-1-ol and z-11-hexadecen-1-ol acetate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">In order to verify that the analysed compounds are the desired pheromones, we acquired standards for (z)-11-hexadecen-1-ol and (z)-11-hexadecen-1-ol acetate and (z)-11-hexadecenal, and indeed, the analysed compunds were the right ones.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Our happiness reached a peak!! A PEAK!</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had problems to amplify the FAO1 gene, so in order to obtain it we performed a colony PCR. Using this method, it is possible to amplify a fragment directly from a colony rather than a DNA sample. </p><br />
<br />
<p class="p_notebook">We made two different PCRs, one of them as a positive control and the other one to amplify our disered DNA fragment.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colony PCR protocol (Taq Polimerase):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1.5 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Forward Primer </li><br />
<br />
<li>1 &mu;L Reverse Primer</li><br />
<br />
<li>1 &mu;L Taq Polimerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>39.5 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Primers used as a control: HSR1 + 480 and RTRv + 1149.</p><br />
<br />
<p class="p_notebook">Primers used to amplify FAO1 gene: iGEMJUL07_FAO1_1F and iGEMJUL08_FAO1_1R. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Thermocycler conditions, 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Starting from an agar plate containing a Candida genomic library, we add 1 mL of LB medium and we mix it. Then, the mix was transferred into a tube. We stored part of the culture in glycerine and another part (200 &mu;L) was mixed with 5 mL of LB media and Amp (2:1000). </p><br />
<br />
<p class="p_notebook">The tube containing the genomic library was grown at 28&deg;C for 1 hour. Then, we made minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/9/95/20140814_colony_pcr_y_BBSI_test.png"><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that the colony PCR failed, even the control did not work. Additionally, we test the BbsI restriction enzyme and we found that it does not cut well. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the whole pathway (P35S:Atr&Delta;11:T35S, P35S:HarFAR:T35S, P35S:EaDAcT:T35S in 2&alpha;1) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) during 2 days at 28&deg;C. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the colony PCR to obtain FAO1 gene and also control PCRs (using the genomic library minipreps made on 08/14/2014).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Colony PCR 1 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Colony PCR 2:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 colony (<i>C. tropicalis</i>)</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 3 (control):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 BamHI + 480 </li><br />
<br />
<li>1 &mu;L HSR1 RTRv + 1149 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>genomic library PCR 4:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L C. tropicallis genomic library miniprep </li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09 </li><br />
<br />
<li>1 &mu;L iGEMJul10 </li><br />
<br />
<li>1 &mu;L Tap pol.</li><br />
<br />
<li>5 &mu;L Buffer 10x</li><br />
<br />
<li>39 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions were the same as those used on 08/14/2014</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400"src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We were trying to obtain the FAO1 gene. We did a yeast colony PCR. Using an sterile tip, we picked one <i>C. tropicalis</i> colony and we introduced them into a vial containing 30 &mu;L SDS 0.2 %. The vial was vortexed 15 seconds and then heated 4 minutes at 90&deg;C. Next, it was centrifuged during 1 minute ans the supernatant was transferred to a new 1.5 &mu;L vial. That was our PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed a control PCR employing control primers (HSRI Rtrv + 1149 and HSRI BamHI + 480)and the another PCR using FAO1 primers as previously done (iGEMJul09 and iGEMJul10).</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions using Phusion polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">5 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/a7/20140820_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not close the PCR tube properly so we found our PCR product evaporated (named as FAO in the gel). The other PCR product (the control) was loaded and as it is shown in the gel electrophoresis, it didn't work. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again a yeast genomic extraction (<i>C. tropicalis</i>), but this time we changed the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Pick 8 colonies of <i>C. tropicalis</i> growth in YPD media and resuspend them with 100 &mu;L of solution (200 mM LiOAc and SDS 1%). </li><br />
<br />
<li>Incubate 15 min at 70&deg;C.</li><br />
<br />
<li>Add 300 &mu;L of ethanol 96%. Then, vortex the solution.</li><br />
<br />
<li>Centrifuge 3 min at 15000 xg.</li><br />
<br />
<li>Discard the superatant and resuspend the pellet (precipitated DNA) with 100 &mu;L TE.</li><br />
<br />
<li>Centrifuge 1 min at 15000 xg. </li><br />
<br />
<li>Recover 1 &mu;L of supernatant. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Using this genomic DNA as a template, we run a PCR (using Taq polimerase) with our primers and another one as a control. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Control PCR:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L template</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L HSR1 clone Fw+1 </li><br />
<br />
<li>1 &mu;L HSR1 Rtrv + 1149</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>FAO1 PCR</li><br />
<br />
<li>1 &mu;L template</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L iGEMJul09_FAO1_PCR2F</li><br />
<br />
<li>1 &mu;L iGEMJul10_FAO1_PCR2R</li><br />
<br />
<li>&mu;L Taq polimerase </li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR parameters (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">90 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the FAO1 colony PCR using a <i>C. tropicalis</i> genomic library in <i>E. coli</i>. We made 3 PCRs employing HSR1 primers and other 3 PCRs using our iGEM primers as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR 1 (Annealing temperature 49&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 Fw_BamHI+480 </li><br />
<br />
<li>HSR1 RTRv+1149</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 2 and 3 (Annealing temperature 54&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>HSR1 clone Fw+1 </li><br />
<br />
<li>HSR1 RTRv+1149 </li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 4 and 5 (Annealing temperature 50&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul07 </li><br />
<br />
<li>iGEMJul08</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCR 6 (Annealing temperature 56&deg;C)</li><br />
<br />
<ul class="ul_ul_notebook"><li>iGEMJul09 </li><br />
<br />
<li>iGEMJul10</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">PCR conditions with Taq polimerase (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">30 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">49</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/ac/20140825_pcps2_ta29_atr.png><br />
<br />
<br />
<br />
<p class="p_notebook">The electrophoresis gel shows that PCRs have not yielded any product.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We grown pieces from the GB collection in liquid medium:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of GB parts and we recultured them in liquid media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We cultured <i>C. tropicalis</i> in liquid media in order to make a genomic extraction to finally obtain FAO1 gene and we made YPD media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB parts:</li><br />
<br />
<ul class="ul_ul_notebook"><li>GB0490 2&Omega;2R</li><br />
<br />
<li>GB0160 P35S:Renilla:TNos_P35S:P19:TNos</li><br />
<br />
<li>GB0486 2&alpha;2R</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0490 NotI</td><td class="td_notebook">4453, 1532, 1290</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0160</td><td class="td_notebook">HindIII</td><td class="td_notebook">4090, 2579, 788</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4601, 2475, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0486</td><td class="td_notebook">NotI</td><td class="td_notebook">4124, 1532, 1290</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">GB parts were correct except GB0160, which has to be repeated since we digest low DNA concentration. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again a genomic extraction (<i>C. tropicalis</i>) following the same protocols. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated GB0160 digestions and we found that the piece is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We observed agroinfiltered leaves and we took samples of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored liquid media cultured on 08/28/2014 in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies in order to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps again to check our strikes, since we suspect that we have contamination in SF_P35S:EaDAcT:T35(2&Omega;2) agar plates and we want to store it in glycerol correctly. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35S:EaDAcT:T35</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1044, 817 683</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">8806, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain the expected bands, we will try again picking another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and the expected digestion's result was:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35:EaDacT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were not correct. We will keep trying.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the following TU:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>P35S:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Cultures were grown at 28&deg;C during 2 days.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction SF_P35S:EaDAcT:T35S in 2&Omega;2 in glycerol, we picked some colonies and cultured them in liquid media. We repeated the miniprep again to be sure that we are storing it correctly. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Note: Go to 09/16/2014</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we agroinfiltrated the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S coinfiltrated with P35S:EaDAcT:T35S and P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltrated with P35S:P19:GFP:TNos</li><br />
<br />
<li>P35S:P19:GFP:TNos (in this case without vaccum pump, it was agroinfiltrated with syringe)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The protocol followed was the same as usually, but this time using a vacuum pump and a desiccator instead of a syringe.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured A. tumefacies with P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in new liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Additional digestions that were still pending from 09/12:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">SF_P35SEaDAcT</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6600, 1000, 800, 700</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8800, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= "https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (as a control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S (all enzymes in one construct) </li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S and P35S:EaDAcT:T35S (coinfiltrated enzyme constucts)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They did not present necrosis as the previous time, but chlorosis was seen in both agorinfiltered plants.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We refreshed <i>A. tumefaciens</i> cultures to agroinfilter <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were injected to GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S with P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We performed an EAG. Antennae responded to the pheromone.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We agroinfiltred <i>N. benthamiana</i> plants following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the EAG with other Sesamia individuals. We saw a peak corresponding to the alcohol pheromone (Z11-16:OH) and the acetate pheromone (Z11-16:OAc). </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Expression_in_trichomes"></a></br></br><h3 class="section_notebook">Expression in trichomes</h3></br><h4 class="date_notebook">07/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Genomic DNA extraction from Nicotiana tabacum. We need the genome of this organism because we want to obtain the trichome promoter from the NtCPS2 gene.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Obtain 100 mg of the tobacco leaves (5 disks made with a 1.5 mL vial). Made it twice.</li><br />
<br />
<li>Introduce the disks inside the tube.</li><br />
<br />
<li>Introduce the two tubes in liquid nitrogen.</li><br />
<br />
<li>Remove them from the liquid nitrogen and store at -80&deg;C until use.</li><br />
<br />
<li>Remove one tube from -80&deg;C and re-introduce them in liquid nitrogen. </li><br />
<br />
<li>Grind the disks.</li><br />
<br />
<li>Add 600 &mu;L of CTAB (2%) buffer (pre-heat at 65&deg;C.)</li><br />
<br />
<li>Grind the mixture.</li><br />
<br />
<li>Add RNAse (1.6 &mu;L at M = 100 ug/&mu;L for each mL of CTAB buffer). </li><br />
<br />
<li>Vortex it and maintain at 65&deg;C for 45 min. Mix it by inversion 5-15 min.</li><br />
<br />
<li>Add 600 &mu;L cloroform:isoamilic alcohol. Vortex it.</li><br />
<br />
<li>Centrifuge 15 min at 13000 rpm (or 10 min at 14500 rpm.</li><br />
<br />
<li>Recover the supernatant by aspiration (with a 200 &mu;L pipet).</li><br />
<br />
<li>Repeat the last three steps.</li><br />
<br />
<li>Add one volume o isopropanol and mix well by inversion (10 times). </li><br />
<br />
<li>To precipitate, maintain 20 min on ice or at -80&deg;C during 5 min.</li><br />
<br />
<li>Centrifuge 10 min at 13000 rpm (4&deg;C).</li><br />
<br />
<li>Discard the supernatant by decantation (be carefull with the pellet).</li><br />
<br />
<li>Wash with 600 &mu;L ethanol (80%).</li><br />
<br />
<li>Centrifuge 5 min at 13000 rpm. </li><br />
<br />
<li>Discard the ethanol by pipeting and let it dry a few minutes. </li><br />
<br />
<li>Resuspend it in 50-100 &mu;L H2O miliQ or with TE buffer.</li><br />
<br />
<li>Store at -20&deg;C. </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Measurement of genomic concentration with nanodrop.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Tabacco 1: 182 ng/&mu;L (Thrown away)</li><br />
<br />
<li>Tabacco 2: 620 ng/&mu;L (Stored at -20&deg;C)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Electrophoresis performed to check the genomic size of tobacco (to see if it is degradated).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/5/5e/20140703_extraccion_genomico_tobacco.png><br />
<br />
<br />
<br />
<p class="p_notebook">It is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">PCR of genomic extraction of tobacco in order to amplify the trichome promoter CPS2.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ordered primers</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJULO1</li><br />
<br />
<li>IGEMJULO2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ajust primers to a 100 uM concentration:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>IGEMJUL01 + 566 &mu;L miliQ H2O</li><br />
<br />
<li>IGEMJUL02 + 691 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Use a 1:10 alicuot for PCR (10 uM).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Reagents needed for PCR:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.5 &mu;L template</li><br />
<br />
<li>10 &mu;L buffer HF 5x</li><br />
<br />
<li>2 &mu;L dNTPs</li><br />
<br />
<li>2.5 &mu;L oligo R</li><br />
<br />
<li>2.5 &mu;L oligo F</li><br />
<br />
<li>0.5 &mu;L Pfu</li><br />
<br />
<li>32 &mu;L miliQ H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 50 &mu;L</p><br />
<br />
<br />
<br />
<p class="p_notebook">Parameters:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/dd/20140710_productoPCR_tricomas.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR with different parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">1 </td><td class="td_notebook">2 </td><td class="td_notebook">3 </td><td class="td_notebook">4 </td><td class="td_notebook">5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td><td class="td_notebook">32 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">1, 2 and 5 contain buffer F; 3 and 4 contain buffer GC.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR parameters</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>1, 3, 5 -> 59 &deg;C (15 sec). 2, 4 -> 55 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/4/40/20140711_productoPCR_tricomas_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with other parameters.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"> </td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">2 &mu;L</td><td class="td_notebook">2 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">40 &mu;L</td><td class="td_notebook">40 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">8 &mu;L</td><td class="td_notebook">8 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2</td><td class="td_notebook">2 &mu;L &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">128 &mu;L</td><td class="td_notebook">128 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Set 4 tubes with each buffer at different temperatures: 49, 52, 55, 60.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (2 min)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>49, 52, 55, 60 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (7 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/7e/20140711_productoPCR_tricomas_segunda_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">No PCR products again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat PCR again with more genomic.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">Buffer HF </td><td class="td_notebook">Buffer GC</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">5 &mu;L</td><td class="td_notebook">5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer (5x)</td><td class="td_notebook">50 &mu;L</td><td class="td_notebook">50 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">10 &mu;L</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F</td><td class="td_notebook">12.5 &mu;L</td><td class="td_notebook">12.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phu</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer</td><td class="td_notebook">107.5 &mu;L</td><td class="td_notebook">107.5 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Same parameters as before except annealing temperatures which are: 50, 53, 57, 59 &deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/3/3a/20140714_productoPCR_tricomas_tercera_repeticion.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still without having any amplification.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Repeat the PCR with other enzyme.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12.5 &mu;L Q5 Master mix (2x).</li><br />
<br />
<li>1.25 &mu;L forward primer 10 uM</li><br />
<br />
<li>1.25 &mu;L reverse primer 10 uM</li><br />
<br />
<li>0.5 &mu;L template 620 ng/&mu;L</li><br />
<br />
<li>9.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set 4 reactions at 50, 53, 55, 59 &deg;C.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>98 &deg;C (30 sec)</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98 &deg;C (10 sec)</li><br />
<br />
<li>50, 53, 55, 59 &deg;C (15 sec)</li><br />
<br />
<li>72 &deg;C (45 sec)</li><br />
<br />
</ul><li>72 &deg;C (2 min)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/74/20140714_productoPCR_tricomas_cuarta_repeticion_BUENA.png><br />
<br />
<br />
<br />
<p class="p_notebook">The DNA fragment of interest is around 1.5 kb so we see we finally obtained amplification at 55 and 59 &deg;C reactions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome promoter PCR product ligation in pUPD.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L PCR product</li><br />
<br />
<li>1 &mu;L BsmBI (5-10 ud)</li><br />
<br />
<li>1 &mu;L T4 ligase (5-10 ud)</li><br />
<br />
<li>1.2 &mu;L buffer ligase (3 ud)</li><br />
<br />
<li>6.8 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Set the reaction: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transform and grow in Petri dishes yesterday's ligation of the trichome promoter in pUPD.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of the trichome promoter in pUPD and grown it in liquid culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture. Additionally, we have recultured them in solid growth media. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep quantification:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">1</td><td class="td_notebook">317.1</td><td class="td_notebook">26</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome promoter in pUPD</td><td class="td_notebook">3</td><td class="td_notebook">354.8</td><td class="td_notebook">32</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Both minipreps were adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Trichome Promoter in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1523</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">3942, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Note: To see further details of digestion master mixes, go to the biosynthesis part, date 07/22/2014.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>pTnos (GB0037)</li><br />
<br />
<li>pGFP (GB0059)</li><br />
<br />
<li>pLuciferase (GB0096)</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's digestions were correct, so the trichome promoter in pUPD was send to sequencing.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Results of sequencing the promoter were obtained:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Mutation</td><td class="td_notebook">Position</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T insertion</td><td class="td_notebook">??</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of pTnos, pGFP and pLuciferase.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Concentration (ng/&mu;L)</td><td class="td_notebook">Initial Volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">318.8</td><td class="td_notebook">35</td><td class="td_notebook">148.8</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Tnos</td><td class="td_notebook">400.8</td><td class="td_notebook">35</td><td class="td_notebook">186.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">pLuciferase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 1731</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following table shows ligation details of the trichome promoter:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">Volume</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GFP</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TNos</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BsaI</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">p2&alpha;2</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T4 ligase</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ligase buffer</td><td class="td_notebook">1 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">3 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Total Volume</td><td class="td_notebook">10 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Trichome Promoter transformation in <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Using an electrocompetent <i>E. coli</i> strain (DH5&alpha;) and 1.5 ul ligation (CPS2:GFP:TNos in 2&alpha;2), the mix is electroporated at 1500 V. Then, 300 &mu;L of SOC are added and stored at 37 &deg;C with agitation. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of CPS2:GFP:TNos in 2&alpha;2.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made, obtaining the transcripional unit: PCPS2:GFP:TNos in 2 &alpha;2</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we recultured in petri dish with its respective antibiotic (Kan).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Digestion mixes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Master mix for EcoRV:</li><br />
<br />
<ul class="ul_ul_notebook"><li>3 &mu;L EcoRV</li><br />
<br />
<li>15 &mu;L Red buffer</li><br />
<br />
<li>126 &mu;L H20</li><br />
<br />
</ul><li>Master mix for HindIII:</li><br />
<br />
<ul class="ul_ul_notebook"><li>2 &mu;L HindIII</li><br />
<br />
<li>10 &mu;L Red buffer</li><br />
<br />
<li>84 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Note: We made master mixes because digestions were made simultaneously with the biosynthesis part. </p><br />
<br />
<br />
<br />
<p class="p_notebook">An agarose gel was made to check the transcriptional unit:</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/af/20140731_minipreps_eadact_en_2alpha2_y_ptricomas-GFP-tnos_en_2omega2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of CPS2:GFP:TNos in 2&alpha;2 (1) went correctly.</p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep results were quantified and then adjusted at 75 ng/&mu;L:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Tube</td><td class="td_notebook">Concentration (ug/&mu;L)</td><td class="td_notebook">Initial volume (&mu;L)</td><td class="td_notebook">Final Volume (&mu;L)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">1</td><td class="td_notebook">128.5</td><td class="td_notebook">33</td><td class="td_notebook">56.5</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">2</td><td class="td_notebook">135.9</td><td class="td_notebook">34</td><td class="td_notebook">61.6</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:GFP:TNos in 2&alpha;2</td><td class="td_notebook">3</td><td class="td_notebook">126.2</td><td class="td_notebook">35</td><td class="td_notebook">58.9</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Transcriptional Unit (TU) PCPS2:GFP:TNos in 2&alpha;2 was transformed in <i><i>Agrobacterium</i> tumefaciens</i> (C58) and cultured in liquid media with Kan and Rif at 1:1000 (2 days at 28&deg;C).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: The scientific name has been updated to Rhizobium radiobacter. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The TU (PCPS2:GFP:TNos) was recultured in liquid media. Additionally, P35S:GFP:p19:TNos TU was recultured in liquid media, using Spm and Rif as antibiotics.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cultures were refreshed in new liquid media. Additionally, we cultured them in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of the TU PCPS2:GFP:TNos in <i>Agrobacterium</i> were made. and digestions were performed to check they were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico performed to check the insertion:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2694</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">EcoRV</td><td class="td_notebook">8454, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/e2/20140811_pcr_FAO1%2C_controles_%2B%2C_digestiones_agro_PTric.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:GFP:TNos (1) digestion was correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">A part containing P35S:P19:TNos construction was taken from the GoldenBraid collection (GB108) and cultured in solid media with Kanamycin 50 mg/mL. This part is not going to be used as a control but as a silencing supressor.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">One clony (P35S:P19:TNos) was recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and streaks of yesterday's culture were made.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The piece was checked by running a gel containing the digested fragment. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:P19:TNos</td><td class="td_notebook">BanI</td><td class="td_notebook">4256, 392</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">788, 1287, 2563</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The GB108 piece (P35S:P19:TNos) is digested as expected in silico. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed the piece (P35S:P19:T35S) into <i><i>Agrobacterium</i> tumefaciens</i> (C58) and we cultured it in solid media with Kan (1:1000) and Rif (1:1000) at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> containing the piece has not growm well, so we transformed the piece again and we cultured it in an agar plate following the same protocol as previously. In the mean time, we made agar plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of the three enzymes that form the (Z)11-16:OAc (Z11-hexadecenyl acetate) pheromone but this time each TU will contain the trichome promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Note: For further information about the PCPS2 promoter, please check the trichome promoter section. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:HarFAR:T35S and PCPS2:EaDAcT:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Atr&Delta;11/EaDAcT</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU containing the trichome promoter were transformed into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> has not grown in agarose plates, so we made a transformation again.</p><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TUs were recultured in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8448</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2687, 6323</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:HarFAR:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">933, 2140, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">562, 8833</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">2800, 6322</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7363, 1197, 562</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<img class="img_notebook" width="250px" src= https://static.igem.org/mediawiki/2014/1/1e/20140820_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, but the PCPS2:HarFAR:T35S digestion 1 with HindIII resulted in more bands than expected, so we discarded that miniprep product and we used the other one. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We adjusted checked products to 75 ng/&mu;L in order to use them in ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the TUs containing the trichome promoter in &Omega; vectors as follows:</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<ul class="ul_notebook"><li>Ligation 1 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S</li><br />
<br />
<li>1 &mu;L PCPS2:HarFAR:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>Ligation 2 (Vt = 10 &mu;L):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L SF (Stuffer fragment)</li><br />
<br />
<li>1 &mu;L PCPS2:EaDAcT:T35S</li><br />
<br />
<li>1 &mu;L 2&Omega;2</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O miliQ</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we recultured <i>E. coli</i> in solid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">TUs ligated previously were transformed in <i>E. coli</i> following the same protocol as it is usually used. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we obtained the control (Z)11-16Hexadecenl Acetate that will be used to check the peack in the GC-MS analysis. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>Agrobacterium</i> cells containing P35S:P19:TNos did not grow, so we ask Marta for the glycerinated <i>Agrobacterium</i> culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The vector containing the TU was pGreen and we cultured them with Tetracycline, Rifampicin and Kanamycin. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We have confirmed our peak because the control sample has the same retention time and distribution pattern. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we have recultured in liquid media TUs ligated yesterday. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico made to check minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>Agrobacterium</i> the following TUs:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We made minipreps of <i>Agrobacterium</i> culture: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we refreshed <i>Agrobacterium</i> cultures with their corresponding antibiotic:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos (Rif, Kan, Tet)</li><br />
<br />
<li>PCPS2:GFP:TNos (Rif, Kan)</li><br />
<br />
<li>T35S:P19:GFP:TNos (Rif, Smp, Tet)</li><br />
<br />
<li>TUs: P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S in 2&alpha;1 (Rif, Kan)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made to check yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</td><td class="td_notebook">EcoRI</td><td class="td_notebook">7428, 6323</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">2576, 11175</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the Agroinfiltration protocol, but this time we infiltrated the following <i>A. tumefaciens</i> cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>T35S:P19:TNos </li><br />
<br />
<li>PCPS2:GFP:TNos + T35S:P19:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos</li><br />
<br />
<li>T35S:P19:GFP:TNos + P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_P35S:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies which were transformed yesterday and we recultured them in liquid media with Spm, IPTG and X-Gal. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have trasplanted <i>N. benthamiana</i> into new flowerpots to have plants ready to infiltrate in the future. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, but only for the TU PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1 since the other tubes were blue colored. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico the check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPSS:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/f1/20140826_Atr_%2B_Har.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, that is why we repeated TU ligations:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S 2&Omega;1</li><br />
<br />
<li>PCPS2:EaDAcT:T35S 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligations.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates containing the transformants and we recutured them in liquid media with Spm (1:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's liquid culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TUs with trichome promoter:</li><br />
<br />
<ul class="ul_ul_notebook"><li>PCPS2:EaDAcT:T35S (2&Omega;2)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S (2&Omega;1)</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8131, 2669, 1594</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:EaDAcT:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 1197, 817, 562, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8241, 1373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S was correct and PCPS2:EaDAcT:T35S tubes 1 and 3 were also correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked PCPS2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made a ligation as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1 (Total Volume = 10 &mu;L)</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>1 &mu;L SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>3.5 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol followed was the same as previously done.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the previous ligation and we recultured cells in an agar plate.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we transformed into <i>Agrobacterium</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">On the other hand, we observed the leaves agroinfiltred this week and we took pictures showing that the trichome promoter works. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/2f/PCPS2_2.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained trichome selective expression of GFP! </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored PCPS2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S:SF_P35S:EaDAcT:T35S liquid media.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR + EaDAcT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="700px" src= https://static.igem.org/mediawiki/2014/b/b5/2014091_BB_y_Ruta_entera.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we have to repeat the ligation. We repeated it following the same protocol.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltrated samples and we prepared them to the analysis following the same protocol as we did the last time.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we picked colonies and recultured them in liquid media in order to store them in glicerol.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S in 2&alpha;1</li><br />
<br />
<li>PCPS2:HarFAR:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:EaDAcT:T35S in 2&alpha;2</li><br />
<br />
<li>PCPS2:GFP:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We stored in glycerol at -80&deg;C cultures grown yesterday:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Add 300 &mu;L glycerol (50%) and 700 &mu;L of liquid culture.</li><br />
<br />
<li>Mix it well using vortex.</li><br />
<br />
<li>Store at -80&deg;C.</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and we cultured cells in agar plates.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation was repeated since we did not found any white colony in the agar plates. Ligation Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. We followed the same protocol again.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>Agrobacterium</i> colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2&Omega;1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
<li>TNos:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 Atr&Delta;11 + HarFAR</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 5742</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">9572, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2 EaDAcT</td><td class="td_notebook">NotI</td><td class="td_notebook">6792, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">7125, 2419</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="600px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except digestions from one miniprep (SF_PCPS2:EaDAcT:T35S). We had two replicates and only one of them was incorrect, so we could refresh the cultures with liquid media in order to follow the agroinfiltration protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the previously explained agroinfiltration protocol, we agroinfiltrated <i>N. benthamiana</i> with:</p><br />
<br />
<ul class="ul_notebook"><li><i>Agrobacterium</i> control culture P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and P35s:GFP:P19:Tnos </li><br />
<br />
