http://2014.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=Yaan2014.igem.org - User contributions [en]2024-03-29T05:42:13ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-18T02:36:37Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
</style><br />
<div class="content"><br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Modeling&ensp;and&ensp;Simulation</h2></br></center><br />
<center><p>"All models are wrong, but some are useful."<br />
When we decided to use TAL effectors building CROWN, our project, there were three main challenges concerning the efficiency of this system.<br />
First, allowing some DNA mutations, can the CROWN be as efficient as before?<br />
Second, given that CROWN can be successfully distributed on certain area of single cell, can it make sense?<br />
Third, how to design the sequence of Golden Gate?<br />
The following three parts focus on the three questions. </p><br />
</center><br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Part I Single Cell"><br />
<center><h2>Part I Single Cell</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="Part II Docking"><br />
<center> <h2>Part II Docking</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="Part III K-clique Problem"><br />
<center><h2>Part III K-clique Problem</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#Discussion" title="Reference"><br />
<center><h2>Reference</h2></center></a><br />
</div><br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<article class="post__article"><br />
<!-- <h2 id="partisinglecell">Overview&ensp;of&ensp;Modeling&ensp;and&ensp;Simulation</h2><br />
<p>"All models are wrong, but some are useful."</p><br />
<p>When we decide to use TAL effectors building CROWN, our project, there are three main challenges concerning the efficiencies of this system.</p><br />
<p>First, allowing some DNA mutations, whether the CROWN can be efficient as before?</p><br />
<p>Second, given that CROWN can be successfully distributed on certain area of single cell, can it make sense?</p><br />
<p>Third, how to design the sequence of Golden Gate?</p><br />
<p>The following three parts focus on the three questions. </p><br />
--><br />
<br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly on the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
Certain enzymes are polymerized on the cell membrane.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Polymerization</strong><br />
The polymerization of certain enzymes is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<h4>1. Metabolism</h4><br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png" width=800px></img></center><br />
<center><small>Figure2.2.1 The process of the metabolism: s0, s1, s2, s3 are the substrates and E0, E1,E2 are the enzymes </small></center><br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/0/01/SJTU14_animation-synthesis.gif"width=800x></img></center><br />
<center><small>Figure2.2.2 the simulation of the CROWN</small></center><br />
<h4>2. Initial Distribution of Substrates</h4><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<h4>3. Movement of Substrates</h4><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<h4>4. Catalytic reaction</h4><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<h4>5. Other Hypothesis</h4><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<h4>All Results</h4><br />
<center><embed width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></embed></center><br />
<br />
<a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html" > <center>Click to watch the video</a></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/de/SJTU14-All_Results.JPG" width=700x></img></center><br />
<center><small>Figure2.2.3 All the results of the four types.</small></center><br />
<br />
<h4 >Type 1</h4> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/b/ba/SJTU14-Membrane_%26_Random.JPG" width=700x></img></center><br />
<center><small>Figure2.2.4 The extent of reaction of type 1.</small></center><br />
<h4>Type 2</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ad/SJTU14-Membrane_%26_Polymerization.JPG" width=700x></img></center><br />
<center><small>Figure2.2.5 The extent of reaction of type 2.</small></center><br />
<h4>Type 3</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0b/SJTU14-Matrix_%26_Random.JPG" width=700px></img></center><br />
<center><small>Figure2.2.6 The extent of reaction of type 3</small></center><br />
<h4>Type 4</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7a/SJTU14-Matrix_%26_Polymerization.JPG" width=700x ></img></center><br />
<center><small>Figure2.2.7 The extent of reaction of type 4</small></center><p id="dianweidian9"></br></br></br></br></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg" width=800px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p><strong><li>The highlighted Letters represent the mutation site.</li></strong></p><br />
<p><strong><li>The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.</li></strong></p><br />
<p><strong><li>The higher Docking scores, the better Docking</li></strong></p><br />
<br />
<br><br><ul style="padding-left:5%;"><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<br />
<br />
<br/><br/> <br />
<br />
<li ><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<br />
<br />
</ul><br />
<h3 id="Analysis">Analysis</h3><br />
<center><p><strong>Table</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<br><center><p><strong>Scatter Diagram</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<center><small>Figure 2.2.8 The correlation between the number of mutation sites and the docking scores.The higher docking scores indicates the better combination of TAL and target sequence.</small></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p id="dianweidian10">From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<h2>Part Ⅲ K-clique Problem</h2><br />
<h3 id="Problem Identification">Problem Identification</h3><br />
<p>Before designing the TAL sequence, what we need to do first is to design a set of sequences, which are consist of seven fragments containing four nucleotides. In order to accomplish this, we offer a new sequence alignment algorithm for these fragmental sequences comparison. By using Loose Algorithm and Strict Algorithm, two fragmental sequences can be scored, and when the score is less than or equal to a specific value (eg 2), we can accept that they are a valid combination.</p><br />
<p>As we can see, the sequence database contains a total of 4 * 4 * 4 * 4 = 256 kinds of fragmental sequences. Now, what we should do is to find out some seven sequences whose each two fragments can be a valid combination, based on a large (256*256) score table.</p><br />
<h3 id="Assumption and Model Formulation">Assumption and Model Formulation</h3><br />
<p>We try to solve this problem by making full use of graph theory. In our model, each fragmental sequence can be treated as a node, and two “node” is connected, if they are a valid combination (the score less than or equal to 2). After doing that, we just need to find such seven nodes which are consist of a complete graph from a graph with 256 nodes. (Note: not every two nodes in original graph is connected)</p><br />
<h3 id="Brief introduction to graph theory">Brief introduction to graph theory</h3><br />
<p>For an undirected graph G = (V, E),if U⊆V, and for any u, v ⊆ U, (u, v) ⊆ E, U is called complete subgraph of G.</p><br />
<p>A clique in an undirected graph G = (V, E) is a subset of the vertex set C ⊆ V, such that for every two vertices in C, there exists an edge connecting the two. A maximal clique is a clique that cannot be extended by including one more adjacent vertex, that is, a clique which does not exist exclusively within the vertex set of a larger clique.</p><br />
<p>U is the maximal complete subgraph of G, if and only if U is a clique of U and U is not contained in a larger subgraph.</p><br />
<p>The k-clique problem is to find the complete graph with k nodes in a specific graph. What’s more, k-clique algorithm is defined in the paper "Uncovering the overlapping community structure of complex networks in nature and society" - G. Palla, I. Derényi, I. Farkas, and T. Vicsek - Nature 435, 814–818 (2005).</p><br />
<p>Although a deterministic algorithm for this problem with an O(n*2^n) algorithm time complexity, fortunately, in our experiment, the problem we should solve is just with 256 nodes, so a non-deterministic algorithm can be applied.</p><br />
<h3 id="Solution">Solution</h3><br />
<p>Early in 2005, a scientist have tried to use some kinds of Backtracking Algorithm to solve this problem, which have published in Science. Based on this excellent work, we have gone further to offer two more efficient algorithms.</p><br />
<h3 id="Algorithm 1">Algorithm 1</h3><br />
<p>In the solution space tree containing all available solutions, we search the solution space tree from the root according to the depth-first strategy. When reaching a node, we always firstly determine whether the node include any solutions or not. If not, we don't need to search the subtree whose root is such node, and then backtrack the ancestor nodes step-by-step; otherwise, we should continue our depth-first search.</p><br />
<h3 id="Algorithm 2">Algorithm 2</h3> <br />
<p>1.Sort the degree of each node.</p><br />
<p>2.In the current data set, from the first degree to the last, we remain the nodes which is relative to such degree, and delete the unconnected one.</p><br />
<p>3.In the set, containing the nodes connected to the previous one, for each node, determine whether it is connected to others, and then sort the nodes based on their degree.</p><br />
<p>4.Divide the problem into some much smaller size problems, repeat above method.</p><br />
<h3 id="Result">Result</h3><br />
<p>Based on our efficient algorithm, we have found a possible solution:</p><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/SJTU14-model_table.png" width=700x></img><br />
<h3 id="Discussion">Discussion</h3> <br />
<p>Clique problem play an important role in graph theory as well as is quite complex. However, we have provided some valid combinations for the TAL users here.</p> <br />
<h2 id="Reference">Reference</h2><br />
<ol style="font-style: italic;"><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
<li> G. Palla, I. Derényi, I. Farkas, and T. Vicsek. "Uncovering the overlapping community structure of complex networks in nature and society" Nature 435, 814–818 (2005)</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-18T02:25:57Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
</style><br />
<div class="content"><br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Modeling&ensp;and&ensp;Simulation</h2></br></center><br />
<center><p>"All models are wrong, but some are useful."<br />
When we decided to use TAL effectors building CROWN, our project, there were three main challenges concerning the efficiency of this system.<br />
First, allowing some DNA mutations, can the CROWN be as efficient as before?<br />
Second, given that CROWN can be successfully distributed on certain area of single cell, can it make sense?<br />
Third, how to design the sequence of Golden Gate?<br />
The following three parts focus on the three questions. </p><br />
</center><br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Part I Single Cell"><br />
<center><h2>Part I Single Cell</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="Part II Docking"><br />
<center> <h2>Part II Docking</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="Part III K-clique Problem"><br />
<center><h2>Part III K-clique Problem</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#Discussion" title="Reference"><br />
<center><h2>Reference</h2></center></a><br />
</div><br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<article class="post__article"><br />
<!-- <h2 id="partisinglecell">Overview&ensp;of&ensp;Modeling&ensp;and&ensp;Simulation</h2><br />
<p>"All models are wrong, but some are useful."</p><br />
<p>When we decide to use TAL effectors building CROWN, our project, there are three main challenges concerning the efficiencies of this system.</p><br />
<p>First, allowing some DNA mutations, whether the CROWN can be efficient as before?</p><br />
<p>Second, given that CROWN can be successfully distributed on certain area of single cell, can it make sense?</p><br />
<p>Third, how to design the sequence of Golden Gate?</p><br />
<p>The following three parts focus on the three questions. </p><br />
--><br />
<br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly on the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
Certain enzymes are polymerized on the cell membrane.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Polymerization</strong><br />
The polymerization of certain enzymes is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<h4>1. Metabolism</h4><br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png" width=800px></img></center><br />
<center><small>Figure2.2.1 The process of the metabolism: s0, s1, s2, s3 are the substrates and E0, E1,E2 are the enzymes </small></center><br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/0/01/SJTU14_animation-synthesis.gif"width=800x></img></center><br />
<center><small>Figure2.2.2 the simulation of the CROWN</small></center><br />
<h4>2. Initial Distribution of Substrates</h4><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<h4>3. Movement of Substrates</h4><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<h4>4. Catalytic reaction</h4><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<h4>5. Other Hypothesis</h4><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<h4>All Results</h4><br />
<center><embed width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></embed></center><br />
</embed><br />
<a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html" > <center>Click to watch the video</a></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/de/SJTU14-All_Results.JPG" width=700x></img></center><br />
<center><small>Figure2.2.3 All the results of the four types.</small></center><br />
<br />
<h4 >Type 1</h4> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/b/ba/SJTU14-Membrane_%26_Random.JPG" width=700x></img></center><br />
<center><small>Figure2.2.4 The extent of reaction of type 1.</small></center><br />
<h4>Type 2</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ad/SJTU14-Membrane_%26_Polymerization.JPG" width=700x></img></center><br />
<center><small>Figure2.2.5 The extent of reaction of type 2.</small></center><br />
<h4>Type 3</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0b/SJTU14-Matrix_%26_Random.JPG" width=700px></img></center><br />
<center><small>Figure2.2.6 The extent of reaction of type 3</small></center><br />
<h4>Type 4</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7a/SJTU14-Matrix_%26_Polymerization.JPG" width=700x ></img></center><br />
<center><small>Figure2.2.7 The extent of reaction of type 4</small></center><p id="dianweidian9"></br></br></br></br></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg" width=800px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p><strong><li>The highlighted Letters represent the mutation site.</li></strong></p><br />
<p><strong><li>The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.</li></strong></p><br />
<p><strong><li>The higher Docking scores, the better Docking</li></strong></p><br />
<br />
<br><br><ul style="padding-left:5%;"><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<br />
<br />
<br/><br/> <br />
<br />
<li ><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<br />
<br />
</ul><br />
<h3 id="Analysis">Analysis</h3><br />
<center><p><strong>Table</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<br><center><p><strong>Scatter Diagram</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<center><small>Figure 2.2.8 The correlation between the number of mutation sites and the docking scores.The higher docking scores indicates the better combination of TAL and target sequence.</small></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p id="dianweidian10">From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<h2>Part Ⅲ K-clique Problem</h2><br />
<h3 id="Problem Identification">Problem Identification</h3><br />
<p>Before designing the TAL sequence, what we need to do first is to design a set of sequences, which are consist of seven fragments containing four nucleotides. In order to accomplish this, we offer a new sequence alignment algorithm for these fragmental sequences comparison. By using Loose Algorithm and Strict Algorithm, two fragmental sequences can be scored, and when the score is less than or equal to a specific value (eg 2), we can accept that they are a valid combination.</p><br />
<p>As we can see, the sequence database contains a total of 4 * 4 * 4 * 4 = 256 kinds of fragmental sequences. Now, what we should do is to find out some seven sequences whose each two fragments can be a valid combination, based on a large (256*256) score table.</p><br />
<h3 id="Assumption and Model Formulation">Assumption and Model Formulation</h3><br />
<p>We try to solve this problem by making full use of graph theory. In our model, each fragmental sequence can be treated as a node, and two “node” is connected, if they are a valid combination (the score less than or equal to 2). After doing that, we just need to find such seven nodes which are consist of a complete graph from a graph with 256 nodes. (Note: not every two nodes in original graph is connected)</p><br />
<h3 id="Brief introduction to graph theory">Brief introduction to graph theory</h3><br />
<p>For an undirected graph G = (V, E),if U⊆V, and for any u, v ⊆ U, (u, v) ⊆ E, U is called complete subgraph of G.</p><br />
<p>A clique in an undirected graph G = (V, E) is a subset of the vertex set C ⊆ V, such that for every two vertices in C, there exists an edge connecting the two. A maximal clique is a clique that cannot be extended by including one more adjacent vertex, that is, a clique which does not exist exclusively within the vertex set of a larger clique.</p><br />
<p>U is the maximal complete subgraph of G, if and only if U is a clique of U and U is not contained in a larger subgraph.</p><br />
<p>The k-clique problem is to find the complete graph with k nodes in a specific graph. What’s more, k-clique algorithm is defined in the paper "Uncovering the overlapping community structure of complex networks in nature and society" - G. Palla, I. Derényi, I. Farkas, and T. Vicsek - Nature 435, 814–818 (2005).</p><br />
<p>Although a deterministic algorithm for this problem with an O(n*2^n) algorithm time complexity, fortunately, in our experiment, the problem we should solve is just with 256 nodes, so a non-deterministic algorithm can be applied.</p><br />
<h3 id="Solution">Solution</h3><br />
<p>Early in 2005, a scientist have tried to use some kinds of Backtracking Algorithm to solve this problem, which have published in Science. Based on this excellent work, we have gone further to offer two more efficient algorithms.</p><br />
<h3 id="Algorithm 1">Algorithm 1</h3><br />
<p>In the solution space tree containing all available solutions, we search the solution space tree from the root according to the depth-first strategy. When reaching a node, we always firstly determine whether the node include any solutions or not. If not, we don't need to search the subtree whose root is such node, and then backtrack the ancestor nodes step-by-step; otherwise, we should continue our depth-first search.</p><br />
<h3 id="Algorithm 2">Algorithm 2</h3> <br />
<p>1.Sort the degree of each node.</p><br />
<p>2.In the current data set, from the first degree to the last, we remain the nodes which is relative to such degree, and delete the unconnected one.</p><br />
<p>3.In the set, containing the nodes connected to the previous one, for each node, determine whether it is connected to others, and then sort the nodes based on their degree.</p><br />
<p>4.Divide the problem into some much smaller size problems, repeat above method.</p><br />
<h3 id="Result">Result</h3><br />
<p>Based on our efficient algorithm, we have found a possible solution:</p><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/SJTU14-model_table.png" width=700x></img><br />
<h3 id="Discussion">Discussion</h3> <br />
<p>Clique problem play an important role in graph theory as well as is quite complex. However, we have provided some valid combinations for the TAL users here.</p> <br />
<h2 id="Reference">Reference</h2><br />
<ol style="font-style: italic;"><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
