http://2014.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=Bunnech&year=&month=2014.igem.org - User contributions [en]2024-03-29T07:15:13ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/Team:Heidelberg/ProjectTeam:Heidelberg/Project2015-01-21T18:36:41Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/MainTemplate|unresponsive=}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstrapcss}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstraptheme}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/overrides}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/jquery}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/bootstrapjs}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/wikipage}}<br />
<html><br />
<style type="text/css"><br />
#myContainer {<br />
padding:0;<br />
background-color: black;<br />
background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg);<br />
background-repeat: no-repeat;<br />
background-size: 100% auto;<br />
}<br />
<br />
#light:hover {<br />
color: #FF7E25;<br />
}<br />
<br />
.main {<br />
margin-top: 25px;<br />
}<br />
<br />
.middle {<br />
font-size: 3em;<br />
}<br />
<br />
.large {<br />
font-size: 5em;<br />
font-weight: bold;<br />
}<br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icon-scale:hover {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icon-scale {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.ringbox{<br />
/*<br />
width: 750px;<br />
height: 600px;<br />
background-image:url('/wiki/images/d/dc/Ring_Project.png');<br />
background-size: 550px;<br />
background-repeat: no-repeat;<br />
*/<br />
position: absolute;<br />
top:260px;<br />
left:140px;<br />
height:640px;<br />
z-index:3;<br />
}<br />
<br />
.abstract-special {<br />
color: white;<br />
}<br />
<br />
.abstract-special span {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
display: block;<br />
}<br />
<br />
.abstract-special img {<br />
height: 15px;<br />
}<br />
<br />
.toolbox-icon {<br />
height: 90px;<br />
position: absolute;<br />
right:-43px;<br />
bottom:-45px;<br />
}<br />
<br />
#ring-background {<br />
width: 450px;<br />
height: auto;<br />
opacity:0.8;<br />
}<br />
<br />
.block{<br />
display:block;<br />
text-decoration:none;<br />
color: white;<br />
}<br />
<br />
.block:hover{<br />
text-decoration: none;<br />
}<br />
<br />
.box {<br />
background-color: rgba(81,81,81,0.7);<br />
padding: 15px;<br />
position:relative;<br />
}<br />
<br />
.box:hover {<br />
border:solid 2px #DE4230;<br />
padding: 13px;<br />
}<br />
<br />
<br />
.descr-box {<br />
width: 250px;<br />
height: 100px;<br />
position: absolute;<br />
}<br />
<br />
.descr-box h3 {<br />
margin-top: 10px;<br />
margin-bottom: 0;<br />
text-align: left;<br />
}<br />
<br />
.descr-box h3 span {<br />
font-size: 0.8em;<br />
}<br />
<br />
.descr-box div {<br />
border-right: solid white 2px;<br />
border-top: solid white 2px;<br />
padding-right:43px;<br />
}<br />
<br />
.descr-box span {<br />
display: block;<br />
}<br />
<br />
#circ-box {<br />
right: 160px;<br />
top: -120px;<br />
}<br />
<br />
#circ-box img {<br />
bottom: -130px;<br />
height: 120px;<br />
right: -57px;<br />
}<br />
<br />
#circ-box div {<br />
height: 114px;<br />
}<br />
<br />
#oligo-box {<br />
left: -100px;<br />
top: -10px;<br />
width: 200px;<br />
}<br />
<br />
#onoff-box {<br />
left: -105px;<br />
top: 120px;<br />
width: 150px;<br />
}<br />
<br />
#fusion-box {<br />
left: -100px;<br />
top: 330px;<br />
width: 190px;<br />
}<br />
<br />
#fusion-box img {<br />
top: -16px;<br />
}<br />
<br />
#fusion-box div {<br />
border-right: none;<br />
}<br />
<br />
#purification-box {<br />
left: 20px;<br />
top: 445px;<br />
width: 200px;<br />
}<br />
<br />
#purification-box img {<br />
top: -70px;<br />
}<br />
<br />
#purification-box div {<br />
border-top: none;<br />
border-bottom: solid white 2px;<br />
}<br />
<br />
#abstract-content {<br />
display:none;<br />
}<br />
<br />
.graphicalAbstract {<br />
background-image:url('/wiki/images/f/fa/Heidelberg_Project_Background.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
position:relative;<br />
z-index: 1;<br />
height:900px;<br />
}<br />
<br />
#redOverlay {<br />
position:absolute;<br />
width:100%;<br />
height:100%;<br />
left:0;<br />
top:0;<br />
display:none;<br />
background-image:url('/wiki/images/5/51/Heidelberg_project_red_overlay.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
z-index:2;<br />
}<br />
<br />
#lightning {<br />
z-index: 3;<br />
position:absolute;<br />
top: 610px;<br />
left: 460px;<br />
color:white;<br />
}<br />
<br />
<br />
#screened {<br />
z-index: 3;<br />
position:absolute;<br />
left: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#calibrated {<br />
z-index: 3;<br />
position:absolute;<br />
right: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#dnmt1-img {<br />
position: absolute;<br />
height: 155px;<br />
right: 15px;<br />
z-index:4;<br />
}<br />
<br />
a:hover #dnmt1-img {<br />
right: 13px;<br />
}<br />
<br />
#dnmt1-box {<br />
right: 40px;<br />
top: 340px;<br />
position: absolute;<br />
}<br />
<br />
#xylanase-box {<br />
width:250px;<br />
top: 556px;<br />
right:40px;<br />
position:absolute;<br />
}<br />
<br />
#xylanase-img {<br />
height: 140px;<br />
position: absolute;<br />
right: 15px;<br />
}<br />
<br />
a:hover #xylanase-img {<br />
right: 13px;<br />
}<br />
<br />
#toolbox-text{<br />
position: absolute;<br />
top: 145px;<br />
right: -135px;<br />
font-size: 5em;<br />
line-height: 70px;<br />
font-weight: bold;<br />
}<br />
<br />
#linker-links {<br />
position: absolute;<br />
width: 405px;<br />
right: 60px;<br />
top: 35px;<br />
height: 300px;<br />
}<br />
<br />
#toolbox {<br />
position:absolute;<br />
right: 50px;<br />
bottom: 190px;<br />
}<br />
<br />
#toolbox:hover > span {<br />
color: white;<br />
}<br />
<br />
.container {<br />
width: 1170px;<br />
}<br />
<br />
.scheisslinkbleibweiss {<br />
color: white;<br />
}<br />
<br />
.scheisslinkbleibweiss:hover {<br />
color: white;<br />
}<br />
<br />
div.margin-top { margin-top: 100px; }<br />
<br />
img.medal {<br />
height:200px;<br />
margin-top: 40px;<br />
text-align: center;<br />
}<br />
<br />
.center {<br />
text-align:center;<br />
}<br />
<br />
.linie {<br />
margin:20px 40px;<br />
border: solid 1px black;<br />
}<br />
<br />
.vcenter-table{<br />
display: table;<br />
}<br />
<br />
.vcenter-cell {<br />
display: table-cell;<br />
vertical-align: middle;<br />
float: none;<br />
}<br />
<br />
</style><br />
<div id="myContainer" class="container"><br />
</html><br />
{{:Team:Heidelberg/Templates/BootstrapNav|<br />
red=|<br />
white=true|<br />
red-logo=true|<br />
white-logo=|<br />
header-bg=|<br />
header-img=|<br />
title=<br />
}}<br />
<html><br />
<div class="container main" style="color: white;"><br />
<div id="abstract-dropdown" class="row abstract-special dark-grey"><br />
<div class="col-lg-offset-1 col-lg-11"><br />
<h4><img id="dropdownImg" src="/wiki/images/7/70/Heidelberg_Abstract-dropdown.png"/>&nbsp;Project overview</h4><br />
</div><br />
<!--<div class="col-lg-9"><br />
<span>Click to read the project overview</span><br />
</div>--><br />
<div id="abstract-content" class="col-lg-12" ><br />
<p>Proteins are the functional basis of all biological processes and being able to control and improve their functions through design and engineering is one of the fundamental goals of Synthetic Biology. Protein splicing, a process in which a catalytically active internal polypeptide termed INTEIN excises itself from a precursor protein, has been used by our team to alter the functionalities of proteins in various ways post-translationally. <br />
<br></br><br />
We have developed a comprehensive <a href="/Team:Heidelberg/Project/Toolbox">toolbox</a> compromising five sets of <a href="/Team:Heidelberg/Parts">standardized parts</a> that provide standard mechanisms for specific modifications of proteins: <br />
(1) A <a href="/Team:Heidelberg/Project/Toolbox#Purification">purification</a> standard to faciliate purification of recombinant proteins. <br />
(2) A construct that allows for post-translational <a href="/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging">fusion</a> of protein domains to produce synthetic proteins<br />
(3) A standard that allows for switching proteins <a href="/Team:Heidelberg/Project/Toolbox#On_Off">on and off</a>.<br />
(4) One to <a href="/Team:Heidelberg/Project/Toolbox#Oligomerization">oligomerize</a> protein monomers.<br />
And (5) perhaps the most intriguing standard construct of this toolbox that was built to produce heat stable proteins, which can be achieved by <a href="/Team:Heidelberg/Toolbox/Circularization">circularization</a>.<br />
In order to offer a comfortable way to apply any of the above mechanisms to a protein and a biological system we designed a <a href="/Team:Heidelberg/Toolbox_Guide">toolbox guide</a> that provides step by step instructions for cloning based on the intein standard parts described in our <a href="/Team:Heidelberg/Parts/RFC">RFC</a>.<br />