<li>TU Atr&Delta;11 + TU HarFAR and TU EaDAcT and P35s:GFP:P19:Tnos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of colonies transformated yesterday with TU Atr&Delta;11 + TU HarFar + TU EaDAcT.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S in 2mega1</li><br />
<br />
<li>SF_PCPS2:EaDAcT:T35S in 2&Omega;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Result analysis:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Samples were checked by GC-MS and we found low pheromone signal. I may be due to agroinfiltered leaves showed necrosis. We have to repeat the experiment to confirm that our construction is not well tolerated by plants. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we found that the alcohol precursor did not appear in the chromatogram. Nevertheless, the acetate product was present in higher quantities than the previous time, suggesting that higher yields can be obtained when the three gens are placed in the same construction. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies picked yesterday were not correct since resulting cultures were blue. We repeated the ligation, but this time we added 1 &mu;L of BsaI enzyme after the inactivation step. It was incubated at 37&deg;C during 1 hour. Then we transformed the ligation and cultured it in agar plates. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of yesterday's agar plates in order to do minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of cultures containing the TU (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TU Atr&Delta;11 + HarFAR + EaDacT</td><td class="td_notebook">XhoI</td><td class="td_notebook">9121, 3215, 2069</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We trasformed the previous plasmid to <i>A. tumefaciens</i> following the same protocol as usually. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltered samples were collected following the usual procedure:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S coinfiltered with P35S:P19:GFP:TNos and PCPS2:EaDAcT</li><br />
<br />
<li>P35S:P19:GFP:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">They were grinded up with liquid nitrogen and then stored at -80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">To store our constructions in glycerol, we picked some colonies and cultured them in liquid media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We are going to do the miniprep again to be sure that we are storing it correctly.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies of <i>A. tumefaciens</i> containing the pheromone pathway with trichome promoter (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We have recultured <i>A. tumefaciens</i> containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies once again to store the cultures in glycerol, since we did a mistake and minipreps were thrown away:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We prepared samples to inject them in GC-MS following the same protocol as previously carried out, that is to say, grinding samples with liquid nitrogen, adding saturated CaCl2 and EDTA and sonicating.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have digested <i>A. tumefaciens</i> minipreps (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_P35S:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's <i>E. coli</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/68/20140912_Pathway_complete.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digetions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media <i>A. tumefaciens</i> with PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions that were still pending from 09/12.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/28/20140916_ge_pieces_AcPathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, so we picked again to repeat minipreps.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtined the expected bands in case of the pathway regulated by the PCPS2 promoter. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again the ligation in 2&alpha;1 employing the same conditions. Then, we inactivated the enzyme by incubation at 80&deg;C uring 30 min. After that, we added BsaI in order to prevent the growth of blue colonies in the agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">In parallel, we used the miniprep to transform the construction into <i>E. coli</i>. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured <i>A. tumefaciens</i> cutures to agroinfiltrate. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the protocol we agroinfiltrated the following mixtures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with PCPS2:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies of transformants containing the pathway with the trichome promoter and they seem correct since they are white. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S in 2&alpha;1)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</td><td class="td_notebook">XhoI</td><td class="td_notebook">9122, 3215, 2669</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">8682, 6323</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We have transformed on <i>E. coli</i> ligation made yesterday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltered <i>N. benthamiana</i> leaf samples. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:GFP:TNos (control)</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:GFP:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were freezed with liquid nitrogen and grinded. Then, there were stored at -80&deg;C. Some of the samples were analyzed by CEQA.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies containing the TU to agroinfilter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltered <i>N. benthamiana</i> leaves. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Collected samples of previos experiments were analysed GC-MS, following the same procedure as usually:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained a peak corresponding to the ester compound (Z11-16:OAc.) when the P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S construct was expressed in the leaf. We also obtained a big peak of the alcohol (Z11-16:OH).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed new samples of agroinfiltrated leaves in GC-MS (samples were prepared following the same protocol as previously):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We obtained similar results.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Following the same protocol as usually, we agroinfiltred the following cultures:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Additionally, we recultured the same cultures and grown them at 28&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated A. digestions because we did not make streakes:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S</li><br />
<br />
<li>PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="450" src= https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in new media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S </li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S </li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We test the extracts with moths, but unfortunatelly the insects were not active, so they did not react to any stimulus.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We analysed our plants using the method called Volatile Organic Compounds (VOCs). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Following the agroinfiltration protocol we agroinfiltrated:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Atr&Delta;11:T35S_P35S:HarFAR:T35S_SF_P35S:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
<li>PCPS2:Atr&Delta;11:T35S_PCPS2:HarFAR:T35S_SF_PCPS2:EaDAcT:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We coleected agroinfiltred samples from the previou days following the protocol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We collected agroinfiltred leaf samples. </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<a name="Biosafety_module"></a></br></br><h3 class="section_notebook">Biosafety module</h3></br><h4 class="date_notebook">07/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pieces taken from the GoldenBraid 2.0 collection were cultured in solid growth media:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Rosea:TNos</li><br />
<br />
<li>TA29:Barnase:TNos (from GoldenBraid 1.0 collection)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We were told by our advisor that Rosea produces necrosis in <i>N. benthamiana</i>, so we must think of an alternative.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies from P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of P35S:Rosea:TNos and TA29:Barnase:TNos.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico made for checking yesterday's minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Rosea:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2495, 2302</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">4407, 390</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29:Barnase:Tnos</td><td class="td_notebook">BglII</td><td class="td_notebook">2825, 2245</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">See master mix and gel digestion in Biosynthesis part. Pieces were obtained correctly and adjusted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We talked with the NRP-UEA-Norwich team. We stablished a possible collaboration in developing the biosafety module together. They could send us their chromoproteins and we could send them our barnase and TA29 promoter.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Order primers for TA29 and barnase:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Name</td><td class="td_notebook">Sequence</td><td class="td_notebook">T annealing</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago01_TA29_F1</td><td class="td_notebook">CGCCGTCTCGCTCGGGAGTAGCGAATGCAATTAATTTAGACAT</td><td class="td_notebook">61.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago02_TA29_R1</td><td class="td_notebook">CGCCGTCTCGCTCGCATTTTTAGCTAATTTCTTTAAGTAAAAACTTTG</td><td class="td_notebook">60.8&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago03_barnase_F1</td><td class="td_notebook">CGCCGTCTCGCTCGAATGGCACAGGTTATCAACACG</td><td class="td_notebook">65.0&deg;C</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">I14Ago04_barnase_R1</td><td class="td_notebook">CGCCGTCTCGCTCGAAGCTTATCTGATTTTTGTAAAGGTCTGATAATG</td><td class="td_notebook">63.4&deg;C</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Primers received. PCR for barnase and TA29 performed.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29 PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>60&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul><li>Barnase PCR parameters</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<li>98&deg;C, 10 s</li><br />
<br />
<li>63&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
<li>72&deg;C, 7 min</li><br />
<br />
</ul></ul><br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product. There is a band for the barnase, but it should be around 330 bp.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src="https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Results obtained are the same of yesterday's. We should think about charging something else.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We forgot to adjust the TA29:Barnase:Tnos from GB 1.0 to 5 ng/&mu;L. Maybe that's why PCRs don't work. We repeated again with the appropiate temperatures (60&deg;C for TA29 and 63&deg;C for barnase), but it still doesn't work!</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src="https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png"><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed in <i>E. coli</i> the iGEM Barnase part (BBa_1716211), placed in Plate 3, 11o.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A PCR using Nicotiana tobacum genome as a template was made to obtain the Ta29 fragment. Primers used and also PCR conditions were the same as previous PCRs. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="300" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the iGEM Barnase part (BBa_I716.211) were recultured in liquid media.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and to check them we made digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 357</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BamHI</td><td class="td_notebook">1558, 845</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="402" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct, so we adjusted the product to 5 ng/&mu;L in order to use them as a PCR template. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Adittionally, we made a ligation to obtain the TA29 piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H2O miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a mistake predicting digetions in silico, so we repeated them, this time with the appropriate vector (pSB1C3). </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">EcoRI and PstI</td><td class="td_notebook">2029, 374</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">This double digestion was checked with an agarose gel showing that the resulting bands were the expected ones.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, TA29 in pUPD vector was transformed in <i>E. coli</i>. The protocol followed was the same as previously done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR to obtain the Barnase as a product using the primers Bar_F1 and Bar_R1 and the template obtained yesterday.</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200" src= https://static.igem.org/mediawiki/2014/e/ef/20140821_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that the PCR product was correct, but we purified the band to get a better quality product using a QUIAGEN purification kit (QIAEXII Gel Extraction Kit 150, Cat. No: 20021).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured in liquid media yesterday's TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="250" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We picked again TA29 in pUPD colonies and recultured them in liquid media. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of TA29 culture.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions made to check yesterday's minipreps.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= ><br />
<br />
<img class="img_notebook" width="100" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png</p><br />
<br />
<br />
<br />
<p class="p_notebook">Resulting bands were as expected in silico, the piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the Barnase PCR product into pUPD as follows (Total volume = 12 &mu;L):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase product</li><br />
<br />
<li>1.2 &mu;L Buffer Ligase</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Ligation conditions were the same as previous ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we transformed it into <i>E. coli</i> and we cultured them in agar plates with Amp.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured TA29 piece in liquid media with Kan.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">TA29 in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 817</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2818, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/eb/20140817_Ta29_e040.png><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated these digestions because our water tube was contaminated. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/27/20140827_ta29.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked some colonies of yesterday's agar plates containing cells with Barnase in pUPD. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's cultures were blue, but we made minipreps and checked them with digestions.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">AatII</td><td class="td_notebook">2993, 196</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/09/20140828_pcps2_barnase_2alpha2r_gb106.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestion number 1 was correct. We send the resulting miniprep product to sequencing.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing Barnase in pUPD again since we have a point mutation in the previous sequence. Mutation seems to be in the primer, but we are going to try another colony. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made digestions using the same restriction enzymes as previously used. </p><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/e/e5/2014092_Barnasaa_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat again the protocol, so we picked more Barnase in pUPD colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made a screening PCR as a fast way to screen Barnase colonies.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Master Mix (12 reactions)</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>12 &mu;L dNTPs</li><br />
<br />
<li>12 &mu;L primer R</li><br />
<br />
<li>12 &mu;L primer F</li><br />
<br />
<li>12 &mu;L Taq Polymerase</li><br />
<br />
<li>24 &mu;L Buffer 10X</li><br />
<br />
<li>48 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400" src= https://static.igem.org/mediawiki/2014/7/75/2014092_Barnasa_PCR_colony.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both positive and negative control were correct. Additionally, we have barnase in wells 1, 2, 3, 4, 5, 7, 8 and 9. Wells 6 and 10 were not correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase in pUPD. We made minipreps and digestioins to check them. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4e/20140804_bb_bar_EaDAcT.png><br />
<br />
<br />
<br />
<p class="p_notebook">bands were not correct, so we picked another colony.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of barnase's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">300</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<p class="p_notebook">Digestions were not correct. We picked more colonies, tomorrow we have to do minipreps again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did again Barnase minipreps. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140906_Barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were not correct except one of them. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a Barnase PCR using the primers Ago03 and Ago04. Annealing temperature was 63&deg;C. We expect a PCR product around 300bp. We used the HF buffer of phusion polymerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the barnase ligation in pUPD:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L Barnase</li><br />
<br />
<li>1.2 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 ul T4 ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>6.8 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the PCR product is correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated the insert with vector pSB1A3 using primers named Sept02 y Sept03.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR in order to obtian the Barnase again. We used Taq polymerase and the following termocycler conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">63</td><td class="td_notebook">0:20 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">0:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/49/20140918_bar_colony_PCR.png><br />
<br />
<br />
<br />
<p class="p_notebook">We probably had a product in PCR number 7, 8 and 10. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We addded 1.2 &mu;L of buffer CutSmart and 0.8 &mu;L of BsaI enzyme in the ligation made yesterday. It was incubated for 1 h at 37&deg;C. Then, it was transformated as usually.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture (Barnase in pUPD.)</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase</td><td class="td_notebook">NotI</td><td class="td_notebook">2981, 411</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<img class="img_notebook" width="550" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, colony PCR made the previous day has also been checked, but even the positive control (checked Barnase) was not present.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We tried to digest Barnase ligation with XbaI (the enzyme cuts LacZ region) and then transform it on <i>E. coli</i>, but the electroporation cuvette sparked. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Finally, we have received the chromoproteins from Norwich team (safety module collaboration).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations of:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Chromoproteins in 2&alpha;1 (both yellow and blue)</li><br />
<br />
<li>Barnase PCR product in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested Barnase ligation with XbaI.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>MoFlippers constructions</li><br />
<br />
<li>Mutated Barnase in pUPD</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="500" src=https://static.igem.org/mediawiki/2014/b/bb/20140922_Omega_under_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Transformation into E.coli:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Yellow:T35S in 2&alpha;1</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1</li><br />
<br />
<li>Barnase (XbaI digested) in pUPD</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
<li>P35S:Yellow:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>Barnase digested with XbaI </li><br />
<br />
</ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Barnase in pUPD</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 </li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase in pUPD</td><td class="td_notebook">EagI</td><td class="td_notebook">2969, 411, (12)</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again chromoproteins ligation:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L Blue/Yellow</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>3 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions were run in two different gels</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/6/69/20140922_Blue_Ruta_KanRes_Bar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Barnase digestions were not correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Blue digestions were correct</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S iin 2&alpha;2</li><br />
<br />
<li>P35S:Yellow:T35S iin 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's cultures containing Barnase in pUPD.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/05/20140924_Barnase.png><br />
<br />
<p class="p_notebook">We addded mutated Barnase as a control. The other ones were not correct. We are going to use mutated barnase.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies to store them in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Moflippers containing Ta29, Atr&Delta;11, HarFAR and EaDAcT.</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>A. tumefaciens</i>)</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;1 (in <i>E. coli</i>)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We ligated Barase in 2&alpha;1:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1.5 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L Barnase in pUPD (Mutated)</li><br />
<br />
<li>1 &mu;L TA29</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 Ligase</li><br />
<br />
<li>2.5 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the ligation into <i>E. coli</i>.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Additionally, we picked colonies to store the Barnase in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
<li>P35S:Blue:T35S in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2)</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<br />
<br />
<p class="p_notebook">Blue chromoprotein digestions are correct, but only one of the yellow chromoprotein miniprep was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture: </p><br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestion in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Ta29:Barnase:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1452</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/f/ff/20140926_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of the following <i>A. tumefaciens</i> culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;1)</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 1954</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">7891, 386</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a4/20140927_Blue_Agro.png><br />
<br />
<p class="p_notebook">Minipreps were correct. We picked cells and recultured it in liquid media to agroinfiltrate them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies (E.coli):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture. </p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated both chromoproteins with Barnase TU (Amp resistance) into pSB1A3 vector.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>TA29:Barnase:T35S_P35S:Blue:T35S (pSB1A3)</li><br />
<br />
<li>TA29:Barnase:T35S_P35S:Yellow:T35S (pSB1A3)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Blue</td><td class="td_notebook">NotI</td><td class="td_notebook">3388, 2131</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Barnase + Yellow</td><td class="td_notebook">NotI</td><td class="td_notebook">3418, 2131</td><td class="td_notebook"></td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="500px"src= "https://static.igem.org/mediawiki/2014/b/b3/20140929_PCPS2_Blue.png"><br />
<br />
<br />
<br />
<p class="p_notebook">Both digestions were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We digested them with PstI and EcoRI, incubating at 37&deg;C (40 min) and inactivating the enzymes at 80&deg;C (20 min). </p><br />
<br />
<p class="p_notebook">After that, we ligated the insert with pSB1C3 vector, incubaating at 16&deg;C (40 min) and inactivating the ligase at 80&deg;C (20 min). </p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed it into <i>E. coli</i> and we grown the resultant cells in LB plates with chloramphenicol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We send the Biosafety module to Norwich.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred following the protocol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:P19:TNos</li><br />
<br />
<li>P35S:Blue:T35S coinfiltred with P35S:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation into pSB1C3 as previously done. This time we changed the digested vector sample and we used a different T4 ligase. In addition, ligation was incubated 25 min at room temperature instead of 40 min at 25&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Then, we trasformed the result and we cultured it in LB plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of <i>A. tumefaciens</i>:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Blue:T35S (2&alpha;2)</li><br />
<br />
<li>P35S:Yellow:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Blue:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1169, 424, 363</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5789, 2489</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:Yellow:T35S (2&alpha;2</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 1339, 355, 292</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NdeI</td><td class="td_notebook">5819, 2489</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="550px" src= https://static.igem.org/mediawiki/2014/2/27/20141005_Chromoprot_agro.png><br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies containing Biosafety Module did not grown, so we repeated digestion and ligation. Then, we transformed it and we cultured them in chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour. We leave it one day more.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Agroinfiltred plants with Blue chromoprotein did not show any colour, even in the magnifier view.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated again digestion and ligation of the biosafety module (Blue and yellow chromoproteins with Barnase)in pSB1C3.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed ligation made yesterday using a TOP10 <i>E. coli</i> strain. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We agroinfiltred orthologous genes of Rosea and Delila in Tomato. We want to test other approaches that could be used in place of Blue and Yellow chromoproteins. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:Ant1:TNos_P35S:JFA13:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Yesterday's culture did not grow. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestion and ligation to pSB1C3 (for Blue and Yellow modules). Then, we transformed it.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Plant leaves changed its usual green colour. As a result of anthocyanin accumulation, agroinfiltred leaves were purple coloured. We took photos of transient transformation of the two modules.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/2/25/Purple_Plant.png><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<a name="Measurement_Interlab_Study"></a></br></br><h3 class="section_notebook">Measurement Interlab Study</h3></br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed BBa_J23101, BBa_E0240 and BBa_J23115. All of the pieces share the vector pSB1C3, so we have cultured them in solid LB medium supplemented with chloramphenicol. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies and grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture, except from BBa_E0240 culture, which has not grown.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">RsaI</td><td class="td_notebook">1567, 538</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_23115</td><td class="td_notebook">RsaI</td><td class="td_notebook">1199, 538, 368</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">XhoI</td><td class="td_notebook">1213, 892</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/9/9f/20140822_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions were correct except BBa_23101 (1). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_E0240 and BBa_I20260 parts were transformed in <i>E. coli</i> DH5-&alpha;. BBa_E0240 is resistant to kanamycin and BBa_I20260 to chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37ºC.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_E0240 and grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies of BBa_I20260 were not grown, so we performed transformation again.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_I2026 grow them in agitation at 37&deg;C in liquid media supplemented with kanamycin.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_E0240.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 955</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a8/20140827_bb_e0240.png><br />
<br />
<br />
<br />
<p class="p_notebook">Assembly protocol for BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240:</p><br />
<br />
<br />
<br />
<p class="p_notebook">Double digestions</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng of plasmid in 16 &mu;L H20</li><br />
<br />
<li>2.5 &mu;L NEBuffer</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L enzyme 1</li><br />
<br />
<li>0.5 &mu;L enzyme 2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Final volume: 20 &mu;L</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part</td><td class="td_notebook">Enzymes</td><td class="td_notebook">Size</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">SpeI, PstI</td><td class="td_notebook">2.1 kb</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_E0240</td><td class="td_notebook">XbaI, PstI</td><td class="td_notebook">800 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 37&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run digestions in an agarose gel and purify band using QIAEX II Gel Extraction Kit.</p><br />
<br />
<br />
<br />
<p class="p_notebook">BioBricks ligations</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L part 1 (25 ng)</li><br />
<br />
<li>2 &mu;L part 2 (25 ng)</li><br />
<br />
<li>1 &mu;L T4 buffer 10X</li><br />
<br />
<li>0.5 &mu;L T4</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Part 1</td><td class="td_notebook">Part2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115</td><td class="td_notebook">BBa_E0240</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Incubate 30 min at 16&deg;C and 20 min more at 80&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Transform both ligations (BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240) and grow in solid plates supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Colonies did not grow so plates were left one more day at 37&deg;C.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of BBa_I2026.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20620</td><td class="td_notebook">NotI</td><td class="td_notebook">2726, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">3296, 373</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">There was some kind of trouble with the gel and bands where not clear. We repeat the digestion again other day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 grow them in agitation at 37&deg;C in liquid media supplemented with chloramphenicol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23101+BBa_E0240 and BBa_J23115+BBa_E0240 and digestions. Repeat digestions of BBa_I20620.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Device</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115+BBa_E0240</td><td class="td_notebook">NotI</td><td class="td_notebook">2046, 943</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">1991, 998</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/thumb/2/26/20140830_bb.png/800px-20140830_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">None of the digestions of BBa_J23101+BBa_E0240. Digestions BBa_J23115+BBa_E0240 (1) and (4) were correct and all of the colonies of BBa_I20620 were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick 5 more colonies of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps and digestions of 5 more cultures of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/a/a6/20140901_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">BBa_J23101+BBa_E0240 (4) ligation is correct.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We noticed that, for some reason, the stry of BBa_J23115+BBa_E0240 was contaminated, so we picked 6 more colonies.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of BBa_J23115+BBa_E0240 and digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/b/b7/20140902_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">All digestions are correct except BBa_J23115+BBa_E0240 (1).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We found out that the stry of BBa_J23101+BBa_E0240 was contaminated as well, so due to the low efficiency of this ligation (1/9) we decided to transform again with the correct miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick one colony of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Miniprep of BBa_J23101+BBa_E0240.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/0/07/20140904_bb.png><br />
<br />
<br />
<br />
<p class="p_notebook">The digestion was correct. We have scheduled the GFP for next Wednesday.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies for Measurement Interlab Study. Three technical samples for each device and the negative control (untransformed E.coli DH5-&alpha;) were picked. <i>E. coli</i> DH5-&alpha; cells were grown in 3.5 ml Luria-Bertani broth supplied with the corresponding antibiotic at 37&deg;C with shaking at 250 rpm for 16 hours.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Today we measured GFP for the Measurement Interlab Study.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Cells were centrifuged at 4500 rpm for 5 minutes and resuspended in ten folds the culture volume with a phosphate buffered saline (58 mM Na2HPO4, 17 mM NaH2PO4, 68 mM NaCl), as performed by Scholz et al., 2000. Na2HPO4 and NaH2PO4 were purchased from Panreac. NaCl was purchased from Fisher Bioreagents.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A GloMax-Multi Detection System form Promega fluorometer configured with the Blue optical kit (&Lamda;ex=490 nm, &Lamda;em=510-575 nm) was used to measure fluorescence. For measuring fluorescence 250 μl of each sample were placed in a black 96-well plate. Each sample was measured three times and an average was displayed on the screen.</p><br />
<br />
<br />
<br />
<p class="p_notebook">A Biowave CO 8000 from Biochrom spectophotometer was used to measure absorbance at 600 nm. For measuring absorbance 700 μl were placed in a cubet and measured one by one in the spectrophotometer.</p><br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook"></td><td class="td_notebook">Fluorescence*</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">(1) </td><td class="td_notebook">1.157 </td><td class="td_notebook">0.38 </td><td class="td_notebook">3.046</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.105 </td><td class="td_notebook">0.35 </td><td class="td_notebook">3.158</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.148 </td><td class="td_notebook">0.39 </td><td class="td_notebook">2.944</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">(1) </td><td class="td_notebook">5.237 </td><td class="td_notebook">0.36 </td><td class="td_notebook">14.547</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">5.073 </td><td class="td_notebook">0.34 </td><td class="td_notebook">14.92</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">3.729 </td><td class="td_notebook">0.26 </td><td class="td_notebook">14.342</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">61.246 </td><td class="td_notebook">0.43 </td><td class="td_notebook">142.432</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">65.759 </td><td class="td_notebook">0.47 </td><td class="td_notebook">139.913</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">68.295 </td><td class="td_notebook">0.47 </td><td class="td_notebook">145.309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23115 + BBa_E0240</td><td class="td_notebook">(1) </td><td class="td_notebook">1.482 </td><td class="td_notebook">0.37 </td><td class="td_notebook">4.006</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(2) </td><td class="td_notebook">1.443 </td><td class="td_notebook">0.37 </td><td class="td_notebook">3.901</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">(3) </td><td class="td_notebook">1.462 </td><td class="td_notebook">0.33 </td><td class="td_notebook">4.430</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<p class="p_notebook">*Fluorescence measurements were calculated subtracting the average value of fluorescence of three samples of phosphate buffer (286.1) to the value given for each sample by the fluorometer.</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Sample</td><td class="td_notebook">Fluorescence</td><td class="td_notebook">Optical density</td><td class="td_notebook">Fluorescence / Optical density</td><td class="td_notebook"></td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Negative control</td><td class="td_notebook">1.065±0.026</td><td class="td_notebook">0.373±0.021</td><td class="td_notebook">2.857±0.100</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_I20260</td><td class="td_notebook">4.385±0.775</td><td class="td_notebook">0.320±0.053</td><td class="td_notebook">13.684±0.275</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">BBa_J23101 + BBa_E0240</td><td class="td_notebook">61.004±3.346</td><td class="td_notebook">0.457±0.023</td><td class="td_notebook">133.583±2.530</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Bba_J23115 + BBa_E0240</td><td class="td_notebook">1.370±0.018</td><td class="td_notebook">0.357±0.023</td><td class="td_notebook">3.854±0.262</td></tr><br />