<li> G. Palla, I. Derényi, I. Farkas, and T. Vicsek. "Uncovering the overlapping community structure of complex networks in nature and society" Nature 435, 814–818 (2005)</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/File:Bio-X_Logo.pngFile:Bio-X Logo.png2014-10-18T02:14:32Z<p>Yaan: uploaded a new version of &quot;File:Bio-X Logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:SJTU14_iGEM_foundation_logo.pngFile:SJTU14 iGEM foundation logo.png2014-10-18T02:09:48Z<p>Yaan: uploaded a new version of &quot;File:SJTU14 iGEM foundation logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:SJTU14_iGEM_foundation_logo.pngFile:SJTU14 iGEM foundation logo.png2014-10-18T02:07:18Z<p>Yaan: uploaded a new version of &quot;File:SJTU14 iGEM foundation logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:SJTU14_iGEM_foundation_logo.pngFile:SJTU14 iGEM foundation logo.png2014-10-18T02:02:00Z<p>Yaan: uploaded a new version of &quot;File:SJTU14 iGEM foundation logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:SJTU_Logo.pngFile:SJTU Logo.png2014-10-18T01:56:03Z<p>Yaan: uploaded a new version of &quot;File:SJTU Logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:Life-logo.pngFile:Life-logo.png2014-10-18T00:10:30Z<p>Yaan: uploaded a new version of &quot;File:Life-logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:SJTU14_iGEM_foundation_logo.pngFile:SJTU14 iGEM foundation logo.png2014-10-18T00:06:59Z<p>Yaan: uploaded a new version of &quot;File:SJTU14 iGEM foundation logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:Life-logo.pngFile:Life-logo.png2014-10-18T00:04:46Z<p>Yaan: uploaded a new version of &quot;File:Life-logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:Life-logo.pngFile:Life-logo.png2014-10-18T00:01:02Z<p>Yaan: uploaded a new version of &quot;File:Life-logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:Bio-X_Logo.pngFile:Bio-X Logo.png2014-10-17T23:57:24Z<p>Yaan: uploaded a new version of &quot;File:Bio-X Logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:Genewiz_Logo.pngFile:Genewiz Logo.png2014-10-17T23:56:54Z<p>Yaan: uploaded a new version of &quot;File:Genewiz Logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:Merck_Logo.pngFile:Merck Logo.png2014-10-17T23:56:38Z<p>Yaan: uploaded a new version of &quot;File:Merck Logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:SJTU14_iGEM_foundation_logo.pngFile:SJTU14 iGEM foundation logo.png2014-10-17T23:56:10Z<p>Yaan: uploaded a new version of &quot;File:SJTU14 iGEM foundation logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-ShanghaiTeam:SJTU-BioX-Shanghai2014-10-17T23:53:25Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Front_Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav-front}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
#content{<br />
background-color:#2d3e58;}<br />
.content img{background-color:#2d3e58;}<br />
.first{<br />
height:60%;<br />
font-family:Arial, Helvetica, Microsoft Sans Seri;<br />
font-weight:bold;<br />
padding-top:20%;<br />
padding-bottom:20%;<br />
font-size:2em;<br />
}<br />
.first p{padding-bottom:3%;<br />
padding-left:10%;}<br />
#content1{<br />
background-color:#2d3e58;<br />
color:#c5faff;}<br />
#content2{<br />
background-color:#FFF;<br />
color:#2d3e58;}<br />
#content3{<br />
background-color:#f2ce3a;<br />
color:#fff;}<br />
#content4{<br />
background-color:#fff;<br />
color:#2d3e58;}<br />
#content5{<br />
padding-top:10%;<br />
background-color:#2d3e58;<br />
color:#c5faff;<br />
}<br />
#content6{<br />
padding-top:10%;<br />
background-color:#c5faff;<br />
color:#c5faff;<br />
}<br />
.first img{ padding-right:40px;<br />
float:right;}<br />
<br />
#dark{color:#2c3d58;}<br />
#light{color:#f2ce3a;}<br />
#blue{color:#c5faff;}<br />
.big{font-size:2em;font-weight:bolder;}<br />
.small{font-weight:bolder;}<br />
<br />
<br />
@media screen and (max-width: 55.6875em) {<br />
.first {<br />
font-size:1.8em;<br />
padding-top:30%;<br />
}<br />
}<br />
@media screen and (max-width: 30em) {<br />
.first {<br />
font-size:1.5em;<br />
padding-top:40%;<br />
}<br />
}<br />
@media screen and (max-height: 25.25em) {<br />
.first {<br />
font-size:1.5em;<br />
<br />
}}<br />
.projtile_only{background-color:#c5faff;} <br />
.projtile{<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;<br />
background-color:#c5faff;} <br />
.jiao h2,.jiao h5{color:#2c3d58;} <br />
<br />
</style><br />
<div id="content"><br />
<center><a href="#front"><img class="front" src="https://static.igem.org/mediawiki/2014/9/9f/SJTU14-front-center.png"></img></a></center><br />
<a name="front"></a><br />
<div id="content1" class="first"><br />
<img class="front" src="https://static.igem.org/mediawiki/2014/3/30/Front-1.png"></img><br />
<p>Hi, everyone!</p><br />
<p>There is a Chinese song named</p><br />
<p><strong id="light" class="big">"Unity is the strength."</strong></p><br />
<p>This year, we want to explore this great power.</p><br />
</div><br />
<div id="content2" class="first"> <br />
<img class="front" src="https://static.igem.org/mediawiki/2014/6/64/Front-2.png"></img><br />
<p>Of course,we are not talking about ourselves.</p><br />
<p>The main characters are...</p><br />
<p><strong id="light" class="big">Enzymes!!</strong></p><br />
<p>Do you know that the more enzymes <strong id="light" class="small">polymerize</strong>,</p><br />
<p>the more useful they become?</p><br />
</div><br />
<div id="content3" class="first"><br />
<img class="front" src="https://static.igem.org/mediawiki/2014/6/66/Front-3.png"></img> <br />
<p>Enzymes couldn't get close to each others easily.</p><br />
<p>Therefore,</p><br />
<p>we help them using a structure we call</p><br />
<p><a href="/Team:SJTU-BioX-Shanghai/Part1_Connect"> <strong id="blue" class="big"> "Crown"</strong> </a></p><br />
<p> to connet them together.</p><br />
</div> <br />
<div id="content4" class="first"> <br />
<img class="front" src="https://static.igem.org/mediawiki/2014/4/43/Front-4.png"></img> <br />
<p>That's not all.</p><br />
<p>We try to improve our idea by taking </p><br />
<a href="/Team:SJTU-BioX-Shanghai/Part2_Extension"><p><strong id="light" class="big">Maximization</strong></p><br />
<p>and</p> <br />
<p><strong id="light" class="big">Versatility</strong></p></a><br />
<p>into account.</p><br />
</div><br />
<br />
<div id="content5" class="first"><br />
<img class="front" src="https://static.igem.org/mediawiki/2014/2/2e/Front-5.png"></img> <br />
<p>Oops,am I talking too much?</p><br />
<p>Alright,i will just let you figure out by yourselves.</p><br />
<p>At last,Thanks for reading our <strong id="light" class="big">wiki</strong>~</p><br />
</div><br />
<div id="content6" class="first"><br />
<div class="jiao"><br />
<div class="projtile_only"><br />
<center><h5>Want to have a quick view?</h5></center><br />
</div><br />
<div class="projtile"><br />
<a href="/Team:SJTU-BioX-Shanghai/Results" title="RESULTS"><br />
<center><h2>Results</h2></center><br />
</div><br />
<div class="projtile"><br />
<a href="/Team:SJTU-BioX-Shanghai/Modeling" title="MODELING"><br />
<center> <h2>Modeling</h2></center><br />
</div><br />
<div class="projtile"><br />
<a href="/Team:SJTU-BioX-Shanghai/Human_Parctice" title="HUMAN_PRACTICE"><br />
<center><h2>Human Practice</h2></center><br />
</a><br />
</div><br />
<div class="projtile"><br />
<a href="/Team:SJTU-BioX-Shanghai/Judging_Form" title="JUDGINGFORM"><br />
</a><br />
<center><h2>Judging form</h2></center><br />
</div><br />
<div class="projtile"><br />
<a href="/Team:SJTU-BioX-Shanghai/Team_Members" title="TEAM_MEMBERS"><br />
<center> <h2>Team Members</h2></center><br />
</a><br />
</div><br />
</div><br />
</div><br />
</div><br />
</html> <br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/File:SJTU14_iGEM_foundation_logo.pngFile:SJTU14 iGEM foundation logo.png2014-10-17T23:44:25Z<p>Yaan: uploaded a new version of &quot;File:SJTU14 iGEM foundation logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:SJTU_Logo.pngFile:SJTU Logo.png2014-10-17T23:26:31Z<p>Yaan: uploaded a new version of &quot;File:SJTU Logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/File:SJTU_Logo.pngFile:SJTU Logo.png2014-10-17T23:24:19Z<p>Yaan: uploaded a new version of &quot;File:SJTU Logo.png&quot;</p>
<hr />
<div></div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotesTeam:SJTU-BioX-Shanghai/daynotes2014-10-17T15:49:29Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/Header}}<br />
{{Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<br />
<html><br />
<head><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:400italic,200|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
#sidenav_container{<br />
float: left;<br />
width: 15%;<br />
margin-top: 100px;<br />
}<br />
.sidenav{<br />
width: 100%;<br />
border: 1px #ddd solid;<br />
text-align: center;<br />
font-size:1.5em;<br />
}<br />
.sidenav:first-of-type{<br />
border-top-left-radius: 5px;<br />
border-top-right-radius: 5px;<br />
border-bottom-right-radius: 0px;<br />
border-bottom-right-radius: 0px;<br />
}<br />
.sidenav:last-of-type{<br />
border-top-left-radius: 0px;<br />
border-top-right-radius: 0px;<br />
border-bottom-right-radius: 5px;<br />
border-bottom-right-radius: 5px;<br />
}<br />
.sidenav-fixed{<br />
position: fixed;<br />
left: 0;<br />
top: 100px;<br />
width: 100%;<br />
margin-top: 0;<br />
font-size: 2em;<br />
}<br />
.sidenav .heading{<br />
background-color: #fbf4de;<br />
color: #68afbc;<br />
border: 1px #edecec solid;<br />
font-size: 1.5em;<br />
padding: 8px 0px;<br />
}<br />
.sidenav .content{<br />
background-color: #ffffff;<br />
<br />
padding: 8px 0px;<br />
display: none;<br />
<br />
}<br />
.post__article h2{<br />
padding-top: 80px;<br />
padding-bottom: 15px;<br />
}<br />
a:visited {<br />
color:#2d3e58;<br />
}<br />
a{ color:#2d3e58;}<br />
</style><br />
</head><br />
<body><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/2/20/SJTU14_DAY-NOTES.png");}<br />
</style><br />
<div id="sidenav_container" style="font-family: Rancho,Impact, Charcoal, sans-serif; font-size: 1.1em; letter-spacing: 1.5px;"><br />
<div class="sidenav"><br />
<div class="heading"><br />
Week Notes<br />
</div><br />
<div class="content"><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#July">July</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#August">August</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#September">September</a></p><br />
</div><br />
<br />
</div><br />
<div class="sidenav"><br />
<div class="heading"><br />
Protocol<br />
</div><br />
<div class="content"><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Molecule">Molecule</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Cell">Cell</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Protein">Protein</a></p><br />
</div><br />
</div><br />
<br />
</div><br />
<div style="padding-left: 15%; background-color: #fff;"><br />
<div class="content"><br />
<article class="post__article"><br />
<h3 id="July">July Week 1: Plasmid Amplification</h3><br><br />
<p>We chose pRSFDuet-1, pACYCDuet-1 and pCDFDuet-1 as expression vectors and pBluescript II KS(+) as the connector. These plasmids were amplified for further construction.<p><br />
<h3 id ="JulyWeek2" >July Week 2: Plan Making</h3><br><br />
<p>We intended to construct the gene of our fusion protein, ssDsbA-mRFP-HL-Lgt-FL-TAL-His Tag, using overlap PCR, enzyme digestion and ligation. After careful consideration, we decided to connect ssDsbA-mRFP-HL-Lgt as one part of this fusion protein and FL-TAL-His Tag for another, so that they could be connected together.<p><br />
<h3 id ="JulyWeek3" >July Week 3: Construction of Part 1</h3><br><br />
<p> We constructed the first part, ssDsbA-mRFP-HL-Lgt with overlap PCR and ligated it into the pBluescript II KS(+). Then we obtained more plasmids through transformation, colony picking and plasmid extraction. After that, we verified them with digestion identification and sequencing. Sequencing results showed accurate construction.<p><br />
<h3 id ="JulyWeek4" >July Week 4: TAL Connection</h3><br><br />
<p> In order to construct the second part, we had to obtain the TAL we needed using bioparts from 2012 Freiburg iGEM team. But unfortunately, we didn't get any positive result.<p> <br />
<h3 id="August">August Week 1-2: PCR Optimization</h3><br><br />
<p>Because of the negative results, we decided to adjust some PCR parameters, including the annealing temperature, template concentration and cycle number. Test the conditions for the PCR. <br />
Connected TAL, transform, colony picking plasmid extraction and digestion identification. Find with our electrophoresis band. Expression vectors and connector plasmid are confirmed by sequencing.<p><br />
<h3 id ="AugustWeek3" >August Week3</h3><br><br />
<p>There are some problems about Freiburg’s parts. We can’t connected TAL in the right order. <br />
So we design some new primes for PCR that can produce the right sequence.<p><br />
<h3 id ="AugustWeek4" >August Week4</h3><br><br />
<p>Design a few new ports for the fusion protein. <br />
Sequencing results showed accurate construction. Observe the FP using LSCM to confirm the fusion protein can locate on the membrane.<p> <br />
<h3 id="September" >September Week1</h3><br><br />
<p>Try co-transformation: Prsf pacyc pBluescript . <br />
Find the conditions of protein expression. <br />
Find the way to construct the TAL.<p> <br />
<h3 id ="SeptemberWeek2" >September Week2</h3><br><br />
<p>Find the enzymes for the application. <br />
Find the way to detect the substrate in these pathways. <br />
Connector plasmid modification.<p> <br />
<h3 id ="SeptemberWeek3" >September Week3</h3><br><br />
<p>TAL gene synthesis. Construct the part with our new ports.<p> <br />
<h3 id ="SeptemberWeek4" >September Week4</h3><br><br />
<p> TAL gene synthesis.<p> <br />
</article><br />
</div><br />
</div><br />
<br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/jquery-1.11.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('.sidenav > .heading').click(function(event){<br />
var target = $(event.target);<br />
var content = target.next()[0];<br />
var visible = $('.sidenav > .content:visible')[0];<br />
if(visible != content){<br />
$(visible).fadeOut(5);<br />
$(content).fadeIn(600);<br />
}<br />
});<br />
$(window).scroll(function(){<br />
//var top = document.getElementById('sidenav_container').getBoundingClientRect().top;<br />
<br />
if($('#wrap').hasClass('sticky')){<br />
console.log('123');<br />
$('#sidenav_container').addClass('sidenav-fixed');<br />
} else {<br />
console.log('12345');<br />
$('#sidenav_container').removeClass('sidenav-fixed');<br />
}<br />
});<br />
});<br />
</script><br />
</body><br />
<br />
</body><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-17T15:46:14Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly in the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Random</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<h4>1. Metabolism</h4><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png"></img><br />
<br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<h4>2. Initial Distribution of Substrates</h4><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<h4>3. Movement of Substrates</h4><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<h4>4. Catalytic reaction</h4><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<h4>5. Other Hypothesis</h4><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<h4>All Results</h4><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<p><a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html"> Click to watch the video</a></p><br />
<br />
<h4>Type 1</h4> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<h4>Type 2</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<h4>Type 3</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<h4>Type 4</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p>[The highlighted Letters represent the mutation site.]</p><br />
<p>[The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.]</p><br />
<br />
<ul style="padding-left:5%;"><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<br />
<br />
</ul><br />
<h3 id="Analysis">Analysis</h3><br />
<center><p><strong>Table</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<center><p><strong>Scatter Diagram</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<h2 id="Reference">Reference</h2><br />
<ol><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-17T12:46:57Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly in the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Random</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<h4>1. Metabolism</h4><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png"></img><br />
<br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<h4>2. Initial Distribution of Substrates</h4><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<h4>3. Movement of Substrates</h4><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<h4>4. Catalytic reaction</h4><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<h4>5. Other Hypothesis</h4><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<h4>All Results</h4><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<p><a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html"> Click to watch the video</a></p><br />
<br />
<h4>Type 1</h4> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<h4>Type 2</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<h4>Type 3</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<h4>Type 4</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p>[The highlighted Letters represent the mutation site.]</p><br />
<p>[The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.]</p><br />
<br />
<ul style="padding-left:5%;"><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br />
</ul><br />
<h3 id="Analysis">Analysis</h3><br />
<center><p><strong>Table</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<center><p><strong>Scatter Diagram</strong></p></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<h2 id="Reference">Reference</h2><br />
<ol><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-17T12:45:47Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly in the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Random</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<h4>1. Metabolism</h4><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png"></img><br />
<br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<h4>2. Initial Distribution of Substrates</h4><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<h4>3. Movement of Substrates</h4><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<h4>4. Catalytic reaction</h4><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<h4>5. Other Hypothesis</h4><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<h4>All Results</h4><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<p><a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html"> Click to watch the video</a></p><br />
<br />
<h4>Type 1</h4> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<h4>Type 2</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<h4>Type 3</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<h4>Type 4</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p>[The highlighted Letters represent the mutation site.]</p><br />
<p>[The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.]</p><br />
<br />
<ul style="padding-left:5%;"><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br />
</ul><br />
<h3 id="Analysis">Analysis</h3><br />
<p><strong>Table</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<p><strong>Scatter Diagram</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<h2 id="Reference">Reference</h2><br />
<ol><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-17T12:44:36Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly in the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Random</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<h4>1. Metabolism</h4><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png"></img><br />
<br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<h4>2. Initial Distribution of Substrates</h4><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<h4>3. Movement of Substrates</h4><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<h4>4. Catalytic reaction</h4><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<h4>5. Other Hypothesis</h4><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<p><strong>All Results</strong></p><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<p><a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html"> Click to watch the video</a></p><br />
<br />