<br></br><br />
Besides achieving a solid and broad foundation for future intein applications in synthetic biology, we aimed on deeply exploring one of the functions provided in our toolbox: circularization of proteins. In head to tail circularized peptides the terminal amino acids are joined together just like in the rest of the chain, forming a circular structure. Such peptides have been discovered in all kingdoms of life during the past years and they are unified by an extreme stability towards high temperatures, proteases and changes in pH.<br />
Synthetically connecting a protein's termini without disrupting its 3D structure and function is, however, a delicate task which has so far been accomplished only for relatively small proteins whose ends lie close to each other. With <a href="/Team:Heidelberg/Modeling/Linker_Modeling">CRAUT</a> we have brought into existence a powerful open-source software to predict an optimal rigid linker to support stabilizing circularization of a protein preserving its 3D structure and function. <br />
In order to provide us - and future iGEM teams - with a standard way to conduct the needed consuming modelling calculations we deployed a distributed computing platform we call <a href="/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a> that we also developed into a powerful science communication platform.<br />
As an evaluation of the linker software we screened linkers generated by the software by circularizing <a href="/Team:Heidelberg/Project/Linker_Screening">Lambda Lysozyme</a> and experimentally evaluating the heat stability of the products.<br />
<br></br><br />
Based on the calibrated software, we constructed linkers to circularize the 871 a.a. long <a href="/Team:Heidelberg/Project/PCR2.0">methyltransferase Dnmt1</a> and provide data suggesting that circular DNMT1 is more functional than its linear counterpart at high temperatures. Our results have strong implications for developing an innovative PCR-based technique that could revolutionize epigenetic studies and cancer research by maintaining the methylation pattern of the DNA template during amplification.<br />
Besides a protein with potential medical (lysozyme) and one with biotechnological (DNMT1) applications we chose the hemicellulose <a href="/Team:Heidelberg/Project/Xylanase">Xylanase</a> as a third target for circularization, that has applications in large scale production in paper and food industry.<br />
<br></br><br />
As an additional feature we decided to add another dimension to intein mediated modifications of our toolbox by developing optically induced small inteins that are photocaged by an <a href=”/Team:Heidelberg/Project/LOV”>As LOV2</a> domain. While sterically hampering intein dimerization in the dark, the LOV domain opens up when exposed to blue light, releasing the intein to proceed the splicing reaction.<br />
<br></br><br />
Setting new standards also for wiki documentation we created and developed a new way of documenting collaborative lab work by bringing the <a href="/Team:Heidelberg/Notebook">MidnightDoc</a> to life.<br />
<br></br><br />
Finally we complemented our already elaborate <a href="/Team:Heidelberg/Human_Practice">Human Practice</a> activities with two events on education and religion, philosophy and ethics in synthetic biology.<br />
<br />
<br />
<br />
</p><br />
</div><br />
</div><br />
<div class="graphicalAbstract"><br />
<div id="redOverlay"></div><br />
<div style="z-index:3;position:relative; height:100%;"><br />
<div id="linker-links"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome" class="block box" id="calibrated"><br />
<img style="height:60px;display: inline-block;" src="/wiki/images/e/ea/Heidelberg_Project_Computer.png"><br />
<span style="position: relative;top: 10px;display: inline-block;"><br />
calibrated<br><br />
<span class="red-text">in silico</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Linker_Screening" class="block box" id="screened"><br />
<span style="position: relative;top:10px;display: inline-block;"><br />
screened <span class="red-text">in vitro</span><br><br />
with lysozyme</span><br />
<img style="height:60px; display:inline-block;" src="/wiki/images/d/df/Heidelberg_Lysozyme.png" /><br />
</a><br />
<a href="/Team:Heidelberg/Software/Linker_Software" class="block box" style="bottom:0; left:-20px; position:absolute;width:170px;"><br />
<img src="/wiki/images/4/42/Craut_small.png" alt="..." style="width:100%;"/><br />
<span class="red-text" >circularize</span> it<br><br />
with calculated linkers<br />
</a><br />
</div><br />
<div class="ringbox"><br />
<img src="/wiki/images/0/0d/Heidelberg_Firering_red.png" id="ring-background" /><br />
<div id="circ-box" class="descr-box"><br />
<a href="/Team:Heidelberg/Toolbox/Circularization"><br />
<img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" id="circ-icon" class="toolbox-icon toolbox-icon-scale"/><br />
</a><br />
<h3>CIRCULARIZATION</h3><br />
<div><span>Create a linker with our crowd computing software and make your protein heat stable</span></div><br />
</div><br />
<div id="oligo-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><img src="/wiki/images/4/40/Oligomerization.png" id="oligo-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>OLIGOMERIZATION</h3><div><span>Fuse multiple Proteins or Domains using Inteins</span></div><br />
</div><br />
<div id="fusion-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" id="fusion-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>FUSION</h3><div><span>Fuse two Proteins or Domains together using Inteins</span></div><br />
</div><br />
<div id="onoff-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" id="onoff-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>ON/OFF</h3><div><span>Activate or deactivate Proteins using Inteins</span></div></div><br />
<div id="purification-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" id="purification-icon" class="toolbox-icon toolbox-icon-scale"/></a><div><h3>PURIFICATION</h3></div><span>Purify your protein using inteins.</span></div><br />
<div id="toolbox-text"><br />
the intein<br><br />
<span><a class="scheisslinkbleibweiss" href="/Team:Heidelberg/Project/Toolbox">toolbox</a><span><br />
</div><br />
</div><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Induction" class="block" id="lightning"><br />
<img class="toolbox-icon-scale" style="height:110px;display: inline-block;" src="/wiki/images/8/83/Heidelberg_Project_Lightning.png"><span style="position: relative;top: 20px;display: inline-block;">&nbsp;inducible via<br><br />
<span style="font-weight:bold;position: relative;left: -18px;" class="red-text">light induction</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/PCR_2.0" class="block box" style="width:250px;" id="dnmt1-box"><br />
<img id="dnmt1-img" src="/wiki/images/a/a6/Heidelberg_Project_Dnmt1.png"><br />
<span style="position:relative; z-index:5;" class="block"><br />
<span style="font-size:1.5em;"><br />
<span class="red-text">Heat-stable</span><br> circular <br><span style="font-weight:bold;">DNA-<br/>Methyltransferase</span><br />
</span><br><br />
<span style="font-weight:bold;font-size: 2.5em; text-align:right;line-height: 35px;"><br />
<span class="red-text">PCR 2.0</span><br />
</span><br />
</span><br />
</a><br />
<a href="/Team:Heidelberg/Toolbox_Guide" class="block" id="toolbox"><br />
<span style="position:relative; display: inline-block;height:110px; width:110px; vertical-align: middle;"><br />
<img style="height:100%; position:absolute; top:0; left:0;" id="toolbox-img" src="/wiki/images/2/24/Heidelberg_Project_Toolbox_guide.png" /><br />
<img style="height:100%; position:absolute; top:0; left:0; display:none;" id="toolbox-img-hover" src="/wiki/images/4/4c/Heidelberg_Toolbox_guide_highlighted.png" /><br />
</span><br />
<span style="position: relative;top: 20px;display: inline-block; vertical-align:middle;"><br />
<span style="font-weight:bold;" class="red-text">modify your protein</span><br/><br />
using the toolbox guide<br />
</span><br />
</a><br />
<div class="clearfix"></div><br />
</div><br />
</div><br />
</div><br />
<div class="container" id="Achievements"><br />
<ul class="nav nav-tabs" role="tablist"><br />
<li class="active" style="font-size:30px"><a href="#Achievements-tab" role="tab" data-toggle="tab"><img src="https://static.igem.org/mediawiki/2014/2/22/Heidelberg_Achievements_red.png" height="50px" alt="Button"> Achievements</a></li><br />
<li style="font-size:30px"><a href="#Medal_Criteria-tab" role="tab" data-toggle="tab"> <img src="https://static.igem.org/mediawiki/2014/3/3f/Heidelberg_Gold_red.png" height="50px" alt="Button"> Medal Criteria</a></li><br />
</ul><br />
<div class="tab-content"><br />
<div class="tab-pane fade in active" style="background-color:white; color:black;" id="Achievements-tab"><br />
<br />
<div class="row" style="margin-top: 20px; background-color:white"><br />
</div><br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Achievements_3.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establishing protein circularization as a NEW BIOENGINEERING TOOL in synthetic biology.</p> <br />