<br />
</table><br />
<br />
<a name="Translator_to_BioBricks_and_omega_undercover_vector"></a></br></br><h3 class="section_notebook">Translator to BioBricks and omega undercover vector</h3></br><h4 class="date_notebook">08/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Ale's primers labeled A11Dic32 and M11Nov12 found.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Run PCR with the following templates and primers:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">Forward</td><td class="td_notebook">Reverse</td><td class="td_notebook">Expected lenght</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35s</td><td class="td_notebook">iGEMJul11 A11Dic32</td><td class="td_notebook">1086 bp</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35s</td><td class="td_notebook">M11Nov12iGEM12Jul</td><td class="td_notebook">284 bp</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">P35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>67&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">T35s PCR parameters</p><br />
<br />
<ul class="ul_notebook"><li>98&deg;C, 2 min</li><br />
<br />
<li>35 cycles</li><br />
<br />
<ul class="ul_ul_notebook"><li>98&deg;C, 10 s</li><br />
<br />
<li>65&deg;C, 18 s</li><br />
<br />
<li>72&deg;C, 40 s</li><br />
<br />
</ul><li>98&deg;C, 7 min</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/f/f6/20140807_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">We didn't obtain PCR product.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeat yesterday's PCR with 2 degrees less in the annealing step.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/d/d4/20140808_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
<p class="p_notebook">Now there is a band for P35s but it should not be there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">The previous PCR was repeated changing the annealing temperature to 61&deg;C. </p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/c/ca/20140811_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks_otra_vez.png><br />
<br />
<br />
<br />
<p class="p_notebook">We still do not get PCR product.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR once more, this time setting the annealing temperatures at (59&deg;C for T35s and 61&deg;C for P35s).</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ec/20140812_pcr_Barnasa%2C_Ta29%2C_traductor_biobricks.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR setting the annealing temperature at 67&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/d/d5/20140818_COlony_PCR_FAO1_TA29_P35S_BB.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We are trying another PCR strategy to obtain the PCR product. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCR1: P35S template (as previously done)</li><br />
<br />
<li>PCR2: P35S:Atr&Delta;11:T35S template</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCR</td><td class="td_notebook">Primers</td><td class="td_notebook">Tm (&deg;C)</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">1</td><td class="td_notebook">iGEMJul11 and A11Dic32</td><td class="td_notebook">62</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">2</td><td class="td_notebook">M11Nov12 and iGEMJul12</td><td class="td_notebook">65</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/e/e0/20140819_p35s.png><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20140819_t35s2C_p35s.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked PCR products and only the T35S product was amplified correctly (the expected band was around 300 bp).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">As the PCR product was correct, we made a ligation to obtain the T35S piece in pUPD vector as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L T35S_BB</li><br />
<br />
<li>1.2 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>6.8 &mu;L H20 miliQ</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Reaction conditions: 25 cycles x (37&deg;C 2 min, 16&deg;C 5 min).</p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated a PCR to obtain the P35S using the same template as previously and the following conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">57/62/67</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">We checked the PCR product running a gel electrophoresis, but the PCR did not work again and the agarose gel did not show any band. </p><br />
<br />
<br />
<br />
<p class="p_notebook">T35S in pUPD vector was transformed in <i>E. coli</i> and cultured in agar plates. The protocol followed was the same as it is usually done. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/21/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies and recultured them in liquid media with the apprpriate antibiotic, Amp (2:1000). </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture and we made digestions to check them. </p><br />
<br />
<br />
<br />
<p class="p_notebook">In silico digestions:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">T35S in pUPD</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 309</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2210, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/60/20140822_digestions_Ta29_Ea_atr%2Bhar.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We run a PCR with the TUs as templates (adjusted to 5 ng/&mu;L) and using Jul11 and Jul12 as primers.</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>EaDAcT (2&alpha;2)</li><br />
<br />
<li>HarFAR (2&alpha;2)</li><br />
<br />
<li>Atr&Delta;11 (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">2 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">15 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">65</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">45 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We made another PCR to obtain P35S as a product. This time, we used Q5 High Fidelity polimerase. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Conditions for 35 cycles:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">98</td><td class="td_notebook">1:30 min</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">98</td><td class="td_notebook">10 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">55</td><td class="td_notebook">20 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">25 s</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7 min</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/c/ce/20140822_P35S_BB_FAO.png><br />
<br />
<br />
<br />
<p class="p_notebook">The gel shows that the template is not there.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR made the previous day using TUs as a template and primers Jul11 and Jul12, but this time we changed the extension time to 1:30 min.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/0/07/20140825_pcr_tu_biobricks_y_disgestiones.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">The gel showed that the PCR products were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/06/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a PCR in order to obtain a TU ready to send:</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR P35S_BB was performed using primers labelled Jul11 (forward) and Ago09(reverse). The annealing temperature was 62&deg;C and the extension time selected was 50s. Other parameters were the same as previously used.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/a/aa/20140906_PCR_P35S.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/07/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated yesterday's PCR, but this time we changed the annealing temperatures, trying 65&deg;C and 72&deg;C. Other parameters were maintained.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/b/b0/20140907_Barnase_PCR_35S.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S_BB PCR, but this time we changed the annealing temperature to 65&deg;C.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d1/20140908_PCR_P35S_AtrHarEa.png><br />
<br />
<br />
<br />
<p class="p_notebook">We did not obtain any PCR product. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_E0040 with XbaI and PstI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>250 ng E0040</li><br />
<br />
<li>2.5 &mu;L NEB2</li><br />
<br />
<li>0.5 &mu;L BSA</li><br />
<br />
<li>0.5 &mu;L XbaI</li><br />
<br />
<li>0.5 &mu;L PstI</li><br />
<br />
</ul><br />
<br />
<br />
<br />
<p class="p_notebook">We purified the band in order to obtain vector pSB1A3.</p><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> the following constructions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>E0040 + insert (&Omega; undercover)</li><br />
<br />
<li>MoFlipper + Atr&Delta;11</li><br />
<br />
<li>MoFlipper + HarFAR</li><br />
<br />
<li>MoFlipper + EaDAcT</li><br />
<br />
<li>MoFlipper + TA29</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover - GB conversor to BB </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="450px" src=https://static.igem.org/mediawiki/2014/7/75/20140919_omega_undercover_Bar_Colony_PCR.png><br />
<br />
<br />
<br />
<img class="img_notebook" width="380px" src= https://static.igem.org/mediawiki/2014/9/9f/20140919_PCPS2_omegaunder_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct. We have to repeat them, so we picked other colonies.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">MoFlipper cultures did not grow.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>Omega undercover</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Omega undercover</td><td class="td_notebook">DraI</td><td class="td_notebook">906, 692, 558, 19</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="400px" src= https://static.igem.org/mediawiki/2014/8/86/20140922_Ruta_KanRes_Omega_Barnase.png><br />
<br />
<br />
<br />
<p class="p_notebook">DraI does not cut well, but &Omega; undercover seems to be okay. Nevertheless we repeated the digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated digestions with PstI and EcoRI:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Omega undercover with TA29</li><br />
<br />
<li>MoFlipper with Atr&Delta;11</li><br />
<br />
<li>MoFlipper with HarFAR</li><br />
<br />
<li>MoFlipper with EaDAcT</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" width="200px"src= https://static.igem.org/mediawiki/2014/7/7d/20140923_Ta29_Moflippers.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/26/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested BBa_J23115 with EcoRI and PstI to obtain pSB1C3 vector. Then, we purified the band. </p><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We ligated Yellow and Blue TUs to the &Omega; undercover vector. We transformed them into <i>E. coli</i> and we grown the culture in LB agar plates. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook"> </p><br />
<br />
<br />
<br />
<a name="Switch"></a></br></br><h3 class="section_notebook">Switch</h3></br><h4 class="date_notebook">07/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Adquisition of <i>S. cerevisiae</i> genomic DNA. (5 &mu;L, stored in the fridge)</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We had the genome of <i>S. cerevisiae</i>, needed to extract the target genes that are going to be used to build the switch. However we finally used our genome extraction (see Biosynthesis part, date 07/23/2014 for further details).</p><br />
<br />
<p class="p_notebook">Previously we have designed a cupple of primers to amplify the CUP1 and CUP2 genes present in the yeast. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">PCR reaction reagents:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Reagent</td><td class="td_notebook">CUP1-PCR1</td><td class="td_notebook">CUP2-PCR2</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Template</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Buffer HF (5X)</td><td class="td_notebook">10.0 &mu;L</td><td class="td_notebook">10.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">dNTPs</td><td class="td_notebook">2.0 &mu;L</td><td class="td_notebook">2.0 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo R (JUL06)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Oligo F (JUL05)</td><td class="td_notebook">2.5 &mu;L</td><td class="td_notebook">2.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Phusion polymerase</td><td class="td_notebook">0.5 &mu;L</td><td class="td_notebook">0.5 &mu;L</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">H2O</td><td class="td_notebook">32.0 &mu;L</td><td class="td_notebook">32.0 &mu;L</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">Annealing temperature: both 61 &deg;C</p><br />
<br />
<br />
<br />
<p class="p_notebook">PCR products were checked using an electrophoresis. Expected bands:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP1-PCR1: 386 bp</li><br />
<br />
<li>CUP2-PCR2: 348 bp</li><br />
<br />
</ul><br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/8/81/20140728_CUP2yFAO1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Both PCR products were correct.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">07/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the PCR because we had to purify the bands CUP1-PCR1 and CUP2-PCR2.For this purpose we used the kit "QIAEX II Gel Extraction Kit".</p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation of both parts of CUP2.</p><br />
<br />
<ul class="ul_notebook"><li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L CUP1-PCR1</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L ligase buffer</li><br />
<br />
<li>4 &mu;L H20</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">07/31/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 was transformed in pUPD and cultured in solid media (37&deg;C).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/04/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Grow the piece corresponding to Gal4 Activation Domain (GB0095) from the GB collection in solid medium.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Pick colonies from CUP2 (3 colonies) and Gal4AD (1 colony).</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/06/14</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Gal4AD</li><br />
<br />
<li>CUP2</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico in order to check transcriptional units:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 752</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CUP2 in pUPD</td><td class="td_notebook">RsaI</td><td class="td_notebook">Tango</td><td class="td_notebook">2457, 1276</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD in pUPD</td><td class="td_notebook">Not1</td><td class="td_notebook">Orange</td><td class="td_notebook">2981, 330</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Gal4AD</td><td class="td_notebook">PuuI</td><td class="td_notebook">Red</td><td class="td_notebook">2215, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/7/72/20140806_agro_y_cup2.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 in pUPD is correct. RsaI restriction enzyme does not cut properly, as a result we obtained different bands from those ones expected.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/e/ef/20140806_atr%2Bhar%2Bea%2C_gal4ad%2C_fao1.png><br />
<br />
<br />
<br />
<p class="p_notebook">Gal4AD piece is correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Sequencing results of CUP2 piece were finally received and they were correct. </p><br />
<br />
<br />
<br />
<p class="p_notebook">As the sequence was correct, we could continue with ligations. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Quantification </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CUP2: 110.3 ng/&mu;L</li><br />
<br />
<li>Gal4: 221.4 ng/&mu;L</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Samples were diluted to 75 ng/&mu;L.</p><br />
<br />
<br />
<br />
<p class="p_notebook">The following ligations were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>1 &mu;L 2&alpha;2 vector</li><br />
<br />
<li>2 &mu;L H2O </li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/12/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">E. Coli transformation with the previous ligations and culture in solid medium (LB-agar with Kanamycin and X-Gal + IPTG) overnight.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/13/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We recultured yesterday's colonies in liquid media with the same antibiotic (Kan) and X-Gal. </p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;2 (3 colonies)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">08/14/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture and streakes were made. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions made in sililco to chceck the TU:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">Red</td><td class="td_notebook">562, 8401</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BclI</td><td class="td_notebook">Green</td><td class="td_notebook">476, 7137, 932</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/d/d5/20140814_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">The agarose gel shows that P35S:CUP2:Gal4AD:T35S piece is not well build. Nevertheless, PCPS2:CUP2:Gal4AD:T35S piece is OK. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S digestions made yesterday were repeated as follows:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Pieces/TU</td><td class="td_notebook">Resriction enzymes</td><td class="td_notebook">Buffer</td><td class="td_notebook">Expected Bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">Red</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NotI</td><td class="td_notebook">Green</td><td class="td_notebook">5723, 1290, 1532</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src=https://static.igem.org/mediawiki/2014/1/18/20140815_CUP2_digestion.png><br />
<br />
<br />
<br />
<p class="p_notebook">After running the electrophoresis, the resulting bands show that there is something more than expected in the plasmid. Furthermore, we check that the extra part has been added in the part region. Ligation step has to be repeated. </p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">08/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the P35S:CUP2:Gal4AD:T35S ligation. </p><br />
<br />
<br />
<br />
<p class="p_notebook">Ligation reagents:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 ul Gal4AD</li><br />
<br />
<li>1 &mu;L 2&alpha;2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Buffer ligase 10X</li><br />
<br />
<li>1 &mu;L T4</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>2 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
</br><h4 class="date_notebook">08/18/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">TU piece was transformed in <i>E. coli</i> (P35S:CUP2:Gal4AD:T35S) and cultured in solid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/19/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook"><i>E. coli</i> colonies containing the TU (P35S:CUP2:Gal4AD:T35S in 2&alpha;2) were recultured in liquid media.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/20/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2223</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8155, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src=https://static.igem.org/mediawiki/2014/e/e0/20140820_digestions_barnase.png ><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/27/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made ligations as follows:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L P35S:CUP2:Gal4AD:T35S in 2&alpha;2</li><br />
<br />
<li>1 &mu;L SF in 1&alpha;1</li><br />
<br />
<li>1 &mu;L 2&Omega;1</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1:</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 &mu;L PCPS2</li><br />
<br />
<li>1 &mu;L CUP2</li><br />
<br />
<li>1 &mu;L Gal4AD</li><br />
<br />
<li>1 &mu;L T35S</li><br />
<br />
<li>1 &mu;L 2&alpha;1</li><br />
<br />
<li>1 &mu;L BsaI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">Protocol was the same as previously folowed. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/28/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> yesterday's ligations and cultured them in agar plates:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
<li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked CUP2 in pUPD colonies and recultured them in liquid media in order to preservate them with glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">The other TU has not grown, that is why we repeated the transformation as yesterday was done.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">08/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked colonies:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored CUP2 in pUPD liquid media with glycerol. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of PCPS2:CUP2:Gal4AD:T35S in 2&alpha;1.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">EcoRV</td><td class="td_notebook">8401, 562</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">HindIII</td><td class="td_notebook">6322, 2641</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<p class="p_notebook">We have to repeat digestions.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation since previous cultures were blue colored.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed into <i>E. coli</i> ligation made yesterday and cells were cultured in agar plates. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">P35S:CUP2:Gal4AD:T35S in 2&Omega;1 ligation was repeated, since we did not found any white colony in the agar plates. Conditions were the same as we did previously. We transformed it in <i>E. coli</i> and we recultured the cells in agar plates. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We repeated the following digestions:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>PCPS2:CUP2:Gal4AD:T35S (2&alpha;1)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions made in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">PCPS2:CUP2:Gal4AD:T35S</td><td class="td_notebook">NotI</td><td class="td_notebook">6140, 1532, 1290</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">BglII</td><td class="td_notebook">8103, 859</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/a/a2/2014093_agrobacterium_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We consider to use the miniprep number 2.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/05/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Renilla</td><td class="td_notebook">HindIII</td><td class="td_notebook">4000, 2500, 800</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRV</td><td class="td_notebook">4600, 2500, 400</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="280px" src= https://static.igem.org/mediawiki/2014/b/b9/20140905_Barnase_Renilla_EaDAcT.png><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We digested minipreps made the previous days:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:Gal4AD:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/2/24/20140909_Digestiones_fallidas_CUP2.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions were not correct, we made a mistake and we have to repeat them tomorrow. We picked colonies again.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/09/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">To store our construction in glycerol, we picked some colonies (containing the plasmid P35S:CUP2:Gal4AD:T35 in 2&alpha;2)and cultured them in liquid media</p><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture and we repeated digestions.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/6/66/20140910_CUP2_digestions.png><br />
<br />
<br />
<br />
<p class="p_notebook">CUP2 digestions were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/11/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained from GB collection the following piece:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB253 (UTR from TMV to use it as the switch promoter)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We stored in glycerol:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:Gal4AD:T35S (2&alpha;2)</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/15/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>E. coli</i> colonies containing:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253 UTR &Omega; (Amp Resistance)</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We transformed the SF_P35S:CUP2:Gal4AD:T35S in 2&Omega;2 into <i>A. tumefaciens</i>. LB agar plates were stored at 28&deg;C during 2 days. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/16/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps and streakes of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0253</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico to check the minipreps:</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Restriction enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GB0253</td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 130</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">2031, 1096</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/3/35/20140916_gb_pieces_pathway_enzymes.png ><br />
<br />
<br />
<br />
<p class="p_notebook">We had very low DNA content in GB253 miniprep so we recultured it in new liquid media to repeat the miniprep again. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/17/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">Minipreps of yesterday's culture were made:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>GB0256</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico were the same as previouly done.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/1/1f/20140917_gb253_pathway.png><br />
<br />
<br />
<br />
<p class="p_notebook">We obtained low DNA content in GB0253 miniprep, but it was correct. </p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/22/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We finally received the GBlock containing the chimerical promoter: UAS sequence + (-60)mini35S. </p><br />
<br />
<br />
<br />
<p class="p_notebook">We ligate it in pUPD vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>2 &mu;L GBlock</li><br />
<br />
<li>1 &mu;L pUPD</li><br />
<br />
<li>1 &mu;L BsmBI</li><br />
<br />
<li>1 &mu;L T4 ligase</li><br />
<br />
<li>1 &mu;L Ligase buffer</li><br />
<br />
<li>4 &mu;L H2O</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">09/23/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed on <i>E. coli</i> ligations made yesterday:</p><br />
<br />
<ul class="ul_notebook"><li>GBlock in pUPD</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We spread the cells in LB plates and we incubate them overnight at 37&deg;C.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/24/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked clonies containing GBlock in pUPD in order to store them in glycerol.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/25/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture containing the GBlock in pUPD.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/0/06/20140925_CUP_promoter_gblock_fail.png><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions have to be repeated.</p><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/4/4a/20140925_CUP_prom_chromoproteins.png><br />
<br />
<img class="img_notebook" width="200px" src= https://static.igem.org/mediawiki/2014/f/fb/20140925_CUP_promoter_GBlock.png><br />
<br />
<p class="p_notebook">Minipreps were correct. </p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/29/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did a screening PCR of the gBlock (Vt=50 &mu;L/well):</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>1 &mu;L colony</li><br />
<br />
<li>1 &mu;L primer F</li><br />
<br />
<li>1 ul primer R</li><br />
<br />
<li>1 &mu;L dNTPs</li><br />
<br />
<li>1 &mu;L Taq Polymerase</li><br />
<br />
<li>5 &mu;L Buffer 10X</li><br />
<br />
<li>40 &mu;L H20</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">PCR conditions (35 cycles):</p><br />
<br />
<br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Step</td><td class="td_notebook">Temperature (&deg;C)</td><td class="td_notebook">Time (min) </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Initialization</td><td class="td_notebook">94</td><td class="td_notebook">3:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Denaturation</td><td class="td_notebook">94</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Annealing</td><td class="td_notebook">50.4</td><td class="td_notebook">0:20</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Extension</td><td class="td_notebook">72</td><td class="td_notebook">1:00 </td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Final elongation</td><td class="td_notebook">72</td><td class="td_notebook">7:00 </td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<p class="p_notebook">We run a gel with PCR products:</p><br />
<br />
<br />
<br />
<img class="img_notebook" width="355px" src= https://static.igem.org/mediawiki/2014/4/42/20140830_switch.png><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>Correct expected band size: 371 bp</li><br />
<br />
<li>Incorrect possible band: 270 bp</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">We picked colonies 3 and 12 to make the miniprep.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">09/30/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">GBlock in pUPD</td><td class="td_notebook">PvuII</td><td class="td_notebook">2564, 590</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">EcoRI</td><td class="td_notebook">2997, 157</td></tr><br />
<br />
</table><br />
<br />
<br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/9/9e/09012014_Mini35s_GBlock.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/01/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We ligated the GBlock into 2&alpha;1 vector:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>0.75 &mu;L mini35S (75 ng/&mu;L)</li><br />
<br />
<li>3.75 &mu;L UTR &Omega; (15 ng/&mu;L)</li><br />
<br />
<li>0.75 ul Luciferase (75 ng/&mu;L</li><br />
<br />
<li>0.75 T35S (75 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L 2&alpha;1 (58 ng/&mu;L)</li><br />
<br />
<li>1 &mu;L Bsa1</li><br />
<br />
<li>1 &mu;L T4 Ligase </li><br />
<br />
<li>1 &mu;L Buffer ligase</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Tomorrow we will transform the result.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/02/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We transformed yesterday's ligation in 2&alpha;1 into <i>E. coli</i> DH5&alpha; cells and the result was cultured in LB Kan-IPTG-XGal plates.</p><br />
<br />
<br />
<br />
<p class="p_notebook">Addtionally, we ligated the binary assembly: CUP2 with Renilla into the 2&alpha;2 vector. </p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S_P35S:Renilla:TNos_P35S:P19:TNos:</li><br />
<br />
</ul><br />
<br />
<ul class="ul_notebook"><li>1 µl pEGB2?1 35s:CUP2:T35s</li><br />
<br />
<li>2 µl pEGB1?2 35s:Ren:Tnos-35s:p19:Tnos</li><br />
<br />
<li>1 µl pDGB2?2</li><br />
<br />
<li>1 µl BsaI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl T10x</li><br />
<br />
<li>4.8 µl water</li><br />
<br />
</ul></ul><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/03/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked two colonies of each construct: </p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/04/2014</h4><br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR&Omega;:Luciferase:T35s in 2&alpha;1</li><br />
<br />
<li>P35s:CUP2:T35s_P35s:Renilla:TNos_P35s:P19:Tnos in 2&alpha;2</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:UTR&Omega;:Luc:T35s</td><td class="td_notebook">EcoRI</td><td class="td_notebook">6323, 2084</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="475" src= https://static.igem.org/mediawiki/2014/2/2d/20141004_CBSmini35_UTR_Luc.png><br />
<br />
<p class="p_notebook">CBSmini35s:UTR&Omega;:Luc:T35s digestions were correct. </p><br />
<br />
<p class="p_notebook">P35s:CUP2:T35s_P35s:Ren:TNos_P35s:P19:Tnos digestions were not correct. If we look at the band size, colony number 1 could be P35S:Ren_P35S:P19 without CUP2 TU.</p><br />
<br />
<p class="p_notebook">We changed the strategy, we have the Luciferase TU and another Renilla + P19 in 2&alpha;2, so we made the following ligation.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
</br><h4 class="date_notebook">10/06/2014</h4><br />
<br />
<p class="p_notebook">We made the following binary assembly.</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35s:UTR?:Luc:T35s-35s:Ren:Tnos-35s:p19:Tnos (2&Omega;2):</li><br />
<br />
<ul class="ul_ul_notebook"><li>1 µl CBSmini35s:UTR&Omega;:Luc:T35s 2&alpha;1</li><br />
<br />
<li>1 µl P35s:Ren:Tnos_P35s:P19:Tnos 1&alpha;1</li><br />
<br />
<li>1 µl 2&Omega;2</li><br />
<br />
<li>1 µl BsmBI</li><br />
<br />
<li>1 µl T4 ligasa</li><br />
<br />
<li>1.2 µl Buffer T10x</li><br />
<br />
<li>5.8 µl H2O</li><br />
<br />
</ul></ul><br />
<br />
<p class="p_notebook">We transformed on <i>A. tumefaciens</i>:</p><br />
<br />
<ul class="ul_notebook"><li>P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</br><h4 class="date_notebook">10/07/2014</h4><br />
<br />
<p class="p_notebook">We picked two colonies of:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos</li><br />
<br />
</ul><br />
<br />
</br><h4 class="date_notebook">10/08/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We made minipreps of yesterday's culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:UTR&Omega;:Luc:T35s_P35s:Ren:Tnos_P35s:P19:TNos </li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Restriction analysis:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35s:Luc_35s:Ren_35s:P19</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">PvuI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" src= https://static.igem.org/mediawiki/2014/5/55/20141008_cbsmini35_2omega2.png><br />
<br />
<br />
<br />
<br />
<br />
<p class="p_notebook">We transformated colony 1 on <i>A. tumefaciens</i>.</p><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies with P35S:CUP2:T35S in 2&Omega;1.</p><br />
<br />
<br />
<br />
<br />
<br />
</br><h4 class="date_notebook">10/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We picked <i>A. tumefaciens</i> colonies transformated the previous day.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">11/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday' culture:</p><br />
<br />
<br />
<br />
<ul class="ul_notebook"><li>SF_P35S:CUP2:T35S in 2&Omega;1</li><br />
<br />
</ul><br />
<br />
<p class="p_notebook">Digestions in silico:</p><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">P35S:CUP2:T35S</td><td class="td_notebook">BamHI</td><td class="td_notebook">6652, 2385</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">8647, 390</td></tr><br />
<br />
</table><br />
<br />
<p class="p_notebook"> </p><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/3/31/20141011_Yellow_chromoprot_CUP_agro.png><br />
<br />
<br />
<br />
<p class="p_notebook">They were correct.</p><br />
<br />
<br />
<br />
</br><h4 class="date_notebook">13/10/2014</h4><br />
<br />
<br />
<br />
<p class="p_notebook">We did minipreps of yesterday's culture:</p><br />
<br />
<ul class="ul_notebook"><li>CBSmini35S:Luciferase_P35S:Renilla_P35S:P19:Tnos</li><br />
<br />
</ul><br />
<br />
<table class="table_notebook"><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">Piece</td><td class="td_notebook">Enzyme</td><td class="td_notebook">Expected bands</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook">CBSmini35S Luciferase Renilla</td><td class="td_notebook">EcoRV</td><td class="td_notebook">6652, 3276, 2475, 812, 381</td></tr><br />
<br />
<tr class="tr_notebook"><td class="td_notebook"></td><td class="td_notebook">NcoI</td><td class="td_notebook">5946, 5595, 2055</td></tr><br />
<br />
</table><br />
<br />
<img class="img_notebook" width="300px" src= https://static.igem.org/mediawiki/2014/c/c8/20141013_luciferase_mini35.png><br />
<br />
<p class="p_notebook">They were correct.</p><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content-trans" id="goto-left" align="center"></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/interlab"><strong>Go to Interlab Study&rarr;</strong></a></div></br></br></br><br />
<br />
<div class="right-col"><br />
<div class="pinned note-container"><br />
<div class="note"><br />
<h3>Great Days!</h3><br />
<p>Here is our biggest days in the Laboratory</p><br />
<p><a href="#">Day 1</a>.</p><br />
<p><a href="#">Day 2</a>.</p><br />
<p><a href="#">Day 3</a>.</p><br />
</div><br />
<br />
</div><br />
<br />
</div><br />
<br />
<br />
</section> <br />
</div><br />
<br />
<div id="space-margin"></div><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.9.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:Valencia_UPV/Templates/sticky-notebook_jquery?action=raw&ctype=text/javascript"></script><br />
<br />
<br />
<script><br />
$(".pinned").pin({containerSelector: ".container", minWidth: 940});<br />
</script><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior
Team:Valencia UPV/Project/modules/moths behavior
2014-10-18T02:44:22Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Moths Behaviour</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>oths <roja>B</roja>ehaviour<roja></span> </div><br/><br />
<br />
<p class="subpart">The Idea</p><br/><br />
<br />
<p>You better know your enemy before starting a fight. Moths, flying insects from the order Lepidoptera, cause great damage in crops all over the world. We aim to avoid damages caused by them, so understanding their behaviour is a main issue for us. We focused in their sexual behaviour to look for an elegant strategy to fight them.</p><br/><br/><br />
<br />
<p class="subpart">Moth Sexual Behavior</p><br/><br />
<br />
<p>Moth individuals within the same specie communicate with each other using volatile chemical compounds called “sex pheromones”. Female moths generate several pheromone compounds in their sex pheromone gland, at the tip of their abdomen, and release them in certain ratios. Male moths locate the females of their own species, by tracing these compounds in species-specific ratios [1]. Offspring derived from this encounter is the cause of damage in crops.</p><br/><br/><br />
<br />
<p class="subpart">Pheromone-based Pest Control in Moths</p><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/fa/VUPVMoth.png" alt="moth_img"></img><br />