<h4>Type 1</h4> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<h4>Type 2</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<h4>Type 3</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<h4>Type 4</h4><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p>[The highlighted Letters represent the mutation site.]</p><br />
<p>[The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.]</p><br />
<br />
<ul style="padding-left:5%;"><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br />
</ul><br />
<h3 id="Analysis">Analysis</h3><br />
<p><strong>Table</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<p><strong>Scatter Diagram</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<h2 id="Reference">Reference</h2><br />
<ol><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-17T12:37:59Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly in the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Random</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<p>1. Metabolism</p><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png"></img><br />
<br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<p>2. Initial Distribution of Substrates</p><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<p>3. Movement of Substrates</p><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<p>4. Catalytic reaction</p><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<p>5. Other Hypothesis</p><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<p><strong>All Results</strong></p><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<p><a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html"> Click to watch the video</a></p><br />
<br />
<p><strong>Type 1</strong></p> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<p><strong>Type 2</strong></p><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<p><strong>Type 3</strong></p><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<p><strong>Type 4</strong></p><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p>[The highlighted Letters represent the mutation site.]</p><br />
<p>[The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.]</p><br />
<br />
<ul style="padding-left:5%;"><br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<br/><br/><br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br/><br/><br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br/><br/> <br />
<br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br />
</ul><br />
<h3 id="Analysis">Analysis</h3><br />
<p><strong>Table</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<p><strong>Scatter Diagram</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<h2 id="Reference">Reference</h2><br />
<ol><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-17T12:25:37Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly in the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Random</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<p>1. Metabolism</p><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png"></img><br />
<br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<p>2. Initial Distribution of Substrates</p><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<p>3. Movement of Substrates</p><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<p>4. Catalytic reaction</p><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<p>5. Other Hypothesis</p><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<p><strong>All Results</strong></p><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<p><a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html"> Click to watch the video</a></p><br />
<br />
<p><strong>Type 1</strong></p> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<p><strong>Type 2</strong></p><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<p><strong>Type 3</strong></p><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<p><strong>Type 4</strong></p><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<ul style="align:center;"><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p>[The highlighted Letters represent the mutation site.]</p><br />
<p>[The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.]</p><br />
<br />
<br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br />
<br />
<h3 id="Analysis">Analysis</h3><br />
<p><strong>Table</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<p><strong>Scatter Diagram</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<h2 id="Reference">Reference</h2><br />
<ol><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-17T12:23:38Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<br />
<p><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly in the cell membrane.</p><br />
<p><strong>Type 2: Membrane & Polymerization</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<p><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</p><br />
<p><strong>Type 4: Matrix & Random</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</p><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<p>1. Metabolism</p><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png"></img><br />
<br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<p>2. Initial Distribution of Substrates</p><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<p>3. Movement of Substrates</p><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<p>4. Catalytic reaction</p><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<p>5. Other Hypothesis</p><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<p><strong>All Results</strong></p><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<p><a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html"> Click to watch the video</a></p><br />
<br />
<p><strong>Type 1</strong></p> <br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <br />
<a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a></p><br />
<p><strong>Type 2</strong></p><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a></p><br />
<p><strong>Type 3</strong></p><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a></p><br />
<p><strong>Type 4</strong></p><br />
<p>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul></p><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<ul><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p>[The highlighted Letters represent the mutation site.]</p><br />
<p>[The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.]</p><br />
<br />
<br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br />
<br />
<h3 id="Analysis">Analysis</h3><br />
<p><strong>Table</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<p><strong>Scatter Diagram</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<h2 id="Reference">Reference</h2><br />
<ol><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/ModelingTeam:SJTU-BioX-Shanghai/Modeling2014-10-17T12:17:29Z<p>Yaan: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/d8/SJTU14_modeling.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="partisinglecell">Part&ensp;I&ensp;Single&ensp;Cell</h2><br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p><br />
<br />
<h3 id="fourtypesofdistribution">Four Types of Distribution</h3><br />
<ul><br />
<br />
<li><strong>Type 1: Membrane & Random</strong><br />
The position of enzyme is distributed randomly in the cell membrane.</li><br />
<li><strong>Type 2: Membrane & Polymerization</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</li><br />
<li><strong>Type 3: Matrix & Random</strong><br />
The position of enzyme is distributed randomly inside the cell.</li><br />
<li><strong>Type 4: Matrix & Random</strong><br />
The polymerization of certain enzymes, based on MembRing, is distributed randomly inside the cell.</li><br />
</ul><br />
<br />
<h3 id="hypothesisofsimulation">Hypothesis of Simulation</h3><br />
<p>1. Metabolism</p><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/SJTU14_matabolism.png"></img><br />
<br />
<p>Enzymes: E0, E1,E2</p><br />
<p>Substrates:S0,S1,S2,S3</p><br />
<p>2. Initial Distribution of Substrates</p><br />
<p>All substrates are randomly distributed OUTSIDE the cell in all four simulations.</p><br />
<p>3. Movement of Substrates</p><br />
<p>The motion of molecules is random, including the rate and orientation.</p><br />
<p>4. Catalytic reaction</p><br />
<p>The time period of reaction is neglected. When the type of chemical match the type of enzyme, distance is less than threshold, then the enzyme reaction is recognized and recorded.</p><br />
<p>5. Other Hypothesis</p><br />
<p>Other physical and chemical parameters are under the scaling rule. The whole modeling combined with periodic boundary condition(PBC) to show the real performance of substrates and enzyme system.</p><br />
<br />
<h3 id="results:">Results:</h3><br />
<ul><li><strong>All Results</strong></li><br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3msikNu8D7M" frameborder="0" allowfullscreen></iframe><br />
</embed><br />
<a href="http://v.youku.com/v_show/id_XODAyOTY5MzM2.html"> Click to watch the video</a><br />
<br />
<li><strong>Type 1</strong></li> Click to watch the video<a href="https://www.youtube.com/watch?v=EJQXhFBMqN4&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ4OTYw.html">Youku</a><br />
<li><strong>Type 2</strong></li>Click to watch the video<a href="https://www.youtube.com/watch?v=hjr4DZ7nJwA&list=UUjN3REkaTC_YulQONweFpSA"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ3NjA4.html">Youku</a><br />
<li><strong>Type 3</strong></li>Click to watch the video<a href="https://www.youtube.com/watch?v=W-AkV9MUITQ&list=UUjN3REkaTC_YulQONweFpSA&index=2"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQ1MDAw.html">Youku</a><br />
<li><strong>Type 4</strong></li>Click to watch the video<a href="https://www.youtube.com/watch?v=eS2nZS7mFsc"> Youtube</a> <a href="http://v.youku.com/v_show/id_XODAyMzQwODg4.html">Youku</a></ul><br />
<br />
<!--Part II--><br />
<h2 id="part2">Part&ensp;II&ensp;Docking</h2><br />
<br />
<!--<br />
<p>Our project is about the system involving various enzymes, mostly the series enzymes, combining into certain area. This area can be more efficient when it comes to synthesizing or degrading chemicals. So the first question is, whether this system can be so useful when distributing multiple similar areas in a single cell.</p>--><br />
<br />
<h3 id="WhydoweneedDocking?">Why do we need Docking?</h3><br />
<p>Biobrick designers and users want to understand the characteristics of a particular biobrick, especially the performance and accuracy. Because they need to answer a question, that is, were there to be a certain mutation, whether a huge change would happen to the protein function. We hope to introduce evaluation methods of bioinformatics, to evaluate binding of protein and DNA.</p><br />
<br />
<h3 id="Materials">Materials</h3><br />
<br />
<p>TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat consists of 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13.</p><br />
<p><strong>PDB:3V6T</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/10/SJTU14_original_seq.jpg"></img></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/d/d3/SJTU14_3V6T.gif"></img></center><br />
<br />
<h3 id="Mutations">Mutations</h3><br />
<ul><br />
<br />
<p>We designed fifteen sequences derived from raw sequence. These mutated sequences contain different mutations, ranging from one to five. Through a series of calculations, we obtained scores to represent the binding of TAL effectors and DNA.</p><br />
<p>[The highlighted Letters represent the mutation site.]</p><br />
<p>[The white DNA sequences on the graph is the originated position and orange one represents the possible binding DNA.]</p><br />
<br />
<br />
<li><strong>mutation-1</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9b/SJTU14_seq01.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_4M2.gif"></img><br />
<br />
<br />
<br />
<br />
<li><strong>mutation-2</strong></li><br />
<li><strong>Score:1170.910</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/9/9e/SJTU14_seq02.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/53/SJTU_14M2.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-3</strong></li><br />
<li><strong>Score:1153.537</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/d2/SJTU14_seq03.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/SJTU14_3M2.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-4</strong></li><br />
<li><strong>Score:1377.231</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/8/8f/SJTU14_seq04.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/SJTU14_4.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-5</strong></li><br />
<li><strong>Score:1169.283</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/1/1c/SJTU14_seq05.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/b9/SJTU14_2M2.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-6</strong></li><br />
<li><strong>Score:1179.122</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/SJTU14_seq06.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/1/14/SJTU14_6.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-7</strong></li><br />
<li><strong>Score:1482.902</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/d/dc/SJTU14_seq07.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/7/73/SJTU14_7.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-8</strong></li><br />
<li><strong>Score:1161.824</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/22/SJTU14_seq08.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/b/be/SJTU14_8.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-9</strong></li><br />
<li><strong>Score:1482.897</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_seq09.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/SJTU14_9.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-10</strong></li><br />
<li><strong>Score:1174.229</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/a/ab/SJTU14_seq10.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/d/d1/SJTU14_10.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-11</strong></li><br />
<li><strong>Score:1237.449</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/0/0d/SJTU14_seq11.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_11.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-12</strong></li><br />
<li><strong>Score:1482.896</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/c/cc/SJTU14_seq12.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/55/SJTU14_12.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-13</strong></li><br />
<li><strong>Score:1483.352</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/f/f5/SJTU14_seq13.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/6/60/SJTU14_13.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-14</strong></li><br />
<li><strong>Score:1482.048</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/7/77/SJTU14_seq14.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/SJTU14_14.gif"></img><br />
<br />
<br />
<br />
<li><strong>mutation-15</strong></li><br />
<li><strong>Score:1164.128</strong></li><br />
<img src="https://static.igem.org/mediawiki/2014/2/21/SJTU14_seq15.jpg"></img><br />
<img src="https://static.igem.org/mediawiki/2014/5/58/SJTU14_15.gif"></img><br />
<br />
<br />
<h3 id="Analysis">Analysis</h3><br />
<p><strong>Table</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7f/SJTU14_Dcok_score.PNG" width="800px"></img></center><br />
<p><strong>Scatter Diagram</strong></p><br />
<center><img src="https://static.igem.org/mediawiki/2014/c/c5/SJTU14_scatter.JPG" width="800px"></img></center><br />
<p>From the docking scores, we can see that in the event of single nucleotide mutation, binding of TAL effectors and DNA differs greatly from normal. However, when there are more than two mutation sites, the difference becomes less drastic.</p><br />
<p>From the PDB document, we can find that mutation at certain sites may lead to huge conformational distortions of TAL-DNA complex. With as many as five mutations, the binding site changes greatly.</p><br />
<p>In conclusion, we strongly recommend that TAL designers and users ensure the accuracy of DNA binding sequence. If not, the specificity of binding site will not be guaranteed.</p><br />
<br />
<h2 id="Reference">Reference</h2><br />
<ol><br />
<li>Pierce, Brian G., Yuichiro Hourai, and Zhiping Weng. "Accelerating protein docking in ZDOCK using an advanced 3D convolution library." PloS one 6.9 (2011): e24657.</li><br />
<li>Mintseris, Julian, et al. "Integrating statistical pair potentials into protein complex prediction." Proteins: Structure, Function, and Bioinformatics 69.3 (2007): 511-520.</li><br />
</ol><br />
<br />
</article><br />
</div><br />
<br />
<br />
<br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_ImprovementTeam:SJTU-BioX-Shanghai/Part3 TAL Improvement2014-10-17T11:59:38Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/db/SJTU14_gearbox.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2>Overview</h2><br />
<p>This year our team not only focus on our project and bioparts but also debug several existing parts designed by 2012 Freiburg. When we use their parts and follow their protocol, we find that it is hard for us to repeat their success. There are a lot of difficulties in our way to construct a TALE. After discussion and thinking, our team decide to improve the existing TAL parts by find out new and better sticky ends. Moreover, our method can be used in border way when people want to connect some components by Golden Gate method.</p><br />
<h2>Why we want to improve it?</h2><br />
<h3>Whether the Freiburg's design is efficient or not</h3><br />
<p>According to the experimental record of Freiburg, the success rate is higher than 95%(32/33). However, this result, to some degree, lacks statistical significance.</p><br />
<p>In the result section, they emphasize that there is a light band at 1200bp, which they believe could indicate that the Golden Gate connection works well. However, after conducting several experiments by ourselves, we find that the key point to indicate whether Golden Gate connection works is not the band at 1200bp. If the band is not clear and specific in the gel, it indicates the experiment doesn’t go well. We can easily find several light bands under the band of 1200bp. Moreover, the second light band is somewhat lighter than the band at 1200bp. Although the Freiburg can explain the results with the repeatability of the TALE sequence, we suppose that the possibility of the mismatch of the sticky ends still can’t be excluded. Frankly speaking, we try to believe that they really made it, but if the success cannot be repeated, there must be something wrong with their system. You can view <a href="https://2012.igem.org/Team:Freiburg/Project/Experiments">Detail information</a> in iGEM2012 Freiburg wiki.</p><br />
<center><img alt="Freiburg gel result" src="https://static.igem.org/mediawiki/2014/5/57/Freiburg_result_picture.png"width=400px vspace=20px></img></center><br />
<h3>The protocol we take to connect the parts of TALE</h3><br />
<br />
<p>1. Freiburg's protocol</p><br />
<p>2. Restriction enzyme digestion of plasmid and TAL repeats and gel extraction respectively. By the mole ratio, plasmid to TALE is 1 to 5 and TALE to TALE is 1 to 1. Ligation with T4 ligase in 22 ℃over night.</p><br />
<p>3. The same ratio of plasmid and TALE repeat, but add the TALE repeats one by one and ligation in 22 ℃, 30 minutes</p><br />
<p>4. Every two parts connect at one time, and try to make three intermediates of 400bp, and then mix the plasmid to make the complete TALE.</p><br />
<p>5. The same ratio and ligation with the program of 22℃ 2min, 40℃ 30,25 repeats.</p><br />
<br />
<h3>The motivation to debug 2012 Freiburg’s parts</h3><br />
<br />
<p>Unfortunately, all of our attempts failed. We didn’t manage to make a complete TALE, or even make two of them together. However, what is important for us is that when we try the 5th protocol, we notice an unexpected result. When we analyze the sequence result, we find that our left adaptor, 1st part and right adaptor connect together. Why do we get this result? We notice that their sticky end is TGAC, GCTC, and ACTC. That is to say, GCTC and ACTC connect with each other by mistake. In another word, if the sticky ends are very similar, they probably connect with each other. Although we failed again, the result gives us confidence to debug 2012 Freiburg's parts. </p><br />
<br />
<h2>How do we connect certain monomer? </h2><br />
<h3>Some advanced tips for TALE protein</h3><br />
<br />
<p>1. Given a sample sequence with repeating amino acids:</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/f2/SJTU14_tal_improvment_1.png"></img></center><br />