<p style="margin-left:50px; font-size:20px">Contributing to iGEM with a new foundational advance!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/Achievement_1.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Providing a NEW COMPREHENSIVE TOOLBOX based on inteins for modifying proteins post-translationally.</p> <br />
<p style="margin-left:50px; font-size:20px">Sending 67 Biobricks to Registry of Biological parts!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Achievement_2.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Development of a NEW STANDARD to make the use of inteins easy and modular.</p> <br />
<p style="margin-left:50px; font-size:20px">Establishment of a new <a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC">RFC</a>!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/1b/Achievements_toolbox.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Showing that the toolbox WORKS: proteins are circularized and split fluorescent proteins are reconstituted.</p> <br />
<p style="margin-left:50px; font-size:20px">Making Gels, Western Blots, Fluorescence-based Assays and Mass spectrometry to prove it! </p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/2/26/Achievements_4.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating circular DNMT1 and showing that it is ACTIVE.</p> <br />
<p style="margin-left:50px; font-size:20px">For the first time achieving the circularization of a large protein!</p><br />
<p style="margin-left:50px; font-size:20px">Circularizing LYSOZYME and XYLANASE, two very important proteins for<br />
research and industry!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/5/5a/Achievements_craut.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Developing a NEW SOFTWARE to calculate customized linkers to circularize proteins.</p> <br />
<p style="margin-left:50px; font-size:20px">Making CRAUT open-source for the scientific community.</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/e/e5/Heidelberg_Frontpage_igemathome.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px"> Establishing a distributed computing platform called <a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome">iGEM@home</a>.</p> <br />
<p style="margin-left:50px; font-size:20px">Using this platform as an entirely new way to reach out to the world with synthetic biology concepts!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
</div><br />
</div><br />
<div class="linie"></div><br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/Achievements_md.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating a NEW SOFTWARE to display the notebook on the wiki.</p> <br />
<p style="margin-left:50px; font-size:20px">Distributing MidNightDOC to the iGEM community to help future teams organize their protocols!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="tab-pane fade" style="color:white;" id="Medal_Criteria-tab"><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin-top: 20px"><br />
</div><br />
<div class="row "> <br />
<div class="col-md-3 col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/6/63/Heidelberg_Bronze.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Bronze</h1><br />
<br><br />
<ul><br />
<li>Please find a comprehensive compilation of <a href="https://2014.igem.org/Team:Heidelberg/Team/Sponsoring">sponsors</a>, partners and scientific contributors on our <a href="https://2014.igem.org/Team:Heidelberg/Team/Attributions">acknowledgements page</a>. </li><br />
<br/><br />
<li>We also encourage you to take notice of the projects “Photo-intein” and “Mito-intein” by <a href="https://2014.igem.org/Team:Queens_Canada/Project">iGEM team Queens from Canada</a> that may supply you with complementary information and tools for the use of inteins in synthetic biology!</li><br />
<br/><br />
<li>A list of links to more than 60 parts in the registry submitted by our team (being or not being part of the new intein toolbox) can be found <a href="https://2014.igem.org/Team:Heidelberg/Parts#allParts">here</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row "><br />
<div class="col-md-3 col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/b/bf/Heidelberg_Silver.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Silver</h1><br />
<br><br />
<ul><br />
<li>We experimentally validated that our biobricks <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, <a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100 </a>and <a href="http://parts.igem.org/Part:BBa_K1362101">BBa_K1362101</a> work as expected. For more information on the <a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">parts</a> please visit the corresponding main pages in the parts registry or explore their involvement in our subprojects.</li><br />
<br/><br />
<li>Religious perceptions of synthetic biology have been part of several surveys during the past ten years of iGEM and Human Practices projects. Since religious groups cover the majority of worlds population, deliver moral values and wield power at the same time, we decided to dedicate a whole event on the topic of religion, philosophy and ethics regarding synthetic biology. Please find an <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/Ethics">evaluation of our event</a> on the corresponding Human Practices pages. <!--In order to reassure ourselves about the acceptability of our project and synthetic biology in general, we also used this opportunity to build up on the work of the iGEM Team Heidelberg 2013 and conducted a survey that addresses basic questions regarding the public reflection of our work.--><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row"><br />
<div class="col-md-3 col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/0/0a/Heidelberg_Gold.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Gold</h1><br />
<ul><br />
<li>We improved the function of the <b>already existing</b> biobrick part <a href="http://parts.igem.org/Part:BBa_K117505">BBa_K1175005 </a>by optimizing and resubmitting the corresponding sequence of B. subtilis xylanase to the registry (Part:<a href="http://parts.igem.org/Part:BBa_K1362020"> BBa_K1362020</a>). In addition, we submitted a new part for expression of <a href="http://parts.igem.org/Part:BBa_K1362022">circularized xylanase </a>(BBa_K1362022) that might be used in future applications with need for refined enzyme stability.</li><br />
<br/><br />
<li>Despite the fact that we focused on building a set of powerful soft- and wetware tools to help future iGEM-teams developing and realizing projects in synthetic biology, we are happy to announce that we were also able to help out several team during the course of our project, aspecially with sending <a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones"> our expression vectors</a>. Read more abou in in our <a href="https://2014.igem.org/Team:Heidelberg/Team/Collaborations">Collaborations</a>.</li><br />
<br/><br />
<li>In the style of of the new iGEM community labs track that involves science amateurs “beyond the accolades of scientific publishing and economic reward”, we sought for a new way to involve laymen in actual science and build a strong community of well informed supporters and communicators of synthetic biology at the same time. Now we proudly present the crowd sourcing and communication platform <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
</div><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
if(window.location.hash) {<br />
var hash = window.location.hash.substring(1); //Puts hash in variable, and removes the # character<br />
if(hash == "Abstract")<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
$('#abstract-dropdown').click(function() {<br />
if($('#abstract-content').css("display") == 'none'){<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
else{<br />
$('#abstract-content').slideUp(400, function() {$('#dropdownImg').attr("src", "/wiki/images/7/70/Heidelberg_Abstract-dropdown.png");});<br />
}<br />
});<br />
<br />
$('#linker-links').mouseenter(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeIn();<br />
});<br />
<br />
$('#linker-links').mouseleave(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeOut();<br />
});<br />
<br />
$('.descr-box span').css("opacity", 0);<br />
$('.descr-box h3, .descr-box > a')<br />
.mouseenter(function(){<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent()<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 1}, 800);<br />
})<br />
.mouseleave(function() {<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent();<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 0}, 800);<br />
});<br />
<br />
$('#toolbox')<br />
.mouseover(function() {<br />
$('#toolbox-img-hover').fadeIn();<br />
})<br />
.mouseleave(function() {<br />
$('#toolbox-img-hover').fadeOut();<br />
});<br />
<br />
$('#myTab a').click(function (e) {<br />
e.preventDefault()<br />
$(this).tab('show')<br />
})<br />
<br />
});<br />
</script><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/Notebook/MaterialsTeam:Heidelberg/pages/Notebook/Materials2014-12-08T16:57:05Z<p>Bunnech: </p>
<hr />
<div><html><br />