<p><br/>Some experts indicate that "The direct management of insect pests using pheromones can provide excellent suppression of key lepidopteran pests in agriculture" [2]. If a high concentration of the major pheromone component (the most abundant pheromone for a specie) is present in the air, this may lead to a "nonresponsive outcome". Fatigue or adaptation of the male's pheromone sensory organs are the cause of this [2]. This strategy is called <b>mating disruption</b>.</p><br/><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 775px;"><span class="black-bold">Figure 1</span>. Healthy crop field.</p></div><br />
<br />
<br/><br />
<br />
<p>Traditional pest control strategies based on pesticides are non-specific and affect the target along with other species (bees, humans, etc.), which can cause ecological problems [3]. However, <b>pheromone-based pest control strategies</b> are more species-specific than pesticides and they target a narrower range of species. They have shown no effect on pest species outside of a "cropping system, reducing the risk of outbreak of a secondary pest.</p><br/><br/><br/><br/><br />
<br />
<p><span class="red-bold">Sexy Plant</span> uses this pheromone-based mating-disruption strategy to avoid damages in crops and becomes an environmentally-friendly choice in pest control.</p><br/><br/><br/><br/><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/problem"><strong>&larr; Go to Problem</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis"><strong>Go to Biosynthesis &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Vogel H, Heidel AJ, Heckel DG, Groot AT (2010) Transcriptome analysis of the sex pheromone gland of the noctuid moth Heliothis virescens. BMC Genomics 11: 29.</li><br />
<li>Welter SC, Pickel C, Millar J, Cave F, Steenwyk RAV, et al. (2005) Pheromone mating disruption offers selective management options for key pests. California Agriculture 59: 16-22.</li><br />
<li>Brittain C, Potts SG (2011) The potential impacts of insecticides on the life-history traits of bees and the consequences for pollination. Basic and Applied Ecology 12: 321-331.</li><br />
<br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior
Team:Valencia UPV/Project/modules/moths behavior
2014-10-18T02:44:12Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Moths Behaviour</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>oths <roja>B</roja>ehaviour<roja></span> </div><br/><br />
<br />
<p class="subpart">The Idea</p><br/><br />
<br />
<p>You better know your enemy before starting a fight. Moths, flying insects from the order Lepidoptera, cause great damage in crops all over the world. We aim to avoid damages caused by them, so understanding their behaviour is a main issue for us. We focused in their sexual behaviour to look for an elegant strategy to fight them.</p><br/><br/><br />
<br />
<p class="subpart">Moth Sexual Behavior</p><br/><br />
<br />
<p>Moth individuals within the same specie communicate with each other using volatile chemical compounds called “sex pheromones”. Female moths generate several pheromone compounds in their sex pheromone gland, at the tip of their abdomen, and release them in certain ratios. Male moths locate the females of their own species, by tracing these compounds in species-specific ratios [1]. Offspring derived from this encounter is the cause of damage in crops.</p><br/><br/><br />
<br />
<p class="subpart">Pheromone-based Pest Control in Moths</p><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/fa/VUPVMoth.png" alt="moth_img"></img><br />
<p><br/>Some experts indicate that "The direct management of insect pests using pheromones can provide excellent suppression of key lepidopteran pests in agriculture" [2]. If a high concentration of the major pheromone component (the most abundant pheromone for a specie) is present in the air, this may lead to a "nonresponsive outcome". Fatigue or adaptation of the male's pheromone sensory organs are the cause of this [2]. This strategy is called <b>mating disruption</b>.</p><br/><br/><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 775px;"><span class="black-bold">Figure 1</span>. Healthy crop field.</p></div><br />
<br />
<br/><br />
<br />
<p>Traditional pest control strategies based on pesticides are non-specific and affect the target along with other species (bees, humans, etc.), which can cause ecological problems [3]. However, <b>pheromone-based pest control strategies</b> are more species-specific than pesticides and they target a narrower range of species. They have shown no effect on pest species outside of a "cropping system, reducing the risk of outbreak of a secondary pest.</p><br/><br/><br/><br/><br />
<br />
<p><span class="red-bold">Sexy Plant</span> uses this pheromone-based mating-disruption strategy to avoid damages in crops and becomes an environmentally-friendly choice in pest control.</p><br/><br/><br/><br/><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/problem"><strong>&larr; Go to Problem</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis"><strong>Go to Biosynthesis &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Vogel H, Heidel AJ, Heckel DG, Groot AT (2010) Transcriptome analysis of the sex pheromone gland of the noctuid moth Heliothis virescens. BMC Genomics 11: 29.</li><br />
<li>Welter SC, Pickel C, Millar J, Cave F, Steenwyk RAV, et al. (2005) Pheromone mating disruption offers selective management options for key pests. California Agriculture 59: 16-22.</li><br />
<li>Brittain C, Potts SG (2011) The potential impacts of insecticides on the life-history traits of bees and the consequences for pollination. Basic and Applied Ecology 12: 321-331.</li><br />
<br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior
Team:Valencia UPV/Project/modules/moths behavior
2014-10-18T02:43:59Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Moths Behaviour</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>oths <roja>B</roja>ehaviour<roja></span> </div><br/><br />
<br />
<p class="subpart">The Idea</p><br/><br />
<br />
<p>You better know your enemy before starting a fight. Moths, flying insects from the order Lepidoptera, cause great damage in crops all over the world. We aim to avoid damages caused by them, so understanding their behaviour is a main issue for us. We focused in their sexual behaviour to look for an elegant strategy to fight them.</p><br/><br/><br />
<br />
<p class="subpart">Moth Sexual Behavior</p><br/><br />
<br />
<p>Moth individuals within the same specie communicate with each other using volatile chemical compounds called “sex pheromones”. Female moths generate several pheromone compounds in their sex pheromone gland, at the tip of their abdomen, and release them in certain ratios. Male moths locate the females of their own species, by tracing these compounds in species-specific ratios [1]. Offspring derived from this encounter is the cause of damage in crops.</p><br/><br/><br />
<br />
<p class="subpart">Pheromone-based Pest Control in Moths</p><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/fa/VUPVMoth.png" alt="moth_img"></img><br />
<p>Some experts indicate that "The direct management of insect pests using pheromones can provide excellent suppression of key lepidopteran pests in agriculture" [2]. If a high concentration of the major pheromone component (the most abundant pheromone for a specie) is present in the air, this may lead to a "nonresponsive outcome". Fatigue or adaptation of the male's pheromone sensory organs are the cause of this [2]. This strategy is called <b>mating disruption</b>.</p><br/><br/><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 775px;"><span class="black-bold">Figure 1</span>. Healthy crop field.</p></div><br />
<br />
<br/><br />
<br />
<p>Traditional pest control strategies based on pesticides are non-specific and affect the target along with other species (bees, humans, etc.), which can cause ecological problems [3]. However, <b>pheromone-based pest control strategies</b> are more species-specific than pesticides and they target a narrower range of species. They have shown no effect on pest species outside of a "cropping system, reducing the risk of outbreak of a secondary pest.</p><br/><br/><br/><br/><br />
<br />
<p><span class="red-bold">Sexy Plant</span> uses this pheromone-based mating-disruption strategy to avoid damages in crops and becomes an environmentally-friendly choice in pest control.</p><br/><br/><br/><br/><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/problem"><strong>&larr; Go to Problem</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis"><strong>Go to Biosynthesis &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Vogel H, Heidel AJ, Heckel DG, Groot AT (2010) Transcriptome analysis of the sex pheromone gland of the noctuid moth Heliothis virescens. BMC Genomics 11: 29.</li><br />
<li>Welter SC, Pickel C, Millar J, Cave F, Steenwyk RAV, et al. (2005) Pheromone mating disruption offers selective management options for key pests. California Agriculture 59: 16-22.</li><br />
<li>Brittain C, Potts SG (2011) The potential impacts of insecticides on the life-history traits of bees and the consequences for pollination. Basic and Applied Ecology 12: 321-331.</li><br />
<br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior
Team:Valencia UPV/Project/modules/moths behavior
2014-10-18T02:43:48Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Moths Behaviour</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>oths <roja>B</roja>ehaviour<roja></span> </div><br/><br />
<br />
<p class="subpart">The Idea</p><br/><br />
<br />
<p>You better know your enemy before starting a fight. Moths, flying insects from the order Lepidoptera, cause great damage in crops all over the world. We aim to avoid damages caused by them, so understanding their behaviour is a main issue for us. We focused in their sexual behaviour to look for an elegant strategy to fight them.</p><br/><br/><br />
<br />
<p class="subpart">Moth Sexual Behavior</p><br/><br />
<br />
<p>Moth individuals within the same specie communicate with each other using volatile chemical compounds called “sex pheromones”. Female moths generate several pheromone compounds in their sex pheromone gland, at the tip of their abdomen, and release them in certain ratios. Male moths locate the females of their own species, by tracing these compounds in species-specific ratios [1]. Offspring derived from this encounter is the cause of damage in crops.</p><br/><br/><br />
<br />
<p class="subpart">Pheromone-based Pest Control in Moths</p><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/fa/VUPVMoth.png" alt="moth_img"></img><br />
<p>Some experts indicate that "The direct management of insect pests using pheromones can provide excellent suppression of key lepidopteran pests in agriculture" [2]. If a high concentration of the major pheromone component (the most abundant pheromone for a specie) is present in the air, this may lead to a "nonresponsive outcome". Fatigue or adaptation of the male's pheromone sensory organs are the cause of this [2]. This strategy is called <b>mating disruption</b>.</p><br/><br/><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 800px;"><span class="black-bold">Figure 1</span>. Healthy crop field.</p></div><br />
<br />
<br/><br />
<br />
<p>Traditional pest control strategies based on pesticides are non-specific and affect the target along with other species (bees, humans, etc.), which can cause ecological problems [3]. However, <b>pheromone-based pest control strategies</b> are more species-specific than pesticides and they target a narrower range of species. They have shown no effect on pest species outside of a "cropping system, reducing the risk of outbreak of a secondary pest.</p><br/><br/><br/><br/><br />
<br />
<p><span class="red-bold">Sexy Plant</span> uses this pheromone-based mating-disruption strategy to avoid damages in crops and becomes an environmentally-friendly choice in pest control.</p><br/><br/><br/><br/><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/problem"><strong>&larr; Go to Problem</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis"><strong>Go to Biosynthesis &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Vogel H, Heidel AJ, Heckel DG, Groot AT (2010) Transcriptome analysis of the sex pheromone gland of the noctuid moth Heliothis virescens. BMC Genomics 11: 29.</li><br />
<li>Welter SC, Pickel C, Millar J, Cave F, Steenwyk RAV, et al. (2005) Pheromone mating disruption offers selective management options for key pests. California Agriculture 59: 16-22.</li><br />
<li>Brittain C, Potts SG (2011) The potential impacts of insecticides on the life-history traits of bees and the consequences for pollination. Basic and Applied Ecology 12: 321-331.</li><br />
<br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior
Team:Valencia UPV/Project/modules/moths behavior
2014-10-18T02:43:39Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Moths Behaviour</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>oths <roja>B</roja>ehaviour<roja></span> </div><br/><br />
<br />
<p class="subpart">The Idea</p><br/><br />
<br />
<p>You better know your enemy before starting a fight. Moths, flying insects from the order Lepidoptera, cause great damage in crops all over the world. We aim to avoid damages caused by them, so understanding their behaviour is a main issue for us. We focused in their sexual behaviour to look for an elegant strategy to fight them.</p><br/><br/><br />
<br />
<p class="subpart">Moth Sexual Behavior</p><br/><br />
<br />
<p>Moth individuals within the same specie communicate with each other using volatile chemical compounds called “sex pheromones”. Female moths generate several pheromone compounds in their sex pheromone gland, at the tip of their abdomen, and release them in certain ratios. Male moths locate the females of their own species, by tracing these compounds in species-specific ratios [1]. Offspring derived from this encounter is the cause of damage in crops.</p><br/><br/><br />
<br />
<p class="subpart">Pheromone-based Pest Control in Moths</p><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/fa/VUPVMoth.png" alt="moth_img"></img><br />
<p>Some experts indicate that "The direct management of insect pests using pheromones can provide excellent suppression of key lepidopteran pests in agriculture" [2]. If a high concentration of the major pheromone component (the most abundant pheromone for a specie) is present in the air, this may lead to a "nonresponsive outcome". Fatigue or adaptation of the male's pheromone sensory organs are the cause of this [2]. This strategy is called <b>mating disruption</b>.</p><br/><br/><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 850px;"><span class="black-bold">Figure 1</span>. Healthy crop field.</p></div><br />
<br />
<br/><br />
<br />
<p>Traditional pest control strategies based on pesticides are non-specific and affect the target along with other species (bees, humans, etc.), which can cause ecological problems [3]. However, <b>pheromone-based pest control strategies</b> are more species-specific than pesticides and they target a narrower range of species. They have shown no effect on pest species outside of a "cropping system, reducing the risk of outbreak of a secondary pest.</p><br/><br/><br/><br/><br />
<br />
<p><span class="red-bold">Sexy Plant</span> uses this pheromone-based mating-disruption strategy to avoid damages in crops and becomes an environmentally-friendly choice in pest control.</p><br/><br/><br/><br/><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/problem"><strong>&larr; Go to Problem</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis"><strong>Go to Biosynthesis &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Vogel H, Heidel AJ, Heckel DG, Groot AT (2010) Transcriptome analysis of the sex pheromone gland of the noctuid moth Heliothis virescens. BMC Genomics 11: 29.</li><br />
<li>Welter SC, Pickel C, Millar J, Cave F, Steenwyk RAV, et al. (2005) Pheromone mating disruption offers selective management options for key pests. California Agriculture 59: 16-22.</li><br />
<li>Brittain C, Potts SG (2011) The potential impacts of insecticides on the life-history traits of bees and the consequences for pollination. Basic and Applied Ecology 12: 321-331.</li><br />
<br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior
Team:Valencia UPV/Project/modules/moths behavior
2014-10-18T02:43:30Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Moths Behaviour</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>oths <roja>B</roja>ehaviour<roja></span> </div><br/><br />
<br />
<p class="subpart">The Idea</p><br/><br />
<br />
<p>You better know your enemy before starting a fight. Moths, flying insects from the order Lepidoptera, cause great damage in crops all over the world. We aim to avoid damages caused by them, so understanding their behaviour is a main issue for us. We focused in their sexual behaviour to look for an elegant strategy to fight them.</p><br/><br/><br />
<br />
<p class="subpart">Moth Sexual Behavior</p><br/><br />
<br />
<p>Moth individuals within the same specie communicate with each other using volatile chemical compounds called “sex pheromones”. Female moths generate several pheromone compounds in their sex pheromone gland, at the tip of their abdomen, and release them in certain ratios. Male moths locate the females of their own species, by tracing these compounds in species-specific ratios [1]. Offspring derived from this encounter is the cause of damage in crops.</p><br/><br/><br />
<br />
<p class="subpart">Pheromone-based Pest Control in Moths</p><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/fa/VUPVMoth.png" alt="moth_img"></img><br />
<p>Some experts indicate that "The direct management of insect pests using pheromones can provide excellent suppression of key lepidopteran pests in agriculture" [2]. If a high concentration of the major pheromone component (the most abundant pheromone for a specie) is present in the air, this may lead to a "nonresponsive outcome". Fatigue or adaptation of the male's pheromone sensory organs are the cause of this [2]. This strategy is called <b>mating disruption</b>.</p><br/><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 850px;"><span class="black-bold">Figure 1</span>. Healthy crop field.</p></div><br />
<br />
<br/><br />
<br />
<p>Traditional pest control strategies based on pesticides are non-specific and affect the target along with other species (bees, humans, etc.), which can cause ecological problems [3]. However, <b>pheromone-based pest control strategies</b> are more species-specific than pesticides and they target a narrower range of species. They have shown no effect on pest species outside of a "cropping system, reducing the risk of outbreak of a secondary pest.</p><br/><br/><br/><br/><br />
<br />
<p><span class="red-bold">Sexy Plant</span> uses this pheromone-based mating-disruption strategy to avoid damages in crops and becomes an environmentally-friendly choice in pest control.</p><br/><br/><br/><br/><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/problem"><strong>&larr; Go to Problem</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis"><strong>Go to Biosynthesis &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Vogel H, Heidel AJ, Heckel DG, Groot AT (2010) Transcriptome analysis of the sex pheromone gland of the noctuid moth Heliothis virescens. BMC Genomics 11: 29.</li><br />
<li>Welter SC, Pickel C, Millar J, Cave F, Steenwyk RAV, et al. (2005) Pheromone mating disruption offers selective management options for key pests. California Agriculture 59: 16-22.</li><br />
<li>Brittain C, Potts SG (2011) The potential impacts of insecticides on the life-history traits of bees and the consequences for pollination. Basic and Applied Ecology 12: 321-331.</li><br />
<br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior
Team:Valencia UPV/Project/modules/moths behavior
2014-10-18T02:43:10Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Moths Behaviour</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>oths <roja>B</roja>ehaviour<roja></span> </div><br/><br />
<br />
<p class="subpart">The Idea</p><br/><br />
<br />
<p>You better know your enemy before starting a fight. Moths, flying insects from the order Lepidoptera, cause great damage in crops all over the world. We aim to avoid damages caused by them, so understanding their behaviour is a main issue for us. We focused in their sexual behaviour to look for an elegant strategy to fight them.</p><br/><br/><br />
<br />
<p class="subpart">Moth Sexual Behavior</p><br/><br />
<br />
<p>Moth individuals within the same specie communicate with each other using volatile chemical compounds called “sex pheromones”. Female moths generate several pheromone compounds in their sex pheromone gland, at the tip of their abdomen, and release them in certain ratios. Male moths locate the females of their own species, by tracing these compounds in species-specific ratios [1]. Offspring derived from this encounter is the cause of damage in crops.</p><br/><br/><br />
<br />
<p class="subpart">Pheromone-based Pest Control in Moths</p><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/fa/VUPVMoth.png" alt="moth_img"></img><br />
<p>Some experts indicate that "The direct management of insect pests using pheromones can provide excellent suppression of key lepidopteran pests in agriculture" [2]. If a high concentration of the major pheromone component (the most abundant pheromone for a specie) is present in the air, this may lead to a "nonresponsive outcome". Fatigue or adaptation of the male's pheromone sensory organs are the cause of this [2]. This strategy is called <b>mating disruption</b>.</p><br/><br />
<br />
<br/><p style="text-align: justify; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 1</span>. Healthy crop field.</p></div><br />
<br />
<br/><br />
<br />
<p>Traditional pest control strategies based on pesticides are non-specific and affect the target along with other species (bees, humans, etc.), which can cause ecological problems [3]. However, <b>pheromone-based pest control strategies</b> are more species-specific than pesticides and they target a narrower range of species. They have shown no effect on pest species outside of a "cropping system, reducing the risk of outbreak of a secondary pest.</p><br/><br/><br/><br/><br />
<br />
<p><span class="red-bold">Sexy Plant</span> uses this pheromone-based mating-disruption strategy to avoid damages in crops and becomes an environmentally-friendly choice in pest control.</p><br/><br/><br/><br/><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/problem"><strong>&larr; Go to Problem</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis"><strong>Go to Biosynthesis &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Vogel H, Heidel AJ, Heckel DG, Groot AT (2010) Transcriptome analysis of the sex pheromone gland of the noctuid moth Heliothis virescens. BMC Genomics 11: 29.</li><br />
<li>Welter SC, Pickel C, Millar J, Cave F, Steenwyk RAV, et al. (2005) Pheromone mating disruption offers selective management options for key pests. California Agriculture 59: 16-22.</li><br />
<li>Brittain C, Potts SG (2011) The potential impacts of insecticides on the life-history traits of bees and the consequences for pollination. Basic and Applied Ecology 12: 321-331.</li><br />
<br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/moths_behavior
Team:Valencia UPV/Project/modules/moths behavior
2014-10-18T02:42:49Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Moths Behaviour</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>oths <roja>B</roja>ehaviour<roja></span> </div><br/><br />
<br />
<p class="subpart">The Idea</p><br/><br />
<br />
<p>You better know your enemy before starting a fight. Moths, flying insects from the order Lepidoptera, cause great damage in crops all over the world. We aim to avoid damages caused by them, so understanding their behaviour is a main issue for us. We focused in their sexual behaviour to look for an elegant strategy to fight them.</p><br/><br/><br />
<br />
<p class="subpart">Moth Sexual Behavior</p><br/><br />
<br />
<p>Moth individuals within the same specie communicate with each other using volatile chemical compounds called “sex pheromones”. Female moths generate several pheromone compounds in their sex pheromone gland, at the tip of their abdomen, and release them in certain ratios. Male moths locate the females of their own species, by tracing these compounds in species-specific ratios [1]. Offspring derived from this encounter is the cause of damage in crops.</p><br/><br/><br />
<br />
<p class="subpart">Pheromone-based Pest Control in Moths</p><br/><br />
<br />
<div><br />
<img width="300px" style="float:right; margin-left: 15px;" src="https://static.igem.org/mediawiki/2014/f/fa/VUPVMoth.png" alt="moth_img"></img><br />
<p>Some experts indicate that "The direct management of insect pests using pheromones can provide excellent suppression of key lepidopteran pests in agriculture" [2]. If a high concentration of the major pheromone component (the most abundant pheromone for a specie) is present in the air, this may lead to a "nonresponsive outcome". Fatigue or adaptation of the male's pheromone sensory organs are the cause of this [2]. This strategy is called <b>mating disruption</b>.</p><br/><br />
<br />
<br/><p style="text-align: justify; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 1</span>. Healthy crop field.</p></div><br />
<br />
<br/><br />
<br />
<p>Traditional pest control strategies based on pesticides are non-specific and affect the target along with other species (bees, humans, etc.), which can cause ecological problems [3]. However, <b>pheromone-based pest control strategies</b> are more species-specific than pesticides and they target a narrower range of species. They have shown no effect on pest species outside of a "cropping system, reducing the risk of outbreak of a secondary pest.</p><br/><br/><br />
<br />
<p><span class="red-bold">Sexy Plant</span> uses this pheromone-based mating-disruption strategy to avoid damages in crops and becomes an environmentally-friendly choice in pest control.</p><br/><br/><br/><br/><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/problem"><strong>&larr; Go to Problem</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis"><strong>Go to Biosynthesis &rarr;</strong></a></div></br></br></br><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Vogel H, Heidel AJ, Heckel DG, Groot AT (2010) Transcriptome analysis of the sex pheromone gland of the noctuid moth Heliothis virescens. BMC Genomics 11: 29.</li><br />
<li>Welter SC, Pickel C, Millar J, Cave F, Steenwyk RAV, et al. (2005) Pheromone mating disruption offers selective management options for key pests. California Agriculture 59: 16-22.</li><br />
<li>Brittain C, Potts SG (2011) The potential impacts of insecticides on the life-history traits of bees and the consequences for pollination. Basic and Applied Ecology 12: 321-331.</li><br />
<br />
</ol></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/style_css
Team:Valencia UPV/style css
2014-10-18T02:33:38Z
<p>Ivllobel: </p>
<hr />
<div><html><br />
<style><br />
@import url(http://fonts.googleapis.com/css?family=Coda:400,800|Open+Sans:400,800,700,600,400italic,600italic,300italic,300,700italic,800italic&subset=latin,cyrillic);<br />
body<br />
{ <br />
background-color: #FFFFFF;<br />
}<br />
<br />
#top-section { /*Sets the wiki default box size */<br />
height:0px;<br />
width:100%;<br />
border:none;<br />
}<br />
<br />
#p-logo {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;}<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
.container{<br />
max-width: 920px;<br />
min-width:600px;<br />
margin: 0 auto;<br />
display: block !important;<br />
-webkit-backface-visibility: hidden; <br />
position: relative; <br />
}<br />
<br />
#space-margin<br />
{<br />
height: 100px;<br />
background-color: transparent;<br />
}<br />
<br />
#cn-box{ /*External content box*/<br />
position: relative;<br />
width: 850px;<br />
padding: 15px;<br />
font-size: 1.175em;<br />
font-family: 'Open Sans', 'Helvetica Neue', 'HelveticaNeue', sans-serif;<br />
<br />
}<br />
<br />
#text-content{<br />
font-size: 1.4em;<br />
}<br />
<br />
.button-content{<br />
padding: 7px;<br />
height: auto;<br />
background-color: #C00000;<br />
max-width: 300px;<br />
text-decoration: none;<br />
}<br />
<br />
.button-content-trans{<br />
padding: 7px;<br />
height: auto;<br />
width: 120px;<br />
background-color: transparent;<br />
max-width: 300px;<br />
text-decoration: none;<br />
}<br />
<br />
.button-content:hover{<br />
<br />
background-color: #fe0100;<br />
text-decoration: none;<br />
<br />
}<br />
<br />
.emphasize<br />
{<br />
text-decoration: underline;<br />
color: blue;<br />
}<br />
<br />
.vectorial<br />
{<br />
text-decoration: overline;<br />
}<br />
<br />
.table-width<br />
{<br />
width: 640px;<br />
padding-top: 40px;<br />
padding-right: 65px;<br />
}<br />
<br />
.spon<br />
{<br />
width: 250px;<br />
}<br />
<br />
<br />
.link-page{<br />
margin: 40px;<br />
display: inline;<br />
<br />
}<br />
<br />
.link-page<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
.link-page:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
.normal-link-page<br />
{<br />
color: blue;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
<br />
.normal-link-page:hover<br />
{<br />
color: #00BFFF;<br />
text-decoration: none;<br />
}<br />
<br />
#goto-left<br />
{<br />
float: left;<br />
color: #FFFFFF;<br />
}<br />
<br />
#goto-middle<br />
{<br />
color: #FFFFFF;<br />
}<br />
<br />
#goto-right<br />
{<br />
float: right;<br />
color: #FFFFFF;<br />
}<br />
<br />
.coda <br />
{<br />
font-family: 'Coda', sans-serif;<br />
font-weight:bold;<br />
font-size: 2em;<br />
color: white;<br />
text-shadow:<br />
-1px -1px 0 #000, <br />
1px -1px 0 #000,<br />
-1px 1px 0 #000,<br />
1px 1px 0 #000;<br />
}<br />
<br />
roja<br />
{<br />
font-style:normal;<br />
color: rgb(255, 0, 0);<br />
<br />
}<br />
<br />
.modules<br />
{<br />
height: 150px;<br />
width: 150px;<br />
padding: 10px;<br />
/*border: 2px solid yellow;*/<br />
margin: 15px;<br />
}<br />
<br />
.results<br />
{<br />
height: 180px;<br />
width: 180px;<br />
padding: 10px;<br />
/*border: 2px solid yellow;*/<br />
margin: 15px;<br />
}<br />
<br />
/*HEADER MENU STYLE*/<br />
<br />
.example <br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/b/bc/VUPVHeader_Sin_hoja_2.png) no-repeat center center; /* METER EL FONDO */<br />
background-size: cover;<br />
height:200px;<br />
width:100%;<br />
border:0px #000 solid;<br />
margin:0px;<br />
padding:0px;<br />
border-radius:3px;<br />
-moz-border-radius:3px;<br />
-webkit-border-radius:3px;<br />
}<br />
<br />
<br />
.menu <br />
{<br />
background-color:#c00000;<br />
text-align:center;<br />
width:100%;<br />
position: absolute;<br />
top: 159px;<br />
}<br />
<br />
.menu > span <br />
{<br />
display:inline-block;<br />
margin:0 auto;<br />
height: 41px;/*It modifies the menu bar height*/<br />
}<br />
<br />
#nav<br />
{<br />
display:inline;<br />
text-align:center;<br />
position:relative;<br />
list-style-type:none;<br />
}<br />
<br />
#nav > li <br />
{<br />
float:left;<br />
padding:0;<br />
position:relative;<br />
}<br />
<br />
#nav > li > a <br />
{<br />
border:1px solid transparent;<br />
color:#FFFFFF;<br />
display:block;<br />
font-size:1.5em;<br />
padding:10px 10px;<br />
position:relative;<br />
text-decoration:none;<br />
}<br />
<br />
#nav > li > a:hover <br />
{<br />
background-color:#fe0100;<br />
color: #FFFFFF;<br />
border-color:#999;<br />
}<br />
<br />
#nav > li.selected > a <br />
{<br />
background-color:#fe0100;<br />
color: #FFFFFF;<br />
border-color:#999999 #999999 #858B91;<br />
z-index:2;<br />
}<br />
<br />
#nav li div <br />
{<br />
position:relative;<br />
}<br />
<br />
#nav li div div<br />
{<br />
background-color:#FFFFFF;<br />
border:1px solid #999999;<br />
padding:12px 0;<br />
display:none;<br />
font-size:0.75em;<br />
margin:0;<br />
position:absolute;<br />
top:-1px;<br />
z-index:1;<br />
width:190px;<br />
}<br />
<br />
#nav li div div.wrp2 <br />
{<br />
width:380px;<br />
}<br />
<br />
#nav .sep <br />
{<br />
left:190px;<br />
border-left:1px solid #E3E3E3;<br />
bottom:0;<br />
height:auto;<br />
margin:15px 0;<br />
position:absolute;<br />
top:0;<br />
width:1px;<br />
}<br />
<br />
#nav li div ul <br />
{<br />
padding-left:10px;<br />
padding-right:10px;<br />
position:relative;<br />
width:170px;<br />
float:left;<br />
list-style-type:none;<br />
}<br />
<br />
#nav li div ul li <br />
{<br />
margin:0;<br />
padding:0;<br />
}<br />
<br />
#nav li div ul li h3 <br />
{<br />
border-bottom:1px solid #E3E3E3;<br />
color:#4F4F4F;<br />
font-weight:bold;<br />
margin:0 5px 4px;<br />
font-size:1.6em;<br />
padding-bottom:3px;<br />
padding-top:3px;<br />
}<br />
<br />
#nav li ul ul <br />
{<br />
padding:0 0 8px;<br />
}<br />
<br />
#nav li ul ul li <br />
{<br />
margin:0;<br />
padding:0;<br />
}<br />
<br />
#nav li ul li a <br />
{<br />
text-decoration:none; /* Level Team and Photogallery*/<br />
}<br />
<br />
#nav li ul ul li a <br />
{<br />
color:#0060A6;<br />
display:block;<br />
margin-bottom:1px;<br />
padding:3px 5px;<br />
text-decoration:none;<br />
font-size:1.5em;<br />
}<br />
<br />
#nav li ul ul li a:hover<br />
{<br />
background-color:#0060a6;<br />
color:#fff;<br />
}<br />
<br />
<br />
<br />
.n-title{<br />
display: inline;<br />
}<br />
<br />
#na-title{<br />
font-size: 2.5em;<br />
color: red;<br />
<br />
<br />
}<br />
<br />
.footer-ext{<br />
height: 250px;<br />
width: 75%;<br />
}<br />
<br />
.footer-text{<br />
padding: 15px;<br />
height: 250px;<br />
text-align: left;<br />
display: inline;<br />
float: left;<br />
<br />
}<br />
<br />
.footer-sponsors{<br />
padding: 15px;<br />
height: 250px;<br />
text-align: left;<br />
display: inline;<br />
float: left;<br />
<br />
}<br />
<br />
.team-img<br />
{<br />
background:url(https://static.igem.org/mediawiki/2014/0/07/VUPVTeam_logo.png) no-repeat center center; <br />
background-size: cover;<br />
width:120px;<br />
height:120px;<br />
z-index: 100;<br />
position: fixed;<br />
top: 2%;<br />
left: 1%;<br />
}<br />
<br />
.footer-img<br />
{<br />
/* METER EL FONDO */<br />
background:url(https://static.igem.org/mediawiki/2014/4/48/VUPV_Footer_trans_mod_3.png) no-repeat center center; <br />
background-size: cover;<br />
width:100%;<br />
height:108px;<br />
z-index: 100;<br />
padding:0px;<br />
margin:0px;<br />
border-radius:3px;<br />
-moz-border-radius:3px;<br />
-webkit-border-radius:3px;<br />
bottom: 0px;<br />
position: fixed;<br />
}<br />
<br />
.method li ul li<br />
{<br />
list-style-type: circle;<br />
margin-left: 25px;<br />
padding: 0px 0px 0px 5px;<br />
}<br />
<br />
.method > li<br />
{<br />
list-style-type: initial;<br />
margin-left: 20px;<br />
padding: initial;<br />
}<br />
<br />
<br />
<br />
.italic<br />
{<br />
font-style: italic;<br />
color: inherit;<br />
}<br />
<br />
.italic:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
.black-bold<br />
{<br />
color: black;<br />
font-weight: bold;<br />
}<br />
<br />
.green-bold<br />
{<br />
color: green;<br />
font-weight: bold;<br />
}<br />
<br />
.red-bold<br />
{<br />
color: #C00000;<br />
font-weight: bold;<br />
}<br />
<br />
.blue-bold<br />
{<br />
color: blue;<br />
font-weight: bold;<br />
}<br />
<br />
.purple-bold<br />
{<br />
color: purple;<br />
font-weight: bold;<br />
}<br />
<br />
.fucsia-bold<br />
{<br />
color: #FF00FF;<br />
font-weight: bold;<br />
}<br />
<br />
.marron-bold<br />
{<br />
color: #61210B;<br />
font-weight: bold;<br />
}<br />
<br />
<br />
.fucsia-bold:hover, .marron-bold:hover, .purple-bold:hover, .blue-bold:hover, .red-bold:hover, .green-bold:hover, .black-bold:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
.subpart<br />
{<br />
color: #006400;<br />
font-weight: bold;<br />
font-size: 1.15em;<br />
}<br />
<br />
<br />
#igem-link<br />
{<br />
position: relative; <br />
background: url(https://static.igem.org/mediawiki/2014/c/c6/VUPV_igem_non_selected.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
width: 131px; <br />
height: 100px;<br />
}<br />
<br />
#igem-link:hover<br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/a/ad/VUPV_igem_selected2.png) no-repeat center center; <br />
background-size: cover;<br />
}<br />
<br />
#follow-link<br />
{<br />
position: relative;<br />
background: url(https://static.igem.org/mediawiki/2014/6/6d/VUPVFollow_us.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
}<br />
<br />
#facebook-link<br />
{<br />
position: relative;<br />
background: url(https://static.igem.org/mediawiki/2014/f/f6/VUPV_facebook_non_selected.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
}<br />
<br />
#facebook-link:hover<br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/1/1e/VUPV_facebook_selected3.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
#twitter-link<br />
{<br />
position: relative; <br />
background: url(https://static.igem.org/mediawiki/2014/e/ec/VUPV_twitter2.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
}<br />
<br />
#twitter-link:hover<br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/1/14/VUPV_twitter_selected2.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
#mail-link<br />
{<br />
position: relative;<br />
background: url(https://static.igem.org/mediawiki/2014/5/57/VUPV_mail.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
}<br />
<br />
#mail-link:hover<br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/8/85/VUPV_mail_selected2.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
@media only screen and (max-width : 1024px)<br />
{<br />
<br />
.table-width<br />
{<br />
width: 500px;<br />
}<br />
<br />
.spon<br />
{<br />
width: 250px;<br />
}<br />
<br />
/*#spon-ibmcp<br />
{<br />
width: 400px;<br />
}*/<br />
<br />
.img-title<br />
{<br />
width: 70%;<br />
}<br />
<br />
/*.example <br />
{<br />
background-size: 105% 110%;<br />
height:200px;<br />
}<br />
<br />
.menu <br />
{<br />
top: 159px;<br />
}<br />
*/<br />
<br />
#nav > li > a <br />
{<br />
font-size:1.35em;<br />
}<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
<br />
}<br />
<br />
<br />
.footer-img<br />
{<br />
height:75px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 85%; <br />
top: 40px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 35px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 28%;<br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
#twitter-link<br />
{<br />
right: 12%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
#mail-link<br />
{<br />
left: 10%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
}<br />
<br />
<br />
@media only screen and (min-width : 1025px) and (max-width : 1280px)<br />
{<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
<br />
}<br />
<br />
.modules<br />
{<br />
height: 130px;<br />
width: 130px;<br />
}<br />
<br />
.results<br />
{<br />
height: 130px;<br />
width: 130px;<br />
}<br />
<br />
.spon<br />
{<br />
width: 220px;<br />
}<br />
<br />
/*#spon-ibmcp<br />
{<br />
width: 250px;<br />
}*/<br />
<br />
/*<br />
.example <br />
{<br />
background-size: cover;<br />
}<br />
<br />
.menu <br />
{<br />
top: 184px;<br />
}<br />
*/<br />
<br />
.footer-img<br />
{<br />
height:75px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 86%; <br />
top: 45px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 35px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 22%;<br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