<p>What XX means is that it determine the certain kind of base. For one unit of repetition, other amino acids can be identical.</p><br />
<p>2. A fully functional TALE protein contains one sequence, that does not have repetitive units, recognizing base T, and similar sequence but is only half length as its end. That is, one complete TALE protein is able to recognize certain number of repetitive units and two bases.</p><br />
<p>3. The length that can be recognized is not strictly twelve or fourteen. According to the published results, the length and certain sequence are dependent on number and type of monomer.</p><br><br />
<br />
<p>We can gather 96 bioparts based on Freiburg, and each part has its counterproductive base on certain location(1,2,3,4,5 or 6). By picking two bases on certain location, we are able to design one TALE protein sequence.</p><br />
<br />
<h3>Previous Review: Freiburg’s way of connection</h3><br />
<br />
<p>The main principles of connection is built upon the idea of Golden Gate Connection.( Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).)</p><br />
<p>The gust of these procedures is more related to one type of restriction enzyme, type II Restriction Enzyme, especially BsmBI enzyme.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/5/5b/SJTU14_tal_improvment_2.png" ></img></center><br />
<p>The main feature of this enzyme is the recognition sequence is on only one side of cleavage site. It provides the way which can be used to get certain incision without damaging the whole sequence. The sticky end has 4bp base, and it could be designed even for combination of multiple sticky end. That feature is fancy at first, but we cannot regardless its latent shortcomings. </p><br />
<p>Let’s analyze the example (AA1) provided by Freiburg. </p><br />
<center><img src="https://static.igem.org/mediawiki/2014/b/bc/SJTU14_tal_improvment_3.png" width=400px></img></center><br />
<p><small><i>The underlined parts are recognized by BsmBI. Vertical bar(|) is the cutting position. As for this sample, TGAC is one sticky end which can combine with other seven sticky ends.</i></small></p><br />
<h3>Evaluate seven sticky ends designed by 2012 Freiburg</h3><br />
<p>2012 Freiburg's parts have seven sticky ends:</p><br />
<p><center>TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC</center></p><br />
<p>We all know that certain two parts can combine together, under base-pair rule. However, whether it is possible that unpaired sticky ends can bind together? In fact, the more similar they are, the more possibility that can form new but error base pairs.<br />
Spired by BLAST algorithm, we calculate the similarity of each other sticky ends. </p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/TAL%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF%E8%A1%A8%E6%A0%BC.png" width=400px></img></center><br />
<p>The higher score, the higher similarity, and the higher possibility of mismatch. <br />
The table shows that more than 30% of pairs’ score is equal to 3, which means that the possibility of mismatch cannot be neglected.<br />
<br />
Even if we employ the relatively loose rule to calculate the similarity, we can still find that error rates cannot be neglected.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Tal_%E8%A1%A8%E6%A0%BC%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF2.png" width=400px></img></center><br />
<br />
<h2> Why not other sticky ends?</h2><br />
<h3>The Reason why Freiburg used these sticky ends</h3><br />
<p>Failed to contact the original designers of these sticky ends, what we can do is just to find feasible advantages of these combinations.</p><br />
<p>Review the TALE repeated amino acids sequence:</p><br />
<p><center>LTPEQVVAIAS(XX)GGKQALETVQRLLPVLCQAHG(34aa)</center></p><br />
<p>The first amino acid is Leu, which is essential for all connection process. There are six different types of base arrangement for Leu, one of the most number of base arrangement. </p><br />
<p><center>UUA,UUG,CUU,CUC,CUA,CUG</center></p><br />
<br />
<p>The counterproductive sticky ends:</p><br />
<p><center>(C)TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC</center></p><br />
<p>The useless of Degeneracy has helped to design seven sticky ends. However, since the codons for identical amino acid are highly similar.<br />
This feature, for experimental scientists, is a double-edged sword.</p><br />
<h2>How to improve the Golden Gate sticky ends? A big Table!</h2><br />
<br />
<p>Three basic key questions need to be answered:</p><br />
<p>1. Whether it’s possible to find perfect match pair?</p><br />
<p>2. Whether we can find a certain number of sticky ends with least possibility to be mismatched?</p><br />
<p>3. How to make this sticky-end score table?</p><br />
<br />
<h3>Key algorithms derived from BLAST algorithm</h3><br />
<p>Loose rule: Match: 1; Mismatch:-1; Gap: 0</p><br />
<p>Strict rule: Match: 1; Mismatch:0; Gap: -1</p><br />
<p>The sticky end is composed of four bases, which means that we can design 256 types of sticky ends at most.<br />
The forming pair is represented as a 256*256 table. </p><br />
<h3>Find target groups of sticky ends</h3><br />
<p>To solve the TALE parts problem, we need find seven sticky ends, and the similarity score(hereafter referred to as Score) of each pair of them are less than or equal to 1.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/12/Choices_for_group.png" width=400px></img></center><br />
<p>When we select Strict Algorithm to find these ends, it is impossible to find seven sticky ends, that each pair of them has score no more than 1. So we have to select Loose Algorithm.</p><br />
<h3>Four basepair sticky ends convert to amino acid pair</h3><br />
<p>What we are caring about is whether two amino acids can be located on my target sequence, rather than the 4bp bases. So we should convert the sticky ends information to 2 amino acids.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/4/45/Amino_acid_table.png"width=600px></img></center><br />
<p>Based on the above table, we are able to calculate the total scores of each combination and find the least one.</p><br />
<h2>Best choice for seven sticky ends on TALE protein</h2><br />
<p>Best combination:<br />
<center>AAAA, AGGG, GTAC, GCTC, TTTT, TCGA, CCCC</center></p><br />
<p>Scores Table(Loose rule):</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e0/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-16_%E4%B8%8B%E5%8D%883.24.40.png" width=400px></img></center><br />
<p>Position in TALE amino acids sequence:</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e1/Sticky3333.png" width="500px"></img></center><br />
<h2>Reconstruct DNA Sequence</h2><br />
<p>Two main factors to reconstruct DNA sequence:<br />
1.Use the table of best combination and rearrange the sticky ends with your demand.<br />
2.No BsmBI recognition sequence in the reconstruct DNA sequence.<br />
Final DNA Sequence for TALE protein:</p><br />
<pre><br />
1 CTGACCCCGG AACAGGTGGT GGCCATTGCA AGCAACGGTG GTGGCAAGCA GGCCCTGGAG<br />
61 ACAGTCCAAC GGCTGCTTCC GGTTCTGTGT CAGGCCCACG GCCTGACTCC AGAACAAGTG<br />
121 GTTGCTATCG CCAGCCACGA TGGCGGAAAA CAAGCCCTCG AAACCGTGCA GCGCCTGCTT<br />
181 CCGGTGCTGT GTCAGGCCCA CGGGCTCACC CCGGAACAGG TGGTGGCCAT CGCATCTAAC<br />
241 AATGGCGGTA AGCAGGCACT GGAAACAGTG CAGCGCCTGC TTCCGGTCCT GTGTCAGGCT<br />
301 CATGGCCTGA CCCCAGAGCA GGTCGTGGCA ATTGCCTCCA ACATTGGAGG GAAGCAGGCA<br />
361 CTGGAGACCG TGCAGCGGCT GCTGCCGGTG CTGTGTCAGG CCCACGGCTT GACCCCGGAA<br />
421 CAGGTGGTGG CCATCGCCTC CAACGGCGGT GGCAAACAGG CGCTGGAAAC AGTTCAACGC<br />
481 CTCCTTCCGG TCCTGTGCCA GGCCCATGGT CTGACTCCAG AGCAGGTTGT GGCAATTGCA<br />
541 AGCAACATTG GTGGTAAACA AGCTTTGGAA ACCGTCCAGC GCTTGCTGCC AGTACTGTGT<br />
601 CAGGCCCACG GGCTTACCCC GGAACAGGTG GTGGCCATTG CAAGCAACGG TGGTGGCAAG<br />
661 CAGGCCCTGG AGACAGTCCA ACGGCTGCTT CCGGTTCTGT GTCAGGCCCA CGGCCTGACT<br />
721 CCAGAACAAG TGGTTGCTAT CGCCAGCCAC GATGGCGGTA AACAAGCCCT CGAAACCGTG<br />
781 CAGCGCCTGC TTCCGGTGCT CTGTCAGGCC CACGGACTGA CCCCGGAACA GGTGGTGGCC<br />
841 ATCGCCTCCA ACATTGGTGG TAAGCAAGCC CTCGAAACTG TGCAGCGGCT GCTTCCAGTC<br />
901 TTGTGCCAGG CTCACGGCCT GACACCGGAG CAGGTGGTTG CAATCGCGTC TAATATCGGC<br />
961 GGCAAACAGG CACTCGAGAC CGTGCAGCGC TTGCTTCCAG TGCTGTGTCA GGCCCACGGC<br />
1021 CTGACCCCGG AACAGGTGGT GGCCATCGCC TCTAACAATG GCGGCAAACA GGCATTGGAA<br />
1081 ACAGTTCAGC GCCTGCTGCC GGTGTTGTGT CAGGCTCACG GCCTGACTCC GGAGCAGGTT<br />
1141 GTGGCCATCG CAAGCCATGA TGGCGGTAAA CAAGCTCTGG AGACAGTGCA ACGCCTCTTG<br />
1201 CCAGTTTTGT GTCAGGCCCA CGGA <br />
</pre><br />
<p>Final Amino acids remain the same:</p><br />
<pre><br />
1 LTPEQVVAIA SNGGGKQALE TVQRLLPVLC QAHG<br />
35 LTPEQVVAIA SHDGGKQALE TVQRLLPVLC QAHG<br />
69 LTPEQVVAIA SNNGGKQALE TVQRLLPVLC QAHG<br />
103 LTPEQVVAIA SNIGGKQALE TVQRLLPVLC QAHG<br />
137 LTPEQVVAIA SNGGGKQALE TVQRLLPVLC QAHG<br />
171 LTPEQVVAIA SNIGGKQALE TVQRLLPVLC QAHG<br />
205 LTPEQVVAIA SNGGGKQALE TVQRLLPVLC QAHG<br />
239 LTPEQVVAIA SHDGGKQALE TVQRLLPVLC QAHG<br />
273 LTPEQVVAIA SNIGGKQALE TVQRLLPVLC QAHG<br />
307 LTPEQVVAIA SNIGGKQALE TVQRLLPVLC QAHG<br />
341 LTPEQVVAIA SNNGGKQALE TVQRLLPVLC QAHG<br />
375 LTPEQVVAIA SHDGGKQALE TVQRLLPVLC QAHG<br />
</pre><br />
<p>Corresponding part:</p><br />
<br />
<p ><br />
<b>PART-left:</b><br />
…CTGACCCCGGAGACG<br />
</p><br />
<center><p><br />
<b>PART1(150bp):</b><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p></center><br />
<center><p><br />
<b>PART2(219bp):</b><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p></center><br />
<center><p><br />
<b>PART3(262bp):</b><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<center><p><br />
<br />
<b>PART4(224bp):</b><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br />
GACG<br />
</p></center><br />
<center><p><br />
<b>PART5(194bp):</b><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p></center><br />
<center><p><br />
<b>PART6(249bp):</b><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p></center><br />
<center><p><br />
<br />
<b>PART-right:</b><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p></center><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<p>All parts are under artificial synthesis process, so there is few results, which can prove our changes are useful. However, with the principle of complementary base pairing, our chioce should be better than original vision. And if you want our data or use our method to create your own best sticky ends, just contact us!</p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</article><br />
</div></html><br />
<br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_ImprovementTeam:SJTU-BioX-Shanghai/Part3 TAL Improvement2014-10-17T11:58:49Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/d/db/SJTU14_gearbox.png");}<br />
<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2>Overview</h2><br />
<p>This year our team not only focus on our project and bioparts but also debug several existing parts designed by 2012 Freiburg. When we use their parts and follow their protocol, we find that it is hard for us to repeat their success. There are a lot of difficulties in our way to construct a TALE. After discussion and thinking, our team decide to improve the existing TAL parts by find out new and better sticky ends. Moreover, our method can be used in border way when people want to connect some components by Golden Gate method.</p><br />
<h2>Why we want to improve it?</h2><br />
<h3>Whether the Freiburg's design is efficient or not</h3><br />
<p>According to the experimental record of Freiburg, the success rate is higher than 95%(32/33). However, this result, to some degree, lacks statistical significance.</p><br />
<p>In the result section, they emphasize that there is a light band at 1200bp, which they believe could indicate that the Golden Gate connection works well. However, after conducting several experiments by ourselves, we find that the key point to indicate whether Golden Gate connection works is not the band at 1200bp. If the band is not clear and specific in the gel, it indicates the experiment doesn’t go well. We can easily find several light bands under the band of 1200bp. Moreover, the second light band is somewhat lighter than the band at 1200bp. Although the Freiburg can explain the results with the repeatability of the TALE sequence, we suppose that the possibility of the mismatch of the sticky ends still can’t be excluded. Frankly speaking, we try to believe that they really made it, but if the success cannot be repeated, there must be something wrong with their system. You can view <a href="https://2012.igem.org/Team:Freiburg/Project/Experiments">Detail information</a> in iGEM2012 Freiburg wiki.</p><br />
<center><img alt="Freiburg gel result" src="https://static.igem.org/mediawiki/2014/5/57/Freiburg_result_picture.png"width=400px vspace=20px></img></center><br />
<h3>The protocol we take to connect the parts of TALE</h3><br />
<br />
<p>1. Freiburg's protocol</p><br />
<p>2. Restriction enzyme digestion of plasmid and TAL repeats and gel extraction respectively. By the mole ratio, plasmid to TALE is 1 to 5 and TALE to TALE is 1 to 1. Ligation with T4 ligase in 22 ℃over night.</p><br />
<p>3. The same ratio of plasmid and TALE repeat, but add the TALE repeats one by one and ligation in 22 ℃, 30 minutes</p><br />
<p>4. Every two parts connect at one time, and try to make three intermediates of 400bp, and then mix the plasmid to make the complete TALE.</p><br />
<p>5. The same ratio and ligation with the program of 22℃ 2min, 40℃ 30,25 repeats.</p><br />
<br />
<h3>The motivation to debug 2012 Freiburg’s parts</h3><br />
<br />
<p>Unfortunately, all of our attempts failed. We didn’t manage to make a complete TALE, or even make two of them together. However, what is important for us is that when we try the 5th protocol, we notice an unexpected result. When we analyze the sequence result, we find that our left adaptor, 1st part and right adaptor connect together. Why do we get this result? We notice that their sticky end is TGAC, GCTC, and ACTC. That is to say, GCTC and ACTC connect with each other by mistake. In another word, if the sticky ends are very similar, they probably connect with each other. Although we failed again, the result gives us confidence to debug 2012 Freiburg's parts. </p><br />
<br />
<h2>How do we connect certain monomer? </h2><br />
<h3>Some advanced tips for TALE protein</h3><br />
<br />
<p>1. Given a sample sequence with repeating amino acids:</p><br />
<center></center><img src="https://static.igem.org/mediawiki/2014/f/f2/SJTU14_tal_improvment_1.png"></img></center><br />
<p>What XX means is that it determine the certain kind of base. For one unit of repetition, other amino acids can be identical.</p><br />
<p>2. A fully functional TALE protein contains one sequence, that does not have repetitive units, recognizing base T, and similar sequence but is only half length as its end. That is, one complete TALE protein is able to recognize certain number of repetitive units and two bases.</p><br />
<p>3. The length that can be recognized is not strictly twelve or fourteen. According to the published results, the length and certain sequence are dependent on number and type of monomer.</p><br><br />
<br />
<p>We can gather 96 bioparts based on Freiburg, and each part has its counterproductive base on certain location(1,2,3,4,5 or 6). By picking two bases on certain location, we are able to design one TALE protein sequence.</p><br />
<br />
<h3>Previous Review: Freiburg’s way of connection</h3><br />
<br />
<p>The main principles of connection is built upon the idea of Golden Gate Connection.( Sanjana, N. E. et al. A transcription activator-like effector toolbox for genome engineering. Nature Protocols 7, 171–192 (2012).)</p><br />
<p>The gust of these procedures is more related to one type of restriction enzyme, type II Restriction Enzyme, especially BsmBI enzyme.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/5/5b/SJTU14_tal_improvment_2.png" ></img></center><br />
<p>The main feature of this enzyme is the recognition sequence is on only one side of cleavage site. It provides the way which can be used to get certain incision without damaging the whole sequence. The sticky end has 4bp base, and it could be designed even for combination of multiple sticky end. That feature is fancy at first, but we cannot regardless its latent shortcomings. </p><br />
<p>Let’s analyze the example (AA1) provided by Freiburg. </p><br />
<center><img src="https://static.igem.org/mediawiki/2014/b/bc/SJTU14_tal_improvment_3.png" width=400px></img></center><br />
<p><small><i>The underlined parts are recognized by BsmBI. Vertical bar(|) is the cutting position. As for this sample, TGAC is one sticky end which can combine with other seven sticky ends.</i></small></p><br />
<h3>Evaluate seven sticky ends designed by 2012 Freiburg</h3><br />
<p>2012 Freiburg's parts have seven sticky ends:</p><br />
<p><center>TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC</center></p><br />
<p>We all know that certain two parts can combine together, under base-pair rule. However, whether it is possible that unpaired sticky ends can bind together? In fact, the more similar they are, the more possibility that can form new but error base pairs.<br />
Spired by BLAST algorithm, we calculate the similarity of each other sticky ends. </p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/TAL%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF%E8%A1%A8%E6%A0%BC.png" width=400px></img></center><br />
<p>The higher score, the higher similarity, and the higher possibility of mismatch. <br />
The table shows that more than 30% of pairs’ score is equal to 3, which means that the possibility of mismatch cannot be neglected.<br />
<br />
Even if we employ the relatively loose rule to calculate the similarity, we can still find that error rates cannot be neglected.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Tal_%E8%A1%A8%E6%A0%BC%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF2.png" width=400px></img></center><br />
<br />
<h2> Why not other sticky ends?</h2><br />
<h3>The Reason why Freiburg used these sticky ends</h3><br />
<p>Failed to contact the original designers of these sticky ends, what we can do is just to find feasible advantages of these combinations.</p><br />
<p>Review the TALE repeated amino acids sequence:</p><br />
<p><center>LTPEQVVAIAS(XX)GGKQALETVQRLLPVLCQAHG(34aa)</center></p><br />
<p>The first amino acid is Leu, which is essential for all connection process. There are six different types of base arrangement for Leu, one of the most number of base arrangement. </p><br />
<p><center>UUA,UUG,CUU,CUC,CUA,CUG</center></p><br />
<br />
<p>The counterproductive sticky ends:</p><br />
<p><center>(C)TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC</center></p><br />
<p>The useless of Degeneracy has helped to design seven sticky ends. However, since the codons for identical amino acid are highly similar.<br />
This feature, for experimental scientists, is a double-edged sword.</p><br />
<h2>How to improve the Golden Gate sticky ends? A big Table!</h2><br />
<br />
<p>Three basic key questions need to be answered:</p><br />
<p>1. Whether it’s possible to find perfect match pair?</p><br />
<p>2. Whether we can find a certain number of sticky ends with least possibility to be mismatched?</p><br />
<p>3. How to make this sticky-end score table?</p><br />
<br />
<h3>Key algorithms derived from BLAST algorithm</h3><br />
<p>Loose rule: Match: 1; Mismatch:-1; Gap: 0</p><br />
<p>Strict rule: Match: 1; Mismatch:0; Gap: -1</p><br />
<p>The sticky end is composed of four bases, which means that we can design 256 types of sticky ends at most.<br />
The forming pair is represented as a 256*256 table. </p><br />
<h3>Find target groups of sticky ends</h3><br />
<p>To solve the TALE parts problem, we need find seven sticky ends, and the similarity score(hereafter referred to as Score) of each pair of them are less than or equal to 1.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/1/12/Choices_for_group.png" width=400px></img></center><br />
<p>When we select Strict Algorithm to find these ends, it is impossible to find seven sticky ends, that each pair of them has score no more than 1. So we have to select Loose Algorithm.</p><br />
<h3>Four basepair sticky ends convert to amino acid pair</h3><br />
<p>What we are caring about is whether two amino acids can be located on my target sequence, rather than the 4bp bases. So we should convert the sticky ends information to 2 amino acids.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/4/45/Amino_acid_table.png"width=600px></img></center><br />