<p>See below all the Materials we used. For the individual experiments visit our Notebook, the <a style="font-weight:bold" href="https://2014.igem.org/Team:Heidelberg/Notebook">MidnightDoc</a>, for a collection of our Methods please see <a href="https://2014.igem.org/Team:Heidelberg/Notebook/Methods">Methods</a>.</p><br />
</html><br />
<br />
=Kits=<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Kit !! Supplier !! Catalog Number<br />
|-<br />
| MinElute® PCR Purification Kit (250) || QIAGEN || 28006<br />
|-<br />
| Plasmid Plus Maxi Kit (25) || QIAGEN || 12963<br />
|-<br />
| Plasmid Plus Midi Kit (25) || QIAGEN || 12943<br />
|-<br />
| QIAEX II® Gel Extraction Kit (500) || QIAGEN || 20051<br />
|-<br />
| QIAGEN® Plasmid Plus Midi Kit (100) || QIAGEN || 12945<br />
|-<br />
| QIAquick® Gel Extraction Kit (250) || QIAGEN || 28706<br />
|-<br />
| QIAquick® PCR Purification Kit (250) || QIAGEN || 28106<br />
|-<br />
| QIAprep® Spin Miniprep Kit (250) || QIAGEN || 27106<br />
|-<br />
| QIAprep® Spin Miniprep Columns || QIAGEN || 27115<br />
|-<br />
|Protein Thermal Shift Starter Kit || 4462263 || Life Technologies<br />
|-<br />
| EnzChek® Ultra Xylanase Assay Kit || Life Technologies || E33650<br />
|}<br />
<br/><br />
<br />
=Marker=<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Marker !! Supplier !! Catalog Number<br />
|-<br />
| Quick-Load® 2-Log DNA Ladder (0.1-10.0 kb) || New England BioLabs || N3200S<br />
|-<br />
| Quick-Load® 1 kb DNA Ladder || New England BioLabs || N0468S<br />
|-<br />
| 50 bp DNA Ladder || New England BioLabs || N3236S<br />
|-<br />
| Gel loading solution || Sigma-Aldrich Chemie GmbH || G2526-5ML<br />
|-<br />
| MagicMark XP Western Protein Standard || Life Technologies || LC5602<br />
|-<br />
| Novex® Sharp Pre-stained Protein Standard || Invitrogen || LC5800<br />
|-<br />
| SERVA Triple Color Protein Standard || SERVA Electrophoresis || 39258.01<br />
|}<br />
<br/><br />
<br />
=Enzymes=<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Enzyme !! Supplier !! Catalog Number<br />
|-<br />
| DreamTaq Green PCR Master Mix (2X) || Thermo Fisher Scientific Biosciences GmbH || K1081<br />
|-<br />
| DreamTaq PCR MM || Fermentas Life Sciences || K1071<br />
|-<br />
| Gibson Assembly® Master Mix || New England Biolabs || E2611 S<br />
|-<br />
| Lysozyme from Chicken Egg White || Sigma-Aldrich Chemie GmbH || L4919-500MG<br />
|-<br />
| Phusion® Flash High-Fidelity PCR Master Mix || Biozym Scientific GmbH || F-548L<br />
|-<br />
| Phusion® High-Fidelity PCR Master Mix || New England Biolabs || M0531 L<br />
|-<br />
| T4 DNA Ligase || New England Biolabs GmbH || M0202 S<br />
|-<br />
| 2x PCR Master mix Solution (iTaq) || HISS DIAGNOSTICS GmbH || 25028<br />
|-<br />
| Sortase A (Staphylococcus aureus) || roboklon || E4400-01<br />
|-<br />
| TEV Protease || Th. Geyer GmbH || SA/T4455/000001<br />
|-<br />
| Xylanase, recombinant || Sigma-Aldrich Chemie GmbH || X2753-10G<br />
|-<br />
| Human DNA (cytosine-5) Methyltransferase || NEB || M0230 S<br />
|}<br />
<br/><br />
<br />
=Antibodies=<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Antibody !! Supplier !! Catalog Number<br />
|-<br />
| Penta·His Antibody, BSA-free || QIAGEN || 34660 <br />
|-<br />
| Anti-GFP || Roche || 11814460001<br />
|-<br />
| RFP antibody [5F8] || Chromotec || 5F8<br />
|-<br />
| Goat anti Mouse IgG || HRPO Dianova GmbH || 115-035-003<br />
|-<br />
| Rat IgG, HRP-linked whole antibody (from goat) || GE Healthcare || NA935<br />
|}<br />
<br/><br />
<br />
=Restriction Enzymes=<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Enzyme !! Supplier !! Catalog Number<br />
|-<br />
| BamI || New England Biolabs || R3136 S<br />
|-<br />
| BgIII || New England Biolabs || R0144 S<br />
|-<br />
| BsaI-HF® || NEB || R3535 L<br />
|-<br />
| BsmBI || NEB || R0580 L<br />
|-<br />
| DpnI || New England Biolabs || R0176 S<br />
|-<br />
| EcoRI || New England BioLabs || R0101S<br />
|-<br />
| EcoRI-HF || New England Biolabs || R3101<br />
|-<br />
| HindIII-HF || New England Biolabs || R3104 S<br />
|-<br />
| HpaII || NEB || R0171 S<br />
|-<br />
| KpnI-HF || New England Biolabs || R3142 S<br />
|-<br />
| MfeI-HF || New England Biolabs || R3589 S<br />
|-<br />
| NheI-HF || New England BioLabs || R3131 S<br />
|-<br />
| NotI-HF || New England BioLabs || R3189 S<br />
|-<br />
| PacI || New England Biolabs || R0547 S<br />
|-<br />
| PstI-HF || New England Biolabs || R3140 S<br />
|-<br />
| PvuI-HF || New England BioLabs || R3150S<br />
|-<br />
| SalI-HF || New England Biolabs || R3138 S<br />
|-<br />
| Sau3AI|| NEB || R0169 S<br />
|-<br />
| SpeI-HF || New England BioLabs || R3133 S<br />
|-<br />
| XbaI || New England BioLabs || R0145 S<br />
|}<br />
<br/><br />
<br />
=Bacterial Strains=<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Strain !! Supplier !! Catalog Number<br />
|-<br />
| ''E. coli'' DH10ß || New England Biolabs || C3019<br />
|-<br />
| ''E. coli'' Top10 || Invitrogen || C404010<br />
|-<br />
| ''E. coli'' Turbos ||<br />
|-<br />
| ''E. coli'' MG1655 ||<br />
|-<br />
| ''E. coli'' OneShot ||<br />
|-<br />
| ''E. coli'' Bl21 (DE3) ||<br />
|-<br />
| Bacillus subtilis ||<br />
|-<br />
| Micrococcus lysodeikticus ||<br />
|}<br />
<br/><br />
<br />
=Antibiotics and Media Supplements=<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Antibiotic !! Supplier !! Catalog Number !! Concentration stock solution !! Dilution !! Solvent<br />
|-<br />
| Ampicillin Anhydrous Crystalline || Sigma-Aldrich Chemie GmbH || A9393-5G || 100 mg/ml || 1:1000 || H<sub>2</sub>O<br />
|-<br />
| Ampicillin Sodium Crystalline || Sigma-Aldrich Chemie GmbH || A9518-5G || 100 mg/ml ||1:1000 || H<sub>2</sub>O<br />
|-<br />
| Chloramphenicol Crystalline || Sigma-Aldrich Chemie GmbH || C0378-5G || 30 mg/ml || 1:3000 || Ethanol<br />
|-<br />
| Kanamycinsulfat ''Mixture of Componenta'' || Sigma-Aldrich Chemie GmbH || 60615-5G || 50 mg/ml || 1:1000 || H<sub>2</sub>O<br />
|-<br />
| Tetracycline || Sigma-Aldrich Chemie GmbH || T7660 || 10 mg/ml || 1:1000 || Ethanol<br />
|-<br />
| Propionic Acid Sodium Insect Cell*Culture || Sigma-Aldrich Chemie GmbH || P5436-100G || 100mM || 10mM || H<sub>2</sub>O<br />
|-<br />
| Bacitracin || Sigma-Aldrich Chemie GmbH || B0125-50KU || - || -<br />
|}<br />
<br/><br />
=Media=<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Medium !! Supplier !! Catalog Number<br />
|-<br />
| SOC Outgrowth Medium || New England Biolabs GmbH || B9020 S<br />
|-<br />
| LB BROTH BASE || Th. Geyer GmbH & Co KG || SA/L3022/001000<br />
|-<br />
| LB Broth Powder || Sigma-Aldrich Chemie GmbH || L3022-1KG<br />
|-<br />
| M9 Minimal Salts || SERVA || 48505.01<br />
|}<br />
<br/><br />
<br />
=Buffers=<br />
<br />
{|class="wikitable sortable table table-hover"<br />
!Buffer !! Supplier !! Catalog Number<br />
|-<br />
| NEBuffer Pack #4 (green) || New England Biolabs GmbH || B7004 S<br />
|-<br />
| NEBuffer Pack #1 (yellow) || New England Biolabs GmbH || B7001 S<br />
|-<br />
| NEBuffer Pack for T4 DNA Ligase || New England Biolabs GmbH || B0202 S<br />
|-<br />
| NEBuffer Pack #2 (blue) || New England Biolabs GmbH || B7002 S<br />
|-<br />
| NEBuffer Pack #3 (red) || New England Biolabs GmbH || B7003 S<br />
|-<br />
| TAE - Buffer (50X) for Molecular Biology || VWR International GmbH || A4686.1000<br />
|-<br />
| Gel Loading Buffer || Sigma-Aldrich || G2526-5ML<br />
|-<br />
| Tris Acetate-EDTA Buffer || Sigma-Aldrich || T9650-1L<br />
|}<br />
<br/><br />
<br />
=Other Chemicals=<br />
<br />
{|class="wikitable sortable table table-hover"<br />
! Chemical !! Supplier !! Catalog Number<br />
|-<br />
| Isopropyl B-D-Thiogalactopyranoside 1 piece || Sigma-Aldrich Chemie GmbH || I5502-1G<br />
|-<br />
| Dimethyl Sulfoxide PCR Reagent || Sigma-Aldrich Chemie GmbH || D9170-1VL<br />
|-<br />
| Glycerol Sigma Grade || Sigma-Aldrich Chemie GmbH || G9012-100ML<br />
|-<br />
| 5-Bromo-4-Chloro-3-Indolyl B-D-*Galactop|| Sigma-Aldrich Chemie GmbH || B4252-100MG<br />
|-<br />
| Bacteriological Agar || Sigma-Aldrich Chemie GmbH || A5306-250G<br />
|-<br />
| L-Plus-Arabinose Crystalline || Sigma-Aldrich Chemie GmbH || A3256-25G<br />
|-<br />
| Calciumchlorid Dihydrat || Th. Geyer GmbH & Co KG || SA/00223506/000500<br />
|-<br />
| Malt Extract from Starch Digestion || Sigma-Aldrich Chemie GmbH || M0383-100G<br />
|-<br />
| D(+)-Saccharose, ACS, for Micro-Biology || Sigma-Aldrich Chemie GmbH || 84100-1KG<br />
|-<br />
| Dimethyl Sulfoxide Plant Cell Culture*TE || || D4540-100ML<br />
|-<br />
| Sodium Hydroxide Anhydrous Pellets || Th. Geyer GmbH & Co.KG || SA/S5881/000500<br />
|-<br />
| TRIZMA(R) Hydrochloride PH 3.5-5.0 || Sigma-Aldrich Chemie GmbH || T6666-50G<br />
|-<br />
| L-Glutamine 200 MM Sterile || Sigma-Aldrich Chemie GmbH || G7513-20ML<br />
|-<br />
| Ethanol 96% Denatured || Carl Roth GmbH & Co.KG || T171.3<br />
|-<br />
| Propanol-2 || Sigma-Aldrich Chemie GmbH || 59309-1L<br />
|-<br />
| Natriumdodecylsulfat,SDS,99%, Ultra Pure || || 13904<br />
|-<br />
| Gold(III)-Chloride || Carl Roth GmbH & Co.KG || 5624.1<br />
|-<br />