#twitter-link<br />
{<br />
right: 5%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
#mail-link<br />
{<br />
left: 15%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
}<br />
<br />
<br />
@media only screen and (min-width : 1281px) and (max-width : 1366px)<br />
{<br />
<br />
<br />
.img-title<br />
{<br />
width: 75%;<br />
height: 75%;<br />
}<br />
<br />
.table-width<br />
{<br />
width: 550px;<br />
}<br />
<br />
.spon<br />
{<br />
width: 250px;<br />
}<br />
<br />
/*#spon-ibmcp<br />
{<br />
width: 480px;<br />
}*/<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
}<br />
<br />
.footer-img<br />
{<br />
height:75px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 86%; <br />
top: 45px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 35px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 21%;<br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#twitter-link<br />
{<br />
right: 4.5%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#mail-link<br />
{<br />
left: 14.25%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
}<br />
<br />
<br />
@media only screen and (min-width : 1367px)<br />
and (max-width : 1600px)<br />
{<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
<br />
}<br />
<br />
.footer-img<br />
{<br />
height:108px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 85%; <br />
top: 40px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 15px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 22%;<br />
bottom: 20px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#twitter-link<br />
{<br />
right: 5%; <br />
bottom: 20px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#mail-link<br />
{<br />
left: 15%; <br />
bottom: 20px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
<br />
}<br />
<br />
<br />
@media only screen and (min-width : 1601px)<br />
{<br />
<br />
#nav > li > a <br />
{<br />
font-size:1.5em; <br />
}<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
<br />
}<br />
<br />
.footer-img<br />
{<br />
height:100px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 85%; <br />
top: 40px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 25px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 22%;<br />
bottom: 30px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#twitter-link<br />
{<br />
right: 5%; <br />
bottom: 30px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#mail-link<br />
{<br />
left: 15%; <br />
bottom: 30px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
}<br />
<br />
<br />
.hook a<br />
{<br />
text-decoration: none;<br />
font-size: 0.80em;<br />
}<br />
<br />
ul {<br />
list-style:none; /* Button inside images*/<br />
}<br />
<br />
ul li a {<br />
text-decoration: none; /* Button inside images*/<br />
}<br />
<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td { <br />
margin:0;<br />
padding:0;<br />
}<br />
<br />
<br />
a{<br />
text-decoration: none;<br />
<br />
}<br />
<br />
.subtitles<br />
{<br />
<br />
font-size: 0.8em; <br />
width: 80%; <br />
text-align: justify;<br />
<br />
}<br />
<br />
.encabezado<br />
{<br />
color: #006230;<br />
font-weight: bold;<br />
<br />
}<br />
<br />
.encabezado:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
/*----- Tabs -----*/<br />
.tabs {<br />
width:100%;<br />
display:inline-block;<br />
}<br />
<br />
/*----- Tab Links -----*/<br />
/* Clearfix */<br />
.tab-links:after {<br />
display:block;<br />
clear:both;<br />
content:'';<br />
}<br />
<br />
.tab-links li {<br />
margin:0px 5px;<br />
float:left;<br />
list-style:none;<br />
}<br />
<br />
.tab-links a {<br />
padding:9px 15px;<br />
display:inline-block;<br />
border-radius:3px 3px 0px 0px;<br />
background:#7FB5DA;<br />
font-size:16px;<br />
font-weight:600;<br />
color:#4c4c4c;<br />
transition:all linear 1s;<br />
}<br />
<br />
.tab-links a:hover {<br />
background:#a7cce5;<br />
text-decoration:none;<br />
}<br />
<br />
li.active a, li.active a:hover {<br />
background:#fff;<br />
color:#4c4c4c;<br />
}<br />
<br />
/*----- Content of Tabs -----*/<br />
.tab-content {<br />
padding:15px;<br />
border-radius:3px;<br />
box-shadow:-1px 1px 1px rgba(0,0,0,0.15);<br />
background:#fff;<br />
}<br />
<br />
.tab {<br />
display:none;<br />
}<br />
<br />
.tab.active {<br />
display:block;<br />
}<br />
<br />
#pinned-footer<br />
{<br />
height: 25px;<br />
}<br />
<br />
dl {<br />
margin-bottom:50px;<br />
}<br />
<br />
dl dt {<br />
background:#C00000;<br />
color:#fff;<br />
float:left; <br />
font-weight:bold; <br />
margin-right:10px; <br />
padding:5px; <br />
width:100px; <br />
}<br />
<br />
dl dd {<br />
margin:2px 0; <br />
padding:5px 0;<br />
}<br />
<br />
.results_sli<br />
{<br />
background: #fff url(https://static.igem.org/mediawiki/2014/6/64/VUPVChromato_benta_off.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
.results_sli:hover<br />
{<br />
background: #fff url(https://static.igem.org/mediawiki/2014/2/2b/VUPVChromato_bentha_on.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
.normal-sangría<br />
{<br />
margin-left: 30px;<br />
}<br />
<br />
.background_medal<br />
{<br />
color: #fff;<br />
position: relative;<br />
top: 15px;<br />
left: -30px;<br />
z-index: -10;<br />
padding: 5px 60px 5px 35px;<br />
background: url(https://static.igem.org/mediawiki/2014/9/91/VUPVMedal_background.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
.medals-tick<br />
{<br />
margin-left: 130px;<br />
}<br />
<br />
.medals-tick li ul li<br />
{<br />
list-style: square;<br />
margin-left: 35px;<br />
}<br />
<br />
#bronze<br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2014/6/6b/VUPVTick_bronze.png');<br />
}<br />
<br />
#silver<br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2014/1/1f/VUPVTick_silver_mod.png');<br />
}<br />
<br />
#gold<br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2014/5/56/VUPVTick_golden_mod.png');<br />
}<br />
#green<br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2014/d/d0/VUPVTick_green_mod.png');<br />
}<br />
<br />
<br />
<br />
</style><br />
</html></div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/style_css
Team:Valencia UPV/style css
2014-10-18T02:33:29Z
<p>Ivllobel: </p>
<hr />
<div><html><br />
<style><br />
@import url(http://fonts.googleapis.com/css?family=Coda:400,800|Open+Sans:400,800,700,600,400italic,600italic,300italic,300,700italic,800italic&subset=latin,cyrillic);<br />
body<br />
{ <br />
background-color: #FFFFFF;<br />
}<br />
<br />
#top-section { /*Sets the wiki default box size */<br />
height:0px;<br />
width:100%;<br />
border:none;<br />
}<br />
<br />
#p-logo {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;}<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
.container{<br />
max-width: 920px;<br />
min-width:600px;<br />
margin: 0 auto;<br />
display: block !important;<br />
-webkit-backface-visibility: hidden; <br />
position: relative; <br />
}<br />
<br />
#space-margin<br />
{<br />
height: 100px;<br />
background-color: transparent;<br />
}<br />
<br />
#cn-box{ /*External content box*/<br />
position: relative;<br />
width: 850px;<br />
padding: 15px;<br />
font-size: 1.175em;<br />
font-family: 'Open Sans', 'Helvetica Neue', 'HelveticaNeue', sans-serif;<br />
<br />
}<br />
<br />
#text-content{<br />
font-size: 1.4em;<br />
}<br />
<br />
.button-content{<br />
padding: 7px;<br />
height: auto;<br />
background-color: #C00000;<br />
max-width: 300px;<br />
text-decoration: none;<br />
}<br />
<br />
.button-content-trans{<br />
padding: 7px;<br />
height: auto;<br />
width: 120px;<br />
background-color: transparent;<br />
max-width: 300px;<br />
text-decoration: none;<br />
}<br />
<br />
.button-content:hover{<br />
<br />
background-color: #fe0100;<br />
text-decoration: none;<br />
<br />
}<br />
<br />
.emphasize<br />
{<br />
text-decoration: underline;<br />
color: blue;<br />
}<br />
<br />
.vectorial<br />
{<br />
text-decoration: overline;<br />
}<br />
<br />
.table-width<br />
{<br />
width: 640px;<br />
padding-top: 40px;<br />
padding-right: 65px;<br />
}<br />
<br />
.spon<br />
{<br />
width: 250px;<br />
margin: 10px;<br />
}<br />
<br />
<br />
.link-page{<br />
margin: 40px;<br />
display: inline;<br />
<br />
}<br />
<br />
.link-page<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
.link-page:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
.normal-link-page<br />
{<br />
color: blue;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
<br />
.normal-link-page:hover<br />
{<br />
color: #00BFFF;<br />
text-decoration: none;<br />
}<br />
<br />
#goto-left<br />
{<br />
float: left;<br />
color: #FFFFFF;<br />
}<br />
<br />
#goto-middle<br />
{<br />
color: #FFFFFF;<br />
}<br />
<br />
#goto-right<br />
{<br />
float: right;<br />
color: #FFFFFF;<br />
}<br />
<br />
.coda <br />
{<br />
font-family: 'Coda', sans-serif;<br />
font-weight:bold;<br />
font-size: 2em;<br />
color: white;<br />
text-shadow:<br />
-1px -1px 0 #000, <br />
1px -1px 0 #000,<br />
-1px 1px 0 #000,<br />
1px 1px 0 #000;<br />
}<br />
<br />
roja<br />
{<br />
font-style:normal;<br />
color: rgb(255, 0, 0);<br />
<br />
}<br />
<br />
.modules<br />
{<br />
height: 150px;<br />
width: 150px;<br />
padding: 10px;<br />
/*border: 2px solid yellow;*/<br />
margin: 15px;<br />
}<br />
<br />
.results<br />
{<br />
height: 180px;<br />
width: 180px;<br />
padding: 10px;<br />
/*border: 2px solid yellow;*/<br />
margin: 15px;<br />
}<br />
<br />
/*HEADER MENU STYLE*/<br />
<br />
.example <br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/b/bc/VUPVHeader_Sin_hoja_2.png) no-repeat center center; /* METER EL FONDO */<br />
background-size: cover;<br />
height:200px;<br />
width:100%;<br />
border:0px #000 solid;<br />
margin:0px;<br />
padding:0px;<br />
border-radius:3px;<br />
-moz-border-radius:3px;<br />
-webkit-border-radius:3px;<br />
}<br />
<br />
<br />
.menu <br />
{<br />
background-color:#c00000;<br />
text-align:center;<br />
width:100%;<br />
position: absolute;<br />
top: 159px;<br />
}<br />
<br />
.menu > span <br />
{<br />
display:inline-block;<br />
margin:0 auto;<br />
height: 41px;/*It modifies the menu bar height*/<br />
}<br />
<br />
#nav<br />
{<br />
display:inline;<br />
text-align:center;<br />
position:relative;<br />
list-style-type:none;<br />
}<br />
<br />
#nav > li <br />
{<br />
float:left;<br />
padding:0;<br />
position:relative;<br />
}<br />
<br />
#nav > li > a <br />
{<br />
border:1px solid transparent;<br />
color:#FFFFFF;<br />
display:block;<br />
font-size:1.5em;<br />
padding:10px 10px;<br />
position:relative;<br />
text-decoration:none;<br />
}<br />
<br />
#nav > li > a:hover <br />
{<br />
background-color:#fe0100;<br />
color: #FFFFFF;<br />
border-color:#999;<br />
}<br />
<br />
#nav > li.selected > a <br />
{<br />
background-color:#fe0100;<br />
color: #FFFFFF;<br />
border-color:#999999 #999999 #858B91;<br />
z-index:2;<br />
}<br />
<br />
#nav li div <br />
{<br />
position:relative;<br />
}<br />
<br />
#nav li div div<br />
{<br />
background-color:#FFFFFF;<br />
border:1px solid #999999;<br />
padding:12px 0;<br />
display:none;<br />
font-size:0.75em;<br />
margin:0;<br />
position:absolute;<br />
top:-1px;<br />
z-index:1;<br />
width:190px;<br />
}<br />
<br />
#nav li div div.wrp2 <br />
{<br />
width:380px;<br />
}<br />
<br />
#nav .sep <br />
{<br />
left:190px;<br />
border-left:1px solid #E3E3E3;<br />
bottom:0;<br />
height:auto;<br />
margin:15px 0;<br />
position:absolute;<br />
top:0;<br />
width:1px;<br />
}<br />
<br />
#nav li div ul <br />
{<br />
padding-left:10px;<br />
padding-right:10px;<br />
position:relative;<br />
width:170px;<br />
float:left;<br />
list-style-type:none;<br />
}<br />
<br />
#nav li div ul li <br />
{<br />
margin:0;<br />
padding:0;<br />
}<br />
<br />
#nav li div ul li h3 <br />
{<br />
border-bottom:1px solid #E3E3E3;<br />
color:#4F4F4F;<br />
font-weight:bold;<br />
margin:0 5px 4px;<br />
font-size:1.6em;<br />
padding-bottom:3px;<br />
padding-top:3px;<br />
}<br />
<br />
#nav li ul ul <br />
{<br />
padding:0 0 8px;<br />
}<br />
<br />
#nav li ul ul li <br />
{<br />
margin:0;<br />
padding:0;<br />
}<br />
<br />
#nav li ul li a <br />
{<br />
text-decoration:none; /* Level Team and Photogallery*/<br />
}<br />
<br />
#nav li ul ul li a <br />
{<br />
color:#0060A6;<br />
display:block;<br />
margin-bottom:1px;<br />
padding:3px 5px;<br />
text-decoration:none;<br />
font-size:1.5em;<br />
}<br />
<br />
#nav li ul ul li a:hover<br />
{<br />
background-color:#0060a6;<br />
color:#fff;<br />
}<br />
<br />
<br />
<br />
.n-title{<br />
display: inline;<br />
}<br />
<br />
#na-title{<br />
font-size: 2.5em;<br />
color: red;<br />
<br />
<br />
}<br />
<br />
.footer-ext{<br />
height: 250px;<br />
width: 75%;<br />
}<br />
<br />
.footer-text{<br />
padding: 15px;<br />
height: 250px;<br />
text-align: left;<br />
display: inline;<br />
float: left;<br />
<br />
}<br />
<br />
.footer-sponsors{<br />
padding: 15px;<br />
height: 250px;<br />
text-align: left;<br />
display: inline;<br />
float: left;<br />
<br />
}<br />
<br />
.team-img<br />
{<br />
background:url(https://static.igem.org/mediawiki/2014/0/07/VUPVTeam_logo.png) no-repeat center center; <br />
background-size: cover;<br />
width:120px;<br />
height:120px;<br />
z-index: 100;<br />
position: fixed;<br />
top: 2%;<br />
left: 1%;<br />
}<br />
<br />
.footer-img<br />
{<br />
/* METER EL FONDO */<br />
background:url(https://static.igem.org/mediawiki/2014/4/48/VUPV_Footer_trans_mod_3.png) no-repeat center center; <br />
background-size: cover;<br />
width:100%;<br />
height:108px;<br />
z-index: 100;<br />
padding:0px;<br />
margin:0px;<br />
border-radius:3px;<br />
-moz-border-radius:3px;<br />
-webkit-border-radius:3px;<br />
bottom: 0px;<br />
position: fixed;<br />
}<br />
<br />
.method li ul li<br />
{<br />
list-style-type: circle;<br />
margin-left: 25px;<br />
padding: 0px 0px 0px 5px;<br />
}<br />
<br />
.method > li<br />
{<br />
list-style-type: initial;<br />
margin-left: 20px;<br />
padding: initial;<br />
}<br />
<br />
<br />
<br />
.italic<br />
{<br />
font-style: italic;<br />
color: inherit;<br />
}<br />
<br />
.italic:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
.black-bold<br />
{<br />
color: black;<br />
font-weight: bold;<br />
}<br />
<br />
.green-bold<br />
{<br />
color: green;<br />
font-weight: bold;<br />
}<br />
<br />
.red-bold<br />
{<br />
color: #C00000;<br />
font-weight: bold;<br />
}<br />
<br />
.blue-bold<br />
{<br />
color: blue;<br />
font-weight: bold;<br />
}<br />
<br />
.purple-bold<br />
{<br />
color: purple;<br />
font-weight: bold;<br />
}<br />
<br />
.fucsia-bold<br />
{<br />
color: #FF00FF;<br />
font-weight: bold;<br />
}<br />
<br />
.marron-bold<br />
{<br />
color: #61210B;<br />
font-weight: bold;<br />
}<br />
<br />
<br />
.fucsia-bold:hover, .marron-bold:hover, .purple-bold:hover, .blue-bold:hover, .red-bold:hover, .green-bold:hover, .black-bold:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
.subpart<br />
{<br />
color: #006400;<br />
font-weight: bold;<br />
font-size: 1.15em;<br />
}<br />
<br />
<br />
#igem-link<br />
{<br />
position: relative; <br />
background: url(https://static.igem.org/mediawiki/2014/c/c6/VUPV_igem_non_selected.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
width: 131px; <br />
height: 100px;<br />
}<br />
<br />
#igem-link:hover<br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/a/ad/VUPV_igem_selected2.png) no-repeat center center; <br />
background-size: cover;<br />
}<br />
<br />
#follow-link<br />
{<br />
position: relative;<br />
background: url(https://static.igem.org/mediawiki/2014/6/6d/VUPVFollow_us.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
}<br />
<br />
#facebook-link<br />
{<br />
position: relative;<br />
background: url(https://static.igem.org/mediawiki/2014/f/f6/VUPV_facebook_non_selected.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
}<br />
<br />
#facebook-link:hover<br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/1/1e/VUPV_facebook_selected3.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
#twitter-link<br />
{<br />
position: relative; <br />
background: url(https://static.igem.org/mediawiki/2014/e/ec/VUPV_twitter2.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
}<br />
<br />
#twitter-link:hover<br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/1/14/VUPV_twitter_selected2.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
#mail-link<br />
{<br />
position: relative;<br />
background: url(https://static.igem.org/mediawiki/2014/5/57/VUPV_mail.png) no-repeat center center; <br />
background-size: cover;<br />
/*border: 1px solid yellow;*/<br />
display: inline-block;<br />
}<br />
<br />
#mail-link:hover<br />
{<br />
background: url(https://static.igem.org/mediawiki/2014/8/85/VUPV_mail_selected2.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
@media only screen and (max-width : 1024px)<br />
{<br />
<br />
.table-width<br />
{<br />
width: 500px;<br />
}<br />
<br />
.spon<br />
{<br />
width: 250px;<br />
}<br />
<br />
/*#spon-ibmcp<br />
{<br />
width: 400px;<br />
}*/<br />
<br />
.img-title<br />
{<br />
width: 70%;<br />
}<br />
<br />
/*.example <br />
{<br />
background-size: 105% 110%;<br />
height:200px;<br />
}<br />
<br />
.menu <br />
{<br />
top: 159px;<br />
}<br />
*/<br />
<br />
#nav > li > a <br />
{<br />
font-size:1.35em;<br />
}<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
<br />
}<br />
<br />
<br />
.footer-img<br />
{<br />
height:75px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 85%; <br />
top: 40px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 35px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 28%;<br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
#twitter-link<br />
{<br />
right: 12%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
#mail-link<br />
{<br />
left: 10%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
}<br />
<br />
<br />
@media only screen and (min-width : 1025px) and (max-width : 1280px)<br />
{<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
<br />
}<br />
<br />
.modules<br />
{<br />
height: 130px;<br />
width: 130px;<br />
}<br />
<br />
.results<br />
{<br />
height: 130px;<br />
width: 130px;<br />
}<br />
<br />
.spon<br />
{<br />
width: 220px;<br />
}<br />
<br />
/*#spon-ibmcp<br />
{<br />
width: 250px;<br />
}*/<br />
<br />
/*<br />
.example <br />
{<br />
background-size: cover;<br />
}<br />
<br />
.menu <br />
{<br />
top: 184px;<br />
}<br />
*/<br />
<br />
.footer-img<br />
{<br />
height:75px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 86%; <br />
top: 45px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 35px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 22%;<br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
#twitter-link<br />
{<br />
right: 5%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
#mail-link<br />
{<br />
left: 15%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
}<br />
<br />
<br />
@media only screen and (min-width : 1281px) and (max-width : 1366px)<br />
{<br />
<br />
<br />
.img-title<br />
{<br />
width: 75%;<br />
height: 75%;<br />
}<br />
<br />
.table-width<br />
{<br />
width: 550px;<br />
}<br />
<br />
.spon<br />
{<br />
width: 250px;<br />
}<br />
<br />
/*#spon-ibmcp<br />
{<br />
width: 480px;<br />
}*/<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
}<br />
<br />
.footer-img<br />
{<br />
height:75px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 86%; <br />
top: 45px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 35px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 21%;<br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#twitter-link<br />
{<br />
right: 4.5%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#mail-link<br />
{<br />
left: 14.25%; <br />
bottom: 50px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
}<br />
<br />
<br />
@media only screen and (min-width : 1367px)<br />
and (max-width : 1600px)<br />
{<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
<br />
}<br />
<br />
.footer-img<br />
{<br />
height:108px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 85%; <br />
top: 40px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 15px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 22%;<br />
bottom: 20px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#twitter-link<br />
{<br />
right: 5%; <br />
bottom: 20px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#mail-link<br />
{<br />
left: 15%; <br />
bottom: 20px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
<br />
}<br />
<br />
<br />
@media only screen and (min-width : 1601px)<br />
{<br />
<br />
#nav > li > a <br />
{<br />
font-size:1.5em; <br />
}<br />
<br />
#cn-box{ /*External content box*/<br />
/* width: 78%; */<br />
padding: 15px;<br />
font-size: 1.175em;<br />
<br />
}<br />
<br />
.footer-img<br />
{<br />
height:100px;<br />
}<br />
<br />
#igem-link<br />
{<br />
left: 85%; <br />
top: 40px;<br />
width: 105px;<br />
height: 80px;<br />
}<br />
<br />
<br />
#follow-link<br />
{<br />
right: 35%;<br />
bottom: 25px;<br />
width: 175px; <br />
height: 125px;<br />
}<br />
<br />
<br />
#facebook-link<br />
{<br />
right: 22%;<br />
bottom: 30px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#twitter-link<br />
{<br />
right: 5%; <br />
bottom: 30px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
#mail-link<br />
{<br />
left: 15%; <br />
bottom: 30px;<br />
width: 50px; <br />
height: 50px;<br />
}<br />
<br />
<br />
}<br />
<br />
<br />
.hook a<br />
{<br />
text-decoration: none;<br />
font-size: 0.80em;<br />
}<br />
<br />
ul {<br />
list-style:none; /* Button inside images*/<br />
}<br />
<br />
ul li a {<br />
text-decoration: none; /* Button inside images*/<br />
}<br />
<br />
body,div,dl,dt,dd,ul,ol,li,h1,h2,h3,h4,h5,h6,pre,form,fieldset,input,textarea,p,blockquote,th,td { <br />
margin:0;<br />
padding:0;<br />
}<br />
<br />
<br />
a{<br />
text-decoration: none;<br />
<br />
}<br />
<br />
.subtitles<br />
{<br />
<br />
font-size: 0.8em; <br />
width: 80%; <br />
text-align: justify;<br />
<br />
}<br />
<br />
.encabezado<br />
{<br />
color: #006230;<br />
font-weight: bold;<br />
<br />
}<br />
<br />
.encabezado:hover<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
<br />
<br />
<br />
.p_notebook {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
margin-right: 0px;<br />
margin-left: 0px; <br />
}<br />
<br />
.normal-table<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr td<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
.normal-table tr th<br />
{<br />
border: 1px solid black;<br />
margin: 0px;<br />
padding: 15px;<br />
white-space: normal;<br />
table-layout: normal;<br />
background: transparent;<br />
<br />
}<br />
<br />
/*----- Tabs -----*/<br />
.tabs {<br />
width:100%;<br />
display:inline-block;<br />
}<br />
<br />
/*----- Tab Links -----*/<br />
/* Clearfix */<br />
.tab-links:after {<br />
display:block;<br />
clear:both;<br />
content:'';<br />
}<br />
<br />
.tab-links li {<br />
margin:0px 5px;<br />
float:left;<br />
list-style:none;<br />
}<br />
<br />
.tab-links a {<br />
padding:9px 15px;<br />
display:inline-block;<br />
border-radius:3px 3px 0px 0px;<br />
background:#7FB5DA;<br />
font-size:16px;<br />
font-weight:600;<br />
color:#4c4c4c;<br />
transition:all linear 1s;<br />
}<br />
<br />
.tab-links a:hover {<br />
background:#a7cce5;<br />
text-decoration:none;<br />
}<br />
<br />
li.active a, li.active a:hover {<br />
background:#fff;<br />
color:#4c4c4c;<br />
}<br />
<br />
/*----- Content of Tabs -----*/<br />
.tab-content {<br />
padding:15px;<br />
border-radius:3px;<br />
box-shadow:-1px 1px 1px rgba(0,0,0,0.15);<br />
background:#fff;<br />
}<br />
<br />
.tab {<br />
display:none;<br />
}<br />
<br />
.tab.active {<br />
display:block;<br />
}<br />
<br />
#pinned-footer<br />
{<br />
height: 25px;<br />
}<br />
<br />
dl {<br />
margin-bottom:50px;<br />
}<br />
<br />
dl dt {<br />
background:#C00000;<br />
color:#fff;<br />
float:left; <br />
font-weight:bold; <br />
margin-right:10px; <br />
padding:5px; <br />
width:100px; <br />
}<br />
<br />
dl dd {<br />
margin:2px 0; <br />
padding:5px 0;<br />
}<br />
<br />
.results_sli<br />
{<br />
background: #fff url(https://static.igem.org/mediawiki/2014/6/64/VUPVChromato_benta_off.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
.results_sli:hover<br />
{<br />
background: #fff url(https://static.igem.org/mediawiki/2014/2/2b/VUPVChromato_bentha_on.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
.normal-sangría<br />
{<br />
margin-left: 30px;<br />
}<br />
<br />
.background_medal<br />
{<br />
color: #fff;<br />
position: relative;<br />
top: 15px;<br />
left: -30px;<br />
z-index: -10;<br />
padding: 5px 60px 5px 35px;<br />
background: url(https://static.igem.org/mediawiki/2014/9/91/VUPVMedal_background.png) no-repeat center center;<br />
background-size: cover;<br />
}<br />
<br />
.medals-tick<br />
{<br />
margin-left: 130px;<br />
}<br />
<br />
.medals-tick li ul li<br />
{<br />
list-style: square;<br />
margin-left: 35px;<br />
}<br />
<br />
#bronze<br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2014/6/6b/VUPVTick_bronze.png');<br />
}<br />
<br />
#silver<br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2014/1/1f/VUPVTick_silver_mod.png');<br />
}<br />
<br />
#gold<br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2014/5/56/VUPVTick_golden_mod.png');<br />
}<br />
#green<br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2014/d/d0/VUPVTick_green_mod.png');<br />
}<br />
<br />
<br />
<br />
</style><br />
</html></div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Sponsors
Team:Valencia UPV/Sponsors
2014-10-18T02:33:07Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" text-align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Sponsors</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>ponsors</span> </div><br/><br/><br />
<br />
<br />
<a target="_blank" href="http://www.upv.es/index-en.html"><img class="spon" alt="upv_logo" title="Universidad Politécnica de Valencia" src="https://static.igem.org/mediawiki/2014/2/2d/VUPV-modificated.jpg"></a><br />
<br />
<br />
<a target="_blank" href="http://www.ibmcp.upv.es/index_en.php"><img class="spon" id="spon-ibmcp" alt="ibmcp_csic_logo" title="IBMCP & CSIC" src="https://static.igem.org/mediawiki/2014/9/91/VUPVIBMCP.png"></a><br />
<br />
<a target="_blank" href="http://www.dival.es/"><img class="spon" alt="diputacion_val_logo" title="Diputación de Valencia" src="https://static.igem.org/mediawiki/2014/9/98/VUPV_DIP-mod.png"></a><br />
<br />
<a target="_blank" href="http://www.etsii.upv.es/index-es.php"><img class="spon" alt="etsii_upv_logo" title="Escuela Técnica Superior de Ingenieros Industriales" src="https://static.igem.org/mediawiki/2014/3/39/VUPVETSII_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.cropscience.bayer.com/"><img class="spon" id="spon-bayer" alt="bayer_cropscience_logo" title="Bayer Cropscience" src="https://static.igem.org/mediawiki/2014/f/fb/VUPVBayer_cropscience.png"></a><br />
<br />
<a target="_blank" href="http://www.upv.es/iam/ingles/bienvenida.htm"><img class="spon" alt="ceqa" title="CEQA" src="https://static.igem.org/mediawiki/2014/f/f0/VUPVCEQA_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.csic.es/web/guest/home"><img class="spon" alt="csic" title="CSIC" src="https://static.igem.org/mediawiki/2014/2/2f/VUPVCsic.jpg"></a><br />
<br />
<a target="_blank" href="http://www.neb.com/"><img class="spon" alt="NEB" title="New England BioLabs" src="https://static.igem.org/mediawiki/2014/7/75/VUPVNeb.png"></a><br />
<br />
<a target="_blank" href="http://eu.idtdna.com/site"><img class="spon" alt="IDT" title="IDT" src="https://static.igem.org/mediawiki/2014/2/22/IDT-Logo.jpg"></a><br />
<br />
<br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Sponsors
Team:Valencia UPV/Sponsors
2014-10-18T02:32:28Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" text-align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Sponsors</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>ponsors</span> </div><br/><br/><br />
<br />
<br />
<a target="_blank" href="http://www.upv.es/index-en.html"><img class="spon" alt="upv_logo" title="Universidad Politécnica de Valencia" src="https://static.igem.org/mediawiki/2014/2/2d/VUPV-modificated.jpg"></a><br />
<br />
<br />
<a target="_blank" href="http://www.ibmcp.upv.es/index_en.php"><img class="spon" id="spon-ibmcp" alt="ibmcp_csic_logo" title="IBMCP & CSIC" src="https://static.igem.org/mediawiki/2014/9/91/VUPVIBMCP.png"></a><br />
<br />
<a target="_blank" href="http://www.dival.es/"><img class="spon" alt="diputacion_val_logo" title="Diputación de Valencia" src="https://static.igem.org/mediawiki/2014/9/98/VUPV_DIP-mod.png"></a><br />
<br />
<a target="_blank" href="http://www.etsii.upv.es/index-es.php"><img class="spon" alt="etsii_upv_logo" title="Escuela Técnica Superior de Ingenieros Industriales" src="https://static.igem.org/mediawiki/2014/3/39/VUPVETSII_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.cropscience.bayer.com/"><img class="spon" id="spon-bayer" alt="bayer_cropscience_logo" title="Bayer Cropscience" src="https://static.igem.org/mediawiki/2014/f/fb/VUPVBayer_cropscience.png"></a><br />
<br />
<a target="_blank" href="http://www.upv.es/iam/ingles/bienvenida.htm"><img class="spon" alt="ceqa" title="CEQA" src="https://static.igem.org/mediawiki/2014/f/f0/VUPVCEQA_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.csic.es/web/guest/home"><img class="spon" width="1000px" alt="csic" title="CSIC" src="https://static.igem.org/mediawiki/2014/2/2f/VUPVCsic.jpg"></a><br />
<br />
<a target="_blank" href="http://www.neb.com/"><img class="spon" alt="NEB" title="New England BioLabs" src="https://static.igem.org/mediawiki/2014/7/75/VUPVNeb.png"></a><br />
<br />
<a target="_blank" href="http://eu.idtdna.com/site"><img class="spon" alt="IDT" title="IDT" src="https://static.igem.org/mediawiki/2014/2/22/IDT-Logo.jpg"></a><br />
<br />
<br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Sponsors
Team:Valencia UPV/Sponsors
2014-10-18T02:32:21Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" text-align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Sponsors</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>ponsors</span> </div><br/><br/><br />
<br />
<br />
<a target="_blank" href="http://www.upv.es/index-en.html"><img class="spon" alt="upv_logo" title="Universidad Politécnica de Valencia" src="https://static.igem.org/mediawiki/2014/2/2d/VUPV-modificated.jpg"></a><br />
<br />
<br />
<a target="_blank" href="http://www.ibmcp.upv.es/index_en.php"><img class="spon" id="spon-ibmcp" alt="ibmcp_csic_logo" title="IBMCP & CSIC" src="https://static.igem.org/mediawiki/2014/9/91/VUPVIBMCP.png"></a><br />
<br />
<a target="_blank" href="http://www.dival.es/"><img class="spon" alt="diputacion_val_logo" title="Diputación de Valencia" src="https://static.igem.org/mediawiki/2014/9/98/VUPV_DIP-mod.png"></a><br />
<br />
<a target="_blank" href="http://www.etsii.upv.es/index-es.php"><img class="spon" alt="etsii_upv_logo" title="Escuela Técnica Superior de Ingenieros Industriales" src="https://static.igem.org/mediawiki/2014/3/39/VUPVETSII_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.cropscience.bayer.com/"><img class="spon" id="spon-bayer" alt="bayer_cropscience_logo" title="Bayer Cropscience" src="https://static.igem.org/mediawiki/2014/f/fb/VUPVBayer_cropscience.png"></a><br />
<br />
<a target="_blank" href="http://www.upv.es/iam/ingles/bienvenida.htm"><img class="spon" alt="ceqa" title="CEQA" src="https://static.igem.org/mediawiki/2014/f/f0/VUPVCEQA_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.csic.es/web/guest/home"><img class="spon" width="500px" alt="csic" title="CSIC" src="https://static.igem.org/mediawiki/2014/2/2f/VUPVCsic.jpg"></a><br />
<br />
<a target="_blank" href="http://www.neb.com/"><img class="spon" alt="NEB" title="New England BioLabs" src="https://static.igem.org/mediawiki/2014/7/75/VUPVNeb.png"></a><br />
<br />
<a target="_blank" href="http://eu.idtdna.com/site"><img class="spon" alt="IDT" title="IDT" src="https://static.igem.org/mediawiki/2014/2/22/IDT-Logo.jpg"></a><br />
<br />
<br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Sponsors
Team:Valencia UPV/Sponsors
2014-10-18T02:32:14Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" text-align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Sponsors</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>ponsors</span> </div><br/><br/><br />
<br />
<br />
<a target="_blank" href="http://www.upv.es/index-en.html"><img class="spon" alt="upv_logo" title="Universidad Politécnica de Valencia" src="https://static.igem.org/mediawiki/2014/2/2d/VUPV-modificated.jpg"></a><br />
<br />
<br />
<a target="_blank" href="http://www.ibmcp.upv.es/index_en.php"><img class="spon" id="spon-ibmcp" alt="ibmcp_csic_logo" title="IBMCP & CSIC" src="https://static.igem.org/mediawiki/2014/9/91/VUPVIBMCP.png"></a><br />
<br />
<a target="_blank" href="http://www.dival.es/"><img class="spon" alt="diputacion_val_logo" title="Diputación de Valencia" src="https://static.igem.org/mediawiki/2014/9/98/VUPV_DIP-mod.png"></a><br />
<br />
<a target="_blank" href="http://www.etsii.upv.es/index-es.php"><img class="spon" alt="etsii_upv_logo" title="Escuela Técnica Superior de Ingenieros Industriales" src="https://static.igem.org/mediawiki/2014/3/39/VUPVETSII_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.cropscience.bayer.com/"><img class="spon" id="spon-bayer" alt="bayer_cropscience_logo" title="Bayer Cropscience" src="https://static.igem.org/mediawiki/2014/f/fb/VUPVBayer_cropscience.png"></a><br />
<br />
<a target="_blank" href="http://www.upv.es/iam/ingles/bienvenida.htm"><img class="spon" alt="ceqa" title="CEQA" src="https://static.igem.org/mediawiki/2014/f/f0/VUPVCEQA_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.csic.es/web/guest/home"><img class="spon" width="300px" alt="csic" title="CSIC" src="https://static.igem.org/mediawiki/2014/2/2f/VUPVCsic.jpg"></a><br />
<br />
<a target="_blank" href="http://www.neb.com/"><img class="spon" alt="NEB" title="New England BioLabs" src="https://static.igem.org/mediawiki/2014/7/75/VUPVNeb.png"></a><br />
<br />
<a target="_blank" href="http://eu.idtdna.com/site"><img class="spon" alt="IDT" title="IDT" src="https://static.igem.org/mediawiki/2014/2/22/IDT-Logo.jpg"></a><br />
<br />
<br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Sponsors
Team:Valencia UPV/Sponsors
2014-10-18T02:30:48Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" text-align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Sponsors</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>ponsors</span> </div><br/><br/><br />
<br />
<br />
<a target="_blank" href="http://www.upv.es/index-en.html"><img class="spon" alt="upv_logo" title="Universidad Politécnica de Valencia" src="https://static.igem.org/mediawiki/2014/2/2d/VUPV-modificated.jpg"></a><br />
<br />
<br />
<a target="_blank" href="http://www.ibmcp.upv.es/index_en.php"><img class="spon" id="spon-ibmcp" alt="ibmcp_csic_logo" title="IBMCP & CSIC" src="https://static.igem.org/mediawiki/2014/9/91/VUPVIBMCP.png"></a><br />
<br />
<a target="_blank" href="http://www.dival.es/"><img class="spon" alt="diputacion_val_logo" title="Diputación de Valencia" src="https://static.igem.org/mediawiki/2014/9/98/VUPV_DIP-mod.png"></a><br />
<br />
<a target="_blank" href="http://www.etsii.upv.es/index-es.php"><img class="spon" alt="etsii_upv_logo" title="Escuela Técnica Superior de Ingenieros Industriales" src="https://static.igem.org/mediawiki/2014/3/39/VUPVETSII_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.cropscience.bayer.com/"><img class="spon" id="spon-bayer" alt="bayer_cropscience_logo" title="Bayer Cropscience" src="https://static.igem.org/mediawiki/2014/f/fb/VUPVBayer_cropscience.png"></a><br />
<br />
<a target="_blank" href="http://www.upv.es/iam/ingles/bienvenida.htm"><img class="spon" alt="ceqa" title="CEQA" src="https://static.igem.org/mediawiki/2014/f/f0/VUPVCEQA_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.csic.es/web/guest/home"><img class="spon" alt="csic" title="CSIC" src="https://static.igem.org/mediawiki/2014/2/2f/VUPVCsic.jpg"></a><br />
<br />
<a target="_blank" href="http://www.neb.com/"><img class="spon" alt="NEB" title="New England BioLabs" src="https://static.igem.org/mediawiki/2014/7/75/VUPVNeb.png"></a><br />
<br />
<a target="_blank" href="http://eu.idtdna.com/site"><img class="spon" alt="IDT" title="IDT" src="https://static.igem.org/mediawiki/2014/2/22/IDT-Logo.jpg"></a><br />
<br />
<br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Sponsors
Team:Valencia UPV/Sponsors
2014-10-18T02:30:35Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" text-align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Sponsors</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>ponsors</span> </div><br/><br/><br />
<br />
<br />
<a target="_blank" href="http://www.upv.es/index-en.html"><img class="spon" alt="upv_logo" title="Universidad Politécnica de Valencia" src="https://static.igem.org/mediawiki/2014/2/2d/VUPV-modificated.jpg"></a><br />
<br />
<br />
<a target="_blank" href="http://www.ibmcp.upv.es/index_en.php"><img class="spon" id="spon-ibmcp" alt="ibmcp_csic_logo" title="IBMCP & CSIC" src="https://static.igem.org/mediawiki/2014/9/91/VUPVIBMCP.png"></a><br />
<br />
<a target="_blank" href="http://www.dival.es/"><img class="spon" alt="diputacion_val_logo" title="Diputación de Valencia" src="https://static.igem.org/mediawiki/2014/9/98/VUPV_DIP-mod.png"></a><br />
<br />
<a target="_blank" href="http://www.etsii.upv.es/index-es.php"><img class="spon" alt="etsii_upv_logo" title="Escuela Técnica Superior de Ingenieros Industriales" src="https://static.igem.org/mediawiki/2014/3/39/VUPVETSII_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.cropscience.bayer.com/"><img class="spon" id="spon-bayer" alt="bayer_cropscience_logo" title="Bayer Cropscience" src="https://static.igem.org/mediawiki/2014/f/fb/VUPVBayer_cropscience.png"></a><br />
<br />
<a target="_blank" href="http://www.upv.es/iam/ingles/bienvenida.htm"><img class="spon" alt="ceqa" title="CEQA" src="https://static.igem.org/mediawiki/2014/f/f0/VUPVCEQA_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.csic.es/web/guest/home"><img class="spon" alt="csic" title="CSIC" src="https://static.igem.org/mediawiki/2014/2/2f/VUPVCsic.jpg"></a><br />
<br />
<a target="_blank" href="https://www.neb.com/"><img class="spon" alt="NEB" title="New England BioLabs" src="https://static.igem.org/mediawiki/2014/7/75/VUPVNeb.png"></a><br />
<br />
<a target="_blank" href="http://eu.idtdna.com/site"><img class="spon" alt="IDT" title="IDT" src="https://static.igem.org/mediawiki/2014/2/22/IDT-Logo.jpg"></a><br />
<br />
<br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Sponsors
Team:Valencia UPV/Sponsors
2014-10-18T02:29:58Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" text-align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Sponsors</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>ponsors</span> </div><br/><br/><br />
<br />
<br />
<a target="_blank" href="http://www.upv.es/index-en.html"><img class="spon" alt="upv_logo" title="Universidad Politécnica de Valencia" src="https://static.igem.org/mediawiki/2014/2/2d/VUPV-modificated.jpg"></a><br />