<p>Based on the above table, we are able to calculate the total scores of each combination and find the least one.</p><br />
<h2>Best choice for seven sticky ends on TALE protein</h2><br />
<p>Best combination:<br />
<center>AAAA, AGGG, GTAC, GCTC, TTTT, TCGA, CCCC</center></p><br />
<p>Scores Table(Loose rule):</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e0/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-16_%E4%B8%8B%E5%8D%883.24.40.png" width=400px></img></center><br />
<p>Position in TALE amino acids sequence:</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e1/Sticky3333.png" width="500px"></img></center><br />
<h2>Reconstruct DNA Sequence</h2><br />
<p>Two main factors to reconstruct DNA sequence:<br />
1.Use the table of best combination and rearrange the sticky ends with your demand.<br />
2.No BsmBI recognition sequence in the reconstruct DNA sequence.<br />
Final DNA Sequence for TALE protein:</p><br />
<pre><br />
1 CTGACCCCGG AACAGGTGGT GGCCATTGCA AGCAACGGTG GTGGCAAGCA GGCCCTGGAG<br />
61 ACAGTCCAAC GGCTGCTTCC GGTTCTGTGT CAGGCCCACG GCCTGACTCC AGAACAAGTG<br />
121 GTTGCTATCG CCAGCCACGA TGGCGGAAAA CAAGCCCTCG AAACCGTGCA GCGCCTGCTT<br />
181 CCGGTGCTGT GTCAGGCCCA CGGGCTCACC CCGGAACAGG TGGTGGCCAT CGCATCTAAC<br />
241 AATGGCGGTA AGCAGGCACT GGAAACAGTG CAGCGCCTGC TTCCGGTCCT GTGTCAGGCT<br />
301 CATGGCCTGA CCCCAGAGCA GGTCGTGGCA ATTGCCTCCA ACATTGGAGG GAAGCAGGCA<br />
361 CTGGAGACCG TGCAGCGGCT GCTGCCGGTG CTGTGTCAGG CCCACGGCTT GACCCCGGAA<br />
421 CAGGTGGTGG CCATCGCCTC CAACGGCGGT GGCAAACAGG CGCTGGAAAC AGTTCAACGC<br />
481 CTCCTTCCGG TCCTGTGCCA GGCCCATGGT CTGACTCCAG AGCAGGTTGT GGCAATTGCA<br />
541 AGCAACATTG GTGGTAAACA AGCTTTGGAA ACCGTCCAGC GCTTGCTGCC AGTACTGTGT<br />
601 CAGGCCCACG GGCTTACCCC GGAACAGGTG GTGGCCATTG CAAGCAACGG TGGTGGCAAG<br />
661 CAGGCCCTGG AGACAGTCCA ACGGCTGCTT CCGGTTCTGT GTCAGGCCCA CGGCCTGACT<br />
721 CCAGAACAAG TGGTTGCTAT CGCCAGCCAC GATGGCGGTA AACAAGCCCT CGAAACCGTG<br />
781 CAGCGCCTGC TTCCGGTGCT CTGTCAGGCC CACGGACTGA CCCCGGAACA GGTGGTGGCC<br />
841 ATCGCCTCCA ACATTGGTGG TAAGCAAGCC CTCGAAACTG TGCAGCGGCT GCTTCCAGTC<br />
901 TTGTGCCAGG CTCACGGCCT GACACCGGAG CAGGTGGTTG CAATCGCGTC TAATATCGGC<br />
961 GGCAAACAGG CACTCGAGAC CGTGCAGCGC TTGCTTCCAG TGCTGTGTCA GGCCCACGGC<br />
1021 CTGACCCCGG AACAGGTGGT GGCCATCGCC TCTAACAATG GCGGCAAACA GGCATTGGAA<br />
1081 ACAGTTCAGC GCCTGCTGCC GGTGTTGTGT CAGGCTCACG GCCTGACTCC GGAGCAGGTT<br />
1141 GTGGCCATCG CAAGCCATGA TGGCGGTAAA CAAGCTCTGG AGACAGTGCA ACGCCTCTTG<br />
1201 CCAGTTTTGT GTCAGGCCCA CGGA <br />
</pre><br />
<p>Final Amino acids remain the same:</p><br />
<pre><br />
1 LTPEQVVAIA SNGGGKQALE TVQRLLPVLC QAHG<br />
35 LTPEQVVAIA SHDGGKQALE TVQRLLPVLC QAHG<br />
69 LTPEQVVAIA SNNGGKQALE TVQRLLPVLC QAHG<br />
103 LTPEQVVAIA SNIGGKQALE TVQRLLPVLC QAHG<br />
137 LTPEQVVAIA SNGGGKQALE TVQRLLPVLC QAHG<br />
171 LTPEQVVAIA SNIGGKQALE TVQRLLPVLC QAHG<br />
205 LTPEQVVAIA SNGGGKQALE TVQRLLPVLC QAHG<br />
239 LTPEQVVAIA SHDGGKQALE TVQRLLPVLC QAHG<br />
273 LTPEQVVAIA SNIGGKQALE TVQRLLPVLC QAHG<br />
307 LTPEQVVAIA SNIGGKQALE TVQRLLPVLC QAHG<br />
341 LTPEQVVAIA SNNGGKQALE TVQRLLPVLC QAHG<br />
375 LTPEQVVAIA SHDGGKQALE TVQRLLPVLC QAHG<br />
</pre><br />
<p>Corresponding part:</p><br />
<br />
<p ><br />
<b>PART-left:</b><br />
…CTGACCCCGGAGACG<br />
</p><br />
<center><p><br />
<b>PART1(150bp):</b><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p></center><br />
<center><p><br />
<b>PART2(219bp):</b><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p></center><br />
<center><p><br />
<b>PART3(262bp):</b><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<center><p><br />
<br />
<b>PART4(224bp):</b><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br />
GACG<br />
</p></center><br />
<center><p><br />
<b>PART5(194bp):</b><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p></center><br />
<center><p><br />
<b>PART6(249bp):</b><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p></center><br />
<center><p><br />
<br />
<b>PART-right:</b><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p></center><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<p>All parts are under artificial synthesis process, so there is few results, which can prove our changes are useful. However, with the principle of complementary base pairing, our chioce should be better than original vision. And if you want our data or use our method to create your own best sticky ends, just contact us!</p><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</article><br />
</div></html><br />
<br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T11:41:02Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
<br />
<h2 id="connectee:">Connectee:</h2><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br />
<p>At first, tests should be taken to check whether TAL can bind to plasmid DNA in prokaryotic system. Here we used <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. Both of them consist of linkers and various sections, which are shown in the schematic diagrams below.</p><br />
<br />
<br />
<br />
<h4>1. TAL effector–a transactivator-like protein. </h4><br />
<p><strong>TAL effector</strong> can bind to target sequence on DNA. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein is able to identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymin, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
<br />
<br />
<br />
<h4>2. Membrane anchor system–ssDsbA-Lgt. </h4><br />
<p><strong>ssDsbA</strong>, the signal sequence of DsbA, directs the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.</p><br />
<p>The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </p><br />
<br />
<h4>3. Fluorescent protein.</h4><br />
<p><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.</p><br />
<p><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.</p><br />
<p><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</p><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which consists of three major domains, membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reasons why we chose a membrane anchor are as follows.</p><br />
<br />
<p>1. TAL could bind nucleoid which may bring some negative effect on bacteria growth.</p><br />
<p>2. Membrane scaffold is a natural scaffold.</p><br />
<p>3. Exogenous proteins often form inactive inclusion body when expressed in the prokaryotic system.</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
<br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We used Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds to plasmid DNA, we chose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
<br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a Transactivator-like (TAL) protein to recognize a 14-nucleotide-long sequence, TXXXXXXXXXXXXT, on the plasmid DNA.<br />
The plasmid here is called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector.</p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong>.</p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<br />
<p>1. pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> for test for several reasons: </p><br />
<br />
<br />
<p>I. High copy number;</p><br />
<p>II.Medium length—2961bp;</p><br />
<p>III. Easy to detect whether binding a TAL may affect gene expression — through lacI &amp; blue-white spot screening.</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p><br />
<br />
<p>2. After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.</p><br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:</p><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
<br />
<br />
<p>3. Considering our multiple-enzyme system may be applied in the following experiment, we chose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
<br />
<p>4. Similar to the cross-linked ChIP, we used formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p><br />
<p>5. After that we did immunoprecipitation to obtain the protein-plasmid complex and digestd protein.</p><br />
<p>6. Finally, we used PCR to check whether there was any existing plasmid DNA.</p><br />
<br />
<br />
<h2 id="aconvenientpart:">A Convenient Part:</h2><br />
<p>In order to be used cooperatively with TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095), we also design a part named ssDsbA-mRFP-Lgt-TAL adapter-His Tag (BBa_K1453000). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p><br />
<br />
<p>This part consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, this part can produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (Bba_K747000 to Bba_K747015) at 5&#8217; of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (Bba_K747080 to Bba_K747095) at 3&#8217;. </p><br />
<br />
<p>With the rest of TAL-Protein DiRepeats (Bba_K747016 to Bba_K747079), users can synthesize a 14-nucleotide-long Transactivator-like (TAL) protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p>For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<br />
<h2 id="reference">References:</h2><br />
<ol><br />
<li>GONTERO, Brigitte, María Luz CÁRDENAS, and Jacques RICARD. &#8220;A functional five‐enzyme complex of chloroplasts involved in the Calvin cycle.&#8221; European journal of biochemistry 173.2 (1988): 437&#8211;443.</li><br />
<li>Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</li><br />
<li>Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</li><br />
<li>Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</li><br />
<li>Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</li><br />
<li>Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </li><br />
<li>Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</li><br />
<li>Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</li><br />
<li>Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</li><br />
</ol><br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T11:28:47Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
article<br />
{ margin: 3% 10%;<br />
font-size:1.3em;<br />
}<br />
article p,article,<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
-moz-column-count: 1;<br />
-moz-column-gap: 2em;<br />
column-gap: 2em;<br />
-webkit-column-count: 1;<br />
-webkit-column-gap: 2em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
h2#reference+ol li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
<br />
</style><br />
</html></div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T11:26:25Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
article<br />
{ margin: 3% 10%;<br />
font-size:1.3em;<br />
}<br />
article p,article,<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
-moz-column-count: 1;<br />
-moz-column-gap: 2em;<br />
column-gap: 2em;<br />
-webkit-column-count: 1;<br />
-webkit-column-gap: 2em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
margin:0;<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
font-size: 1.3em;<br />
padding-bottom:0.25em;<br />
padding-top:0.25em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
h2#reference+ol li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
<br />
</style><br />
</html></div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T11:24:09Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
article<br />
{ margin: 3% 10%;<br />
font-size:1.3em;<br />
}<br />
article p,article,<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
-moz-column-count: 1;<br />
-moz-column-gap: 2em;<br />
column-gap: 2em;<br />
-webkit-column-count: 1;<br />
-webkit-column-gap: 2em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
padding-bottom:0.1em;<br />
padding-top:0.1em;<br />
text-indent: 0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
h2#reference+ol li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
<br />
</style><br />
</html></div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T11:22:45Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
<br />
<h2 id="connectee:">Connectee:</h2><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br />
<p>At first, tests should be taken to check whether TAL can bind plasmid DNA in prokaryotic system. Here we use <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. Both of them consist of linkers and various sections, which are shown in the schematic diagrams below.</p><br />
<br />
<br />
<br />
<h4>1. TAL effector–a transactivator-like protein. </h4><br />
<p><strong>TAL effector</strong> can bind to target sequence on DNA. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein is able to identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymin, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
<br />
<br />
<br />
<h4>2. Membrane anchor system–ssDsbA-Lgt. </h4><br />
<p><strong>ssDsbA</strong>, the signal sequence of DsbA, directs the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.</p><br />
<p>The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </p><br />
<br />
<h4>3. Fluorescent protein.</h4><br />
<p><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.</p><br />
<p><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.</p><br />
<p><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</p><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which consists of three major domains, membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reasons why we choose a membrane anchor are as follows.</p><br />
<br />
<p>1. TAL could bind nucleoid which may bring some negative effect on bacteria growth.</p><br />
<p>2. Membrane scaffold is a natural scaffold.</p><br />
<p>3. Exogenous proteins often form inactive inclusion body when expressed in the prokaryotic system</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
<br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We use Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds plasmid DNA, we choose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
<br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a 14-nucleotide-long Transactivator-like (TAL) protein TXXXXXXXXXXXXT to recognize the same sequence on the plasmid DNA.<br />
The plasmid here we called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector</p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong></p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<br />
<p>1. pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> for test for several reasons: </p><br />
<br />
<br />
<p>I. High copy number</p><br />
<p>II.Medium length—2961bp</p><br />
<p>III. Easy to test whether binding a TAL may affect gene expression—lacI &amp; blue-white spot screening</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p><br />
<br />
<p>2. After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.</p><br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:</p><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
<br />
<br />
<p>3. Considering our multiple-enzyme system may be applied in the following experiment, we choose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
<br />
<p>4. Similar to the cross-linked ChIP, we use formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p><br />
<p>5. After that we do immunoprecipitation to get the protein-plasmid complex and digest protein</p><br />
<p>6. Finally, we use PCR to check whether there is any existing plasmid DNA.</p><br />
<br />
<br />
<h2 id="aconvenientpart:">A Convenient Part:</h2><br />
<p>In order to be used cooperatively with TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095), we also design a part named ssDsbA-mRFP-Lgt-TAL adapter-His Tag (BBa_K1453000). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p><br />
<br />
<p>This part consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, this part can produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (Bba_K747000 to Bba_K747015) at 5&#8217; of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (Bba_K747080 to Bba_K747095) at 3&#8217;. </p><br />
<br />
<p>With the rest of TAL-Protein DiRepeats (Bba_K747016 to Bba_K747079), users can synthesize a 14-nucleotide-long Transactivator-like (TAL) protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p>For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<br />
<h2 id="reference">References:</h2><br />
<p>[1]GONTERO, Brigitte, María Luz CÁRDENAS, and Jacques RICARD. &#8220;A functional five‐enzyme complex of chloroplasts involved in the Calvin cycle.&#8221; European journal of biochemistry 173.2 (1988): 437&#8211;443.<br />
Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</p><br />
<p>[2]Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</p><br />
<p>[3]Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</p><br />
<p>[4]Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</p><br />
<p>[5]Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </p><br />
<p>[6]Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</p><br />
<p>[7]Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</p><br />
<p>[8]Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</p><br />
<br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T11:20:59Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
article<br />
{ margin: 3% 10%;<br />
font-size:1.3em;<br />
}<br />
article p,article,<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
-moz-column-count: 1;<br />
-moz-column-gap: 2em;<br />
column-gap: 2em;<br />
-webkit-column-count: 1;<br />
-webkit-column-gap: 2em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h4{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
padding-bottom:0.5em;<br />
}<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
h2#reference+ol li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
<br />
</style><br />
</html></div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T11:12:44Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
article<br />
{ margin: 3% 10%;<br />
font-size:1.3em;<br />
}<br />
article p,article,<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
-moz-column-count: 1;<br />
-moz-column-gap: 2em;<br />
column-gap: 2em;<br />
-webkit-column-count: 1;<br />
-webkit-column-gap: 2em;<br />
}<br />
article p{text-indent: 2em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.5em;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
h2#reference+ol li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
<br />
</style><br />
</html></div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T11:08:33Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
<br />
<h2 id="connectee:">Connectee:</h2><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br />
<p>At first, tests should be taken to check whether TAL can bind plasmid DNA in prokaryotic system. Here we use <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. Both of them consist of linkers and various sections, which are shown in the schematic diagrams below.</p><br />
<br />
<br />
<br />
<p><strong>1. TAL effector</strong>–a transactivator-like protein. </p><br />
<p><strong>TAL effector</strong> can bind DNA with target sequence. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein can identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymin, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
<br />
<br />
<br />
<p><strong>2. Membrane anchor system–ssDsbA-Lgt</strong>. </p><br />
<p><strong>ssDsbA</strong> is the signal sequence of DsbA which can direct the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.</p><br />
<p>The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </p><br />
<br />
<p><strong>3. Fluorescent protein</strong>.</p><br />
<p><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.</p><br />
<p><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.</p><br />
<p><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</p><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which is composed of three major domains, membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reason why we choose a membrane anchor is that:</p><br />
<br />
<p>1. TAL could bind nucleoid which may bring some negative effect on bacteria growth.</p><br />
<p>2. Membrane scaffold is a natural scaffold.</p><br />
<p>3. Exogenous proteins often form inactive inclusion body when expressed in the prokaryotic system</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
<br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We use Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds plasmid DNA, we choose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
<br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a 14-nucleotide-long Transactivator-like (TAL) protein TXXXXXXXXXXXXT to recognize the same sequence on the plasmid DNA.<br />
The plasmid here we called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector</p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong></p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<br />
<p>1. pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> for test for several reasons: </p><br />