| Pro-Leu || Sigma-Aldrich Chemie GmbH || P1130-1G<br />
|-<br />
| Nitric Acid 65% p.a. Iso || Carl Roth GmbH & Co.KG || X943.1<br />
|-<br />
| Mops, Sodium || Sigma-Aldrich Chemie GmbH || M9024-25G<br />
|-<br />
| L-Glutamine || Sigma-Aldrich Chemie GmbH || G7513-100ML<br />
|-<br />
| Chelating Resin || Sigma-Aldrich Chemie GmbH || C7901-50G<br />
|-<br />
| Potassium Hydroxide in Platellets|| || 6751.3<br />
|-<br />
| Hydrochloric Acid 37% || || 4625.1<br />
|-<br />
| Pyruvic Acid || Sigma-Aldrich Chemie GmbH || 107360-25G<br />
|-<br />
| Fmoc-Orn(BOC)-OH 96.0 % || || 47560-5G-F<br />
|-<br />
| Glycerol >99.5% || Sigma-Aldrich Chemie GmbH || G9012-1L<br />
|-<br />
| Water Molecular Biology Reagent || Sigma-Aldrich Chemie GmbH || W4502-1L<br />
|-<br />
| Acetonitrile || Sigma-Aldrich Chemie GmbH || 34967-1L<br />
|-<br />
| Ascorbic Acid 99% || Sigma-Aldrich Chemie GmbH || A92902-100G<br />
|-<br />
| Imidazol 99%|| Carl Roth GmbH || 3899.4<br />
|-<br />
| 1,4-Dithiothreit p.a. 25g || Carl Roth GmbH || 6908.2<br />
|-<br />
| Phenylmethylsulfonylfluorid || Carl Roth GmbH || 6367.1<br />
|-<br />
| S-Adenosyl-L-Methionine Chloride (SAM)|| Sigma-Aldrich Chemie GmbH || A7007-5MG<br />
|-<br />
| Boric Acid || Carl Roth GmbH & Co.KG || 6943.1 <br />
|-<br />
| Fluorecine Isothiocyanate Isomer || Sigma-Aldrich Chemie Gmb || F7250-50MG<br />
|-<br />
| Hydroxylammonium chloride || Sigma-Aldrich Chemie GmbH || 159417-100G<br />
|-<br />
| Rotiphorese® Gel 40 (19:1) 250 ml || Carl Roth GmbH || 3030.2<br />
|-<br />
| Rotiphorese® Gel 30 (37,5:1) 1 l || Carl Roth GmbH || 3029.1<br />
|-<br />
| Albumin Bovine Fraction V Powder || Sigma-Aldrich Chemie GmbH || A9647-50G<br />
|-<br />
| Peptidoglycan from Micrococcusluteus || Sigma-Aldrich Chemie GmbH || 53243-10MG-F<br />
|-<br />
| Adenosine 5´-Triphosphate (ATP) || NEB || P0756 S<br />
|-<br />
|-<br />
|-<br />
|-<br />
|-<br />
|-<br />
|-<br />
|}<br />
<br />
=Electrophoresis=<br />
{|class="wikitable sortable table table-hover"<br />
! Reagent !! Supplier !! Catalog Number !! Concentration !! Solvent<br />
|-<br />
| Agarose Molecular Biology Reagent || Th. Geyer GmbH & Co KG || SA/A9539/000050 || 0.5% || H<sub>2</sub>O<br />
|-<br />
| Agarose for Routine Use || Sigma-Aldrich Chemie GmbH || A9539-100G || - || -<br />
|-<br />
| Gel Loading Dye Purple || NEB || B7024 S<br />
|}<br />
<br/><br />
<br />
=Primers and Oligos=<br />
<html><style type="text/css"><br />
table.sequencetable > tbody > tr > td:last-child { word-break: break-all; }<br />
</style></html><br />
{| class="wikitable sortable table table-hover sequencetable"<br />
|-<br />
! Name !! Sequence<br />
|-<br />
| VF2 || tgccacctgacgtctaagaa<br />
|-<br />
| VR || attaccgcctttgagtgagc<br />
|-<br />
| pSB1C3_F_SspDnaE-N-taataat || GACGCAGGTACAATTAAATAATAATACTAGTAGCGGCCGCTGCAG<br />
|-<br />
| pSB1C3_R_Flag-SspDnaE_C || CTTTAACCTTGTCATCATCGTCTTTGTAGTCCATCTAGTACTTTCCTGTGTGACTCTAGAAGCG<br />
|-<br />
| SspDnaE-C_F_pSB1C3-Flag || TACTAGATGGACTACAAAGACGATGATGACAAGGTTAAAGTTATCGGTCGTCGATCCC<br />
|-<br />
| SspDnaE-C_R_BsaI-ccdB || CTCCCTTATACACAGCCAGTGGTCTCGAATTGTTTGTTAAAACAGTTGGCGGCGATAG<br />
|-<br />
| ccdB_F_SspDnaE-C-BsaI || TTAACAAACAATTCGAGACCACTGGCTGTGTATAAGGGAGCCTGAC<br />
|-<br />
| ccdB_R_BsaI-SspDnaE-N || TTAAAATTTCGGTACCAAAACTGAGGCAGCTAGTGAGACCCGCGTGGATCCGGCTTAC<br />
|-<br />
| SspDnaE-N_F_ccdB-BsaI || GGTCTCACTAGCTGCCTCAGTTTTGGTACCG<br />
|-<br />
| SspDnaE-N_R_taataat-pSB1C3 || GCGGCCGCTACTAGTATTATTATTTAATTGTACCTGCGTCAAGTAATG<br />
|-<br />
| SspDnaE-C_R_6His-BsaI-ccdB || GCCAGTGGTCTCGAATTGATGGTGATGGTGATGGTGTTTGTTAAAACAGTTGGCGGCGATAG<br />
|-<br />
| ccdB_F_SspDnaE-C-6His-BsaI || CAAACACCATCACCATCACCATCAATTCGAGACCACTGGCTGTGTATAAGGGAGCCTGAC<br />
|-<br />
| pSB1C3_F_NpuDnaE-N || CGGGTTGATAATTTGCCGAATTAATAATACTAGTAGCGGCCGCTG<br />
|-<br />
| pSB1C3_R_FLAG-NpuDnaE-C || CTTGTCGTCATCGTCTTTGTAGTCCATCTAGTACTTTCCTGTGTGACTCTAGAAGC<br />
|-<br />
| NpuDnaE-C_F_pSB1C3-FLAG || AGGAAAGTACTAGATGGACTACAAAGACGATGACGACAAGCATATGATCAAAATAGCCACACG<br />
|-<br />
| NpuDnaE-C_R_BsaI-ccdB || GCTCCCTTATACACAGCCAGTGGTCTCGAATTGATTGAAACAATTAGAAGCTATGAAGCC<br />
|-<br />
| ccdB_F_NpuDnaE-C-BsaI || TTTCAATCAATTCGAGACCACTGGCTGTGTATAAGGGAGCC<br />
|-<br />
| ccdB_R_BasI-NpuDnaE-N || CTTAAACAGCTAGTGAGACCCGCGTGGATCCGGCTTAC<br />
|-<br />
| NpuDnaE-N_F_BsaI-ccdB || TAGTAAGCCGGATCCACGCGGGTCTCACTAGCTGTTTAAGCTATGAAACGGAAATATTG<br />
|-<br />
| NpuDnaE-N_R_pSB1C3 || CCGCTACTAGTATTATTAATTCGGCAAATTATCAACCC<br />
|-<br />
| NpuDnaE-C_R_6His-BsaI-ccdB || TGGTCTCGAATTGATGATGGTGATGGTGATGATTGAAACAATTAGAAGCTATGAAGCC<br />
|-<br />
| ccdB_F_NpuDnaE-C-6His-BsaI || TGTTTCAATCATCACCATCACCATCATCAATTCGAGACCACTGGCTGTGTATAAGGGAGCC<br />
|-<br />
| BBa_E0040_F_EcoR1 || GAAAGGAATTCATGCGTAAAGGAGAAGAACTTTTCACTGGAG<br />
|-<br />
| BBa_E0040_R_Spe1 || TAGTAACTAGTTTTGTATAGTTCATCCATGCCATGTGTAATCC<br />
|-<br />
| DNMT1_P1_R_deg.seq.731-1602 || GCATCCAGRTTGCTSCC<br />
|-<br />
| DNMT1_P2_R_deg.seq.731-1602 || CCACCACACAGCATYTC<br />
|-<br />
| DNMT1_P3_F_both_seq.731-1602 || ATGTGGGACCCGGCAGC<br />
|-<br />
| DNMT1_P4_F_deg.seq.731-1602 || CAGTAYACCTTTCATGATGTG<br />
|-<br />
| LOV-I539E_mut_F || TTTTGGTCTCAGAGGCCGCCGCCAAGCGGGTGAAGCTGGAC<br />
|-<br />
| LOV-I539E_mut_R || ttttggtctcacctcattttctgcagttttcttaatcagcatg<br />
|-<br />
| LOV-C450A_mut_F || ttttggtctcagccaggtttctacaaggtcctgaaactgatc<br />
|-<br />
| LOV-C450A_mut_R || aaaaggtctcttggcgtttcttcccaaaatttcttcac<br />
|-<br />
| T7RBS BioBrick_F || AAACTACGCTTTAGTAGCTTAATAACTCTGATAGTGCTAGTGTAGATCTC<br />
|-<br />
| T7RBS BioBrick_R || PLACEHOLDER<br />
|-<br />
| T7RBS-IGEMHD_F || PLACEHOLDER<br />
|-<br />
| T7RBS-IGEMHD_R || PLACEHOLDER<br />
|-<br />
| pSBX-T7fwd || AATTTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCGAATTCGCGGCCGCTT<br />
|-<br />
| pSBX-T7rev || CTAGAAGCGGCCGCGAATTCGGGGAATTGTTATCCGCTCACAATTCCCCTATAGTGAGTCGTATTA<br />
|-<br />
| T7RBS-IGEMHD_F_v2 || PLACEHOLDER<br />
|-<br />
| T7RBS-IGEMHD_R_v2 || PLACEHOLDER<br />
|-<br />
| T7RBS BioBrick_F_v2 || AATTCGCGGCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATA<br />
|-<br />
| T7RBS BioBrick_R_v2 || CTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTCTAGAAGCGGCCGCG<br />
|-<br />
| Bba_E0040_F_BsaI=EcoR1 || GAAAGGGTCTCGAATTCATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTC<br />
|-<br />
| Bba_E0040_R_His6_BsaI=Spe1 || TAGTAGGTCTCACTAGTGTGGTGATGGTGATGATGTTTGTATAGTTCATCCATGCCATGTG<br />
|-<br />
| BsaI=EcoRI_null_BsaI=Spe1 || GCAGCAGGTCTCAAATTATGCGACTAGAGAGACCGCTGCT<br />
|-<br />
| BsaI=SpeI_null_BsaI=EcoRI || AGCAGCGGTCTCTCTAGTCGCATAATTTGAGACCTGCTGC<br />
|-<br />
| 1F-smt3_pSB1A3 || AATTCGCGGCCGCTTCTAGATGTCGGACTCAGAAGTCAATCAAGAAGC<br />
|-<br />
| 2R-smt3_Tev_BsaI_ccdb || TCTCTACCCTGGAAGTACAGGTTTTCGGATCCACCAATCTGTTCTCTGTGAGC<br />
|-<br />
| 2F-ccdb_F_smt3_Tev_BsaI || AGATTGGTGGATCCGAAAACCTGTACTTCCAGGGTAGAGACCACTGGCTGTGTATAAGGGAGCC<br />
|-<br />
| 3R-ccdb_R-sortase-his6 || GCCGCTACTAGTATTATTAGTGATGGTGATGGTGATGACCACCGGTTTCCGGAAGTGAGACCCGCGTGGATCCGGCTTACTAAAAGCC<br />
|-<br />
| 3F-pSB1A3_F_ccdb-sortase-his6 || GGTCATCACCATCACCATCACTAATAATACTAGTAGCGGCCGCTGCAGTCCG<br />
|-<br />
| 1R-pSB1A3_smt3 || TTCTTGATTGACTTCTGAGTCCGACATCTAGAAGCGGCCGCGAATTCC<br />
|-<br />
| ccdB_F_BsmBI || AGAGACGACTGGCTGTGTATAAGGGAGCCTGAC<br />
|-<br />
| ccdB_R_BsmBI || TGAGACGCGCGTGGATCCGGCTTACTAAAAG<br />
|-<br />
| mRFP_F_BsaI || AGAGACCCAATACGCAAACCGCCTCTC<br />
|-<br />
| mRFP_R_BsaI || TGAGACCTATAAACGCAGAAAGGCCCACC<br />
|-<br />
| T7RBS-IGEMHDv3_F || AATTCGCGGCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGATCGGTGAAATGCACGACTGATAGTA<br />
|-<br />
| T7RBS-IGEMHDv3_R || CTAGTACTATCAGTCGTGCATTTCACCGATCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTCTAGAAGCGGCCGCG<br />
|-<br />
| NpuDnaEN_F || GTGGGCCTTTCTGCGTTTATAGGTCTCATGCTTAAGCTATGAAACGGAAATATTGACAG<br />
|-<br />
| NpuDnaEN_R || GCTCCCTTATACACAGCCAGTCGTCTCTACCACCATTCGGCAAATTATCAACCCGCATC<br />
|-<br />
| NpuDnaEC_F || GCCGGATCCACGCGCGTCTCAGGTGGAATCAAAATAGCCACACGTAAATATTTAGGCAAAC<br />
|-<br />
| NpuDnaEC_R || GAGAGGCGGTTTGCGTATTGGGTCTCTGTTGGAAGCTATGAAGCCATTTTTGAGTGC<br />
|-<br />
| SspDnaEN_F || PLACEHOLDER<br />
|-<br />
| SspDnaEN_R || PLACEHOLDER<br />
|-<br />
| SspDnaEC_F || PLACEHOLDER<br />
|-<br />
| SspDnaEC_R || PLACEHOLDER<br />
|-<br />
| AssemBIyIntN-linker_F || TGGTTAGTAGGGTGGC<br />
|-<br />
| AssemBIyIntN-linker_R || ATTAGCCACCCTACTA<br />
|-<br />
| AssemBIyIntC-linker_F || GATGGGTGGCGGTGGC<br />
|-<br />
| AssemBIyIntC-linker_R || CACCGCCACCGCCACC<br />
|-<br />
| SB-prep-3P-1 || gccgctgcagtccggcaaaaaa<br />
|-<br />
| SB-prep-2Ea || atgaattccagaaatcatccttagcg<br />
|-<br />
| pSBX_F_ccdB-BsmBI || GCCGGATCCACGCGCGTCTCATAATAAATCGGTGAAATGCACGACTGATAG<br />
|-<br />
| pSBX_R_BsmBI-ccdB || GCTCCCTTATACACAGCCAGTCGTCTCTCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTC<br />
|-<br />
| pSBX_F_mRFP-BsaI || GTGGGCCTTTCTGCGTTTATAGGTCTCATAATAAATCGGTGAAATGCACGACTGATAG<br />
|-<br />
| pSBX_R_BsaI-mRFP || GAGAGGCGGTTTGCGTATTGGGTCTCTCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTC<br />
|-<br />
| pSBX_F_taataa || TAATAAATCGGTGAAATGCACGACTGATAG<br />
|-<br />
| pSBX_R_atg || CATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTC<br />