<br />
<br />
<a target="_blank" href="http://www.ibmcp.upv.es/index_en.php"><img class="spon" id="spon-ibmcp" alt="ibmcp_csic_logo" title="IBMCP & CSIC" src="https://static.igem.org/mediawiki/2014/9/91/VUPVIBMCP.png"></a><br />
<br />
<a target="_blank" href="http://www.dival.es/"><img class="spon" alt="diputacion_val_logo" title="Diputación de Valencia" src="https://static.igem.org/mediawiki/2014/9/98/VUPV_DIP-mod.png"></a><br />
<br />
<a target="_blank" href="http://www.etsii.upv.es/index-es.php"><img class="spon" alt="etsii_upv_logo" title="Escuela Técnica Superior de Ingenieros Industriales" src="https://static.igem.org/mediawiki/2014/3/39/VUPVETSII_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.cropscience.bayer.com/"><img class="spon" id="spon-bayer" alt="bayer_cropscience_logo" title="Bayer Cropscience" src="https://static.igem.org/mediawiki/2014/f/fb/VUPVBayer_cropscience.png"></a><br />
<br />
<a target="_blank" href="http://www.upv.es/iam/ingles/bienvenida.htm"><img class="spon" alt="ceqa" title="CEQA" src="https://static.igem.org/mediawiki/2014/f/f0/VUPVCEQA_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.csic.es/web/guest/home"><img class="spon" alt="csic" title="CSIC" src="https://static.igem.org/mediawiki/2014/2/2f/VUPVCsic.jpg"></a><br />
<br />
<a target="_blank" href="https://www.neb.com/"><img class="spon" alt="NEB" title="New England BioLabs" src="https://static.igem.org/mediawiki/2014/7/75/VUPVNeb.png"></a><br />
<br />
<a target="_blank" href="http://www.csic.es/web/guest/home"><img class="spon" alt="IDT" title="IDT" src="http://eu.idtdna.com/site"></a><br />
<br />
<br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/File:VUPVNeb.png
File:VUPVNeb.png
2014-10-18T02:28:16Z
<p>Ivllobel: </p>
<hr />
<div></div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb
Team:Valencia UPV/Project/modules/methodology/gb
2014-10-18T02:25:38Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<br />
<div align="center"><br />
<br />
<div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>GoldenBraid</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>he <roja>G</roja>olden<roja>B</roja>raid <roja>c</roja>loning <roja>s</roja>trategy</span> </div><br/><br />
<p>Our Sexy Plant is a challenging project for many reasons; a very important one is that we use plants as chassis for engineering. Plants have eukaryotic gene structure, make use of plant-specific regulatory regions and require special T-vectors for transformation, among other special features. Consequently, DNA repositories and DNA assembly standards need certain adaptations to facilitate engineering using plant chassis. Without letting aside BioBricks, we decided to use the GoldenBraid system (GB) to build several of the intermediate genetic constructs employed in this project. GB is a DNA assembly system specially conceived to facilitate genetic engineering in Plant Synthetic Biology projects (visit <a href="http://gbcloning.org" class="normal-link-page" target="_blank">gbcloning.org</a> for more information). </p><br />
<br />
<br/><br />
<p>As BioBricks, GB is a modular cloning strategy that allows the fabrication of new devices by the combination of prefabricated standard modules. A difference between both strategies is that BioBricks is based on type II enzymes and GB relies on the use of type IIS restriction enzymes.</p><br />
<br />
<br/><br />
<br />
<p>Type IIS restriction enzymes, unlike type II enzymes; cleave DNA at a defined distance from their recognition sites, not requiring any specific sequence in the cleavage site. Since there are no sequence requirements in the cleavage sites, these can be defined by the user and adapted to serve as standard fusion sites to DNA parts. The enzymes used in GoldenBraid are BsaI and BsmBI, which cut out from their binding sites generating 4 base overhangs.</p> <br />
<br />
</br></br><br />
<br />
<div align="center"><img width="650px" src="https://static.igem.org/mediawiki/2014/9/91/VUPV_Gb1.png" alt="solid_phase_extraction" title="Figure 1. Comparison between type II and type IIS restriction enzymes"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 1</b>. Comparison between type II and type IIS restriction enzymes</p></div><br/><br />
<br />
<h3> GoldenBraid step by step</h3> <br/><br />
<h4> 1. <u>GB Domestication</u> </h4><br />
<p><br />
The first step in the GB cloning strategy is the adaptation of the DNA sequence to the GB standard. This process is called domestication and implies (1) the removal of internal restriction sites for the enzymes used in GB (BsaI, BsmBI and BtgZI) and (2) the addition of appropriate 4-nt flanking overhangs to convert the DNA sequence into a standard part (Gbpart). Gbparts are the minimal standard building blocks and they are classified in different categories according to their specific function. </p><br />
</br></br><br />
<p>There are three basic categories that define the most common parts making up a transcriptional unit. These part categories are PROM (GGAG-AATG), CDS (AATG-GCTT) and TER (GCTT-CGCT) and were the most used on this project.</p><br />
</br></br><br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/f/fc/VUPV_Gb2.png" alt="solid_phase_extraction" title="Figure 2. Part categories of a basic GoldenBraid trancriptional unit. Promoter’s (PROM) prefix is GGAG and its suffix is AATG, which is the same as the coding region’s (CDS) prefix. The same happens with the CDS and the terminator (TER), which share the part identity overhang GCTT, the first one as its suffix and the second one as its prefix."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 2</b>. Part categories of a basic GoldenBraid trancriptional unit. Promoter’s (PROM) prefix is GGAG and its suffix is AATG, which is the same as the coding region’s (CDS) prefix. The same happens with the CDS and the terminator (TER), which share the part identity overhang GCTT, the first one as its suffix and the second one as its prefix.</p></div><br/><br />
<br />
<p>The mutagenesis procedure required to remove internal restriction sites is standardized and involves the amplification of the target DNA in separated fragments (GBpatches) using GB-adapted primers, which incorporate single mismatches to disrupt the enzyme target sites. Once amplified, GBpatches are reassembled together in a single-tube BsmBI restriction-ligation reaction into the universal entry vector (pUPD) to yield a domesticated GBpart</p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/9/9a/VUPV_Gb3.png" alt="solid_phase_extraction" title="Figure 3. Domestication strategy with removal of internal restriction sites. Internal Type IIs recognition sites (exemplified here with the GGTCTC BsaI recognition site) are mutagenized during domestication following a standard procedure. In addition to the GB.F and GB.R primers that amplify the whole fragment, two other primers (M.F and M.R) are required for mutagenesis, which incorporate the flanking BsmBI overhangs and the single nucleotide change (C>M). Each primer pair is used to amplify a GBpatch by PCR, and the resulting fragments are assembled together in a BsmBI restriction-ligation reaction into pUPD. The resulting GBpart is free of internal recognition sites and can be released from pUPD using BsaI or BtgZI."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 3</b>. Domestication strategy with removal of internal restriction sites. Internal Type IIs recognition sites (exemplified here with the GGTCTC BsaI recognition site) are mutagenized during domestication following a standard procedure. In addition to the GB.F and GB.R primers that amplify the whole fragment, two other primers (M.F and M.R) are required for mutagenesis, which incorporate the flanking BsmBI overhangs and the single nucleotide change (C>M). Each primer pair is used to amplify a GBpatch by PCR, and the resulting fragments are assembled together in a BsmBI restriction-ligation reaction into pUPD. The resulting GBpart is free of internal recognition sites and can be released from pUPD using BsaI or BtgZI.</p></div><br/><br />
<br />
<br/><br />
<h4> 2. <u>GB Multipartite assemblies </u></h4><br />
<br />
<br/><br />
<br />
<p>Domesticated GBparts can now be assembled together in a one-tube-one-step reaction to create a Transcriptional Unit (TU). GB uses the Golden Gate multipartite reaction to create transcriptional units (TU). By using special GB destination vectors in the reaction, we make sure that the resulting TUs can be subsequently used to build multigene constructs (constructs comprising several TUs within the same destination plasmid). GB destination vectors are T-plasmids, a special type of plasmids used for plant transformation. Therefore the new TUs assembled in GB vectors can be directly transferred into plants using Agrobacterium-mediated plant transformation.</p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/a/a1/VUPV_Gb4.png" alt="solid_phase_extraction" title="Figure 4. Schema of a GoldenGate reaction. All the DNA parts composing a basic structure (PROM, CDS and TER) are mixed together in one tube with a GB destination plasmid, BsaI and T4 ligase. As result of the restriction-ligation reaction the correctly assembled transcriptional unit is obtained."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 4</b>. Schema of a GoldenGate reaction. All the DNA parts composing a basic structure (PROM, CDS and TER) are mixed together in one tube with a GB destination plasmid, BsaI and T4 ligase. As result of the restriction-ligation reaction the correctly assembled transcriptional unit is obtained.</p></div><br/><br />
<br />
<br />
<br/><br />
<h4> 3. <u>GB binary assemblies </u></h4><br />
<br />
<br/><br />
<br />
<p>Multigene constructs are important in Plant Synthetic Biology because they allow several TUs to be jointly transferred to the plant genome. Co-transformed TUs are expressed coordinately and eventually inherited together, avoiding lengthy breeding strategies.</p><br />
</br></br><br />
<br />
<p>GB-made TUs can be combined using GB binary assemblies to create increasingly complex multigenic structures. The special orientation and disposition of the restriction sites in the GB destination vectors defines two levels of destination plasmids: the α plasmids used for BsaI reactions and the Ω plasmids, which are used for BsmBI GB reactions. </p><br />
</br></br><br />
<br />
<p>The double loop topology of the GB cloning strategy allows an indefinite growth of the constructs through iterative binary assembly steps. By choosing the appropriate combinations of expression and destination vectors, increasingly complex multigenic modules are created.</p><br />
</br></br><br />
<br />
<p>We used this strategy to build and transform in N. benthamiana a multigene construct encoding the last 3 enzymatic steps of the synthesis of a moth pheromone. </p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/3/33/VUPV_Gb5.png" alt="solid_phase_extraction" title="Figure 5. Schema of a GoldenBraid reaction. Two TUs assembled in complementary α-level plasmids are combined in a Ω-level destination vector to create a two genes module."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 5</b>. Schema of a GoldenBraid reaction. Two TUs assembled in complementary α-level plasmids are combined in a Ω-level destination vector to create a two genes module.</p></div><br/><br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/switch"><strong>&larr; Go to Switch</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/flowchart"><strong>Go to Flowchart &rarr;</strong></a></div></br></br></br><br/><br />
<br />
<br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Engler C, Gruetzner R, Kandzia R, Marillonnet S (2009) Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One 4 (5):e5553. doi:10.1371/journal.pone.0005553</li><br/><br />
<li>Sarrion-Perdigones, A., Falconi, E.E., Zandalinas, S.I., Juarez, P., Fernandez-Del-Carmen, A., Granell, A. and Orzaez, D. (2011) GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS One 6, e21622</li><br />
<li>Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D (2013) GoldenBraid2.0: A comprehensive DNA assembly framework for Plant Synthetic Biology. Plant Physiol </li> <br />
</ol><br/><br/><br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<div id="space-margin"></div><br />
<br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/flowchart
Team:Valencia UPV/Project/modules/methodology/flowchart
2014-10-18T02:22:28Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Flowchart</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>F</roja>lowchart</span> </div><br/><br/><br />
<br />
<p>All the parts we used were either obtained by PCR or ordered by GBlocks. Sequences need have the appropiate flanking sequences so they can be ligated into a pUPD vector and transformed into <i>E. coli DH5alpha</i>. Transformed cells are cultured in solid LB plates supplied with ampicilin and grown at 37&deg;C. Colonies are picked and grown in liquid LB with shaking at 37&deg;C. Minipreps are done from liquid culture and digestions were performed to check whether they are correct. Parts are then sequenced to ensure no mutation occurred during the PCR process.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/3/39/VUPVflowchart_1_parts.jpg" alt="Flowchart - parts"> <br/><br />
<br />
<br />
<p><br/>Parts can be assembled into transcriptional units in an alpha vector provided that they follow the GoldenBraid 2.0 grammar. Once transcriptional units are constructed an iterative loop of binary assemblies can be performed using alpha and omega vectors in order to obtain the final construction.</p><br/><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/8/89/VUPVflowchart_2_assembly.jpg" alt="Flowchart - assembly"> <br/></br></br><br/></br><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb"><strong>&larr; Go to GoldenBraid</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>Go to Parts Construction &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb
Team:Valencia UPV/Project/modules/methodology/gb
2014-10-18T02:21:57Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<br />
<div align="center"><br />
<br />
<div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>GoldenBraid</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>he <roja>G</roja>olden<roja>B</roja>raid <roja>c</roja>loning <roja>s</roja>trategy</span> </div><br/><br />
<p>Our Sexy Plant is a challenging project for many reasons; a very important one is that we use plants as chassis for engineering. Plants have eukaryotic gene structure, make use of plant-specific regulatory regions and require special T-vectors for transformation, among other special features. Consequently, DNA repositories and DNA assembly standards need certain adaptations to facilitate engineering using plant chassis. Without letting aside BioBricks, we decided to use the GoldenBraid system (GB) to build several of the intermediate genetic constructs employed in this project. GB is a DNA assembly system specially conceived to facilitate genetic engineering in Plant Synthetic Biology projects (visit <a href="http://gbcloning.org" class="normal-link-page" target="_blank">gbcloning.org</a> for more information). </p><br />
<br />
<br/><br />
<p>As BioBricks, GB is a modular cloning strategy that allows the fabrication of new devices by the combination of prefabricated standard modules. A difference between both strategies is that BioBricks is based on type II enzymes and GB relies on the use of type IIS restriction enzymes.</p><br />
<br />
<br/><br />
<br />
<p>Type IIS restriction enzymes, unlike type II enzymes; cleave DNA at a defined distance from their recognition sites, not requiring any specific sequence in the cleavage site. Since there are no sequence requirements in the cleavage sites, these can be defined by the user and adapted to serve as standard fusion sites to DNA parts. The enzymes used in GoldenBraid are BsaI and BsmBI, which cut out from their binding sites generating 4 base overhangs.</p> <br />
<br />
</br></br><br />
<br />
<div align="center"><img width="650px" src="https://static.igem.org/mediawiki/2014/9/91/VUPV_Gb1.png" alt="solid_phase_extraction" title="Figure 1. Comparison between type II and type IIS restriction enzymes"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 1</b>. Comparison between type II and type IIS restriction enzymes</p></div><br/><br />
<br />
<h3> GoldenBraid step by step</h3> <br/><br />
<h4> 1. <u>GB Domestication</u> </h4><br />
<p><br />
The first step in the GB cloning strategy is the adaptation of the DNA sequence to the GB standard. This process is called domestication and implies (1) the removal of internal restriction sites for the enzymes used in GB (BsaI, BsmBI and BtgZI) and (2) the addition of appropriate 4-nt flanking overhangs to convert the DNA sequence into a standard part (Gbpart). Gbparts are the minimal standard building blocks and they are classified in different categories according to their specific function. </p><br />
</br></br><br />
<p>There are three basic categories that define the most common parts making up a transcriptional unit. These part categories are PROM (GGAG-AATG), CDS (AATG-GCTT) and TER (GCTT-CGCT) and were the most used on this project.</p><br />
</br></br><br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/f/fc/VUPV_Gb2.png" alt="solid_phase_extraction" title="Figure 2. Part categories of a basic GoldenBraid trancriptional unit. Promoter’s (PROM) prefix is GGAG and its suffix is AATG, which is the same as the coding region’s (CDS) prefix. The same happens with the CDS and the terminator (TER), which share the part identity overhang GCTT, the first one as its suffix and the second one as its prefix."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 2</b>. Part categories of a basic GoldenBraid trancriptional unit. Promoter’s (PROM) prefix is GGAG and its suffix is AATG, which is the same as the coding region’s (CDS) prefix. The same happens with the CDS and the terminator (TER), which share the part identity overhang GCTT, the first one as its suffix and the second one as its prefix.</p></div><br/><br />
<br />
<p>The mutagenesis procedure required to remove internal restriction sites is standardized and involves the amplification of the target DNA in separated fragments (GBpatches) using GB-adapted primers, which incorporate single mismatches to disrupt the enzyme target sites. Once amplified, GBpatches are reassembled together in a single-tube BsmBI restriction-ligation reaction into the universal entry vector (pUPD) to yield a domesticated GBpart</p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/9/9a/VUPV_Gb3.png" alt="solid_phase_extraction" title="Figure 3. Domestication strategy with removal of internal restriction sites. Internal Type IIs recognition sites (exemplified here with the GGTCTC BsaI recognition site) are mutagenized during domestication following a standard procedure. In addition to the GB.F and GB.R primers that amplify the whole fragment, two other primers (M.F and M.R) are required for mutagenesis, which incorporate the flanking BsmBI overhangs and the single nucleotide change (C>M). Each primer pair is used to amplify a GBpatch by PCR, and the resulting fragments are assembled together in a BsmBI restriction-ligation reaction into pUPD. The resulting GBpart is free of internal recognition sites and can be released from pUPD using BsaI or BtgZI."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 3</b>. Domestication strategy with removal of internal restriction sites. Internal Type IIs recognition sites (exemplified here with the GGTCTC BsaI recognition site) are mutagenized during domestication following a standard procedure. In addition to the GB.F and GB.R primers that amplify the whole fragment, two other primers (M.F and M.R) are required for mutagenesis, which incorporate the flanking BsmBI overhangs and the single nucleotide change (C>M). Each primer pair is used to amplify a GBpatch by PCR, and the resulting fragments are assembled together in a BsmBI restriction-ligation reaction into pUPD. The resulting GBpart is free of internal recognition sites and can be released from pUPD using BsaI or BtgZI.</p></div><br/><br />
<br />
<br/><br />
<h4> 2. <u>GB Multipartite assemblies </u></h4><br />
<br />
<br/><br />
<br />
<p>Domesticated GBparts can now be assembled together in a one-tube-one-step reaction to create a Transcriptional Unit (TU). GB uses the Golden Gate multipartite reaction to create transcriptional units (TU). By using special GB destination vectors in the reaction, we make sure that the resulting TUs can be subsequently used to build multigene constructs (constructs comprising several TUs within the same destination plasmid). GB destination vectors are T-plasmids, a special type of plasmids used for plant transformation. Therefore the new TUs assembled in GB vectors can be directly transferred into plants using Agrobacterium-mediated plant transformation.</p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/a/a1/VUPV_Gb4.png" alt="solid_phase_extraction" title="Figure 4. Schema of a GoldenGate reaction. All the DNA parts composing a basic structure (PROM, CDS and TER) are mixed together in one tube with a GB destination plasmid, BsaI and T4 ligase. As result of the restriction-ligation reaction the correctly assembled transcriptional unit is obtained."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 4</b>. Schema of a GoldenGate reaction. All the DNA parts composing a basic structure (PROM, CDS and TER) are mixed together in one tube with a GB destination plasmid, BsaI and T4 ligase. As result of the restriction-ligation reaction the correctly assembled transcriptional unit is obtained.</p></div><br/><br />
<br />
<br />
<br/><br />
<h4> 3. <u>GB binary assemblies </u></h4><br />
<br />
<br/><br />
<br />
<p>Multigene constructs are important in Plant Synthetic Biology because they allow several TUs to be jointly transferred to the plant genome. Co-transformed TUs are expressed coordinately and eventually inherited together, avoiding lengthy breeding strategies.</p><br />
</br></br><br />
<br />
<p>GB-made TUs can be combined using GB binary assemblies to create increasingly complex multigenic structures. The special orientation and disposition of the restriction sites in the GB destination vectors defines two levels of destination plasmids: the α plasmids used for BsaI reactions and the Ω plasmids, which are used for BsmBI GB reactions. </p><br />
</br></br><br />
<br />
<p>The double loop topology of the GB cloning strategy allows an indefinite growth of the constructs through iterative binary assembly steps. By choosing the appropriate combinations of expression and destination vectors, increasingly complex multigenic modules are created.</p><br />
</br></br><br />
<br />
<p>We used this strategy to build and transform in N. benthamiana a multigene construct encoding the last 3 enzymatic steps of the synthesis of a moth pheromone. </p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/3/33/VUPV_Gb5.png" alt="solid_phase_extraction" title="Figure 5. Schema of a GoldenBraid reaction. Two TUs assembled in complementary α-level plasmids are combined in a Ω-level destination vector to create a two genes module."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 5</b>. Schema of a GoldenBraid reaction. Two TUs assembled in complementary α-level plasmids are combined in a Ω-level destination vector to create a two genes module.</p></div><br/><br />
<br />
<br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>&larr; Go back to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety"><strong>Go to Biosafety &rarr;</strong></a></br></br></br><br />
</br></br><br />
<br />
<br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Engler C, Gruetzner R, Kandzia R, Marillonnet S (2009) Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One 4 (5):e5553. doi:10.1371/journal.pone.0005553</li><br/><br />
<li>Sarrion-Perdigones, A., Falconi, E.E., Zandalinas, S.I., Juarez, P., Fernandez-Del-Carmen, A., Granell, A. and Orzaez, D. (2011) GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS One 6, e21622</li><br />
<li>Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D (2013) GoldenBraid2.0: A comprehensive DNA assembly framework for Plant Synthetic Biology. Plant Physiol </li> <br />
</ol><br/><br/><br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<div id="space-margin"></div><br />
<br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction
Team:Valencia UPV/Project/modules/methodology/parts construction
2014-10-18T02:21:50Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Parts Construction</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>P</roja>arts <roja>C</roja>onstruction</span> </div><br/><br/><br />
<br />
<p>Our team used a Golden Gate based DNA cloning system, called GoldenBraid in order to construct the different DNA parts of our project. Unluckily, GoldenBraid 2.0 and BioBrick standard parts are different. The parts of the two systems have different flanking recognition sites and the overhangs obtained upon digestion are also different. Therefore, we needed a strategy to convert GoldenBraid standard parts to BioBricks.</p><br/><br />
<br />
<p>We sent 7 <a href="https://2014.igem.org/Team:Valencia_UPV/VUPV_Parts" class="normal-link-page">Parts</a> to the registry. Four of them, the coding sequences from <span class="blue-bold">AtrΔ11</span>, <span class="blue-bold">HarFAR</span> and <span class="blue-bold">EaDAcT</span> (Biosynthesis) and the <span class="blue-bold">TA29</span> promoter (Biosafety) were converted to the Biobrick standard in collaboration with the NRP-UEA-Norwich team, who very kindly provided us with their <a class="normal-link-page" href="https://2014.igem.org/Team:NRP-UEA-Norwich/Project_Mo-Flipper">Mo-Flippers</a>. These were modified pSB1C3 plasmids altered to include GoldenBraid restriction enzymes recognition sites.</p><br/><br />
<br />
<p>In addition, we designed a new vector that can be used to convert GoldenBraid multigenic assemblies into the BioBrick standard. This new vector is a modified pSB1A3 plasmid with two BsmBI recognition sites leaving upon BsmBI digestion overhangs that match the GoldenBraid 2.0 grammar (Figure 1). We called this new vector "omega undercover" as it works as the GoldenBraid 2.0 omega vector with a pSB1A3 backbone. This vector was sent to the Registry, so it can be used for future teams using Golden Gate based cloning strategies.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/4/45/VUPVomega_undercover.jpg" alt="pheromone_pathway" title="Pheromone Pathway" width="450px"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 1</span>."Omega undercover" vector.</p></div><br/><br />
<br />
<p>Using the omega undercover plasmid we constructed the remaining 2 Parts that were sent to the Registry (Figure 2). These were two biosafety devices that consisted of two modules, a male sterility module (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety">See Biosafety</a>) and an identity preservation module, expressing either <span class="blue-bold">yellow</span> or <span class="blue-bold">blue</span> chromoproteins.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/e/e2/VUPV_biosafety_constr_omega_undercover.jpg" width="450px"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-style: italic; font-size: 0.8em; width: 700px;"><span class="black-bold">Figure 2</span>.Construction of parts/devices <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1554004" class="normal-link-page">BBa_K1554004</a> and <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1554005" class="normal-link-page">BBa_K1554005</a>.</p></div><br/></br></br></br><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/flowchart"><strong>&larr; Go to Flowchart</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression"><strong>Go to Transient Gene Expression &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/flowchart
Team:Valencia UPV/Project/modules/methodology/flowchart
2014-10-18T02:21:37Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Flowchart</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>F</roja>lowchart</span> </div><br/><br/><br />
<br />
<p>All the parts we used were either obtained by PCR or ordered by GBlocks. Sequences need have the appropiate flanking sequences so they can be ligated into a pUPD vector and transformed into <i>E. coli DH5alpha</i>. Transformed cells are cultured in solid LB plates supplied with ampicilin and grown at 37&deg;C. Colonies are picked and grown in liquid LB with shaking at 37&deg;C. Minipreps are done from liquid culture and digestions were performed to check whether they are correct. Parts are then sequenced to ensure no mutation occurred during the PCR process.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/3/39/VUPVflowchart_1_parts.jpg" alt="Flowchart - parts"> <br/><br />
<br />
<br />
<p><br/>Parts can be assembled into transcriptional units in an alpha vector provided that they follow the GoldenBraid 2.0 grammar. Once transcriptional units are constructed an iterative loop of binary assemblies can be performed using alpha and omega vectors in order to obtain the final construction.</p><br/><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/8/89/VUPVflowchart_2_assembly.jpg" alt="Flowchart - assembly"> <br/></br></br><br/></br><br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb"><strong>&larr; Go to GoldenBraid</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction"><strong>Go to Parts Construction &rarr;</strong></a></div></br></br></br><br/><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb
Team:Valencia UPV/Project/modules/methodology/gb
2014-10-18T02:21:09Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<br />
<div align="center"><br />
<br />
<div id="cn-box" align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>GoldenBraid</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>he <roja>G</roja>olden<roja>B</roja>raid <roja>c</roja>loning <roja>s</roja>trategy</span> </div><br/><br />
<p>Our Sexy Plant is a challenging project for many reasons; a very important one is that we use plants as chassis for engineering. Plants have eukaryotic gene structure, make use of plant-specific regulatory regions and require special T-vectors for transformation, among other special features. Consequently, DNA repositories and DNA assembly standards need certain adaptations to facilitate engineering using plant chassis. Without letting aside BioBricks, we decided to use the GoldenBraid system (GB) to build several of the intermediate genetic constructs employed in this project. GB is a DNA assembly system specially conceived to facilitate genetic engineering in Plant Synthetic Biology projects (visit <a href="http://gbcloning.org" class="normal-link-page" target="_blank">gbcloning.org</a> for more information). </p><br />
<br />
<br/><br />
<p>As BioBricks, GB is a modular cloning strategy that allows the fabrication of new devices by the combination of prefabricated standard modules. A difference between both strategies is that BioBricks is based on type II enzymes and GB relies on the use of type IIS restriction enzymes.</p><br />
<br />
<br/><br />
<br />
<p>Type IIS restriction enzymes, unlike type II enzymes; cleave DNA at a defined distance from their recognition sites, not requiring any specific sequence in the cleavage site. Since there are no sequence requirements in the cleavage sites, these can be defined by the user and adapted to serve as standard fusion sites to DNA parts. The enzymes used in GoldenBraid are BsaI and BsmBI, which cut out from their binding sites generating 4 base overhangs.</p> <br />
<br />
</br></br><br />
<br />
<div align="center"><img width="650px" src="https://static.igem.org/mediawiki/2014/9/91/VUPV_Gb1.png" alt="solid_phase_extraction" title="Figure 1. Comparison between type II and type IIS restriction enzymes"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 1</b>. Comparison between type II and type IIS restriction enzymes</p></div><br/><br />
<br />
<h3> GoldenBraid step by step</h3> <br/><br />
<h4> 1. <u>GB Domestication</u> </h4><br />
<p><br />
The first step in the GB cloning strategy is the adaptation of the DNA sequence to the GB standard. This process is called domestication and implies (1) the removal of internal restriction sites for the enzymes used in GB (BsaI, BsmBI and BtgZI) and (2) the addition of appropriate 4-nt flanking overhangs to convert the DNA sequence into a standard part (Gbpart). Gbparts are the minimal standard building blocks and they are classified in different categories according to their specific function. </p><br />
</br></br><br />
<p>There are three basic categories that define the most common parts making up a transcriptional unit. These part categories are PROM (GGAG-AATG), CDS (AATG-GCTT) and TER (GCTT-CGCT) and were the most used on this project.</p><br />
</br></br><br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/f/fc/VUPV_Gb2.png" alt="solid_phase_extraction" title="Figure 2. Part categories of a basic GoldenBraid trancriptional unit. Promoter’s (PROM) prefix is GGAG and its suffix is AATG, which is the same as the coding region’s (CDS) prefix. The same happens with the CDS and the terminator (TER), which share the part identity overhang GCTT, the first one as its suffix and the second one as its prefix."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 2</b>. Part categories of a basic GoldenBraid trancriptional unit. Promoter’s (PROM) prefix is GGAG and its suffix is AATG, which is the same as the coding region’s (CDS) prefix. The same happens with the CDS and the terminator (TER), which share the part identity overhang GCTT, the first one as its suffix and the second one as its prefix.</p></div><br/><br />
<br />
<p>The mutagenesis procedure required to remove internal restriction sites is standardized and involves the amplification of the target DNA in separated fragments (GBpatches) using GB-adapted primers, which incorporate single mismatches to disrupt the enzyme target sites. Once amplified, GBpatches are reassembled together in a single-tube BsmBI restriction-ligation reaction into the universal entry vector (pUPD) to yield a domesticated GBpart</p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/9/9a/VUPV_Gb3.png" alt="solid_phase_extraction" title="Figure 3. Domestication strategy with removal of internal restriction sites. Internal Type IIs recognition sites (exemplified here with the GGTCTC BsaI recognition site) are mutagenized during domestication following a standard procedure. In addition to the GB.F and GB.R primers that amplify the whole fragment, two other primers (M.F and M.R) are required for mutagenesis, which incorporate the flanking BsmBI overhangs and the single nucleotide change (C>M). Each primer pair is used to amplify a GBpatch by PCR, and the resulting fragments are assembled together in a BsmBI restriction-ligation reaction into pUPD. The resulting GBpart is free of internal recognition sites and can be released from pUPD using BsaI or BtgZI."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 3</b>. Domestication strategy with removal of internal restriction sites. Internal Type IIs recognition sites (exemplified here with the GGTCTC BsaI recognition site) are mutagenized during domestication following a standard procedure. In addition to the GB.F and GB.R primers that amplify the whole fragment, two other primers (M.F and M.R) are required for mutagenesis, which incorporate the flanking BsmBI overhangs and the single nucleotide change (C>M). Each primer pair is used to amplify a GBpatch by PCR, and the resulting fragments are assembled together in a BsmBI restriction-ligation reaction into pUPD. The resulting GBpart is free of internal recognition sites and can be released from pUPD using BsaI or BtgZI.</p></div><br/><br />
<br />
<br/><br />
<h4> 2. <u>GB Multipartite assemblies </u></h4><br />
<br />
<br/><br />
<br />
<p>Domesticated GBparts can now be assembled together in a one-tube-one-step reaction to create a Transcriptional Unit (TU). GB uses the Golden Gate multipartite reaction to create transcriptional units (TU). By using special GB destination vectors in the reaction, we make sure that the resulting TUs can be subsequently used to build multigene constructs (constructs comprising several TUs within the same destination plasmid). GB destination vectors are T-plasmids, a special type of plasmids used for plant transformation. Therefore the new TUs assembled in GB vectors can be directly transferred into plants using Agrobacterium-mediated plant transformation.</p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/a/a1/VUPV_Gb4.png" alt="solid_phase_extraction" title="Figure 4. Schema of a GoldenGate reaction. All the DNA parts composing a basic structure (PROM, CDS and TER) are mixed together in one tube with a GB destination plasmid, BsaI and T4 ligase. As result of the restriction-ligation reaction the correctly assembled transcriptional unit is obtained."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 4</b>. Schema of a GoldenGate reaction. All the DNA parts composing a basic structure (PROM, CDS and TER) are mixed together in one tube with a GB destination plasmid, BsaI and T4 ligase. As result of the restriction-ligation reaction the correctly assembled transcriptional unit is obtained.</p></div><br/><br />
<br />
<br />
<br/><br />
<h4> 3. <u>GB binary assemblies </u></h4><br />
<br />
<br/><br />
<br />
<p>Multigene constructs are important in Plant Synthetic Biology because they allow several TUs to be jointly transferred to the plant genome. Co-transformed TUs are expressed coordinately and eventually inherited together, avoiding lengthy breeding strategies.</p><br />
</br></br><br />
<br />
<p>GB-made TUs can be combined using GB binary assemblies to create increasingly complex multigenic structures. The special orientation and disposition of the restriction sites in the GB destination vectors defines two levels of destination plasmids: the α plasmids used for BsaI reactions and the Ω plasmids, which are used for BsmBI GB reactions. </p><br />
</br></br><br />
<br />
<p>The double loop topology of the GB cloning strategy allows an indefinite growth of the constructs through iterative binary assembly steps. By choosing the appropriate combinations of expression and destination vectors, increasingly complex multigenic modules are created.</p><br />
</br></br><br />
<br />
<p>We used this strategy to build and transform in N. benthamiana a multigene construct encoding the last 3 enzymatic steps of the synthesis of a moth pheromone. </p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/3/33/VUPV_Gb5.png" alt="solid_phase_extraction" title="Figure 5. Schema of a GoldenBraid reaction. Two TUs assembled in complementary α-level plasmids are combined in a Ω-level destination vector to create a two genes module."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 5</b>. Schema of a GoldenBraid reaction. Two TUs assembled in complementary α-level plasmids are combined in a Ω-level destination vector to create a two genes module.</p></div><br/><br />
<br />
<br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>&larr; Go back to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety"><strong>Go to Biosafety &rarr;</strong></a></br></br></br><br />
</br></br><br />
<br />