<br />
<br />
<p>I. High copy number</p><br />
<p>II.Medium length—2961bp</p><br />
<p>III. Easy to test whether binding a TAL may affect gene expression—lacI &amp; blue-white spot screening</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p><br />
<br />
<p>2. After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.</p><br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:</p><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
<br />
<br />
<p>3. Considering our multiple-enzyme system may be applied in the following experiment, we choose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
<br />
<p>4. Similar to the cross-linked ChIP, we use formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p><br />
<p>5. After that we do immunoprecipitation to get the protein-plasmid complex and digest protein</p><br />
<p>6. Finally, we use PCR to check whether there is any existing plasmid DNA.</p><br />
<br />
<br />
<h2 id="aconvenientpart:">A Convenient Part:</h2><br />
<p>In order to be used cooperatively with TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095), we also design a part named ssDsbA-mRFP-Lgt-TAL adapter-His Tag (BBa_K1453000). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p><br />
<br />
<p>This part consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, this part can produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (Bba_K747000 to Bba_K747015) at 5&#8217; of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (Bba_K747080 to Bba_K747095) at 3&#8217;. </p><br />
<br />
<p>With the rest of TAL-Protein DiRepeats (Bba_K747016 to Bba_K747079), users can synthesize a 14-nucleotide-long Transactivator-like (TAL) protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p>For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<br />
<h2 id="reference">References:</h2><br />
<p>[1]GONTERO, Brigitte, María Luz CÁRDENAS, and Jacques RICARD. &#8220;A functional five‐enzyme complex of chloroplasts involved in the Calvin cycle.&#8221; European journal of biochemistry 173.2 (1988): 437&#8211;443.<br />
Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</p><br />
<p>[2]Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</p><br />
<p>[3]Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</p><br />
<p>[4]Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</p><br />
<p>[5]Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </p><br />
<p>[6]Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</p><br />
<p>[7]Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</p><br />
<p>[8]Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</p><br />
<br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T11:06:14Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
article<br />
{ margin: 3% 10%;<br />
font-size:1.3em;<br />
}<br />
article p,article,<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
word-spacing: 0.1em;<br />
-moz-column-count: 1;<br />
-moz-column-gap: 2em;<br />
column-gap: 2em;<br />
-webkit-column-count: 1;<br />
-webkit-column-gap: 2em;<br />
}<br />
article p{text-indent: 1em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-top: 0.25em;<br />
padding-bottom: 0.25em;<br />
font-size: 1.3em;<br />
color:#2d3e58;<br />
line-height:1.25;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
h2#reference+ol li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
<br />
</style><br />
</html></div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T10:58:34Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
<br />
<h2 id="connectee:">Connectee:</h2><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br />
<p>At first, tests should be taken to check whether TAL can bind plasmid DNA in prokaryotic system. Here we use <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. Both of them consist of linkers and various sections, which are shown in the schematic diagrams below.</p><br />
<br />
<br />
<br />
<p><strong>1. TAL effector</strong>–a transactivator-like protein. </p><br />
<p><strong>TAL effector</strong> can bind DNA with target sequence. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein can identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymin, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
<br />
<br />
<br />
<p><strong>2. Membrane anchor system–ssDsbA-Lgt</strong>. </p><br />
<p><strong>ssDsbA</strong> is the signal sequence of DsbA which can direct the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.</p><br />
<p>The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </p><br />
<br />
<p><strong>3. Fluorescent protein</strong>.</p><br />
<p><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.</p><br />
<p><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.</p><br />
<p><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</p><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which is composed of three major domains, membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reason why we choose a membrane anchor is that:</p><br />
<br />
<p>1. TAL could bind nucleoid which may bring some negative effect on bacteria growth.</p><br />
<p>2. Membrane scaffold is a natural scaffold.</p><br />
<p>3. Exogenous proteins often form inactive inclusion body when expressed in the prokaryotic system</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
<br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We use Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds plasmid DNA, we choose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
<br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a 14-nucleotide-long Transactivator-like (TAL) protein TXXXXXXXXXXXXT to recognize the same sequence on the plasmid DNA.<br />
The plasmid here we called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector</p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong></p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<br />
<p>1. pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> for test for several reasons: </p><br />
<br />
<br />
<p>I. High copy number</p><br />
<p>II.Medium length—2961bp</p><br />
<p>III. Easy to test whether binding a TAL may affect gene expression—lacI &amp; blue-white spot screening</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p><br />
<br />
<p>2. After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.</p><br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:</p><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
<br />
<br />
<p>3. Considering our multiple-enzyme system may be applied in the following experiment, we choose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
<br />
<p>4. Similar to the cross-linked ChIP, we use formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p><br />
<p>5. After that we do immunoprecipitation to get the protein-plasmid complex and digest protein</p><br />
<p>6. Finally, we use PCR to check whether there is any existing plasmid DNA.</p><br />
<br />
<br />
<h2 id="aconvenientpart:">A Convenient Part:</h2><br />
<p>In order to be used cooperatively with TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095), we also design a part named ssDsbA-mRFP-Lgt-TAL adapter-His Tag (BBa_K1453000). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p><br />
<br />
<p>This part consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, this part can produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (Bba_K747000 to Bba_K747015) at 5&#8217; of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (Bba_K747080 to Bba_K747095) at 3&#8217;. </p><br />
<br />
<p>With the rest of TAL-Protein DiRepeats (Bba_K747016 to Bba_K747079), users can synthesize a 14-nucleotide-long Transactivator-like (TAL) protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p>For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<br />
<h2 id="reference">References:</h2><br />
<p>GONTERO, Brigitte, María Luz CÁRDENAS, and Jacques RICARD. &#8220;A functional five‐enzyme complex of chloroplasts involved in the Calvin cycle.&#8221; European journal of biochemistry 173.2 (1988): 437&#8211;443.<br />
Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</p><br />
<p>Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</p><br />
<p>Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</p><br />
<p>Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</p><br />
<p>Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </p><br />
<p>Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</p><br />
<p>Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</p><br />
<p>Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</p><br />
<br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T10:58:12Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
<br />
<h2 id="connectee:">Connectee:</h2><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br />
<p>At first, tests should be taken to check whether TAL can bind plasmid DNA in prokaryotic system. Here we use <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. Both of them consist of linkers and various sections, which are shown in the schematic diagrams below.</p>.<br />
<br />
<br />
<br />
<p><strong>1. TAL effector</strong>–a transactivator-like protein. </p><br />
<p><strong>TAL effector</strong> can bind DNA with target sequence. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein can identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymin, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</p><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
<br />
<br />
<br />
<p><strong>2. Membrane anchor system–ssDsbA-Lgt</strong>. </p><br />
<p><strong>ssDsbA</strong> is the signal sequence of DsbA which can direct the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.</p><br />
<p>The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </p><br />
<br />
<p><strong>3. Fluorescent protein</strong>.</p><br />
<p><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.</p><br />
<p><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.</p><br />
<p><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</p><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which is composed of three major domains, membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reason why we choose a membrane anchor is that:</p><br />
<br />
<p>1. TAL could bind nucleoid which may bring some negative effect on bacteria growth.</p><br />
<p>2. Membrane scaffold is a natural scaffold.</p><br />
<p>3. Exogenous proteins often form inactive inclusion body when expressed in the prokaryotic system</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
<br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We use Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds plasmid DNA, we choose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
<br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a 14-nucleotide-long Transactivator-like (TAL) protein TXXXXXXXXXXXXT to recognize the same sequence on the plasmid DNA.<br />
The plasmid here we called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector</p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong></p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<br />
<p>1. pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> for test for several reasons: </p><br />
<br />
<br />
<p>I. High copy number</p><br />
<p>II.Medium length—2961bp</p><br />
<p>III. Easy to test whether binding a TAL may affect gene expression—lacI &amp; blue-white spot screening</p><br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p><br />
<br />
<p>2. After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.</p><br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:</p><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
<br />
<br />
<p>3. Considering our multiple-enzyme system may be applied in the following experiment, we choose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
<br />
<p>4. Similar to the cross-linked ChIP, we use formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p><br />
<p>5. After that we do immunoprecipitation to get the protein-plasmid complex and digest protein</p><br />
<p>6. Finally, we use PCR to check whether there is any existing plasmid DNA.</p><br />
<br />
<br />
<h2 id="aconvenientpart:">A Convenient Part:</h2><br />
<p>In order to be used cooperatively with TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095), we also design a part named ssDsbA-mRFP-Lgt-TAL adapter-His Tag (BBa_K1453000). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p><br />
<br />
<p>This part consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, this part can produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (Bba_K747000 to Bba_K747015) at 5&#8217; of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (Bba_K747080 to Bba_K747095) at 3&#8217;. </p><br />
<br />
<p>With the rest of TAL-Protein DiRepeats (Bba_K747016 to Bba_K747079), users can synthesize a 14-nucleotide-long Transactivator-like (TAL) protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p>For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<br />
<h2 id="reference">References:</h2><br />
<p>GONTERO, Brigitte, María Luz CÁRDENAS, and Jacques RICARD. &#8220;A functional five‐enzyme complex of chloroplasts involved in the Calvin cycle.&#8221; European journal of biochemistry 173.2 (1988): 437&#8211;443.<br />
Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</p><br />
<p>Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</p><br />
<p>Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</p><br />
<p>Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</p><br />
<p>Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </p><br />
<p>Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</p><br />
<p>Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</p><br />
<p>Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</p><br />
<br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T10:54:45Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
article<br />
{ margin: 3% 10%;<br />
font-size:1.3em;<br />
}<br />
article p,article,<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
margin-left:2em;<br />
word-spacing: 0.2em;<br />
-moz-column-count: 1;<br />
-moz-column-gap: 2em;<br />
column-gap: 2em;<br />
-webkit-column-count: 1;<br />
-webkit-column-gap: 2em;<br />
}<br />
article p{text-indent: 1em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-bottom:0.5em;<br />
font-size: 1.3em;<br />
/*margin: 10px 0px 10px 0px;*/<br />
color:#2d3e58;<br />
line-height:1.25;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-top:0.5em;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 10px 10px 10px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
h2#reference+ol li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
<br />
</style><br />
</html></div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/articleTemplate:Team:SJTU-BioX-Shanghai/article2014-10-17T10:30:42Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<style type="text/css"><br />
@charset "UTF-8"; <br />
/* CSS Document */<br />
<br />
article<br />
{ margin: 3% 10%;<br />
font-size:1.3em;<br />
}<br />
article p,article,<br />
{<br />
font-family:'Open Sans','Times New Roman', Times, serif;<br />
list-style-position: inside<br />
font-style:normal;<br />
line-height:2;<br />
text-align: justify;<br />
padding-bottom:0.5em;<br />
margin-left:2em;<br />
word-spacing: 0.2em;<br />
-moz-column-count: 1;<br />
-moz-column-gap: 2em;<br />
column-gap: 2em;<br />
-webkit-column-count: 1;<br />
-webkit-column-gap: 2em;<br />
}<br />
article p{text-indent: 1em;}<br />
article ul{list-style:none;}<br />
/*blockquote,article ol{padding-left:2em;}*/<br />
article h3<br />
{<br />
font-family: 'Open Sans', 'Palatino Linotype', 'Book Antiqua', sans-serif;<br />
padding-bottom:0.5em;<br />
font-size: 1.3em;<br />
padding-left:1em;<br />
margin: 10px 0px 10px 0px;<br />
color:#2d3e58;<br />
line-height:1.25;<br />
}<br />
article h2<br />
{<br />
letter-spacing:3px;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
padding-bottom:0.5em;<br />
font-size: 2.5em;}<br />
<br />
margin: 25px 3px 10px 3px;<br />
letter-spacing:3px;<br />
color:#2d3e58;<br />
}<br />
h2#reference+ol li{<br />
font-style:italic;<br />
font-size: 0.95em;<br />
}<br />
@media screen and (max-width: 55.6875em) {<br />
article p <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
#overview <br />
{<br />
-webkit-column-count: 1;<br />
-moz-columns: 1;<br />
columns: 1;<br />
}<br />
}<br />
<br />
</style><br />
</html></div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T05:40:16Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
<h2 id="connectee:">Connectee:</h2><br/><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br/><br />
<p>At first, tests should be taken to check whether TAL can bind plasmid DNA in prokaryotic system. Here we use <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. Both of them consist of linkers and various sections, which are shown in the schematic diagrams below.</p>.<br />
<br />
<br />
<ol><br />
<li><strong>TAL effector</strong>–a transactivator-like protein. <br />
<br/><strong>TAL effector</strong> can bind DNA with target sequence. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein can identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymin, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</li><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
<br />
<br />
<br/><br />
<li><strong>Membrane anchor system–ssDsbA-Lgt</strong>. <br />
<br/><strong>ssDsbA</strong> is the signal sequence of DsbA which can direct the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.<br/><br />
The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </li><br />
<br/><br/><br />
<li><strong>Fluorescent protein</strong>.<br />
<br/><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.<br />
<br/><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.<br />
<br/><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</li><br />
</ol><br />
<br/><br />
<br/><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which is composed of three major domains, membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reason why we choose a membrane anchor is that:</p><br />
<ol><br />
<li>TAL could bind nucleoid which may bring some negative effect on bacteria growth.</li><br />
<li>Membrane scaffold is a natural scaffold.</li><br />
<li>Exogenous proteins often form inactive inclusion body when expressed in the prokaryotic system</li><br />
</ol><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
<br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We use Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds plasmid DNA, we choose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
<br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a 14-nucleotide-long Transactivator-like (TAL) protein TXXXXXXXXXXXXT to recognize the same sequence on the plasmid DNA.<br/><br />
The plasmid here we called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector</br></p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong></p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<ol><br />
<li>pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> for test for several reasons: <br />
<br />
<br />
I. High copy number</br><br />
II.Medium length—2961bp</br><br />
III. Easy to test whether binding a TAL may affect gene expression—lacI &amp; blue-white spot screening<br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p></li><br />
<br />
<li>After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.<br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
</br><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
</li><br />
<br />
<li>Considering our multiple-enzyme system may be applied in the following experiment, we choose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</li><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
<br />
<li>Similar to the cross-linked ChIP, we use formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p></li><br />
<li>After that we do immunoprecipitation to get the protein-plasmid complex and digest protein</p></li><br />
<li>Finally, we use PCR to check whether there is any existing plasmid DNA.</p></li><br />
</ol><br />
<h2 id="aconvenientpart:">A Convenient Part:</h2><br />
<br />
<p>In order to be used cooperatively with TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095), we also design a part named ssDsbA-mRFP-Lgt-TAL adapter-His Tag (BBa_K1453000). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p><br />
<br />