|-<br />
| GFP_F_pSBX || TCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGATGCGTAAAGGAGAAGAACTTTTC<br />
|-<br />
| GFP_R_pSBX || CTAGTACTATCAGTCGTGCATTTCACCGATTTATTATTTGTATAGTTCATCCATGCCATG<br />
|-<br />
| Lambda-Lys_F_pSBX || TCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGGTAGAAATCAATAATCAACGTAAGGC<br />
|-<br />
| Lambda-Lys_R_pSBX || CTAGTACTATCAGTCGTGCATTTCACCGATTTATTATACATCAATCTCTCTGACCGTTCCG<br />
|-<br />
| 1F-ccdb_F_pSB1A3-bsaI || ATTTCTGGAATTCGCGGCCGCTTCTAGATGTGAGACCACTGGCTGTGTATAAGGGAGCC<br />
|-<br />
| 1R-pSB1A3_R_bsaI-sortase-his-pSB1A3 || TTATACACAGCCAGTGGTCTCACATCTAGAAGCGGCCGCGAATTCC<br />
|-<br />
| SspDnaX-S11C_F || TTAGTAAGCCGGATCCACGCGCGTCTCAGGTGGTGGCCTGCTGGTACACAACAGAGACCCAATACGCAAACCGCCTCTCCCC<br />
|-<br />
| SspDnaX-S11C_R || GGGGAGAGGCGGTTTGCGTATTGGGTCTCTGTTGTGTACCAGCAGGCCACCACCTGAGACGCGCGTGGATCCGGCTTACTAA<br />
|-<br />
| SspGyrB-S11C_F || TTAGTAAGCCGGATCCACGCGCGTCTCAGGTGGTGGTGTTTTCGTTCACAACAGAGACCCAATACGCAAACCGCCTCTCCCC<br />
|-<br />
| SspGyrB-S11C_R || GGGGAGAGGCGGTTTGCGTATTGGGTCTCTGTTGTGAACGAAAACACCACCACCTGAGACGCGCGTGGATCCGGCTTACTAA<br />
|-<br />
| TerDnaE3-S11C_F || TTAGTAAGCCGGATCCACGCGCGTCTCAGGTGGTGGTCTGATCGCGAGCAACAGAGACCCAATACGCAAACCGCCTCTCCCC<br />
|-<br />
| TerDnaE3-S11C_R || GGGGAGAGGCGGTTTGCGTATTGGGTCTCTGTTGCTCGCGATCAGACCACCACCTGAGACGCGCGTGGATCCGGCTTACTAA<br />
|-<br />
| NpuDnaEN_R_taataa-pSBX || CTAGTACTATCAGTCGTGCATTTCACCGATTTATTAATTCGGCAAATTATCAACCCGCATC<br />
|-<br />
| NpuDnaEC_F_pSB-T7RBS || TCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGATCAAAATAGCCACACGTAAATATTTAGGC<br />
|-<br />
| AssemBIyIntN-linker+H6_F || TGGTGGTCATCATCACCATCACCATTAG<br />
|-<br />
| AssemBIyIntN-linker+H6_R || ATTACTAATGGTGATGGTGATGATGACC<br />
|-<br />
| AssemBIyIntC-linker+H6_F || GATGCATCATCACCATCACCACGGT<br />
|-<br />
| AssemBIyIntC-linker+H6_R || CACCACCGTGGTGATGGTGATGATG<br />
|-<br />
| GFPn_1-157_R_KGG_TGCT_BsaI || CGTAGGTCTCGAGCACTTACCTCCTTTGTCTGCCATGATGTATACATTG<br />
|-<br />
| GFPn_1-64_R_KGG_TGCT_BsaI || CGTAGGTCTCAAGCACTTACCTCCGAAAGTAGTGACAAGTGTTGGCC<br />
|-<br />
| GFPn_1-64_1-157_F_H6_GATG_BsaI || GCATGGTCTCAGATGCATCATCACCATCACCACCGTAAAGGAGAAGAACTTTTC<br />
|-<br />
| GFPc_158-238_F_NWC_CAAC_BsaI || GCATGGTCTCACAACTGCTGGAACCAAAAGAATGGAATCAAAGTTAAC<br />
|-<br />
| GFPc_65-238_F_NWC_CAAC_BsaI || GCATGGTCTCACAACTGCTGGAACGGTTATGGTGTTCAATGCTTTGC<br />
|-<br />
| GFPc_65-238_158-238_R_H6_TAAT_BsaI || CGTAGGTCTCTATTAGTGGTGATGGTGATGATGTTTGTATAGTTCATCCATGCCATGTG<br />
|-<br />
| mCherryN_1-168_R_KGG_TGCT_BsaI || CGTAGGTCTCAAGCACTTACCTCCCTGCTTGATCTCGCCCTTC<br />
|-<br />
| mCherryN_1-168_F_H6_GATG_BsaI || GCATGGTCTCAGATGCATCATCACCATCACCACGTGAGCAAGGGCG<br />
|-<br />
| mCherryC_169-236_R_H6_TAAT_BsaI || CGTAGGTCTCTATTAGTGGTGATGGTGATGATGCTTGTACAGCTCGTCCATGC<br />
|-<br />
| mCherryC_169-236_F_NWC_CAAC_BsaI || GCATGGTCTCACAACTGCTGGAACAGGCTGAAGCTGAAGGACG<br />
|-<br />
| mRFPn_1-168_R_KGG_TGCT_BsaI || CGTAGGTCTCAAGCACTTACCTCCTTTCAGTTTCAGACGCATTTTGATTTC<br />
|-<br />
| mRFPn_1-154_R_KGG_TGCT_BsaI || CGTAGGTCTCAAGCACTTACCTCCGTCTTCCGGGTACATACGTTCG<br />
|-<br />
| mRFPn_1-154_1-168_F_H6_GATG_BsaI || GCATGGTCTCAGATGCATCATCACCATCACCACGCTTCCTCCGAAGACG<br />
|-<br />
| mRFPc_169-225_F_NWC_CAAC_BsaI || GCATGGTCTCACAACTGCTGGAACGACGGTGGTCACTACGACG<br />
|-<br />
| mRFPc_155-225_F_NWC_CAAC_BsaI || GCATGGTCTCACAACTGCTGGAACGGTGCTCTGAAAGGTGAAATC<br />
|-<br />
| mRFPc_155-225_169-225_R_H6_TAAT_BsaI || CGTAGGTCTCTATTAGTGGTGATGGTGATGATGAGCACCGGTGGAGTG<br />
|-<br />
| RenLucN_1-229_R_KGG_TGCT_BsaI || CGTAGGTCTCAAGCACTTACCTCCCTTAACGAGAGG<br />
|-<br />
| RenLucN_1-229_F_H6_GATG_BsaI || GCATGGTCTCAGATGCATCATCACCATCACCACGCTTCCAAGGTGTACG<br />
|-<br />
| RenLucC_230-311_R_H6_TAAT_BsaI || CGTAGGTCTCTATTAGTGGTGATGGTGATGATGTTACTGCTCGTTCTTCAGCACG<br />
|-<br />
| RenLucC_230-311_F_NWC_CAAC_BsaI || GCATGGTCTCACAACTGCTGGAACAAGCCCGACGTCGTCC<br />
|-<br />
| FireLucN_1-437_R_KGG_TGCT_BsaI || CGTAGGTCTCAAGCACTTACCTCCGCGGTCAACGATGAAG<br />
|-<br />
| FireLucN_1-437_F_H6_GATG_BsaI || GCATGGTCTCAGATGCATCATCACCATCACCACGAAGACGCCAAAAAC<br />
|-<br />
| FireLucC_438-550_R_H6_TAAT_BsaI || CGTAGGTCTCTATTAGTGGTGATGGTGATGATGCACGGCGATCTTTCC<br />
|-<br />
| FireLucC_438-550_F_F_NWC_CAAC_BsaI || GCATGGTCTCACAACTGCTGGAACCTGAAGTCTCTGATTAAGTACAAAGGC<br />
|-<br />
| PCA(t7rbs-npuc-mrfp-npun-igemhd)_F_prefix || CCCCGAATTCGCGGCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATG<br />
|-<br />
| PCA(t7rbs-npuc-mrfp-npun-igemhd)_R_SpeI || CGCTACTAGTACTATCAGTCGTGCATTTCACCG<br />
|-<br />
| LambdaLys_F_BsaI_c-ext || CTGGTCTCACAACTGCTGGGAAGTAGAAATCAATAATCAACGTAAGGCGTTCC<br />
|-<br />
| LambdaLys_R_HISTAG_n-ext_BsaI || CTGGTCTCTAGCATTTACCACGGCCGCTGTGATGATGATGATGATGGCTGCCTACATCAATCTCTCTGACCGTTCCG<br />
|-<br />
| LambdaLys_R_RIGIDLINKER_n-ext_BsaI || CTGGTCTCTAGCATTTACCACGCGGTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCGCCACCTACATCAATCTCTCTGACCGTTCCG<br />
|-<br />
| LambdyLys_R_FLEXLINKER_n-ext_BsaI || CTGGTCTCTAGCATTTACCACGTCCAGAACCACCACCAGAACCACCTACATCAATCTCTCTGACCGTTCCG<br />
|-<br />
| Xyla_BB_F_RBS34_X || GCCGCTTCTAGAGAAAGAGGAGAAATACTAGATGGCTAGCACAGACTACTGGCAAAATTG<br />
|-<br />
| Xyla_BB_R_SP || GGAAGCCTGCAGCGGCCGCTACTAGTATTATTACCACACTGTTACGTTAGAACTTCCAC<br />
|-<br />
| Xyla_F_BsaI_C-ext || CTGGTCTCACAACTGCTGGGAAGCTAGCACAGACTACTGGCAAAATTG<br />
|-<br />
| Xyla_F_BsaI_Destroyed-C-ext_His || CTGGTCTCACAACGGCTGGGAAGCTAGCACAGACTACTGGCAAAATTG<br />
|-<br />
| Xyla_R_BsaI_N-ext || CTGGTCTCTAGCATTTACCACGCCACACTGTTACGTTAGAACTTCCAC<br />
|-<br />
| Xyla_R_BsaI_N-ext_His || CTGGTCTCTAGCATTTACCACGATGATGGTGATGGTGATGCCACACTGTTACGTTAGAACTTCCAC<br />
|-<br />
| 2GateNinsert_F_X-T7RBS || CCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGAGAGACCCAATACGCAAACC<br />
|-<br />
| 2GateNinsert_R_SP || CCGGACTGCAGCGGCCGCTACTAGTATTTATTATGAGACGCGCGTGGATC<br />
|-<br />
| 2GateCinsert_F_X-T7RBS || CGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGAGAGACGACTGGCTGTGTATAAGG<br />
|-<br />
| 2GateCinsert_R_SP || CCGGACTGCAGCGGCCGCTACTAGTATTATTATGAGACCTATAAACGCAGAAAGG<br />
|-<br />
| GFP^C_F_ || TATGGTGTTCAATGCTTTGCGAG<br />
|-<br />
| GFP^C_R_H6 || GTGGTGATGGTGATGATGTTTGTATAGTTCATCCATGCCATGTG<br />
|-<br />
| NpuDnaE^C_F_T7RBS-H6 || GGAGATACTAGATGCATCATCACCATCACCACATCAAAATAGCCACACGTAAATATTTAGGC<br />
|-<br />
| NpuDnaE^C_R_GFP^C || CTCGCAAAGCATTGAACACCATAACAATTAGAAGCTATGAAGCCATTTTTGAGTG<br />
|-<br />
| pSB_F_GFP^C-H6 || AACTATACAAACATCATCACCATCACCACTAATAATACTAGTAGCGGCCGCTGC<br />
|-<br />
| pSB-T7RBS_R_H6 || GATGGTGATGATGCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTC<br />
|-<br />
| GFP^N_F_T7RBS-H6 || GGAGATACTAGATGCATCATCACCATCACCACCGTAAAGGAGAAGAACTTTTCACTGGA<br />
|-<br />
| GFP^N_R_NpuDnaE^N || CAAAGTAGTGACAAGTGTTGGCCATG<br />
|-<br />
| NpuDnaE^N_F_GFP^N || TGGCCAACACTTGTCACTACTTTGTGTTTAAGCTATGAAACGGAAATATTGAC<br />
|-<br />
| NpuDnaE^N_R_H6 || GGTGATGATGATTCGGCAAATTATCAACCCGCATC<br />
|-<br />
| pSB_F_NpuDnaE^N-H6 || GATAATTTGCCGAATCATCATCACCATCACCACTAATAATACTAGTAGCGGCCGCTGC<br />
|-<br />
| NpuDnaE^C_R_SN->AG-sfGFP^C || GCAAAGCACTGAACACCATAGCAACCAGCAGCTATGAAGCCATTTTTGAGTGC<br />
|-<br />
| NpuDnaE^C_F_H6 || CATCATCATATCAAAATAGCCACACGTAAATATTTAGGC<br />
|-<br />
| NpuDnaE^C_R_sfGFP || GCAAAGCACTGAACACCATAGCAATTAGAAGCTATGAAGCCATTTTTGAGTG<br />
|-<br />
| sfGFP^C_F_NpuDnaE^C || GCTATGGTGTTCAGTGCTTTGCTC<br />
|-<br />
| sfGFP^C_R_H6 || GTGGTGGTGGTGGTGTTTGTACAGTTCATCCATACCATGC<br />
|-<br />
| pSB_F_H6-sfGFP^C || GTACAAACACCACCACCACCACCACTAATAATACTAGTAGCGGCCGCTGC<br />
|-<br />
| pSB-T7RBS_R_NpuDnaE^C-H6 || CGTGTGGCTATTTTGATATGATGATGATGATGATGCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTC<br />
|-<br />
| NpuDnaE^N_F_sfGFP^N || GACGCTGTGTTTAAGCTATGAAACGGAAATATTGACAGTAG<br />
|-<br />
| NpuDnaE^N_R_H6 || GATGATTCGGCAAATTATCAACCCGCATC<br />
|-<br />
| sfGFP^N_F_T7RBS-H6 || GAGATACTAGATGCACCACCACCACCACCACCGTAAAGGCGAAGAGCTGTTC<br />
|-<br />
| sfGFP^N_R_NpuDnaE^N || CGTTTCATAGCTTAAACACAGCGTCGTTACCAGAGTCG<br />
|-<br />
| pSB_F_NpuDnaE^N-H6 || GGGTTGATAATTTGCCGAATCATCATCATCATCATCATTAATAATACTAGTAGCGGCCGCTGCAG<br />
|-<br />
| pSB-T7RBS_R_H6 || GTGGTGGTGGTGCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTC<br />
|-<br />
| sfGFP^N_R_C->G-NpuDnaE^N || CATAGCTTAAACCCAGCGTCGTTACCAGAGTCG<br />
|-<br />
| NpuDnaE^N_F_sfGFP-C>-G || CGACGCTGGGTTTAAGCTATGAAACGGAAATATTGACAGTAG<br />
|-<br />
| pSBX1C3-Ter_F_KpnI || CTAGGGTCTACGTGATCGAGGTACCTACTAGAGCCAGGCATCAAATAAAA<br />
|-<br />
| pSBX1C3-GFP_R_Ext_IntN_BamHI || GATCGAGGATCCCGCCAGAGAGATCAGAGAGTCACCAGAGATGCAACCAGATTCACGCAGTTTGTATAGTTCATCCATGCCATG<br />
|-<br />
| BamHI-MTS_bs_minD-KpnI-**_F || GATCCCCTTTACAGGTGCTTGAAGAGCAAAACAAAGGAATGATGGCTAAGATTAAGTCATTTTTCGGAGTAAGATCTTAATAAGGTAC<br />
|-<br />
| BamHI-MTS_bs_minD-KpnI-**_R || CTTATTAAGATCTTACTCCGAAAAATGACTTAATCTTAGCCATCATTCCTTTGTTTTGCTCTTCAAGCACCTGTAAAGGG<br />
|-<br />
| SspDnaBC_F_M+H6 || GCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGCATCATCACCATCACCACAGCACAGGAAAAAGAGTTTCTATTAAAGATT<br />
|-<br />
| SspDnaBC_R_N->A+SGG || GCCGGACTGCAGCGGCCGCTACTAGTATTATTACCCGCCTGAGGCATGGACAATGATGTCATTGGC<br />
|-<br />
| SspDnaBC_F_M-noH6 || GCCGCTTCTAGAGAATAATTTTGTTTAACTTTAAGAAGGAGATACTAGATGAGCACAGGAAAAAGAGTTTCTATTAAAGATT<br />
|-<br />