<br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Engler C, Gruetzner R, Kandzia R, Marillonnet S (2009) Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One 4 (5):e5553. doi:10.1371/journal.pone.0005553</li><br/><br />
<li>Sarrion-Perdigones, A., Falconi, E.E., Zandalinas, S.I., Juarez, P., Fernandez-Del-Carmen, A., Granell, A. and Orzaez, D. (2011) GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS One 6, e21622</li><br />
<li>Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D (2013) GoldenBraid2.0: A comprehensive DNA assembly framework for Plant Synthetic Biology. Plant Physiol </li> <br />
</ol><br/><br/><br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<div id="space-margin"></div><br />
<br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb
Team:Valencia UPV/Project/modules/methodology/gb
2014-10-18T02:20:53Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<br />
<div align="center"><br />
<br />
<div id="cn-box" align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>GolgenBraid</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>T</roja>he <roja>G</roja>olden<roja>B</roja>raid <roja>c</roja>loning <roja>s</roja>trategy</span> </div><br/><br />
<p>Our Sexy Plant is a challenging project for many reasons; a very important one is that we use plants as chassis for engineering. Plants have eukaryotic gene structure, make use of plant-specific regulatory regions and require special T-vectors for transformation, among other special features. Consequently, DNA repositories and DNA assembly standards need certain adaptations to facilitate engineering using plant chassis. Without letting aside BioBricks, we decided to use the GoldenBraid system (GB) to build several of the intermediate genetic constructs employed in this project. GB is a DNA assembly system specially conceived to facilitate genetic engineering in Plant Synthetic Biology projects (visit <a href="http://gbcloning.org" class="normal-link-page" target="_blank">gbcloning.org</a> for more information). </p><br />
<br />
<br/><br />
<p>As BioBricks, GB is a modular cloning strategy that allows the fabrication of new devices by the combination of prefabricated standard modules. A difference between both strategies is that BioBricks is based on type II enzymes and GB relies on the use of type IIS restriction enzymes.</p><br />
<br />
<br/><br />
<br />
<p>Type IIS restriction enzymes, unlike type II enzymes; cleave DNA at a defined distance from their recognition sites, not requiring any specific sequence in the cleavage site. Since there are no sequence requirements in the cleavage sites, these can be defined by the user and adapted to serve as standard fusion sites to DNA parts. The enzymes used in GoldenBraid are BsaI and BsmBI, which cut out from their binding sites generating 4 base overhangs.</p> <br />
<br />
</br></br><br />
<br />
<div align="center"><img width="650px" src="https://static.igem.org/mediawiki/2014/9/91/VUPV_Gb1.png" alt="solid_phase_extraction" title="Figure 1. Comparison between type II and type IIS restriction enzymes"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 1</b>. Comparison between type II and type IIS restriction enzymes</p></div><br/><br />
<br />
<h3> GoldenBraid step by step</h3> <br/><br />
<h4> 1. <u>GB Domestication</u> </h4><br />
<p><br />
The first step in the GB cloning strategy is the adaptation of the DNA sequence to the GB standard. This process is called domestication and implies (1) the removal of internal restriction sites for the enzymes used in GB (BsaI, BsmBI and BtgZI) and (2) the addition of appropriate 4-nt flanking overhangs to convert the DNA sequence into a standard part (Gbpart). Gbparts are the minimal standard building blocks and they are classified in different categories according to their specific function. </p><br />
</br></br><br />
<p>There are three basic categories that define the most common parts making up a transcriptional unit. These part categories are PROM (GGAG-AATG), CDS (AATG-GCTT) and TER (GCTT-CGCT) and were the most used on this project.</p><br />
</br></br><br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/f/fc/VUPV_Gb2.png" alt="solid_phase_extraction" title="Figure 2. Part categories of a basic GoldenBraid trancriptional unit. Promoter’s (PROM) prefix is GGAG and its suffix is AATG, which is the same as the coding region’s (CDS) prefix. The same happens with the CDS and the terminator (TER), which share the part identity overhang GCTT, the first one as its suffix and the second one as its prefix."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 2</b>. Part categories of a basic GoldenBraid trancriptional unit. Promoter’s (PROM) prefix is GGAG and its suffix is AATG, which is the same as the coding region’s (CDS) prefix. The same happens with the CDS and the terminator (TER), which share the part identity overhang GCTT, the first one as its suffix and the second one as its prefix.</p></div><br/><br />
<br />
<p>The mutagenesis procedure required to remove internal restriction sites is standardized and involves the amplification of the target DNA in separated fragments (GBpatches) using GB-adapted primers, which incorporate single mismatches to disrupt the enzyme target sites. Once amplified, GBpatches are reassembled together in a single-tube BsmBI restriction-ligation reaction into the universal entry vector (pUPD) to yield a domesticated GBpart</p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/9/9a/VUPV_Gb3.png" alt="solid_phase_extraction" title="Figure 3. Domestication strategy with removal of internal restriction sites. Internal Type IIs recognition sites (exemplified here with the GGTCTC BsaI recognition site) are mutagenized during domestication following a standard procedure. In addition to the GB.F and GB.R primers that amplify the whole fragment, two other primers (M.F and M.R) are required for mutagenesis, which incorporate the flanking BsmBI overhangs and the single nucleotide change (C>M). Each primer pair is used to amplify a GBpatch by PCR, and the resulting fragments are assembled together in a BsmBI restriction-ligation reaction into pUPD. The resulting GBpart is free of internal recognition sites and can be released from pUPD using BsaI or BtgZI."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 3</b>. Domestication strategy with removal of internal restriction sites. Internal Type IIs recognition sites (exemplified here with the GGTCTC BsaI recognition site) are mutagenized during domestication following a standard procedure. In addition to the GB.F and GB.R primers that amplify the whole fragment, two other primers (M.F and M.R) are required for mutagenesis, which incorporate the flanking BsmBI overhangs and the single nucleotide change (C>M). Each primer pair is used to amplify a GBpatch by PCR, and the resulting fragments are assembled together in a BsmBI restriction-ligation reaction into pUPD. The resulting GBpart is free of internal recognition sites and can be released from pUPD using BsaI or BtgZI.</p></div><br/><br />
<br />
<br/><br />
<h4> 2. <u>GB Multipartite assemblies </u></h4><br />
<br />
<br/><br />
<br />
<p>Domesticated GBparts can now be assembled together in a one-tube-one-step reaction to create a Transcriptional Unit (TU). GB uses the Golden Gate multipartite reaction to create transcriptional units (TU). By using special GB destination vectors in the reaction, we make sure that the resulting TUs can be subsequently used to build multigene constructs (constructs comprising several TUs within the same destination plasmid). GB destination vectors are T-plasmids, a special type of plasmids used for plant transformation. Therefore the new TUs assembled in GB vectors can be directly transferred into plants using Agrobacterium-mediated plant transformation.</p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/a/a1/VUPV_Gb4.png" alt="solid_phase_extraction" title="Figure 4. Schema of a GoldenGate reaction. All the DNA parts composing a basic structure (PROM, CDS and TER) are mixed together in one tube with a GB destination plasmid, BsaI and T4 ligase. As result of the restriction-ligation reaction the correctly assembled transcriptional unit is obtained."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 4</b>. Schema of a GoldenGate reaction. All the DNA parts composing a basic structure (PROM, CDS and TER) are mixed together in one tube with a GB destination plasmid, BsaI and T4 ligase. As result of the restriction-ligation reaction the correctly assembled transcriptional unit is obtained.</p></div><br/><br />
<br />
<br />
<br/><br />
<h4> 3. <u>GB binary assemblies </u></h4><br />
<br />
<br/><br />
<br />
<p>Multigene constructs are important in Plant Synthetic Biology because they allow several TUs to be jointly transferred to the plant genome. Co-transformed TUs are expressed coordinately and eventually inherited together, avoiding lengthy breeding strategies.</p><br />
</br></br><br />
<br />
<p>GB-made TUs can be combined using GB binary assemblies to create increasingly complex multigenic structures. The special orientation and disposition of the restriction sites in the GB destination vectors defines two levels of destination plasmids: the α plasmids used for BsaI reactions and the Ω plasmids, which are used for BsmBI GB reactions. </p><br />
</br></br><br />
<br />
<p>The double loop topology of the GB cloning strategy allows an indefinite growth of the constructs through iterative binary assembly steps. By choosing the appropriate combinations of expression and destination vectors, increasingly complex multigenic modules are created.</p><br />
</br></br><br />
<br />
<p>We used this strategy to build and transform in N. benthamiana a multigene construct encoding the last 3 enzymatic steps of the synthesis of a moth pheromone. </p><br />
</br></br><br />
<br />
<br />
<div align="center"><img width="700px" src="https://static.igem.org/mediawiki/2014/3/33/VUPV_Gb5.png" alt="solid_phase_extraction" title="Figure 5. Schema of a GoldenBraid reaction. Two TUs assembled in complementary α-level plasmids are combined in a Ω-level destination vector to create a two genes module."></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 5</b>. Schema of a GoldenBraid reaction. Two TUs assembled in complementary α-level plasmids are combined in a Ω-level destination vector to create a two genes module.</p></div><br/><br />
<br />
<br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>&larr; Go back to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety"><strong>Go to Biosafety &rarr;</strong></a></br></br></br><br />
</br></br><br />
<br />
<br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Engler C, Gruetzner R, Kandzia R, Marillonnet S (2009) Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One 4 (5):e5553. doi:10.1371/journal.pone.0005553</li><br/><br />
<li>Sarrion-Perdigones, A., Falconi, E.E., Zandalinas, S.I., Juarez, P., Fernandez-Del-Carmen, A., Granell, A. and Orzaez, D. (2011) GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules. PLoS One 6, e21622</li><br />
<li>Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D (2013) GoldenBraid2.0: A comprehensive DNA assembly framework for Plant Synthetic Biology. Plant Physiol </li> <br />
</ol><br/><br/><br />
<br />
<br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<div id="space-margin"></div><br />
<br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety
Team:Valencia UPV/Project/modules/biosafety
2014-10-18T02:20:01Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Biosafety</a> </h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>B</roja>iosafety</span> </div><br/><br/><br />
<br />
<p>"With great powers comes great responsibility." – <span class="italic">Benjamin Parker (Uncle Ben)</span>.</p><br/><br/><br />
<br />
<p>We know the importance of keeping genetically modified organisms under control. Ideally, modified genetic material should be unable to spread and organisms containing it should be easily distinguishable from wild type. Keeping this in mind, we created a biosafety module to be used in plants which will be available for future iGEM teams working with plants. Our biosafety module combines two biosafety strategies: <span class="black-bold">identity preservation</span> and <span class="black-bold">male sterility</span>.</p><br/><br/><br />
<br />
<p><span class="black-bold">Identity preservation</span> enables an easy identification of the genetically modified organism. We incorporated a <span class="black-bold">chromoprotein</span>, which provides a differential pigmentation to the plant, in the biosafety module. The implementation of this chromoprotein to our system is the result of the collaboration with <a class="normal-link-page" target="_blank" href="https://2014.igem.org/Team:NRP-UEA-Norwich">NRP-UEA-Norwich</a> , and it is also used in their project “<span class="italic">Green Canary</span>”.</p><br/><br/><br />
<br />
<p><span class="black-bold">Male sterility</span> makes impossible the dispersion of genetic material using pollen as the vehicle or by seeds result of self-pollination. In order to achieve this dispersion restriction, we integrated the active peptide of <span class="black-bold">barnase</span>, a RNAse from <span class="italic">Bacillus amyloliquefaciens</span>, (Biobricks accession code BBa_I716211) under the regulation of the tapetum-specific promoter TA29 [1]. Both components are very well documented since TA29 has been used by a large number of researchers [2-6] and barnase has also been used under the regulation of different promoters [7,8]. We chose this strategy because it had been previously used in our laboratory with satisfactory results [9].</p><br/><br/><br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Mariani C, Beuckeleer MD, Truettner J, Leemans J, Goldberg RB (1990) Induction of male sterility in plants by a chimaeric ribonuclease gene. Nature 347: 737-741.</li><br />
<li>Cho HJ, Kim S, Kim M, Kim BD (2001) Production of transgenic male sterile tobacco plants with the cDNA encoding a ribosome inactivating protein in Dianthus sinensis L. Mol Cells 11: 326-333.</li><br />
<li>Sa G, Mi M, He-Chun Y, Guo-Feng L (2002) Anther-specific expression of ipt gene in transgenic tobacco and its effect on plant development. Transgenic Res 11: 269-278.</li><br />
<li>Shaya F, Gaiduk S, Keren I, Shevtsov S, Zemah H, et al. (2012) Expression of mitochondrial gene fragments within the tapetum induce male sterility by limiting the biogenesis of the respiratory machinery in transgenic tobacco. J Integr Plant Biol 54: 115-130.</li><br />
<li>Kriete G, Niehaus K, Perlick AM, Puhler A, Broer I (1996) Male sterility in transgenic tobacco plants induced by tapetum-specific deacetylation of the externally applied non-toxic compound N-acetyl-L-phosphinothricin. Plant J 9: 809-818.</li><br />
<li>Shukla P, Singh NK, Kumar D, Vijayan S, Ahmed I, et al. (2014) Expression of a pathogen-induced cysteine protease (AdCP) in tapetum results in male sterility in transgenic tobacco. Funct Integr Genomics 14: 307-317.</li><br />
<li>Goldman MH, Goldberg RB, Mariani C (1994) Female sterile tobacco plants are produced by stigma-specific cell ablation. EMBO J 13: 2976-2984.</li><br />
<br />
<li>Wang HZ, Hu B, Chen GP, Shi NN, Zhao Y, et al. (2008) Application of Arabidopsis AGAMOUS second intron for the engineered ablation of flower development in transgenic tobacco. Plant Cell Rep 27: 251-259.</li><br />
<br />
<li>Sarrion-Perdigones A, Falconi EE, Zandalinas SI, Juarez P, Fernandez-del-Carmen A, et al. (2011) GoldenBraid: an iterative cloning system for standardized assembly of reusable genetic modules. PLoS One 6: e21622.</li> <br />
</ol></br></br><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>&larr; Go to Methodology</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/ideal_plant"><strong>Go to Future Perspectives &rarr;</strong></a></div></br></br></br><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/EAG
Team:Valencia UPV/Project/modules/methodology/EAG
2014-10-18T02:19:08Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a>Electroantennogram</a></h3></p><br/></br><br />
<br />
<div align="center"><span class="coda"><roja>E</roja>lectroantennogram </div><br/><br/><br />
<br />
<br />
<p class="subpart">Sesamia nonagrioides</p><br />
<p><br />
Sesamina nonagrioides (Lepidoptera: Nocturnidae) or the corn stalk borer is an important pest of corn in Mediterranean regions and Central Africa. Feeding habitat of Sesamia larvae is the stem and the ear of a wide range of host plants, which include corn, sorghum, millet, rice, sugar cane, grasses, palms or banana [1]. </p><br />
<p><br />
These moths are nocturnal, which means that their vision is limited, so males are guided to the female from relative large distance by an odour trail opposite to the wind instead of a visual orientation. Females produce and release the sexual pheromone trough a gland present in the apex of the abdomen and the essence is transported by air currents allowing male’s receptors to detect the signal and triggering a sexual motivation response. </p><br />
<p> <br />
The S. Nonagrioides female sex pheromones blend consist of (Z)-11-hexadecenyl acetate, (Z)-11-hexadecen-1-ol, (Z)-11-hexadecenal and dodecyl acetate [2]. Nevertheless, they are not equally present in the female’s trace. The major component is the Z11-16:Ac, which presence is enough to trigger an attraction response in males, even though it is not the optimal chemical signal to draw male moths to the source. </p><br />
<p><br />
We selected this organism to test our pheromone since the major component of the female’s pheromone blend coincides with one of the target component that The Sexy Plant is able to produce<br />
</p><br/><br/><br />
<br />
<p class="subpart">Electroantennogram (EAG)</p><br />
<br />
<pEAG is a detection system that records the potential difference that arises from an exposure to a chemical signal. It detects and measures the quantitative and qualitative response of insect antennal receptor cells to a particular biologically active compound employing a moth antenna. The antenna is the site of olfaction of the moth, composed by antennal receptors which are very sensitive and specific so they enable perception and recognition of particular odours. In this case a male’s moth antenna is used because male moths are capable of receive and process the essence that female emit into the environment. The pheromone stimulus exerts a determined electrical response which is registered and quantified in volts. </p><br/><br/><br/><br />
<br />
<p>EAG consists of a circuit and two electrodes connected to an amplifier which is closed by means of the moth antenna. A continuous clear air flow is blown over the antenna at a constant rate and the samples to be analysed are introduced inside the air stream. Once the stimulus is exerted to the antenna, for example the pheromone, it is locked on the antenna receptors, a signal transduction cascade is initiated and it is converted to an electrical impulse, which is registered [4]. As a result, base line undergoes an up and down or derivation, similar to those shown in an electrocardiogram. Different compounds elicit different electrophysiological responses but concentration could vary the registry, too. The characterization of DNA parts involved in pheromone biosynthesis was made by transient gene expression in <i>N. benthamiana</i> coupled to Electroantennography (NBTE-AEG). The volatiles synthesized by the Sexy Plant were puffed into the odour delivery system and the electrical response was registred.</p><br/><br/><br />
<br />
<br />
<div align="center"><img width="550px" src="https://static.igem.org/mediawiki/2014/e/ef/VUPV_EAG1.png" alt="solid_phase_extraction" title="EAG Diagram"></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 1</b>. EAG Diagram</p></div><br/><br />
<br />
<br />
<p>Our moths were immobilized and the antennas were cut or detached from the male. Then, terminal ends of the antenna were cut and the resulting antenna fragment was placed in the electrodes. A small amount of each sample (1 ug) was loaded onto small pieces of filter paper inside the wide section of a Pasteur pipette. </p><br/><br/><br />
<br />
<div align="center"><img width="550px" src="https://static.igem.org/mediawiki/2014/2/2a/VUPV_Eag_foto.png" alt="solid_phase_extraction" title="Antenna in contact with both electrodes "></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 2</b>. Antenna in contact with both electrodes </p></div><br/><br />
<br />
<div align="center"><img width="550px" src="https://static.igem.org/mediawiki/2014/8/89/VUPU_EAGinst.jpg" alt="solid_phase_extraction" title=" EAG instrument. "></img></div><br/><br />
<div align="center"><p style="text-align: center; font-size: 0.8em; width: 670px;"><b>Figure 4</b>. EAG instrument.</p></div><br/><br />
<br />
<br />
<br />
<p>The characterization of DNA parts involved in pheromone biosynthesis was made by transient gene expression in N. benthamiana coupled to Electroantennography (NBTE-AEG). The volatiles synthesized by the Sexy Plant were puffed into a device containing two small electrodes connected by a moth ́s antenna. Specific receptors in the antenna respond to the pheromones producing a measurable electric output. The volatiles in our Sexy Plants induced detectable electric pulses that could indicate a pheromone response, although further testing will be required for confirmation.</p><br/><br/><br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/dynamic_headspace"><strong>&larr; Go to Sampling Technique</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/windtunnel"><strong>Go to Wind Tunnel Assay &rarr;</strong></a></div><br/><br/><br/><br/><br />
<br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Eizaguirre M, Fantinou AA (2011) Abundance of Sesamia nonagrioides (Lef.) (Lepidoptera: Noctuidae) on the Edge of the Mediterranean Basin. Psyche vol. 2012 (ID 854045) 7 pages doi:10.1155/2012/854045 </li><br/><br />
<li>Eizaguirre M, Albajes R, López C, Sans A, Gemeno (2007) Inhibition of pheromone response in Sesamia nonagrioides by the pheromone of the sympatric corn borer, Ostrinia nubilalis. Pest Manag Sci 63:608-614.</li><br />
<li>Howse P, Stevens I, Jones O (2004) Feromonas de insectos y su uso en el control de plagas. Davince (first edition)Traduced by Gil-Ruíz P.</li><br />
<li>Gullan PJ, Cranston S (2014) The insects: An Outline of Enthomology. Wiley-Blackwell.</li> <br />
</ol><br/><br/><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology
Team:Valencia UPV/Project/modules/methodology
2014-10-18T02:17:04Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<br />
<div align="center"><br />
<br />
<div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Methodology</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>ethodology</span> </div><br/><br/><br />
<br />
<br />
<a name="cloning"><h3>Cloning</h3></a><br />
<br/><br />
<br />
<p><br />
In order to assemble the necessary BioBricks (BB) to create the Sexy Plant, we employed a modular DNA cloning method called <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb" class="normal-link-page">GoldenBraid </a>(GB). The GB constructs were assembled following this procedure <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/flowchart" class="normal-link-page">Flowchart</a>. To convert GoldenBraid assemblies to the BioBricks standards, we followed the conversion <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction" class="normal-link-page">from GB to BB procedure.</a> </p><br />
<br/><br/><br />
<h3>Expression</h3><br />
<br/><br />
<p>As plants are complex organisms they require the use of more sophisticated transformation techniques than the ones used with bacteria. In order to introduce a given construct into the plant cells and insert it in the genome, soil bacteria called Agrobacterium tumefaciens/Rhizobium radiobacter are used. By injecting these bacteria in the plant leaves, they can induce <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression" class="normal-link-page">Transient gene expression</a> in the host plant.</p><br />
<br />
<br/><br/> <br />
<br />
<h3>Measurements</h3><br/><br />
<p>Such a complex project as the Sexy Plant, requires many different measurement techniques. </p><br />
<br />
<p>In order to analyse the pheromone production in the plant, we collected transformed Nicotiana benthamiana leaf samples and performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation" class="normal-link-page">Headspace SPME</a>, a technique that traps the volatile organic compounds produced in the sample. Then, the volatiles were analysed and identified by <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_analysis" class="normal-link-page">Gas Chromatography-Mass Spectrometry.</a></p><br />
<br />
<p>Willing to test if the plants efficiently released the pheromone, we also performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/dynamic_headspace" class="normal-link-page"> Dynamic Headspace sampling technique.</a></p><br />
<br />
<p>We also wanted to study moth’s response to pheromones produced by our genetically engineered plants. Therefore we performed an <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/EAG" class="normal-link-page">Electroantennography</a> to test the antennae detection and signal transmission upon stimulation with our plant samples. In addition, we performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/windtunnel" class="normal-link-page">Wind tunnel assay</a> to observe male moths behaviour under stimulation with our pheromones.</p><br />
<br />
<p>Finally, to test the induction of gene expression triggered by our cupper-activated switch, we performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/luciferase" class="normal-link-page">Luciferase expression assay</a>. </p><br />
<br />
<br />
</br></br></br></br><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/switch"><strong>&larr; Go to Switch</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety"><strong>Go to Biosafety &rarr;</strong></a></div><br/><br/><br/><br/><br />
</br></br><br />
</div><br />
</div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/windtunnel
Team:Valencia UPV/Project/modules/methodology/windtunnel
2014-10-18T02:16:46Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology">Methodology</a> > <a> Wind Tunnel</a></h3></p><br/></br><br />
<br />
<div align="center"><span class="coda"><roja>W</roja>ind <roja>T</roja>unnel </div><br/><br/><br />
<br />
<p><br />
Wind tunnel is a tool used for insect flight studies where the biological response of an insect to a certain stimuli, usually an odorant molecule, is tested. It consists of a rectangular cabinet of transparent walls with a laminar air flow system. The stimulant source is placed at the side where the air is entering the chamber and at the opposite extreme of the wind tunnel a male moth is placed on the ground or preferably elevated over a base.</p><br />
<p><br />
Saturation ambient in the cabinet is difficult to achieve as the laminar flow allows the air renewal at each instant, preventing the receptor saturation inside the tunnel. Therefore in these set up the odorant molecule is not expected to act a disruptant but as an attractant. </p><br />
<br />
<div align="center"><img width="550px" src="https://static.igem.org/mediawiki/2014/1/1c/VUPV_Wind.png" alt="solid_phase_extraction" title="Wind tunnel"></img></div><br/><br />
<br />
<p> <br />
The insect will react to the source and this behaviour is recorded. Possible actions include keeping quiet, moving from its position by flying or not, oriented flight to the source, get in contact with the stimulus and so forth. This procedure has to be repeated many times in order to obtain statistically significant data. </p><br />
<p><br />
When the moth and a small amount of the inducing agent (0.05 ug) are placed on the opposite side, the laminar flow is switched on. Male behaviour is observed for 3-10 minutes. If the moth flies to the opposite side where the stimulus is placed means an attractive response. Behaviour recordings includes staying on the place where it was deposited, oriented flight, taking flight but dispersed or not oriented to the source [1]. <br />
</p><br/><br/><br />
<p><br />
(*) Part of this figure has been taken of "Helicoverpa armigera 1" by Donald Hobern from Canberra, Australia - Helicoverpa armigera. Uploaded by berichard. Licensed under Creative Commons Attribution 2.0 via Wikimedia Commons - http://commons.wikimedia.org/wiki/File:Helicoverpa_armigera_1.jpg#mediaviewer/File:Helicoverpa_armigera_1.jpg<br />
</p><br />
<br />
<br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/EAG"><strong>&larr; Go to Electroantennography</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/luciferase"><strong>Go to Luciferase Assay &rarr;</strong></a></div><br/><br/><br/><br/><br />
<br />
<br />
<p align="center"><strong>References</strong></p><br/><br />
<div style="position: relative; left: 3%; width: 96%;"><ol><br />
<li>Eizaguirre M, Albajes R, López C, Sans A, Gemeno (2007) Inhibition of pheromone response in Sesamia nonagrioides by the pheromone of the sympatric corn borer, Ostrinia nubilalis. Pest Manag Sci 63:608-614.</li> <br />
</ol><br/><br/><br />
<br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology
Team:Valencia UPV/Project/modules/methodology
2014-10-18T02:13:57Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<br />
<div align="center"><br />
<br />
<div id="cn-box" align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Methodology</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>ethodology</span> </div><br/><br/><br />
<br />
<br />
<a name="cloning"><h3>Cloning</h3></a><br />
<br/><br />
<br />
<p><br />
In order to assemble the necessary BioBricks (BB) to create the Sexy Plant, we employed a modular DNA cloning method called <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb" class="normal-link-page">GoldenBraid </a>(GB). The GB constructs were assembled following this procedure <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/flowchart" class="normal-link-page">Flowchart</a>. To convert GoldenBraid assemblies to the BioBricks standards, we followed the conversion <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction" class="normal-link-page">from GB to BB procedure.</a> </p><br />
<br/><br/><br />
<h3>Expression</h3><br />
<br/><br />
<p>As plants are complex organisms they require the use of more sophisticated transformation techniques than the ones used with bacteria. In order to introduce a given construct into the plant cells and insert it in the genome, soil bacteria called Agrobacterium tumefaciens/Rhizobium radiobacter are used. By injecting these bacteria in the plant leaves, they can induce <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression" class="normal-link-page">Transient gene expression</a> in the host plant.</p><br />
<br />
<br/><br/> <br />
<br />
<h3>Measurements</h3><br/><br />
<p>Such a complex project as the Sexy Plant, requires many different measurement techniques. </p><br />
<br />
<p>In order to analyse the pheromone production in the plant, we collected transformed Nicotiana benthamiana leaf samples and performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation" class="normal-link-page">Headspace SPME</a>, a technique that traps the volatile organic compounds produced in the sample. Then, the volatiles were analysed and identified by <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_analysis" class="normal-link-page">Gas Chromatography-Mass Spectrometry.</a></p><br />
<br />
<p>Willing to test if the plants efficiently released the pheromone, we also performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/dynamic_headspace" class="normal-link-page"> Dynamic Headspace sampling technique.</a></p><br />
<br />
<p>We also wanted to study moth’s response to pheromones produced by our genetically engineered plants. Therefore we performed an <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/EAG" class="normal-link-page">Electroantennography</a> to test the antennae detection and signal transmission upon stimulation with our plant samples. In addition, we performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/windtunnel" class="normal-link-page">Wind tunnel assay</a> to observe male moths behaviour under stimulation with our pheromones.</p><br />
<br />
<p>Finally, to test the induction of gene expression triggered by our cupper-activated switch, we performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/luciferase" class="normal-link-page">Luciferase expression assay</a>. </p><br />
<br />
<br />
</br></br></br></br><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/switch"><strong>&larr; Go to Switch</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules"><strong>Go to Modules</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety"><strong>Go to Biosafety &rarr;</strong></a></div><br/><br/><br/><br/><br />
</br></br><br />
</div><br />
</div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology
Team:Valencia UPV/Project/modules/methodology
2014-10-18T02:13:40Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<br />
<div align="center"><br />
<br />
<div id="cn-box" align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules">Modules</a> > <a>Methodology</a> </h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>M</roja>ethodology</span> </div><br/><br/><br />
<br />
<br />
<a name="cloning"><h3>Cloning</h3></a><br />
<br/><br />
<br />
<p><br />
In order to assemble the necessary BioBricks (BB) to create the Sexy Plant, we employed a modular DNA cloning method called <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb" class="normal-link-page">GoldenBraid </a>(GB). The GB constructs were assembled following this procedure <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/flowchart" class="normal-link-page">Flowchart</a>. To convert GoldenBraid assemblies to the BioBricks standards, we followed the conversion <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/parts_construction" class="normal-link-page">from GB to BB procedure.</a> </p><br />
<br/><br/><br />
<h3>Expression</h3><br />
<br/><br />
<p>As plants are complex organisms they require the use of more sophisticated transformation techniques than the ones used with bacteria. In order to introduce a given construct into the plant cells and insert it in the genome, soil bacteria called Agrobacterium tumefaciens/Rhizobium radiobacter are used. By injecting these bacteria in the plant leaves, they can induce <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/expression" class="normal-link-page">Transient gene expression</a> in the host plant.</p><br />
<br />
<br/><br/> <br />
<br />
<h3>Measurements</h3><br/><br />
<p>Such a complex project as the Sexy Plant, requires many different measurement techniques. </p><br />
<br />
<p>In order to analyse the pheromone production in the plant, we collected transformed Nicotiana benthamiana leaf samples and performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_preparation" class="normal-link-page">Headspace SPME</a>, a technique that traps the volatile organic compounds produced in the sample. Then, the volatiles were analysed and identified by <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/sample_analysis" class="normal-link-page">Gas Chromatography-Mass Spectrometry.</a></p><br />
<br />
<p>Willing to test if the plants efficiently released the pheromone, we also performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/dynamic_headspace" class="normal-link-page"> Dynamic Headspace sampling technique.</a></p><br />
<br />
<p>We also wanted to study moth’s response to pheromones produced by our genetically engineered plants. Therefore we performed an <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/EAG" class="normal-link-page">Electroantennography</a> to test the antennae detection and signal transmission upon stimulation with our plant samples. In addition, we performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/windtunnel" class="normal-link-page">Wind tunnel assay</a> to observe male moths behaviour under stimulation with our pheromones.</p><br />
<br />
<p>Finally, to test the induction of gene expression triggered by our cupper-activated switch, we performed a <a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/luciferase" class="normal-link-page">Luciferase expression assay</a>. </p><br />
<br />
<br />
</br></br></br></br><br />
<br />
<br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/switch"><strong>&larr; Go to Switch</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>Go to Methodology</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety"><strong>Go to Biosafety &rarr;</strong></a></div><br/><br/><br/><br/><br />
</br></br><br />
</div><br />
</div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Sponsors
Team:Valencia UPV/Sponsors
2014-10-18T02:07:09Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<div align="center"><div id="cn-box" text-align="justify"></br><br />
<br />
<p><h3 class="hook" align="left"><a>Team</a> > <a>Sponsors</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>S</roja>ponsors</span> </div><br/><br/><br />
<br />
<br />
<!--<div align="center"><img class="img-title" alt="Sponsors" src="https://static.igem.org/mediawiki/2014/0/01/VUPVSponsors.png"></img></div>--></br></br><br />
<br />
<br />
<a target="_blank" href="http://www.upv.es/index-en.html"><img class="spon" alt="upv_logo" title="Universidad Politécnica de Valencia" src="https://static.igem.org/mediawiki/2014/2/2d/VUPV-modificated.jpg"></a><br />
<br />
<br />
<a target="_blank" href="http://www.ibmcp.upv.es/index_en.php"><img class="spon" id="spon-ibmcp" alt="ibmcp_csic_logo" title="IBMCP & CSIC" src="https://static.igem.org/mediawiki/2014/9/91/VUPVIBMCP.png"></a><br />
<br />
<a target="_blank" href="http://www.dival.es/"><img class="spon" alt="diputacion_val_logo" title="Diputación de Valencia" src="https://static.igem.org/mediawiki/2014/9/98/VUPV_DIP-mod.png"></a><br />
<br />
<a target="_blank" href="http://www.etsii.upv.es/index-es.php"><img class="spon" alt="etsii_upv_logo" title="Escuela Técnica Superior de Ingenieros Industriales" src="https://static.igem.org/mediawiki/2014/3/39/VUPVETSII_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.cropscience.bayer.com/"><img class="spon" id="spon-bayer" alt="bayer_cropscience_logo" title="Bayer Cropscience" src="https://static.igem.org/mediawiki/2014/f/fb/VUPVBayer_cropscience.png"></a><br />
<br />
<a target="_blank" href="http://www.upv.es/iam/ingles/bienvenida.htm"><img class="spon" alt="ceqa" title="CEQA" src="https://static.igem.org/mediawiki/2014/f/f0/VUPVCEQA_mod.png"></a><br />
<br />
<a target="_blank" href="http://www.csic.es/web/guest/home"><img class="spon" alt="csic" title="CSIC" src="https://static.igem.org/mediawiki/2014/2/2f/VUPVCsic.jpg"></a><br />
<br />
<br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
</html><br />
<br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/results/constructs
Team:Valencia UPV/Project/results/constructs
2014-10-18T02:06:18Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<style><br />
.box_achieve{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
</style><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results">Results</a> > <a>Constructs</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>C</roja>onstructs</span> </div><br/><br/><br />
<br />