<p>This part consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, this part can produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (Bba_K747000 to Bba_K747015) at 5&#8217; of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (Bba_K747080 to Bba_K747095) at 3&#8217;. </p><br />
<br />
<p>With the rest of TAL-Protein DiRepeats (Bba_K747016 to Bba_K747079), users can synthesize a 14-nucleotide-long Transactivator-like (TAL) protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p>For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<h2 id="reference">References:</h2><br />
<br />
<ol><br />
<li>GONTERO, Brigitte, María Luz CÁRDENAS, and Jacques RICARD. &#8220;A functional five‐enzyme complex of chloroplasts involved in the Calvin cycle.&#8221; European journal of biochemistry 173.2 (1988): 437&#8211;443.</li><br />
<li>Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</li><br />
<li>Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</li><br />
<li>Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</li><br />
<li>Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</li><br />
<li>Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </li><br />
<li>Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</li><br />
<li>Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</li><br />
<li>Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</li><br />
</ol><br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T05:34:11Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
<h2 id="connectee:">Connectee:</h2><br/><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br/><br />
<p>At first, tests should be taken to check whether TAL can bind plasmid DNA in prokaryotic system. Here we use <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. Both of them consist of linkers and various sections, which are shown in the schematic diagrams below.</p>.<br />
<br />
<br />
<ol><br />
<li><strong>TAL effector</strong>–a transactivator-like protein. <br />
<br/><strong>TAL effector</strong> can bind DNA with target sequence. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein can identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymin, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</li><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
<br />
<br />
<br/><br />
<li><strong>Membrane anchor system–ssDsbA-Lgt</strong>. <br />
<br/><strong>ssDsbA</strong> is the signal sequence of DsbA which can direct the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.<br/><br />
The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </li><br />
<br/><br/><br />
<li><strong>Fluorescent protein</strong>.<br />
<br/><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.<br />
<br/><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.<br />
<br/><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</li><br />
</ol><br />
<br/><br />
<br/><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which is composed of three major domains, membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reason why we choose a membrane anchor is that:</p><br />
<ol><br />
<li>TAL could bind nucleoid which may bring some negative effect on bacteria growth.</li><br />
<li>Membrane scaffold is a natural scaffold.</li><br />
<li>Exogenous proteins often form inactive inclusion body when expressed in the prokaryotic system</li><br />
</ol><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
<br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We use Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds plasmid DNA, we choose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
<br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a 14-nucleotide-long Transactivator-like (TAL) protein TXXXXXXXXXXXXT to recognize the same sequence on the plasmid DNA.<br/><br />
The plasmid here we called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector</br></p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong></p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<ol><br />
<li>pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> for test for several reasons: </li><br />
<br />
<br />
I. High copy number</br><br />
II.Medium length—2961bp</br><br />
III. Easy to test whether binding a TAL may affect gene expression—lacI &amp; blue-white spot screening<br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p><br />
<br />
<li>After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.<br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
</br><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
<br />
<li>Considering our multiple-enzyme system may be applied in the following experiment, we choose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</li><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
<br />
<li>Similar to the cross-linked ChIP, we use formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p><br />
<li>After that we do immunoprecipitation to get the protein-plasmid complex and digest protein</p><br />
<li>Finally, we use PCR to check whether there is any existing plasmid DNA.</p><br />
</ol><br />
<h2 id="aconvenientpart:">A Convenient Part:</h2><br />
<br />
<p>In order to be used cooperatively with TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095), we also design a part named ssDsbA-mRFP-Lgt-TAL adapter-His Tag (BBa_K1453000). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p><br />
<br />
<p>This part consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, this part can produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (Bba_K747000 to Bba_K747015) at 5&#8217; of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (Bba_K747080 to Bba_K747095) at 3&#8217;. </p><br />
<br />
<p>With the rest of TAL-Protein DiRepeats (Bba_K747016 to Bba_K747079), users can synthesize a 14-nucleotide-long Transactivator-like (TAL) protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p>For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<h2 id="reference">References:</h2><br />
<br />
<ol><br />
<li>GONTERO, Brigitte, María Luz CÁRDENAS, and Jacques RICARD. &#8220;A functional five‐enzyme complex of chloroplasts involved in the Calvin cycle.&#8221; European journal of biochemistry 173.2 (1988): 437&#8211;443.</li><br />
<li>Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</li><br />
<li>Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</li><br />
<li>Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</li><br />
<li>Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</li><br />
<li>Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </li><br />
<li>Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</li><br />
<li>Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</li><br />
<li>Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</li><br />
</ol><br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_ConnectTeam:SJTU-BioX-Shanghai/Part1 Connect2014-10-17T05:32:51Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/c/c4/SJTU14_connect.png");}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown"><center>Basic Test</center></h2><br />
<h2 id="alignright" align="center">——One Connectee Binds Connector</h2><br />
<h2 id="connectee:">Connectee:</h2><br/><br />
<h3 id="schematicintroduction">Schematic Introduction</h3><br/><br />
<p>At first, tests should be taken to check whether TAL can bind plasmid DNA in prokaryotic system. Here we use <i>E.coli</i>. As mentioned in the overview, in order for the protein to bind to the plasmid–the <strong><em>connector</em></strong>, we have designed two kinds of delicate fusion proteins–the <strong><em>connectee</em></strong>. One is anchored to the cell membrane, the other is free in the cytoplasm. Both of them consist of linkers and various sections, which are shown in the schematic diagrams below.</p>.<br />
<br />
<br />
<ol><br />
<li><strong>TAL effector</strong>–a transactivator-like protein. <br />
<br/><strong>TAL effector</strong> can bind DNA with target sequence. The 2012 Freiburg iGEM team has offered us a whole set of 96 TAL-protein direpeat bioparts, with which we are supposed to build functional TAL proteins. Since each TAL protein can identify a 14-nucleotide target sequence, the first and fourteenth nucleotide being Thymin, all the 96 parts can be used to identify more than 16 million different nucleotide sequences, which makes it very convenient for us to choose a sequence for the fusion protein to bind to.</li><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/2a/TAL_golden_gate.png"></img></center><br />
<br />
<br />
<br/><br />
<li><strong>Membrane anchor system–ssDsbA-Lgt</strong>. <br />
<br/><strong>ssDsbA</strong> is the signal sequence of DsbA which can direct the fusion protein to the periplasm. <strong>Lgt</strong> is a transmembrane protein.<br/><br />
The <strong> membrane anchor system</strong> has been identified by iGEM12_SJTU-BioX-Shanghai. </li><br />
<br/><br/><br />
<li><strong>Fluorescent protein</strong>.<br />
<br/><strong>CFP</strong> is a Cyan Fluorescent Protein which has an excitation peak at 439 nm and an emission peak at 476 nm.<br />
<br/><strong>YFP</strong> is a Yellow Fluorescent Protein which has an excitation peak at 514 nm and an emission peak at 527 nm.<br />
<br/><strong>mRFP</strong> is a Red Fluorescent Protein which has an excitation peak at 584 nm and an emission peak at 607 nm.</li><br />
<br/><br />
<br/><br />
<br />
<br />
<h3 id="connectee1:">Connectee 1:</h3><br />
<br />
<p>The first kind of <strong><em>connectee</em></strong> is designed to be tested on the membrane, which is composed of three major domains, membrane anchor system(ssDsbA-Lgt), mRFP and TAL effector.</p><br />
<p>The reason why we choose a membrane anchor is that:</p><br />
<ol><br />
<li>TAL could bind nucleoid which may bring some negative effect on bacteria growth.</li><br />
<li>Membrane scaffold is a natural scaffold.</li><br />
<li>Exogenous proteins often form inactive inclusion body when expressed in the prokaryotic system</li><br />
</ol><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/7/74/MRFP-Lgt-TAL_effector.png"></img></center></p><br />
<br />
<p>The membrane anchor system (ssDsbA-Lgt) comes from BBa_K771000 designed by iGEM12_SJTU-BioX-Shanghai; mRFP comes from BBa_E1010 designed by Antiquity; TAL effector comes from TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095) designed by iGEM12_Freiburg. We use Helical Linker to connect mRFP and Lgt, in accord with iGEM12_SJTU-BioX-Shanghai. While in consideration of any possible stereospecific blockade when TAL binds plasmid DNA, we choose Flexible Linker to connect Lgt and TAL effector.</p><br />
<br />
<h3 id="connectee2:">Connectee 2:</h3><br />
<br />
<p>The second kind of <strong><em>connectee</em></strong> is designed to be tested in the cytoplasm, which only contains TAL effector.</p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/1/19/Random_tal_effector.png"></img></center></p><br />
<br />
<h2 id="connector:">Connector:</h2><br />
<br />
<p>As iGEM12_Freiburg designed, we can choose a 14-nucleotide-long Transactivator-like (TAL) protein TXXXXXXXXXXXXT to recognize the same sequence on the plasmid DNA.<br/><br />
The plasmid here we called <strong><em>connector</em></strong>. </p><br />
<br />
<br />
<p>The principle for choosing a TAL recognizing sequence: </p><br />
<br />
<p>I. It does not exist in expression vector</br></p><br />
<p>II. It does not exist in the sequence of <strong><em>connectee</em></strong></p><br />
<br />
<br />
<br />
<h2 id="testmethod:">Test Method:</h2><br />
<ol><br />
<li>pBluescript II KS(+) is chosen as the <strong><em>connector</em></strong> for test for several reasons: </li><br />
<br />
<br />
I. High copy number</br><br />
II.Medium length—2961bp</br><br />
III. Easy to test whether binding a TAL may affect gene expression—lacI &amp; blue-white spot screening<br />
<br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/8/81/Pks_ii_original.png"></img></center></p><br />
<br />
<li>After checking the sequence of pBluescript II KS(+), we chose TTCGATATCAAGCT as the recognition sequence for test and designed TAL1.<br />
<br />
<p>Two kinds of connectee with TAL1 are shown below:<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png"></img></center></p><br />
</br><br />
<p><center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png"></img></center></p><br />
<br />
<li>Considering our multiple-enzyme system may be applied in the following experiment, we choose pRSFDuet&#8211;1(<em>NOVAGEN</em>) as the expression vector.</li><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/d/d3/Prsf.png"></img></center></p><br />
<br />
<li>Similar to the cross-linked ChIP, we use formaldehyde to cross-link <strong><em>connectee</em></strong> and <strong><em>connector</em></strong></p><br />
<li>After that we do immunoprecipitation to get the protein-plasmid complex and digest protein</p><br />
<li>Finally, we use PCR to check whether there is any existing plasmid DNA.</p><br />
</ol><br />
<h2 id="aconvenientpart:">A Convenient Part:</h2><br />
<br />
<p>In order to be used cooperatively with TAL-Protein DiRepeats (BBa_K747000 to BBa_K747095), we also design a part named ssDsbA-mRFP-Lgt-TAL adapter-His Tag (BBa_K1453000). </p><br />
<br />
<p><center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png"></img></center></p><br />
<br />
<p>This part consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. When digested with BsmBI, this part can produce two sticky-ends. One can complement with the first TAL-Protein DiRepeat (Bba_K747000 to Bba_K747015) at 5&#8217; of the sequence, while the other can complement with the sixth TAL-Protein DiRepeat (Bba_K747080 to Bba_K747095) at 3&#8217;. </p><br />
<br />
<p>With the rest of TAL-Protein DiRepeats (Bba_K747016 to Bba_K747079), users can synthesize a 14-nucleotide-long Transactivator-like (TAL) protein to recognize their own <strong><em>connector</em></strong> and design their own polymerization. (Golden Gate Cloning) </p><br />
<br />
<p>For more details about membrane anchor, please view <a href="https://2012.igem.org/Team:SJTU-BioX-Shanghai">this page</a>.</p><br />
<br />
<p>For more details about TAL and Golden Gate Cloning, please view <a href="https://2012.igem.org/Team:Freiburg">this page</a>.</p><br />
<br />
<h2 id="reference">References:</h2><br />
<br />
<ol><br />
<li>GONTERO, Brigitte, María Luz CÁRDENAS, and Jacques RICARD. &#8220;A functional five‐enzyme complex of chloroplasts involved in the Calvin cycle.&#8221; European journal of biochemistry 173.2 (1988): 437&#8211;443.</li><br />
<li>Bogdanove, Adam J., and Daniel F. Voytas. &#8220;TAL effector: customizable proteins for DNA targeting.&#8221; Science 333.6051 (2011): 1843&#8211;1846.</li><br />
<li>Deng, Dong, et al. &#8220;Structural basis for sequence-specific recognition of DNA by TAL effector.&#8221; Science 335.6069 (2012): 720&#8211;723.</li><br />
<li>Pailler, J., W. Aucher, et al. (2012). &#8220;Phosphatidylglycerol: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane.&#8221; Journal of bacteriology 194(9): 2142&#8211;2151.</li><br />
<li>Schierle, C. F., M. Berkmen, et al. (2003). &#8220;The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway.&#8221; Journal of bacteriology 185(19): 5706&#8211;5713.</li><br />
<li>Scholze, H. &amp; Boch, J. TAL effector are remote controls for gene activation. &#8216;&#8216;Current Opinion in Microbiology&#8217;&#8217; 14, 47–53 (2011). </li><br />
<li>Moscou, M. J. &amp; Bogdanove, A. J. A Simple Cipher Governs DNA Recognition by TAL Effector. &#8216;&#8216;Science&#8217;&#8217; 326, 1501–1501 (2009).</li><br />
<li>Conrado, R. J., G. C. Wu, et al. (2012). &#8220;DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency.&#8221; Nucleic acids research 40(4): 1879&#8211;1889.</li><br />
<li>Yang, Zhong, et al. &#8220;Highly efficient production of soluble proteins from insoluble inclusion bodies by a two-step-denaturing and refolding method.&#8221; PloS one 6.7 (2011): e22981.</li><br />
</ol><br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/top-nav-frontTemplate:Team:SJTU-BioX-Shanghai/top-nav-front2014-10-16T17:32:44Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<div style="clear:both;"></div> <br />
<br />
<div id="wrap"><br />
<header role="banner"><br />
<div class="flex"><br />
<h1><a href="#top" class="site-title ir">HOME</a></h1><br />
<nav role="navigation"><br />
<ul id="cbp-tm-menu" class="cbp-tm-menu"><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Project">PROJECT</a><br />
<ul class="cbp-tm-submenu"><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Project" class="cbp-tm-icon-archive">OVERVIEW</a></li><br />
<!--<li><a href="/Team:SJTU-BioX-Shanghai/Background" class="cbp-tm-icon-cog">BACKGROUND</a></li>--><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Part1_Connect" class="cbp-tm-icon-cog">1. CONNECT</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension" class="cbp-tm-icon-cog">2. EXTENSION</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" class="cbp-tm-icon-cog">3. TAL IMPROV.</a></li><br />
</ul><br />
</li><br />
<li ><a href="/Team:SJTU-BioX-Shanghai/Achievement">ACHIEVEMENT</a><br />
<ul class="cbp-tm-submenu"><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Results" class="cbp-tm-icon-screen">RESULTS</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Modeling" class="cbp-tm-icon-mail">MODELING</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Parts" class="cbp-tm-icon-contract">PARTS</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Judging_Form" class="cbp-tm-icon-pencil">JUDGING FORM</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Human_Parctice" class="cbp-tm-icon-article">HUMAN PRACTICE</a></li><br />
</ul><br />
</li><br />
<li ><a href="/Team:SJTU-BioX-Shanghai/Notebook">NOTEBOOK</a><br />
<ul class="cbp-tm-submenu"><br />
<li><a href="/Team:SJTU-BioX-Shanghai/daynotes" class="cbp-tm-icon-archive">NOTES & PROTOCOL</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Safety" class="cbp-tm-icon-cog">SAFETY</a></li><br />
</ul><br />
</li><br />
<li ><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Team">TEAM</a><br />
<ul class="cbp-tm-submenu"><br />
<li><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_Members" class="cbp-tm-icon-archive">TEAM MEMBERS</a></li><br />
<li><a href="https://igem.org/Team:SJTU-BioX-Shanghai.cgi" class="cbp-tm-icon-cog">RROFILE</a></li><br />
<li><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Attributions" class="cbp-tm-icon-link">ATTRIBUTIONS</a></li><br />
</ul><br />
</li><br />
</ul><br />
</nav><br />
</div><br />
</header><br />
<div style="clear:both;"></div><br />
</div><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/index.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/component.css?action=raw&ctype=text/css"><br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/jquery-1.11.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/untitled.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/modernizr.custom.js?action=raw&ctype=text/javascript"></script><br />
<br />
<script type="text/javascript"><br />
<br />
var aa = $(window).width();<br />
var bb = document.getElementsByTagName("header")[0];<br />
var cc = document.getElementById("wrap");<br />
<br />
$(document).scroll(function(){<br />
var ee = cc.getBoundingClientRect().top;<br />
if(ee < 0){<br />
cc.setAttribute("class","sticky");<br />
bb.setAttribute("class","sticky");<br />
} else {<br />
cc.setAttribute("class","");<br />
bb.setAttribute("class","");<br />
}<br />
});<br />
<br />
var menu = new cbpTooltipMenu(document.getElementById('cbp-tm-menu'));<br />
</script><br />
<br />
</html></div>Yaanhttp://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/top-navTemplate:Team:SJTU-BioX-Shanghai/top-nav2014-10-16T17:31:55Z<p>Yaan: </p>
<hr />
<div><html><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:600italic,400|Ultra' rel='stylesheet' type='text/css'><br />
<div style="clear:both;"></div> <br />
<br />
<div id="wrap"><br />
<header role="banner"><br />
<div class="flex"><br />
<h1><a href="#top" class="site-title ir">HOME</a></h1><br />
<nav role="navigation"><br />
<ul id="cbp-tm-menu" class="cbp-tm-menu"><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Project">PROJECT</a><br />
<ul class="cbp-tm-submenu"><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Project" class="cbp-tm-icon-archive">OVERVIEW</a></li><br />
<!--<li><a href="/Team:SJTU-BioX-Shanghai/Background" class="cbp-tm-icon-cog">BACKGROUND</a></li>--><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Part1_Connect" class="cbp-tm-icon-cog">1. CONNECT</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension" class="cbp-tm-icon-cog">2. EXTENTION</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" class="cbp-tm-icon-cog">3. TAL IMPROV.</a></li><br />