| CPEC-GFP_F_MTS || GCAAAACAAAGGAATGATGGCTAAGATTAAGTCATTTTTCGGAGTAAGATCTAATACTAGAGCCAGGCATCAAATAAAACGAAAG<br />
|-<br />
| CPEC-GFP_R_Next_Nint || GCCAGAGAGATCAGAGAGTCACCAGAGATGCAACCAGATTCACGCAGTTATTATTTGTATAGTTCATCCATGCCATGTGTAATC<br />
|-<br />
| CPEC_GFP_Insert_oligo_F || CTCTGGTGACTCTCTGATCTCTCTGGCGCCTTTACAGGTGCTTGAAGAGCAAAACAAAGGAATGATGGCTAAGATTAAGT<br />
|-<br />
| dnmt1insert_F_BsaI || ATGTTCGGTCTCAGGGTGGCGGTGGCAAAGATCGCATTAGCTGGCTGGGTCAG<br />
|-<br />
| dnmt1insert_G_BsaI || ATGTTCGGTCTCATGCGCTGCTCAGCAGACACAGTTTAATTTC<br />
|-<br />
| mRFP_F_BsmBIBsaI || ACTTACGGTCTCACGCAAGAGACGCAATACGCAAACCGCCTCTC<br />
|-<br />
| mRFP_R_BsmBIBsaI || GCTTACGGTCTCAGAAGAGAGACGTATAAACGCAGAAAGGCCCACC<br />
|-<br />
| LambdaLys_R_BsaI || CTGGTCTCTTACATCAATCTCTCTGACCGTTCCG<br />
|-<br />
| ccdB_F_BsmBI-BsaI || CTCGTCTCATGTAAGAGACCACTGGCTGTGTATAAGGGAGCCTGAC<br />
|-<br />
| ccdB_R_BsaI-BsmBI || CTCGTCTCAAGCAAGAGACCCGCGTGGATCCGGCTTACTAAAAG<br />
|-<br />
| CPEC_GFP_Insert_oligo_R || ACTTAATCTTAGCCATCATTCCTTTGTTTTGCTCTTCAAGCACCTGTAAAGGCGCCAGAGAGATCAGAGAGTCACCAGAG<br />
|-<br />
| Smt3_F_p2Zv2Npu_flag || GATGGACTACAAAGACGATGACGACAAGTCGGACTCAGAAGTCAATCAAGAAGC<br />
|-<br />
| Smt3_R_p2Zv2Npu || GGCTATTTTGATGGATCCACCAATCTGTTCTCTGTGAG<br />
|-<br />
| p2Zv2Npu_F_Smt3 || GGTGGATCCATCAAAATAGCCACACGTAAATATTTAGGC<br />
|-<br />
| p2Zv2Npu_R_flag_Smt3 || CTTGTCGTCATCGTCTTTGTAGTCCATCTAGTATCTCCTTCTTAAAGTTAAACAAAATTATTCTC<br />
|-<br />
| h6-linker_F || TGTAGGCAGCCATCATCATCATCATCACAGCGGCCGTGGTAAA<br />
|-<br />
| h6-linker_R || AGCATTTACCACGGCCGCTGTGATGATGATGATGATGGCTGCC<br />
|-<br />
| flex-linker_F || TGTAGGTGGTTCTGGTGGTGGTTCTGGACGTGGTAAA<br />
|-<br />
| flex-linker_R || AGCATTTACCACGTCCAGAACCACCACCAGAACCACC<br />
|-<br />
| rigid-linker_F || TGTAGGTGGCGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCACCGCGTGGTAAA<br />
|-<br />
| rigid-linker_R || AGCATTTACCACGCGGTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCGCCACC<br />
|-<br />
| ccdB-pSBX4C5-mRFP(N)_F || AGAGACGACTGGCTGTGTATAAGGG<br />
|-<br />
| ccdB-pSBX4C5-mRFP-(N)_R || TGAGACCTATAAACGCAGAAAGGC<br />
|-<br />
| mRFP-pSBX4C5-ccdB-(C)_F || AGAGACCCAATACGCAAACCG<br />
|-<br />
| mRFP-pSBX4C5-ccdB-(C)_R || TGAGACGCGCGTGGATC<br />
|-<br />
| NpuDnaEN_F_C->G-BsaI-mRFP || GGCCTTTCTGCGTTTATAGGTCTCAGGCTTAAGCTATGAAACGGAAATATTGACA<br />
|-<br />
| NpuDnaEN_R BsmBI_ccdB || CCCTTATACACAGCCAGTCGTCTCTACCACCATTCGGCAAATTATCAACCCG<br />
|-<br />
| Npu DnaEC_F_BsmBI_ccdB || GATCCACGCGCGTCTCAGGTGGAATCAAAATAGCCACACGTAAATATTTAGG<br />
|-<br />
| NpuDnaEC_R SN->AG-BsaI-mRFP || CGGTTTGCGTATTGGGTCTCTGCCTGCAGCTATGAAGCCATTTTTGAGTG<br />
|-<br />
| Universal-S11N_F_BsaI_mRFP || GGCCTTTCTGCGTTTATAGGTCTC<br />
|-<br />
| Universal-S11N_R BsmBI_ccdB || CCCTTATACACAGCCAGTCGTC<br />
|-<br />
| Ssp DnaX-S11N_F_C->G_BsaI_mRFP || GGCCTTTCTGCGTTTATAGGTCTCAGGCTTAACCGGCGACAGCC<br />
|-<br />
| Ssp DnaX-S11C_F_BsmBI_ccdB || GATCCACGCGCGTCTCAGGTGGTGGCCTGCTGGTA<br />
|-<br />
| Ssp DnaX-S11C_R_BsaI_mRFP || CGGTTTGCGTATTGGGTCTCTGTTGTGTACCAGCAGGCCACCACC<br />
|-<br />
| Ssp DnaX-S11C_R || CGGTTTGCGTATTGGGTCTCTGCCTGCTACCAGCAGGCCACCACC<br />
|-<br />
| Ssp GyrB-S11N_F_C->G_BsaI_mRFP || GGCCTTTCTGCGTTTATAGGTCTCAGGCTTCAGCGGTGACACCCTG<br />
|-<br />
| Ssp GyrB-S11C_F_BsmBI_ccdB || GATCCACGCGCGTCTCAGGTGGTGGTGTTTTCGTT<br />
|- <br />
| Ssp GyrB-S11C_R_BsaI_mRFP || CGGTTTGCGTATTGGGTCTCTGTTGTGAACGAAAACACCACCACCTGAG<br />
|-<br />
| Ssp GyrB-S11C_R_BsaI_mRFP || CGGTTTGCGTATTGGGTCTCTGCCTGCAACGAAAACACCACCACCTGAG<br />
|-<br />
| Ter DnaE3-S11N_F_C->G_BsaI_mRFP || GGCCTTTCTGCGTTTATAGGTCTCAGGCTTAACTTACGAAACTGAGATCATGACC<br />
|-<br />
| Ter DnaE3-S11C_F_BsmBI_ccdB || GATCCACGCGCGTCTCAGGTGGTGGTCTGATCGCG<br />
|-<br />
| Ter DnaE3-S11C_R_BsaI_mRFP || CGGTTTGCGTATTGGGTCTCTGTTGCTCGCGATCAGACCACCACC<br />
|-<br />
| Ter DnaE3-S11C_R || CGGTTTGCGTATTGGGTCTCTGCCTGCCGCGATCAGACCACCACC<br />
|-<br />
| dnmt1insert_R_Flag_BsaI || GGTCTCAGAAGCTTGTCGTCATCGTCTTTGTAGTCTGCGCTGCTCAGCAGACACAG<br />
|-<br />
| DNMT1_Substrate_R_1stMedC || GAAGCTGGGACTTCCGGGAGCTTC[5MedC]GATCTGAGAGTGCAA<br />
|-<br />
| DNMT1_Substrate_F_1stMedC || TTGCACTCTCAGAT[5MedC]GGAAGCTCCCGGGAAGTCCCAGCTTC<br />
|-<br />
| DNMT1_Substrate_F_2MedC || TTGCACTCTCAGAT[5MedC]GGAAGCTCC[5MedC]GGGAAGTCCCAGCTTC<br />
|-<br />
| DNMT1_Substrate_F || TTGCACTCTCAGATCGGAAGCTCCCGGGAAGTCCCAGCTTC<br />
|-<br />
| DNMT1_Substrate_R || GAAGCTGGGACTTCCGGGAGCTTCCGATCTGAGAGTGCAA<br />
|-<br />
| DNMT1_Substrate_R_2MedC || GAAGCTGGGACTTC[5MedC]GGGAGCTTC[5MedC]GATCTGAGAGTGCAA<br />
|-<br />
| VF2-C7T || TGCCACTTGACGTCTAAGAA<br />
|-<br />
| sfGFP_T65C_F || CGACGCTGTGTTATGGTGTTCAGTGCTTTGCTC<br />
|-<br />
| sfGFP_T65C_R || GAACACCATAACACAGCGTCGTTACCAGAGTCG<br />
|-<br />
| rfp_F_BsaI || ACTTAACGCAAGAGACCCAATACGCAAACCGCCTCTCC<br />
|-<br />
| rfp_R_BsaI || ACTTTCGAAGTGAGACCTATAAACGCAGAAAGGCCCACCC<br />
|-<br />
| LiLaLy_F_BsaI || CTGGTCTCATAATAAATCGGTGAAATGCACGACTG<br />
|-<br />
| LiLaLy_R_IasB || CTGGTCTCTTACATCAATCTCTCTGACCGTTCCG<br />
|-<br />
| H6+exteins-insert_F || TGTAGGCAGCCATCATCATCATCATCACAGCGGCCGTGGTAAATGCTGGGAA<br />
|-<br />
| H6+exteins-insert_R || ATTATTCCCAGCATTTACCACGGCCGCTGTGATGATGATGATGATGGCTGCC<br />
|-<br />
| XylaLin_F_BsmBI || CTCGTCTCATAATAATACTAGTAGCGGCCGCTG<br />
|-<br />
| XylaLin_R_IBmsB || CTCGTCTCTCCACACTGTTACGTTAGAACTTCCAC<br />
|-<br />
| H6insert(Xyla)_F || GTGGGGCAGCCATCACCATCACCATCATAGTGGT<br />
|-<br />
| H6insert(Xyla)_R || ATTAACCACTATGATGGTGATGGTGATGGCTGCC<br />
|-<br />
| H6insert+exteins(Xyla)_F || GTGGCATCACCATCACCATCATCGTGGTAAATGCTGGGAA<br />
|-<br />
| H6insert+exteins(Xyla)_R || ATTATTCCCAGCATTTACCACGATGATGGTGATGGTGATG<br />
|-<br />
| H6Smt3_F_BBprefix || CGCTTCTAGATGGGCAGCAGCCATCATC<br />
|-<br />
| mRFPexp_F_H6-TEVc || CACAGCAGCGGCGAAAACCTGTACTTCCAGGGTAGAGACCAATACGCAAACCGCCTCTC<br />
|-<br />
| mRFPexp_F_Smt3-TEVc-BsaI || GTGGATCCGAAAACCTGTACTTCCAGGGTAGAGACCAATACGCAAACCGCCTCTC<br />
|-<br />
| mRFPexp_R_BBsuffix-mockSortAc || GCTACTAGTATTATTAGGTTTCCGGAAGTGAGACCTATAAACGCAGAAAGGCCCACC<br />
|-<br />
| pSB**3_F_mockSortAc || GGTCTCACTTCCGGAAACCTAATAATACTAGTAGCGGCCGCTGCAGTCC<br />
|-<br />
| pSB**3_R_Smt3 || GCTGCTGCCCATCTAGAAGCGGCCGCGAATTC<br />
|-<br />
| pSB**3_R_TEVc-H6 || GGTTTTCGCCGCTGCTGTGATGATGATGATGATGACTACTGCCCATCTAGAAGCGGCCGCGAATTC<br />
|-<br />
| Smt3_R_TEVc-BsaI || CTGGAAGTACAGGTTTTCGGATCCACCAATCTGTTCTCTGTGAG<br />
|-<br />
| mRFPexp_F_TEVc-BsaI || CAGTAGTGAGAATCTTTACTTCCAGGGTTGAGACCAATACGCAAACCGCCTCTCC<br />
|-<br />
| mRFPexp_R_BBsuffix-H6-SortAc || CTAGTATTATTAGTGATGGTGATGGTGATGACCACCAGTTTCAGGAAGTGAGACCTATAAACGCAGAAAGGCCCACC<br />
|-<br />
| pSB**3_R_TEVc-BsaI || CAACCCTGGAAGTAAAGATTCTCACTACTGCCCATCTAGAAGCGGCCGCGAATTCC<br />
|-<br />
| eGFP_F_BsaI-G5RM || CAGAACGGTCTCAGGGTGGAGGAGGAGGAAGAATGGTGAGCAAGGGCGAGGAGC<br />
|-<br />
| eGFP_R_BsaI || CAGAACGGTCTCAGAAGCTTGTACAGCTCGTCCATGCC<br />
|-<br />
| ccdB_F_BsaI-BsmBI || CAGAACGGTCTCACGCATGAGACGACTGGCTGTGTATAAGGGAGCCTGAC<br />
|-<br />
| ccdB_R_BsaI-BsmBI || CAGAACGGTCTCAGAAGTGAGACGCGCGTGGATCCGGCTTAC<br />
|-<br />
| DNMT1lnk_0901/1f-FLAG_F || CGCAGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTGATTATAAAGATGATGATGATAAA<br />
|-<br />
| DNMT1lnk_0901/1f-FLAG_R || CCAGTTTATCATCATCATCTTTATAATCACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC<br />
|-<br />
| DNMT1lnk_0825/1r-FLAG-p1F || CGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAA<br />
|-<br />
| DNMT1lnk_0825/1r-FLAG-p1R || TTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGC<br />
|-<br />
| DNMT1lnk_0825/1r-FLAG-p2F || AAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCAGCAAGCGGAGCAGCAGCAGAAGCAGCAGCAAAAGATTATAAAGATGATGATGATAAA<br />
|-<br />
| DNMT1lnk_0825/1r-FLAG-p2R || CCAGTTTATCATCATCATCTTTATAATCTTTTGCTGCTGCTTCTGCTGCTGCTCCGCTTGCTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGC<br />
|-<br />
| EX-BsaI-A-NN-IasB-S_F || AATTCGCGGCCGCTTCTAGAGGTCTCCGATGCCTGCCTGCTAGAGACCTGTCTA<br />
|-<br />
| EX-BsaI-A-NN-IasB-S_R || CTAGTAGACAGGTCTCTAGCAGGCAGGCATCGGAGACCTCTAGAAGCGGCCGCG<br />
|-<br />
| EX-BsaI-CC-O-IasB-S_F || AATTCGCGGCCGCTTCTAGAGGTCTCCCAACCCTGCCTAATAGAGACCTGTCTA<br />
|-<br />
| EX-BsaI-CC-O-IasB-S_R || CTAGTAGACAGGTCTCTATTAGGCAGGGTTGGGAGACCTCTAGAAGCGGCCGCG<br />
|-<br />
| SsrA-Ctag-BsaI-Cext_BsaI_F || CAACTGCTGGGAAGGAGGAGGTGCTGCTAACGACGAAAACTACGCTCTGGCTGCT<br />
|-<br />
| SsrA-Ctag-BsaI-Cext_BsaI_R || ATTAAGCAGCCAGAGCGTAGTTTTCGTCGTTAGCAGCACCTCCTCCTTCCCAGCA<br />
|-<br />
| MTS_bs_minD_C_term_F || CAACTGCTGGGAAGGAGGAGGTCCTTTACAGGTGCTTGAAGAGCAAAACAAAGGAATGATGGCTAAGATTAAGTCATTTTTCGGAGTAAGATCT<br />
|-<br />
| MTS_bs_minD_C_term_R || ATTAAGATCTTACTCCGAAAAATGACTTAATCTTAGCCATCATTCCTTTGTTTTGCTCTTCAAGCACCTGTAAAGGACCTCCTCCTTCCCAGCA<br />
|-<br />
| myristoilation-Ntag_F || GATGGGCATCGGCAAGTCCAAGGGCGGAGGCAGGGGCAAG<br />
|-<br />
| myristoilation-Ntag_R || AGCACTTGCCCCTGCCTCCGCCCTTGGACTTGCCGATGCC<br />
|-<br />
| NLS-Ntag_F || GATGCCCAAGAAAAAGCGCAAGGTAGGCGGAGGCAGGGGCAAG<br />
|-<br />
| NLS-Ntag_R || AGCACTTGCCCCTGCCTCCGCCTACCTTGCGCTTTTTCTTGGG<br />
|-<br />
| OmpA_linker-BsaI_F || GGCCTTGGTCTCAGATGCATATGAAAGCTACTAAACTGGTACTGG<br />
|-<br />
| OmpA_linker-BsaI_R || GGCCTTGGTCTCGAGCACTTGCCCCTAGAGCTCCCTCCTCCAGAAC<br />
|-<br />
| pel_B-Ntag_F || GATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCGGCGGAGGCAGGGGCAAG<br />