<div class="box_achieve"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#biosyn">RESULTS–CONSTRUCTS-BIOSYNTHESIS</a></li> <li> <a href="#phero">RESULTS-CONSTRUCTS-PHEROMONE RELEASE</a></li> <li> <a href="#switch">RESULTS - CONSTRUCTS-SWITCH</a></li> <li> <a href="#biosafe">RESULTS-CONSTRUCTS-BIOSAFETY</a></li></ul><br />
</div><br/><br/><br />
<br />
<br />
<a name="biosyn" class="subpart">RESULTS–CONSTRUCTS-BIOSYNTHESIS</a><br/><br/><br />
<br />
<div><br />
<img title="Figure 1. Engineered pheromone production pathway" width="300px" style="float:right; margin-right: 15px;" src="https://static.igem.org/mediawiki/2014/0/05/VUPVPathway-semiochemical.jpg" alt="pathway_1"></img><br />
<br />
<p>In order to engineer the <span class="blue-bold">insect sexual pheromone</span> <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis">pathway</a> in our Sexy plant, we had to isolate four genes from different organisms: a desaturase (AtrΔ11), a reductase (HarFAR), an acetyltransferase (EaDAcT) and finally an alcohol oxidase (FAO). As they were coming from very different and not easily accessible organisms (two moths and a plant from Asia), the coding sequences (CDS) of the first three enzymes were obtained by gene synthesis (Integrated DNA Technologies, IDT) after codon usage optimization for <i>N. benthamiana</i>. As for the fourth one (FAO) we tried to amplify it from the genomic DNA of the yeast <i>Candida tropicalis</i>, with no successful results. Nevertheless, the three synthetic genes were sufficient to produce at least two of our target pheromones, the alcohol <span class="red-bold">(Z)-11-hexadecen-1-ol</span> and the acetate <span class="blue-bold">(Z)-11-hexadecenyl acetate</span>.</p><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 830px;"><span class="black-bold">Figure 1</span>. Engineered pheromone production pathway.</p></div><br/><br/><br />
<br />
<p>All three DNA sequences were domesticated; that is, standardized as <a href="#" class="normal-link-page">GoldenBraid</a> parts and cloned in the pUPD plasmid. Subsequently, each CDS was assembled with the strong constitutive Cauliflower mosaic virus promoter (P35S) and its terminator (T35S) respectively, in a multipartite assembly reaction. P35S is a strong plant constitutive promoter with high expression levels. As result of these assemblies, we obtained three Transcriptional units (TU) ready for plant transformation.</p><br/><br />
<br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/d/d5/VUPVPlasmido_Atr.png" alt="Atr-plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/VUPVPlasmido_harfar-WIKI.png" alt="harfar_plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/52/VUPVPlasmido_eadact-WIKI.png" alt="eadact_plasmid" width="250px"></img></div><br/><br />
<br />
<p>To maximize the flow through of the pathway, we wanted to make sure that all three genes were co-delivered simultaneously. This is to ensure that each transformed cell receives a complete set of genes and that the expression of all three enzymes is balanced and coordinated. Co-delivery is achieved by creating a multigenic construct, where all three genes are assembled in a single plasmid.</p><br/><br />
<br />
<p>We used the GoldenBraid assembly system to create the multigene assembly. After two binary reactions, the 3-genes construct was obtained. This construct was then transformed, by <span class="blue-bold">agroinfiltration</span>, into <i>N. benthamiana</i> plants for pheromone production.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/b/bc/VUPVPlasmido_MULTI-WIKI.png" width="350px"></img></div><br/><br />
<br />
<p>We used GoldenBraid 2.0 for all our cloning reactions. GoldenBraid and BioBrick parts are not directly exchangeable; however, we adapted the coding sequences of the three biosynthetic genes to BioBrick standards using a <a class="normal-link-page" href="#">GoldenBraid-Biobricks translator</a> developed by the <a href="https://2014.igem.org/Team:NRP-UEA-Norwich/Project_Mo-Flipper" class="normal-link-page">NRP-UEA-Norwich</a> team. These BioBricks have been submitted to the Parts Registry.</p><br/><br/><br/><br />
<br />
<br />
<br />
<a name="phero" class="subpart">RESULTS-CONSTRUCTS-PHEROMONE RELEASE</a><br/><br/><br />
<br />
<br />
<p>To obtain a plant capable of releasing pheromones into the environment in an efficient way, we decided to use the glandular trichome specific promoter (PCPS2) (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/release" class="normal-link-page">see Pheromone Relase</a>).</p><br/><br />
<br />
<p>We obtained this promoter from Nicotiana tabacum genome and tested its functionality assembling it with GFP (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression" class="normal-link-page">see Results: Pheromone Release</a>).</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/8c/VUPVPlasmido_PCPS2-GFP.png" width="350px"></img></div><br/><br />
<br />
<br />
<p>As it proved to be an effective promoter, expressing GFP only at the glandular cells of the trichomes, we decided to assemble each of the pheromone biosynthetic genes with this promoter to reach improvements in the pheromones release (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis">see Biosynthesis</a>).</p><br/><br />
<br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/0/09/VUPVPlasmido_Atr-PCPS.png" alt="Atr-plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/VUPVPlasmido_harfar-PCPS.png" alt="harfar_plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/3/34/VUPVPlasmido_eadact-PCPS2.png" alt="eadact_plasmid" width="250px"></img></div><br/><br />
<br />
<br />
<p>Finally, after two binary GoldenBraid assembly steps, we obtained a multigenic construct with all three transcriptional units with the PCPS2 promoter. This construct was ready to be transferred to the plant to test the release of the pheromones.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/8b/VUPVPlasmido_MULTI-PCPS.png" width="350px"></img></div><br/><br/><br/><br />
<br />
<br />
<a name="switch" class="subpart">RESULTS - CONSTRUCTS-SWITCH</a><br/><br/><br />
<br />
<p>In order to have a tight control over the pheromone production in the plant, we implemented an inducible switch in the plant genetic circuit. This switch is induced with the presence of copper ions, activating the pheromone production pathway in the plant only when the insects mating season arrives. With this kind of inducible expression, the pheromones production metabolic cost for the plant will be reduced and the pheromone release will be always under control (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/switch" class="normal-link-page">see Switch</a>).</p><br/><br />
<br />
<br />
<p>This switch is composed of two different parts:</p><br/><br />
<ul style="list-style: inherit;"><br />
<li class="normal-sangría">A constituvely expressed transcription factor (CUP2) that changes its conformation in the presence of a given concentration of cupper ions. With this change of conformation, it can bind a specific promoter and initiates the transcription of a particular gene.</li><br />
<li class="normal-sangría">A chimeric promoter that includes an Upstream Activating Sequence (UAS) whith the transcription factor binding site.</li><br />
</ul><br/><br />
<br />
<p>This switch is naturally present in yeast, so it must be adapted to plants.</p><br/><br />
<br />
<p>Therefore, the transcription factor CUP2, which was obtained from S. cerevisae genome, was assembled with de Cauliflower mosaic virus (CaMV) P35S promoter and T35S terminator to be constitutively expressed. In addition, an activator domain (GAL4 AD) was joined to the CUP2 sequence, in order to improve the transcription initiation.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/8a/VUPVPlasmido_CUP2.png" width="350px"></img></div><br/><br />
<br />
<p>On the other hand, we needed to assemble the chimeric promoter and the gene of interest. This chimeric promoter is composed of 3 different parts:</p><br/><br />
<br />
<ul style="list-style: inherit;"><br />
<li class="normal-sangría">The aforementioned UAS, which is a 44bp region. Only 16bp of them are actually the binding site for CUP2 while the rest are spacer nucleotides.</li><br />
<li class="normal-sangría">A minimal promoter, miniP35S (-60). These are a reduced number of nucleotides from the CaMV P35S promoter required for starting transcription.</li><br />
<li class="normal-sangría">The 5'-UTR region of the tobacco mosaic virus (TMV), called omega sequence. This sequence functions as a translational enhancer in plants.</li><br />
</ul><br/><br />
<br />
<p>As we were going to perform a Luciferase assay to test the switch (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/results">see Luciferase assay</a>) the gene of interest assembled with the chimeric promoter was the Luciferase. This is the obtained construct.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/c/cf/VUPVPlasmido_QUIMER.png" width="350px"></img></div><br/><br />
<br />
<p>In order to have a control for the Luciferase assay, we needed another construct already available in the GoldenBraid collection. It included the Renilla and P19 genes.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/84/VUPVPlasmido_renilla.png" width="350px"></img></div><br/><br />
<br />
<p>Finally, we assembled all three constructs into a single multigenic construct that was introduced into the plant to perform the Luciferase assay.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/b/b9/VUPVPlasmido_switch_completo.png" width="650px"></img></div><br/><br/><br/><br />
<br />
<a name="biosafe" class="subpart">RESULTS-CONSTRUCTS-BIOSAFETY</a><br/><br/><br />
<br />
<p>In order to obtain a safe plant we developed a biosafety module which avoids spread of the plant’s genetic material and allows easy identification of the modified plant.</p><br/><br />
<br />
<br />
<p>In order to avoid spread of genetic material, we built a plasmid which constitutively expressed Barnase (an RNAse from <i>Bacillus amyloliquefaciens</i>) under the regulation of the tapetum specific promoter TA29. Barnase effect under the regulation of this promoter can’t be tested under the limitations of transient expression and time restrictions didn’t allow us to create the stable plant, but <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety">its function is well documented</a>.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/4/4e/VUPVFigure_1.png" width="350px"></img></div><br/><br />
<br />
<p>We worked together with <a class="normal-link-page" href="https://2014.igem.org/Team:NRP-UEA-Norwich">NRP-UEA-Norwich</a> team to introduce their chromoproteins (Yellow and Blue) in our system to be used as a strategy of identity preservation. We received their complete transcriptional units and tested them in plant. However, their activity was not strong enough to be detected by naked eye.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/6/6d/VUPVFigure_2.png" width="550px"></img></div><br/><br />
<br />
<p>The complete biosafety module, containing chromoproteins as identity preservation agent, had already been constructed in biobricks format. Expression of Barnase specifically in tapetum cells and an identity preservation agent completes our biosafety module.</p><br/><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/b/b3/VUPVFigure_3.png" width="550px"></img></div><br/><br />
<br />
<p>Since the provided chromoproteins did not show enough change in the plant’s colour to be detected by the naked eye, we tested an alternative strategy. We tested an anthocyanin production enhancing genetic construction in <i>N.benthamiana</i>. Anthocyanins are coloured compounds found in plants.</p><br/><br />
<br />
<p>We obtained this construction from <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb">GoldenBraid 2.0</a> collection. This construction expresses two transcription factors (Ant1 and JAF13) and successfully enhanced the synthesis of anthocyanins. Therefore, we propose an identity preservation strategy based in anthocyanin accumulation as part of our biosafety module.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/7/79/Figure_4.png" width="650px"></img></div><br/><br />
<br />
<br />
<br />
<br/><br/><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>&larr; Go to Methodology</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results"><strong>Go to Results</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression"><strong>Go to Trichome-Specific Expression &rarr;</strong></a></div><br/><br/><br/><br/><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/results/constructs
Team:Valencia UPV/Project/results/constructs
2014-10-18T02:05:55Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<style><br />
.box_achieve{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
</style><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results">Results</a> > <a>Constructs</a></h3></p><br/><br />
<br />
<div align="center"><span class="coda"><roja>C</roja>onstructs</span> </div><br/><br/><br />
<br />
<div class="box_achieve"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#biosyn">RESULTS–CONSTRUCTS-BIOSYNTHESIS</a></li> <li> <a href="#phero">RESULTS-CONSTRUCTS-PHEROMONE RELEASE</a></li> <li> <a href="#switch">RESULTS - CONSTRUCTS-SWITCH</a></li> <li> <a href="#biosafe">RESULTS-CONSTRUCTS-BIOSAFETY</a></li></ul><br />
</div><br/><br />
<br />
<br />
<a name="biosyn" class="subpart">RESULTS–CONSTRUCTS-BIOSYNTHESIS</a><br/><br/><br />
<br />
<div><br />
<img title="Figure 1. Engineered pheromone production pathway" width="300px" style="float:right; margin-right: 15px;" src="https://static.igem.org/mediawiki/2014/0/05/VUPVPathway-semiochemical.jpg" alt="pathway_1"></img><br />
<br />
<p>In order to engineer the <span class="blue-bold">insect sexual pheromone</span> <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis">pathway</a> in our Sexy plant, we had to isolate four genes from different organisms: a desaturase (AtrΔ11), a reductase (HarFAR), an acetyltransferase (EaDAcT) and finally an alcohol oxidase (FAO). As they were coming from very different and not easily accessible organisms (two moths and a plant from Asia), the coding sequences (CDS) of the first three enzymes were obtained by gene synthesis (Integrated DNA Technologies, IDT) after codon usage optimization for <i>N. benthamiana</i>. As for the fourth one (FAO) we tried to amplify it from the genomic DNA of the yeast <i>Candida tropicalis</i>, with no successful results. Nevertheless, the three synthetic genes were sufficient to produce at least two of our target pheromones, the alcohol <span class="red-bold">(Z)-11-hexadecen-1-ol</span> and the acetate <span class="blue-bold">(Z)-11-hexadecenyl acetate</span>.</p><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 830px;"><span class="black-bold">Figure 1</span>. Engineered pheromone production pathway.</p></div><br/><br/><br />
<br />
<p>All three DNA sequences were domesticated; that is, standardized as <a href="#" class="normal-link-page">GoldenBraid</a> parts and cloned in the pUPD plasmid. Subsequently, each CDS was assembled with the strong constitutive Cauliflower mosaic virus promoter (P35S) and its terminator (T35S) respectively, in a multipartite assembly reaction. P35S is a strong plant constitutive promoter with high expression levels. As result of these assemblies, we obtained three Transcriptional units (TU) ready for plant transformation.</p><br/><br />
<br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/d/d5/VUPVPlasmido_Atr.png" alt="Atr-plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/VUPVPlasmido_harfar-WIKI.png" alt="harfar_plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/52/VUPVPlasmido_eadact-WIKI.png" alt="eadact_plasmid" width="250px"></img></div><br/><br />
<br />
<p>To maximize the flow through of the pathway, we wanted to make sure that all three genes were co-delivered simultaneously. This is to ensure that each transformed cell receives a complete set of genes and that the expression of all three enzymes is balanced and coordinated. Co-delivery is achieved by creating a multigenic construct, where all three genes are assembled in a single plasmid.</p><br/><br />
<br />
<p>We used the GoldenBraid assembly system to create the multigene assembly. After two binary reactions, the 3-genes construct was obtained. This construct was then transformed, by <span class="blue-bold">agroinfiltration</span>, into <i>N. benthamiana</i> plants for pheromone production.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/b/bc/VUPVPlasmido_MULTI-WIKI.png" width="350px"></img></div><br/><br />
<br />
<p>We used GoldenBraid 2.0 for all our cloning reactions. GoldenBraid and BioBrick parts are not directly exchangeable; however, we adapted the coding sequences of the three biosynthetic genes to BioBrick standards using a <a class="normal-link-page" href="#">GoldenBraid-Biobricks translator</a> developed by the <a href="https://2014.igem.org/Team:NRP-UEA-Norwich/Project_Mo-Flipper" class="normal-link-page">NRP-UEA-Norwich</a> team. These BioBricks have been submitted to the Parts Registry.</p><br/><br/><br/><br />
<br />
<br />
<br />
<a name="phero" class="subpart">RESULTS-CONSTRUCTS-PHEROMONE RELEASE</a><br/><br/><br />
<br />
<br />
<p>To obtain a plant capable of releasing pheromones into the environment in an efficient way, we decided to use the glandular trichome specific promoter (PCPS2) (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/release" class="normal-link-page">see Pheromone Relase</a>).</p><br/><br />
<br />
<p>We obtained this promoter from Nicotiana tabacum genome and tested its functionality assembling it with GFP (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression" class="normal-link-page">see Results: Pheromone Release</a>).</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/8c/VUPVPlasmido_PCPS2-GFP.png" width="350px"></img></div><br/><br />
<br />
<br />
<p>As it proved to be an effective promoter, expressing GFP only at the glandular cells of the trichomes, we decided to assemble each of the pheromone biosynthetic genes with this promoter to reach improvements in the pheromones release (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis">see Biosynthesis</a>).</p><br/><br />
<br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/0/09/VUPVPlasmido_Atr-PCPS.png" alt="Atr-plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/VUPVPlasmido_harfar-PCPS.png" alt="harfar_plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/3/34/VUPVPlasmido_eadact-PCPS2.png" alt="eadact_plasmid" width="250px"></img></div><br/><br />
<br />
<br />
<p>Finally, after two binary GoldenBraid assembly steps, we obtained a multigenic construct with all three transcriptional units with the PCPS2 promoter. This construct was ready to be transferred to the plant to test the release of the pheromones.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/8b/VUPVPlasmido_MULTI-PCPS.png" width="350px"></img></div><br/><br/><br/><br />
<br />
<br />
<a name="switch" class="subpart">RESULTS - CONSTRUCTS-SWITCH</a><br/><br/><br />
<br />
<p>In order to have a tight control over the pheromone production in the plant, we implemented an inducible switch in the plant genetic circuit. This switch is induced with the presence of copper ions, activating the pheromone production pathway in the plant only when the insects mating season arrives. With this kind of inducible expression, the pheromones production metabolic cost for the plant will be reduced and the pheromone release will be always under control (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/switch" class="normal-link-page">see Switch</a>).</p><br/><br />
<br />
<br />
<p>This switch is composed of two different parts:</p><br/><br />
<ul style="list-style: inherit;"><br />
<li class="normal-sangría">A constituvely expressed transcription factor (CUP2) that changes its conformation in the presence of a given concentration of cupper ions. With this change of conformation, it can bind a specific promoter and initiates the transcription of a particular gene.</li><br />
<li class="normal-sangría">A chimeric promoter that includes an Upstream Activating Sequence (UAS) whith the transcription factor binding site.</li><br />
</ul><br/><br />
<br />
<p>This switch is naturally present in yeast, so it must be adapted to plants.</p><br/><br />
<br />
<p>Therefore, the transcription factor CUP2, which was obtained from S. cerevisae genome, was assembled with de Cauliflower mosaic virus (CaMV) P35S promoter and T35S terminator to be constitutively expressed. In addition, an activator domain (GAL4 AD) was joined to the CUP2 sequence, in order to improve the transcription initiation.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/8a/VUPVPlasmido_CUP2.png" width="350px"></img></div><br/><br />
<br />
<p>On the other hand, we needed to assemble the chimeric promoter and the gene of interest. This chimeric promoter is composed of 3 different parts:</p><br/><br />
<br />
<ul style="list-style: inherit;"><br />
<li class="normal-sangría">The aforementioned UAS, which is a 44bp region. Only 16bp of them are actually the binding site for CUP2 while the rest are spacer nucleotides.</li><br />
<li class="normal-sangría">A minimal promoter, miniP35S (-60). These are a reduced number of nucleotides from the CaMV P35S promoter required for starting transcription.</li><br />
<li class="normal-sangría">The 5'-UTR region of the tobacco mosaic virus (TMV), called omega sequence. This sequence functions as a translational enhancer in plants.</li><br />
</ul><br/><br />
<br />
<p>As we were going to perform a Luciferase assay to test the switch (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/results">see Luciferase assay</a>) the gene of interest assembled with the chimeric promoter was the Luciferase. This is the obtained construct.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/c/cf/VUPVPlasmido_QUIMER.png" width="350px"></img></div><br/><br />
<br />
<p>In order to have a control for the Luciferase assay, we needed another construct already available in the GoldenBraid collection. It included the Renilla and P19 genes.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/84/VUPVPlasmido_renilla.png" width="350px"></img></div><br/><br />
<br />
<p>Finally, we assembled all three constructs into a single multigenic construct that was introduced into the plant to perform the Luciferase assay.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/b/b9/VUPVPlasmido_switch_completo.png" width="650px"></img></div><br/><br/><br/><br />
<br />
<a name="biosafe" class="subpart">RESULTS-CONSTRUCTS-BIOSAFETY</a><br/><br/><br />
<br />
<p>In order to obtain a safe plant we developed a biosafety module which avoids spread of the plant’s genetic material and allows easy identification of the modified plant.</p><br/><br />
<br />
<br />
<p>In order to avoid spread of genetic material, we built a plasmid which constitutively expressed Barnase (an RNAse from <i>Bacillus amyloliquefaciens</i>) under the regulation of the tapetum specific promoter TA29. Barnase effect under the regulation of this promoter can’t be tested under the limitations of transient expression and time restrictions didn’t allow us to create the stable plant, but <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety">its function is well documented</a>.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/4/4e/VUPVFigure_1.png" width="350px"></img></div><br/><br />
<br />
<p>We worked together with <a class="normal-link-page" href="https://2014.igem.org/Team:NRP-UEA-Norwich">NRP-UEA-Norwich</a> team to introduce their chromoproteins (Yellow and Blue) in our system to be used as a strategy of identity preservation. We received their complete transcriptional units and tested them in plant. However, their activity was not strong enough to be detected by naked eye.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/6/6d/VUPVFigure_2.png" width="550px"></img></div><br/><br />
<br />
<p>The complete biosafety module, containing chromoproteins as identity preservation agent, had already been constructed in biobricks format. Expression of Barnase specifically in tapetum cells and an identity preservation agent completes our biosafety module.</p><br/><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/b/b3/VUPVFigure_3.png" width="550px"></img></div><br/><br />
<br />
<p>Since the provided chromoproteins did not show enough change in the plant’s colour to be detected by the naked eye, we tested an alternative strategy. We tested an anthocyanin production enhancing genetic construction in <i>N.benthamiana</i>. Anthocyanins are coloured compounds found in plants.</p><br/><br />
<br />
<p>We obtained this construction from <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb">GoldenBraid 2.0</a> collection. This construction expresses two transcription factors (Ant1 and JAF13) and successfully enhanced the synthesis of anthocyanins. Therefore, we propose an identity preservation strategy based in anthocyanin accumulation as part of our biosafety module.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/7/79/Figure_4.png" width="650px"></img></div><br/><br />
<br />
<br />
<br />
<br/><br/><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>&larr; Go to Methodology</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results"><strong>Go to Results</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression"><strong>Go to Trichome-Specific Expression &rarr;</strong></a></div><br/><br/><br/><br/><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel
http://2014.igem.org/Team:Valencia_UPV/Project/results/constructs
Team:Valencia UPV/Project/results/constructs
2014-10-18T02:05:29Z
<p>Ivllobel: </p>
<hr />
<div>{{:Team:Valencia_UPV/header}}<br />
<br />
<html><br />
<style><br />
.box_achieve{<br />
border: 2px dashed blue;<br />
margin: 10px;<br />
padding: 10px;<br />
background-color: #b0c4de;<br />
}<br />
</style><br />
<div align="center"><div id="cn-box" align="justify"><br />
<br />
<p><h3 class="hook" align="left"><a>Project</a> > <a href="https://2014.igem.org/Team:Valencia_UPV/Project/results">Results</a> > <a>Constructs</a></h3></p><br/><br/><br />
<br />
<div align="center"><span class="coda"><roja>C</roja>onstructs</span> </div><br/><br/><br />
<br />
<div class="box_achieve"><br />
<br />
Contents:<br />
<ul style="margin-left: 1.5em;"> <li> <a href="#biosyn">RESULTS–CONSTRUCTS-BIOSYNTHESIS</a></li> <li> <a href="#phero">RESULTS-CONSTRUCTS-PHEROMONE RELEASE</a></li> <li> <a href="#switch">RESULTS - CONSTRUCTS-SWITCH</a></li> <li> <a href="#biosafe">RESULTS-CONSTRUCTS-BIOSAFETY</a></li></ul><br />
</div><br />
<br />
<br />
<a name="biosyn" class="subpart">RESULTS–CONSTRUCTS-BIOSYNTHESIS</a><br/><br/><br />
<br />
<div><br />
<img title="Figure 1. Engineered pheromone production pathway" width="300px" style="float:right; margin-right: 15px;" src="https://static.igem.org/mediawiki/2014/0/05/VUPVPathway-semiochemical.jpg" alt="pathway_1"></img><br />
<br />
<p>In order to engineer the <span class="blue-bold">insect sexual pheromone</span> <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis">pathway</a> in our Sexy plant, we had to isolate four genes from different organisms: a desaturase (AtrΔ11), a reductase (HarFAR), an acetyltransferase (EaDAcT) and finally an alcohol oxidase (FAO). As they were coming from very different and not easily accessible organisms (two moths and a plant from Asia), the coding sequences (CDS) of the first three enzymes were obtained by gene synthesis (Integrated DNA Technologies, IDT) after codon usage optimization for <i>N. benthamiana</i>. As for the fourth one (FAO) we tried to amplify it from the genomic DNA of the yeast <i>Candida tropicalis</i>, with no successful results. Nevertheless, the three synthetic genes were sufficient to produce at least two of our target pheromones, the alcohol <span class="red-bold">(Z)-11-hexadecen-1-ol</span> and the acetate <span class="blue-bold">(Z)-11-hexadecenyl acetate</span>.</p><br />
<br />
<br/><p style="text-align: right; font-style: italic; font-size: 0.8em; width: 830px;"><span class="black-bold">Figure 1</span>. Engineered pheromone production pathway.</p></div><br/><br/><br />
<br />
<p>All three DNA sequences were domesticated; that is, standardized as <a href="#" class="normal-link-page">GoldenBraid</a> parts and cloned in the pUPD plasmid. Subsequently, each CDS was assembled with the strong constitutive Cauliflower mosaic virus promoter (P35S) and its terminator (T35S) respectively, in a multipartite assembly reaction. P35S is a strong plant constitutive promoter with high expression levels. As result of these assemblies, we obtained three Transcriptional units (TU) ready for plant transformation.</p><br/><br />
<br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/d/d5/VUPVPlasmido_Atr.png" alt="Atr-plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/VUPVPlasmido_harfar-WIKI.png" alt="harfar_plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/52/VUPVPlasmido_eadact-WIKI.png" alt="eadact_plasmid" width="250px"></img></div><br/><br />
<br />
<p>To maximize the flow through of the pathway, we wanted to make sure that all three genes were co-delivered simultaneously. This is to ensure that each transformed cell receives a complete set of genes and that the expression of all three enzymes is balanced and coordinated. Co-delivery is achieved by creating a multigenic construct, where all three genes are assembled in a single plasmid.</p><br/><br />
<br />
<p>We used the GoldenBraid assembly system to create the multigene assembly. After two binary reactions, the 3-genes construct was obtained. This construct was then transformed, by <span class="blue-bold">agroinfiltration</span>, into <i>N. benthamiana</i> plants for pheromone production.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/b/bc/VUPVPlasmido_MULTI-WIKI.png" width="350px"></img></div><br/><br />
<br />
<p>We used GoldenBraid 2.0 for all our cloning reactions. GoldenBraid and BioBrick parts are not directly exchangeable; however, we adapted the coding sequences of the three biosynthetic genes to BioBrick standards using a <a class="normal-link-page" href="#">GoldenBraid-Biobricks translator</a> developed by the <a href="https://2014.igem.org/Team:NRP-UEA-Norwich/Project_Mo-Flipper" class="normal-link-page">NRP-UEA-Norwich</a> team. These BioBricks have been submitted to the Parts Registry.</p><br/><br/><br/><br />
<br />
<br />
<br />
<a name="phero" class="subpart">RESULTS-CONSTRUCTS-PHEROMONE RELEASE</a><br/><br/><br />
<br />
<br />
<p>To obtain a plant capable of releasing pheromones into the environment in an efficient way, we decided to use the glandular trichome specific promoter (PCPS2) (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/release" class="normal-link-page">see Pheromone Relase</a>).</p><br/><br />
<br />
<p>We obtained this promoter from Nicotiana tabacum genome and tested its functionality assembling it with GFP (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression" class="normal-link-page">see Results: Pheromone Release</a>).</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/8c/VUPVPlasmido_PCPS2-GFP.png" width="350px"></img></div><br/><br />
<br />
<br />
<p>As it proved to be an effective promoter, expressing GFP only at the glandular cells of the trichomes, we decided to assemble each of the pheromone biosynthetic genes with this promoter to reach improvements in the pheromones release (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosynthesis">see Biosynthesis</a>).</p><br/><br />
<br />
<div align="center"><br />
<img src="https://static.igem.org/mediawiki/2014/0/09/VUPVPlasmido_Atr-PCPS.png" alt="Atr-plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/VUPVPlasmido_harfar-PCPS.png" alt="harfar_plasmid" width="250px"></img><br />
<img src="https://static.igem.org/mediawiki/2014/3/34/VUPVPlasmido_eadact-PCPS2.png" alt="eadact_plasmid" width="250px"></img></div><br/><br />
<br />
<br />
<p>Finally, after two binary GoldenBraid assembly steps, we obtained a multigenic construct with all three transcriptional units with the PCPS2 promoter. This construct was ready to be transferred to the plant to test the release of the pheromones.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/8b/VUPVPlasmido_MULTI-PCPS.png" width="350px"></img></div><br/><br/><br/><br />
<br />
<br />
<a name="switch" class="subpart">RESULTS - CONSTRUCTS-SWITCH</a><br/><br/><br />
<br />
<p>In order to have a tight control over the pheromone production in the plant, we implemented an inducible switch in the plant genetic circuit. This switch is induced with the presence of copper ions, activating the pheromone production pathway in the plant only when the insects mating season arrives. With this kind of inducible expression, the pheromones production metabolic cost for the plant will be reduced and the pheromone release will be always under control (<a href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/switch" class="normal-link-page">see Switch</a>).</p><br/><br />
<br />
<br />
<p>This switch is composed of two different parts:</p><br/><br />
<ul style="list-style: inherit;"><br />
<li class="normal-sangría">A constituvely expressed transcription factor (CUP2) that changes its conformation in the presence of a given concentration of cupper ions. With this change of conformation, it can bind a specific promoter and initiates the transcription of a particular gene.</li><br />
<li class="normal-sangría">A chimeric promoter that includes an Upstream Activating Sequence (UAS) whith the transcription factor binding site.</li><br />
</ul><br/><br />
<br />
<p>This switch is naturally present in yeast, so it must be adapted to plants.</p><br/><br />
<br />
<p>Therefore, the transcription factor CUP2, which was obtained from S. cerevisae genome, was assembled with de Cauliflower mosaic virus (CaMV) P35S promoter and T35S terminator to be constitutively expressed. In addition, an activator domain (GAL4 AD) was joined to the CUP2 sequence, in order to improve the transcription initiation.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/8a/VUPVPlasmido_CUP2.png" width="350px"></img></div><br/><br />
<br />
<p>On the other hand, we needed to assemble the chimeric promoter and the gene of interest. This chimeric promoter is composed of 3 different parts:</p><br/><br />
<br />
<ul style="list-style: inherit;"><br />
<li class="normal-sangría">The aforementioned UAS, which is a 44bp region. Only 16bp of them are actually the binding site for CUP2 while the rest are spacer nucleotides.</li><br />
<li class="normal-sangría">A minimal promoter, miniP35S (-60). These are a reduced number of nucleotides from the CaMV P35S promoter required for starting transcription.</li><br />
<li class="normal-sangría">The 5'-UTR region of the tobacco mosaic virus (TMV), called omega sequence. This sequence functions as a translational enhancer in plants.</li><br />
</ul><br/><br />
<br />
<p>As we were going to perform a Luciferase assay to test the switch (<a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/results">see Luciferase assay</a>) the gene of interest assembled with the chimeric promoter was the Luciferase. This is the obtained construct.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/c/cf/VUPVPlasmido_QUIMER.png" width="350px"></img></div><br/><br />
<br />
<p>In order to have a control for the Luciferase assay, we needed another construct already available in the GoldenBraid collection. It included the Renilla and P19 genes.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/8/84/VUPVPlasmido_renilla.png" width="350px"></img></div><br/><br />
<br />
<p>Finally, we assembled all three constructs into a single multigenic construct that was introduced into the plant to perform the Luciferase assay.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/b/b9/VUPVPlasmido_switch_completo.png" width="650px"></img></div><br/><br/><br/><br />
<br />
<a name="biosafe" class="subpart">RESULTS-CONSTRUCTS-BIOSAFETY</a><br/><br/><br />
<br />
<p>In order to obtain a safe plant we developed a biosafety module which avoids spread of the plant’s genetic material and allows easy identification of the modified plant.</p><br/><br />
<br />
<br />
<p>In order to avoid spread of genetic material, we built a plasmid which constitutively expressed Barnase (an RNAse from <i>Bacillus amyloliquefaciens</i>) under the regulation of the tapetum specific promoter TA29. Barnase effect under the regulation of this promoter can’t be tested under the limitations of transient expression and time restrictions didn’t allow us to create the stable plant, but <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/biosafety">its function is well documented</a>.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/4/4e/VUPVFigure_1.png" width="350px"></img></div><br/><br />
<br />
<p>We worked together with <a class="normal-link-page" href="https://2014.igem.org/Team:NRP-UEA-Norwich">NRP-UEA-Norwich</a> team to introduce their chromoproteins (Yellow and Blue) in our system to be used as a strategy of identity preservation. We received their complete transcriptional units and tested them in plant. However, their activity was not strong enough to be detected by naked eye.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/6/6d/VUPVFigure_2.png" width="550px"></img></div><br/><br />
<br />
<p>The complete biosafety module, containing chromoproteins as identity preservation agent, had already been constructed in biobricks format. Expression of Barnase specifically in tapetum cells and an identity preservation agent completes our biosafety module.</p><br/><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/b/b3/VUPVFigure_3.png" width="550px"></img></div><br/><br />
<br />
<p>Since the provided chromoproteins did not show enough change in the plant’s colour to be detected by the naked eye, we tested an alternative strategy. We tested an anthocyanin production enhancing genetic construction in <i>N.benthamiana</i>. Anthocyanins are coloured compounds found in plants.</p><br/><br />
<br />
<p>We obtained this construction from <a class="normal-link-page" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology/gb">GoldenBraid 2.0</a> collection. This construction expresses two transcription factors (Ant1 and JAF13) and successfully enhanced the synthesis of anthocyanins. Therefore, we propose an identity preservation strategy based in anthocyanin accumulation as part of our biosafety module.</p><br/><br />
<br />
<div align="center"><img src="https://static.igem.org/mediawiki/2014/7/79/Figure_4.png" width="650px"></img></div><br/><br />
<br />
<br />
<br />
<br/><br/><br/><br/><br/><br/><br />
<br />
<div align="center"><br />
<a class="button-content" id="goto-left" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/modules/methodology"><strong>&larr; Go to Methodology</strong></a><br />
<a class="button-content" id="goto-middle" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results"><strong>Go to Results</strong></a><br />
<a class="button-content" id="goto-right" align="center" href="https://2014.igem.org/Team:Valencia_UPV/Project/results/trichome_expression"><strong>Go to Trichome-Specific Expression &rarr;</strong></a></div><br/><br/><br/><br/><br />
<br />
</div><br />
</br></br></div><br />
<div id="space-margin"></div><br />
<br />
<br />
</html><br />
{{:Team:Valencia_UPV/footer_img}}</div>
Ivllobel