</ul><br />
</li><br />
<li ><a href="/Team:SJTU-BioX-Shanghai/Achievement">ACHIEVEMENT</a><br />
<ul class="cbp-tm-submenu"><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Results" class="cbp-tm-icon-screen">RESULTS</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Modeling" class="cbp-tm-icon-mail">MODELING</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Parts" class="cbp-tm-icon-contract">PARTS</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Judging_Form" class="cbp-tm-icon-pencil">JUDGING FORM</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Human_Parctice" class="cbp-tm-icon-article">HUMAN PRACTICE</a></li><br />
</ul><br />
</li><br />
<li ><a href="/Team:SJTU-BioX-Shanghai/Notebook">NOTEBOOK</a><br />
<ul class="cbp-tm-submenu"><br />
<li><a href="/Team:SJTU-BioX-Shanghai/daynotes" class="cbp-tm-icon-archive">NOTES & PROTOCOL</a></li><br />
<li><a href="/Team:SJTU-BioX-Shanghai/Safety" class="cbp-tm-icon-cog">SAFETY</a></li><br />
</ul><br />
</li><br />
<li ><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Team">TEAM</a><br />
<ul class="cbp-tm-submenu"><br />
<li><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Team_Members" class="cbp-tm-icon-archive">TEAM MEMBERS</a></li><br />
<li><a href="https://igem.org/Team:SJTU-BioX-Shanghai.cgi" class="cbp-tm-icon-cog">RROFILE</a></li><br />
<li><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Attributions" class="cbp-tm-icon-link">ATTRIBUTIONS</a></li><br />
</ul><br />
</li><br />
</ul><br />
</nav><br />
</div><br />
</header><br />
<div style="clear:both;"></div><br />
</div><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/index.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/component.css?action=raw&ctype=text/css"><br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/jquery-1.11.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/untitled2.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/modernizr.custom.js?action=raw&ctype=text/javascript"></script><br />
<br />
<script type="text/javascript"><br />
<br />
var aa = $(window).width();<br />
var bb = document.getElementsByTagName("header")[0];<br />
var cc = document.getElementById("wrap");<br />
<br />
$(document).scroll(function(){<br />
var ee = cc.getBoundingClientRect().top;<br />
if(ee < 0){<br />
cc.setAttribute("class","sticky");<br />
bb.setAttribute("class","sticky");<br />
} else {<br />
cc.setAttribute("class","");<br />
bb.setAttribute("class","");<br />
}<br />
});<br />
<br />
var menu = new cbpTooltipMenu(document.getElementById('cbp-tm-menu'));<br />
</script><br />
<br />
</html></div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part2_ExtensionTeam:SJTU-BioX-Shanghai/Part2 Extension2014-10-16T17:10:10Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/5/54/SJTU14_Maxmize.png");}<br />
#alignright{border:0;}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown">More than One Jewel on the Crown</h2><br />
<br />
<h2 id="alignright" align="right">——Polymerization and Maximization</h2><br />
<br />
<!--<p><strong>The ''Crown''</strong></p>--><br />
<p>This Crown will help us achieve the goal of selective polymerization of enzymes. Polymerized enzymes, different from normal scattered condition, has much more opportunities to contact with the substrates. Therefore, our project aims to increase as well as to control the efficiency of complex reactions. We'll build a framework that make multi-enzyme complex easy to form, which we call a Crown.</p><br />
<br />
<p>And based on the success of the individual fusion protein (The first jewel) expression, we tried to add more jewels on the Crown. (fig.1)</p><br />
<br />
<p>In order to build a polymerase system, we make more fusion proteins bind to the same Connector. Then by adding enzymes, it has the practical effect of accelerating the reactions and enhancing efficiency of the production. So far, the Crown is built with more than one jewel shining on it.</p><br />
<br />
<br/><br />
<br />
<h2>Selective Polymerization</h2><br />
<br />
<p>Our fused protein can not only be used to polymerize enzymes but also to control selective combinations. As the pathway showed in the picture, we can get different product by combining E1 and E2 together or combining E1 and E3 together. Therefore, we can control the direction of pathway by simply transforming different Connectee plasmid. </p><br />
<br />
<p>All the three enzymes involves are expressed in the bacteria. Each of fused protein contain ssDsbA,Lgt,FL3,enzyme,HL and TAL while the TAL part can recognize three different sites. We design two Connectee plasmids. Connectee1 has TAL recognition sites for E1 and E2 and Connectee2 has recognition sites for E1 and E3. By transforming P1 only into the bacteria, the fused proteins containing E1 and E2 will bind to the plasmid, thus produce S3 efficiently. Analogously, by transforming P2 into the bacteria, we can expect to get higher yield of product S4.</p><br />
<br />
<br />
<br />
<h2>How to be a Craftsmen</h2><br />
<br />
<p>A compact machine requires bold ideas and careful practicing. Here comes how we built our Crown.</p><br />
<br />
<h3>Construction Method:</h3><br />
<br />
<p>Above all, we use 3sets of Connector 1 to build polymerization system. There are four main parts in a Connector 1 for testing.</p><br />
<br />
<p>ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli .</p><br />
<br />
<p>FP: To visualize the localization of fusion protein with fluorescence test , we added FP in the Connectee 1 and placed it just after the ssDsbA. We chose mRFP,CFP,YFP in our system.</p><br />
<br />
<p>Lgt: Phosphatidylglycerol prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.</p><br />
<br />
<p>TAL effectors:As mentioned earlier,we choose three kinds of combinations to build three different TAL proteins, which is based on the parts that the team of Freiburg offered in 2012. These three TAL proteins can identify three different 14bp nucleotide sequences on a Connector. Note that we added a His Tag at the end of TAL protein to facilitate separation and purification.</p><br />
<br />
<p>For the three kinds of corresponding Connectoe 2, we did not introduced ssDsbA-Lgt section to keep them in a free intracellular state.</p><br />
<br />
<p>In the final production of our construction, we add an easy-to-hand interface sequence between the Lgt and TAL protein in Connector 1 or just before the TAL protein in Connector 2, as sites to adding enzymes.</p><br />
<br />
<h3>Co-Transformation & Induced expression:</h3><br />
<br />
<p>Expression vectors used in the project for membrane protein expression are modified versions of pRSFDuet-1, pETDuet-1,pACYCDuet-1(NOVAGEN), which are originally regulated by T7 promoter. These plasmids can coexist in one cell.</p><br />
<br />
<p>The Connector is pBluescript II KS(+) .</p><br />
<br />
<p>We used the four reformed plasmids to co-transform and induced the Connectors to express. Now the structure of the crown appears in the E. coli cell membrane or cytoplasm.</p><br />
<br />
<br />
<h2>Test methods</h2><br />
<br />
<p>We use formaldehyde to stabilize the connected fusion proteins and Connector, then separate the proteins-Connector complexes and digest the protein. Finally use PCR to detect the three sequences of the Connector which TAL proteins are designed to bind to.</p><br />
<br />
<p>Then, we can test the yield of different product to determine the efficiency of selective combination.</p><br />
<br />
<br />
<br />
<h2>What’s more ?</h2><br />
<br />
<p>We are trying to put more enzymes into the polymerization system, which makes the Crown more practical and brilliant. (fig.3) And with more enzymes on the Crown, there will be more possible choices for selective combination.</p><br />
<br />
<br />
<h2>Reference: </h2><br />
<ol><br />
<li>Pailler, Jérémy, et al. "Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane." Journal of bacteriology 194.9 (2012): 2142-2151.</li><br />
<br />
<li>Schierle, Clark F., et al. "The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway." Journal of bacteriology 185.19 (2003): 5706-5713.</li><br />
<br />
<li>Katsuyama, Tomonori, et al. "An efficient strategy for TALEN-mediated genome engineering in Drosophila." Nucleic acids research 41.17 (2013): e163-e163.</li><br />
<br />
<li>Bogdanove, Adam J., Sebastian Schornack, and Thomas Lahaye. "TAL effectors: finding plant genes for disease and defense." Current opinion in plant biology 13.4 (2010): 394-401.</li><br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part2_ExtensionTeam:SJTU-BioX-Shanghai/Part2 Extension2014-10-16T17:08:59Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/5/54/SJTU14_Maxmize.png");}<br />
#alignright{border:0;}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown">More than One Jewel on the Crown</h2><br />
<br />
<h2 id="alignright" align="right">——Polymerization and Maximization</h2><br />
<br />
<p><strong>The ''Crown''</strong></p><br />
<p>This Crown will help us achieve the goal of selective polymerization of enzymes. Polymerized enzymes, different from normal scattered condition, has much more opportunities to contact with the substrates. Therefore, our project aims to increase as well as to control the efficiency of complex reactions. We'll build a framework that make multi-enzyme complex easy to form, which we call a Crown.</p><br />
<br />
<p>And based on the success of the individual fusion protein (The first jewel) expression, we tried to add more jewels on the Crown. (fig.1)</p><br />
<br />
<p>In order to build a polymerase system, we make more fusion proteins bind to the same Connector. Then by adding enzymes, it has the practical effect of accelerating the reactions and enhancing efficiency of the production. So far, the Crown is built with more than one jewel shining on it.</p><br />
<br />
<br/><br />
<br />
<h2>Selective Polymerization</h2><br />
<br />
<p>Our fused protein can not only be used to polymerize enzymes but also to control selective combinations. As the pathway showed in the picture, we can get different product by combining E1 and E2 together or combining E1 and E3 together. Therefore, we can control the direction of pathway by simply transforming different Connectee plasmid. </p><br />
<br />
<p>All the three enzymes involves are expressed in the bacteria. Each of fused protein contain ssDsbA,Lgt,FL3,enzyme,HL and TAL while the TAL part can recognize three different sites. We design two Connectee plasmids. Connectee1 has TAL recognition sites for E1 and E2 and Connectee2 has recognition sites for E1 and E3. By transforming P1 only into the bacteria, the fused proteins containing E1 and E2 will bind to the plasmid, thus produce S3 efficiently. Analogously, by transforming P2 into the bacteria, we can expect to get higher yield of product S4.</p><br />
<br />
<br />
<br />
<h2>How to be a Craftsmen</h2><br />
<br />
<p>A compact machine requires bold ideas and careful practicing. Here comes how we built our Crown.</p><br />
<br />
<h3>Construction Method:</h3><br />
<br />
<p>Above all, we use 3sets of Connector 1 to build polymerization system. There are four main parts in a Connector 1 for testing.</p><br />
<br />
<p>ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli .</p><br />
<br />
<p>FP: To visualize the localization of fusion protein with fluorescence test , we added FP in the Connectee 1 and placed it just after the ssDsbA. We chose mRFP,CFP,YFP in our system.</p><br />
<br />
<p>Lgt: Phosphatidylglycerol prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.</p><br />
<br />
<p>TAL effectors:As mentioned earlier,we choose three kinds of combinations to build three different TAL proteins, which is based on the parts that the team of Freiburg offered in 2012. These three TAL proteins can identify three different 14bp nucleotide sequences on a Connector. Note that we added a His Tag at the end of TAL protein to facilitate separation and purification.</p><br />
<br />
<p>For the three kinds of corresponding Connectoe 2, we did not introduced ssDsbA-Lgt section to keep them in a free intracellular state.</p><br />
<br />
<p>In the final production of our construction, we add an easy-to-hand interface sequence between the Lgt and TAL protein in Connector 1 or just before the TAL protein in Connector 2, as sites to adding enzymes.</p><br />
<br />
<h3>Co-Transformation & Induced expression:</h3><br />
<br />
<p>Expression vectors used in the project for membrane protein expression are modified versions of pRSFDuet-1, pETDuet-1,pACYCDuet-1(NOVAGEN), which are originally regulated by T7 promoter. These plasmids can coexist in one cell.</p><br />
<br />
<p>The Connector is pBluescript II KS(+) .</p><br />
<br />
<p>We used the four reformed plasmids to co-transform and induced the Connectors to express. Now the structure of the crown appears in the E. coli cell membrane or cytoplasm.</p><br />
<br />
<br />
<h2>Test methods</h2><br />
<br />
<p>We use formaldehyde to stabilize the connected fusion proteins and Connector, then separate the proteins-Connector complexes and digest the protein. Finally use PCR to detect the three sequences of the Connector which TAL proteins are designed to bind to.</p><br />
<br />
<p>Then, we can test the yield of different product to determine the efficiency of selective combination.</p><br />
<br />
<br />
<br />
<h2>What’s more ?</h2><br />
<br />
<p>We are trying to put more enzymes into the polymerization system, which makes the Crown more practical and brilliant. (fig.3) And with more enzymes on the Crown, there will be more possible choices for selective combination.</p><br />
<br />
<br />
<h2>Reference: </h2><br />
<ol><br />
<li>Pailler, Jérémy, et al. "Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane." Journal of bacteriology 194.9 (2012): 2142-2151.</li><br />
<br />
<li>Schierle, Clark F., et al. "The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway." Journal of bacteriology 185.19 (2003): 5706-5713.</li><br />
<br />
<li>Katsuyama, Tomonori, et al. "An efficient strategy for TALEN-mediated genome engineering in Drosophila." Nucleic acids research 41.17 (2013): e163-e163.</li><br />
<br />
<li>Bogdanove, Adam J., Sebastian Schornack, and Thomas Lahaye. "TAL effectors: finding plant genes for disease and defense." Current opinion in plant biology 13.4 (2010): 394-401.</li><br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaanhttp://2014.igem.org/Team:SJTU-BioX-Shanghai/Part2_ExtensionTeam:SJTU-BioX-Shanghai/Part2 Extension2014-10-16T17:08:25Z<p>Yaan: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("https://static.igem.org/mediawiki/2014/5/54/SJTU14_Maxmize.png");}<br />
#alignright{border:0;}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2 id="morethanonejewelonthecrown">More than One Jewel on the Crown</h2><br />
<br />
<h2 id="alignright" align="right">——Polymerization and Maximization</h2><br />
<br />
<p><strong>The ''Crown''</strong></p><br />
<p>This Crown will help us achieve the goal of selective polymerization of enzymes. Polymerized enzymes, different from normal scattered condition, has much more opportunities to contact with the substrates. Therefore, our project aims to increase as well as to control the efficiency of complex reactions. We'll build a framework that make multi-enzyme complex easy to form, which we call a Crown.</p><br />
<br />
<p>And based on the success of the individual fusion protein (The first jewel) expression, we tried to add more jewels on the Crown. (fig.1)</p><br />
<br />
<p>In order to build a polymerase system, we make more fusion proteins bind to the same Connector. Then by adding enzymes, it has the practical effect of accelerating the reactions and enhancing efficiency of the production. So far, the Crown is built with more than one jewel shining on it.</p><br />
<br />
<br/><br />
<br />
<h2>Selective Polymerization</h2><br />
<br />
<p>Our fused protein can not only be used to polymerize enzymes but also to control selective combinations. As the pathway showed in the picture, we can get different product by combining E1 and E2 together or combining E1 and E3 together. Therefore, we can control the direction of pathway by simply transforming different Connectee plasmid. </p><br />
<br />
<p>All the three enzymes involves are expressed in the bacteria. Each of fused protein contain ssDsbA,Lgt,FL3,enzyme,HL and TAL while the TAL part can recognize three different sites. We design two Connectee plasmids. Connectee1 has TAL recognition sites for E1 and E2 and Connectee2 has recognition sites for E1 and E3. By transforming P1 only into the bacteria, the fused proteins containing E1 and E2 will bind to the plasmid, thus produce S3 efficiently. Analogously, by transforming P2 into the bacteria, we can expect to get higher yield of product S4.</p><br />
<br />
<br />
<br />
<h2>How to be a Craftsmen</h2><br />
<br />
<p>A compact machine requires bold ideas and careful practicing. Here comes how we built our Crown.</p><br />
<br />
<h3>Construction Method</h3><br />
<br />
<p>Above all, we use 3sets of Connector 1 to build polymerization system. There are four main parts in a Connector 1 for testing.</p><br />
<br />
<p>ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli .</p><br />
<br />
<p>FP: To visualize the localization of fusion protein with fluorescence test , we added FP in the Connectee 1 and placed it just after the ssDsbA. We chose mRFP,CFP,YFP in our system.</p><br />
<br />
<p>Lgt: Phosphatidylglycerol prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.</p><br />
<br />
<p>TAL effectors:As mentioned earlier,we choose three kinds of combinations to build three different TAL proteins, which is based on the parts that the team of Freiburg offered in 2012. These three TAL proteins can identify three different 14bp nucleotide sequences on a Connector. Note that we added a His Tag at the end of TAL protein to facilitate separation and purification.</p><br />
<br />
<p>For the three kinds of corresponding Connectoe 2, we did not introduced ssDsbA-Lgt section to keep them in a free intracellular state.</p><br />
<br />
<p>In the final production of our construction, we add an easy-to-hand interface sequence between the Lgt and TAL protein in Connector 1 or just before the TAL protein in Connector 2, as sites to adding enzymes.</p><br />
<br />
<h3>Co-Transformation & Induced expression</h3><br />
<br />
<p>Expression vectors used in the project for membrane protein expression are modified versions of pRSFDuet-1, pETDuet-1,pACYCDuet-1(NOVAGEN), which are originally regulated by T7 promoter. These plasmids can coexist in one cell.</p><br />
<br />
<p>The Connector is pBluescript II KS(+) .</p><br />
<br />
<p>We used the four reformed plasmids to co-transform and induced the Connectors to express. Now the structure of the crown appears in the E. coli cell membrane or cytoplasm.</p><br />
<br />
<br />
<h2>Test methods</h2><br />
<br />
<p>We use formaldehyde to stabilize the connected fusion proteins and Connector, then separate the proteins-Connector complexes and digest the protein. Finally use PCR to detect the three sequences of the Connector which TAL proteins are designed to bind to.</p><br />
<br />
<p>Then, we can test the yield of different product to determine the efficiency of selective combination.</p><br />
<br />
<br />
<br />
<h2>What’s more ?</h2><br />
<br />
<p>We are trying to put more enzymes into the polymerization system, which makes the Crown more practical and brilliant. (fig.3) And with more enzymes on the Crown, there will be more possible choices for selective combination.</p><br />
<br />
<br />
<h2>Reference: </h2><br />
<ol><br />
<li>Pailler, Jérémy, et al. "Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) of Escherichia coli has seven transmembrane segments, and its essential residues are embedded in the membrane." Journal of bacteriology 194.9 (2012): 2142-2151.</li><br />
<br />
<li>Schierle, Clark F., et al. "The DsbA signal sequence directs efficient, cotranslational export of passenger proteins to the Escherichia coli periplasm via the signal recognition particle pathway." Journal of bacteriology 185.19 (2003): 5706-5713.</li><br />
<br />
<li>Katsuyama, Tomonori, et al. "An efficient strategy for TALEN-mediated genome engineering in Drosophila." Nucleic acids research 41.17 (2013): e163-e163.</li><br />
<br />
<li>Bogdanove, Adam J., Sebastian Schornack, and Thomas Lahaye. "TAL effectors: finding plant genes for disease and defense." Current opinion in plant biology 13.4 (2010): 394-401.</li><br />
</article><br />
</div></html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Yaan