|-<br />
| pel_B-Ntag_R || AGCACTTGCCCCTGCCTCCGCCGGCCATCGCCGGCTGGGCAGCGAGGAGCAGCAGACCAGCAGCAGCGGTCGGCAGCAGGTATTT<br />
|-<br />
| PKI_NES-Ntag_F || GATGTTGGCTTTGAAATTGGCTGGTTTGGATATTGGCGGAGGCAGGGGCAAG<br />
|-<br />
| PKI_NES-Ntag_R || AGCACTTGCCCCTGCCTCCGCCAATATCCAAACCAGCCAATTTCAAAGCCAA<br />
|-<br />
| DNMT1_F_BsaI=CAAC-CWE || ATGTTCGGTCTCACAACTGCTGGGAAAAAGATCGCATTAGCTGGCTGGGTCAG<br />
|-<br />
| ccdB_R_BsmBI=ATCA-H5SGRGK-TGCT=BsaI || CAGAACGGTCTCAAGCATTTACCACGGCCGCTGTGATGATGATGATGATTGAGACGCGCGTGGATCCGGCTTAC<br />
|-<br />
| DMMT1_R_H6SGRGT-TGCT=BsaI || CAGAACGGTCTCAAGCAGGTACCACGGCCGCTGTGATGATGATGATGATGTGCGCTGCTCAGCAGACACAG<br />
|-<br />
| SSpDnaBC_F_ccdB-CN || ATCCACGCGCGTCTCAGGTGGTAGCACAGGAAAAAGAGTTTCTATTAAAG<br />
|-<br />
| SSpDnaBC_R_CC-mRFP || CGGTTTGCGTATTGGGTCTCTGTTGTGGACAATGATGTCATTGGC<br />
|-<br />
| SSpDnaBC_R_CC*-mRFP || CGGTTTGCGTATTGGGTCTCTGCCTGCGACAATGATGTCATTGGC<br />
|-<br />
| SspDnaBN_F_mRFP-NN || GCCTTTCTGCGTTTATAGGTCTCATGCTTATCTGGTGACTCTCTGATCTCTCTGG<br />
|-<br />
| SspDnaBN_F_mRFP-NN* || GCCTTTCTGCGTTTATAGGTCTCAGGCTTATCTGGTGACTCTCTGATCTCTCTGG<br />
|-<br />
| SspDnaBN_R_NC-ccdB || CCTTATACACAGCCAGTCGTCTCTACCACCACGGGACGCCAGAGAGATCAGAGAGTCACCAG<br />
|-<br />
| CBD_His_BsaI_f || ATGTATGGTCTCAGATGCATCATCACCATCACCACGGTGGAGGTACCACAAATCCTGGTGTATC<br />
|-<br />
| CBD_Nextein_BsaI_r || AAGTTCGGTCTCGAGCCACCAGATTCACGCAGTTGAAGCTGCCACAAGGC<br />
|-<br />
| DNMT1_F_BsaI=GGGT-G || ATGTTCGGTCTCAGGGTGGTAAAGATCGCATTAGCTGGCTGGGTCAG<br />
|-<br />
| AsLOV2-mutagenesis_middle_PstI_F || GAAACTGTAGGTTTCTACAAGGTCCTGAAAC<br />
|-<br />
| AsLOV2_mutagenesis_middle_PstI_R || AGGACCTTGTAGAAACCTACAGTTTCTTCC<br />
|-<br />
| ccdB_R_BsmBI=ATCA-H5SGRGT-TGCT=BsaI || CAGAACGGTCTCAAGCAGGTACCACGGCCGCTGTGATGATGATGATGATTGAGACGCGCGTGGATCCGGCTTAC<br />
|-<br />
| DNMT1lnk_0901/1f-FLAG_R_v2 || GAAGTTTATCATCATCATCTTTATAATCACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC<br />
|-<br />
| DNMT1lnk_0915/4r-FLAG_p2F || AAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCAAAAACCGCAGCAGCAGAAGCAGCAGCAAAAGATTATAAAGATGATGATGATAAA<br />
|-<br />
| DNMT1lnk_0915/3f_p1F || CGCAGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGT<br />
|-<br />
| DNMT1lnk_0915/3f_p1R || GCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC<br />
|-<br />
| DNMT1lnk_0915/3f_p2F || GGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCC<br />
|-<br />
| DNMT1lnk_0915/3f_p2R || TGATGGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC<br />
|-<br />
| rigid+exteins-insert_F || TGTAGGTGGCGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCACCGCGTGGTAAATGCTGGGAA<br />
|-<br />
| rigid+exteins-insert_R || ATTATTCCCAGCATTTACCACGCGGTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCGCCACC<br />
|-<br />
| DNMT1lnk_0915/4r-FLAG_p2R || GAAGTTTATCATCATCATCTTTATAATCTTTTGCTGCTGCTTCTGCTGCTGCGGTTTTTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGC<br />
|-<br />
| DNMT1lnk_0915/2r_p1F || CGCAGCGGAAGCGGCGGCGAAAAACGTGCTGGCGGAAGCGGCGGCGAAAGAAGCGGCGGCGAAAGAAGCGGCGGCGA<br />
|-<br />
| DNMT1lnk_0915/2r_p1R || TTCTTTCGCCGCCGCTTCTTTCGCCGCCGCTTCTTTCGCCGCCGCTTCCGCCAGCACGTTTTTCGCCGCCGCTTCCGC<br />
|-<br />
| DNMT1lnk_0915/2r_p2F || AAGAAGCGGCGGCGAAAGAAGCGGCGGCGAAAGCGAACGTGCTGGCGGAAGCGGCGGCGAAAGAAGCGGCGGCGAAAC<br />
|-<br />
| DNMT1lnk_0915/2r_p2R || TGATGTTTCGCCGCCGCTTCTTTCGCCGCCGCTTCCGCCAGCACGTTCGCTTTCGCCGCCGCTTCTTTCGCCGCCGC<br />
|-<br />
| DNMT1lnk_0915/6f_p1F || CGCAGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGG<br />
|-<br />
| DNMT1lnk_0915/6f_p1R || GCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACCGCTACCACCACC<br />
|-<br />
| DNMT1lnk_0915/6f_p2F || TAGCGGTGGTGGTAGCGGTGGTGGTAGCGGTGGTGGTAGCGATTATAAAGATGATGATGATAAA<br />
|-<br />
| DNMT1lnk_0915/6f_p2R || GAAGTTTATCATCATCATCTTTATAATCGCTACCACCACCGCTACCACCACCGCTACCACCACC<br />
|-<br />
| DNMT1lnk_0915/1r_p1F || CGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAAAC<br />
|-<br />
| DNMT1lnk_0915/1r_p1R || GCACGTTTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGC<br />
|-<br />
| DNMT1lnk_0915/1r_p2F || GTGCTGGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAA<br />
|-<br />
| DNMT1lnk_0915/1r_p2R || TTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCCA<br />
|-<br />
| DNMT1lnk_0915/1r_p3F || AAGAAGCAGCAGCAAAAGCTAACGTGCTGGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAA<br />
|-<br />
| DNMT1lnk_0915/1r_p3R || GAAGTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCCAGCACGTTAGCTTTTGCTGCTGC<br />
|-<br />
| Backbone-H6_R || GATCCGTGGTGGTGGTGGTGG<br />
|-<br />
| H6-Backbone_F || GGTGGTCATCATCATCATCATCATTAATAATACTAGTAG<br />
|-<br />
| LOV-6_R_SspDnaXC || GCAGTTGTGTACCAGCAGGCCTTCTTTCGCCGCTTCATCAATATTTTGTGCAGTTTTCTTAATCAGCATGAC<br />
|-<br />
| LOV-12_R_BsaIIasB || CGAGACCACCTTATTGGTCTCCAATATTTTGTGCAGTTTTCTTAATCAGCATGAC<br />
|-<br />
| LOV-12_R_SspDnaXC || GCAGTTGTGTACCAGCAGGCCAATATTTTGTGCAGTTTTCTTAATCAGCATGAC<br />
|-<br />
| sfGFPC_F_BsaIIasB || GGAGACCAATAAGGTGGTCTCGTGCTATGGTGTTCAGTGCTTTGC<br />
|-<br />
| sfGFPC_F_SspDnaXC || GCCTGCTGGTACACAACTGCTATGGTGTTCAGTGCTTTGC<br />
|-<br />
| sfGFPC_R_H6 || ATGATGATGATGATGATGACCACCTTTGTACAGTTCATCCATACCATGCG<br />
|-<br />
| sfGFPN_F_H6 || CACCACCACCACGGATCACGTAAAGGCGAAGAGCTGTTC<br />
|-<br />
| sfGFPN_R_SspDnaXN || CTGGCTGTCGCCGGTTAAGCACAGCGTCGTTACCAGAG<br />
|-<br />
| sfGFPN_R_SspDnaXN* || CTGGCTGTCGCCGGTTAAACCCAGCGTCGTTACCAG<br />
|-<br />
| SspDnaXN_F || TTAACCGGCGACAGCC<br />
|-<br />
| SspDnaXC*-sfGFP_F_H6 || CACCACCACCACGGATCAGGCCTGCTGGTAGCTGGTTGCTATGGTGTTCAGTGCTTTGC<br />
|-<br />
| SspDnaXC-sfGFP_F_H6 || CACCACCACCACGGATCAGGCCTGCTGGTACACAACTGCTATGGTGTTCAGTGCTTTGC<br />
|-<br />
| SspDnaXN_R_H6 || ATGATGATGATGATGATGACCACCGTTTGCAACGAAG<br />
|-<br />
| mRFP2-168_F_H6 || CACCACCACCACGGATCAGCTTCCTCCGAAGACGTTATC<br />
|-<br />
| mRFP2-168_R_SspDnaXN || CTGGCTGTCGCCGGTTAAGCATTCGTCGATACCAGATCCTTTCAGTTTCAGACGCATTTTG<br />
|-<br />
| mRFP2-168_R_SspDnaXN* || CTGGCTGTCGCCGGTTAAACCTTCGTCGATACCAGATCCTTTCAGTTTCAGACGCATTTTG<br />
|-<br />
| mRFP169-225_F_-6-SspDnaXC-Ext || GCCTGCTGGTACACAACTGCCACACCGACGGTGGTCACTACGACGC<br />
|-<br />
| mRFP169-225_F_-12-SspDnaXC-Ext-Jalpha || GCCTGCTGGTACACAACTGCCACACCGCGAACCTGGACGGTGGTCACTACGACGC<br />
|-<br />
| mRFP169-225_F_BsaIIasB || GGAGACCAATAAGGTGGTCTCGGGTGGTCACTACGACGCTGAAG<br />
|-<br />
| mRFP169-225_F_H6-SspDnaXC || CACCACCACCACGGATCAGGCCTGCTGGTACACAACTGCCACACCGACGGTGGTCACTACGACGC<br />
|-<br />
| mRFP169-255_F_H6-SspDnaXC* || CACCACCACCACGGATCAGGCCTGCTGGTAGCTGGTTGCCACACCGACGGTGGTCACTACGACGC<br />
|-<br />
| mRFP169-255_R_H6 || ATGATGATGATGATGATGACCACCAGCACCGGTGGAGTGACG<br />
|-<br />
| LOV_F_H6 || CACCACCACCACGGATCATTGGCTACTACACTTGAACGTATTG<br />
|-<br />
| GFPc*158-238_F_NWC_CAAC_BsaI || GCATGGTCTCAAGGCTGCTGGAACCAAAAGAATGGAATCAAAGTTAACTTC<br />
|-<br />
| GFPc*_R_H6_TAAT=IasB || CGTAGGTCTCTATTAGTGGTGATGGTGATGATGTTTGTATAGTTCATCCATGCCATG<br />
|-<br />
| GFPn*1-157_R_KGG_GGCT=IasB || CGTAGGTCTCGAGCCCTTACCTCCTTTGTCTGCCATGATGTATACATTG<br />
|-<br />
| GFPn*_F_H6_GATG_BsaI || GCATGGTCTCAGATGCATCATCACCATCACCACCGTAAAGGAGAAGAACTTTTCACTG<br />
|-<br />
| mCherryC*169-236_F_BsaI=AGGC-NWC || GCATGGTCTCAAGGCTGCTGGAACAGGCTGAAGCTGAAGGACG<br />
|-<br />
| mCherryC*_R_H6-TAAT=IasB || CGTAGGTCTCTATTAGTGGTGATGGTGATGATGCTTGTACAGCTCGTCCATGC<br />
|-<br />
| mCherryN*1-168_R_KGG-GGCT=IasB || CGTAGGTCTCAAGCCCTTACCTCCCTGCTTGATCTCGCCCTT<br />
|-<br />
| mCherryN*_F_BsaI=GATG-H6 || GCATGGTCTCAGATGCATCATCACCATCACCACGTGAGCAAGGGCGAGG<br />
|-<br />
| mRFPc*155-225_F_BsaI=AGGC-NWC || GCATGGTCTCAAGGCTGCTGGAACGGTGCTCTGAAAGGTGAAATC<br />
|-<br />
| mRFPc*169-225_F_BsaI=AGGC-NWC || GCATGGTCTCAAGGCTGCTGGAACGACGGTGGTCACTACGACG<br />
|-<br />
| mRFPc*_R_H6_TAAT=IasB || CGTAGGTCTCTATTAGTGGTGATGGTGATGATGAGCACCGGTGGAGTG<br />
|-<br />
| mRFPn*1-154_R_KGG-GGCT=IasB || CGTAGGTCTCAAGCCCTTACCTCCGTCTTCCGGGTACATACGTTC<br />
|-<br />
| mRFPn*1-168_R_KGG-GGCT=IasB || CGTAGGTCTCAAGCCCTTACCTCCTTTCAGTTTCAGACGCATTTTG<br />
|-<br />
| mRFPn*_F_H6_BsaI=GATG || GCATGGTCTCAGATGCATCATCACCATCACCACGCTTCCTCCGAAGACGTTATC<br />
|-<br />
| mRFP_F_BsmBI=GATG=IasB || AATTATCGTCTCAGATGAGAGACCCAATACGCA<br />
|-<br />
| mRFP_R_BsaI=GGTG=IBmsB || TAATATCGTCTCACACCTGAGACCTATAAACGCAG<br />
|-<br />
| mRFP_F_BsmBI=TGGT=IasB || AATTATCGTCTCATGGTAGAGACCCAATACGCAA<br />
|-<br />
| mRFP_R_BsaI=TAAT=IBmsB || TAATATCGTCTCAATTATGAGACCTATAAACGCAGAAAGG<br />
|-<br />
| bad1_F1 || TGTAGGTGGTGCAGAAGCAGCTGCTAAAGAAGCAGCAGCTAAAGTTAACCTGACCGCTGCTGAAGCT<br />
|-<br />
| bad1_R1 || TGCTGCAGCTTCAGCAGCGGTCAGGTTAACTTTAGCTGCTGCTTCTTTAGCAGCTGCTTCTGCACCACC<br />
|-<br />
| bad1_F2 || GCAGCAAAAGAAGCTGCAGCTAAAGTGAACCTGACCGCAGCAGAAGCTGCTGCAAAACGCGGTACC<br />
|-<br />
| bad1_R2 || AGCAGGTACCGCGTTTTGCAGCAGCTTCTGCTGCGGTCAGGTTCACTTTAGCTGCAGCTTCTTT<br />
|-<br />
| may1_F1 || TGTAGGTGGTGCAGAAGCTGCTGCTAAAGAAGCTGCTGCAAAAGCAGCAGCTGCACATCCGGAAGCTGCAGAAGCTGC<br />
|-<br />
| may1_R1 || TTTGCTGCAGCTTCTGCAGCTTCCGGATGTGCAGCTGCTGCTTTTGCAGCAGCTTCTTTAGCAGCAGCTTCTGCACCACC<br />
|-<br />
| may1_F2 || AGCAAAAGAAGCTGCAGCTAAAGCTAAAACCGCTGCTGAAGCTGCAGCAAAAGAAGCTGCAGCGAAAGCACGCGGTACC<br />
|-<br />
| may1_R2 || AGCAGGTACCGCGTGCTTTCGCTGCAGCTTCTTTTGCTGCAGCTTCAGCAGCGGTTTTAGCTTTAGCTGCAGCTTCT<br />
|-<br />
| sgt1_F || TGTAGGTGGTGCAGAAGCAGCTGCTAAAGAAGCTGCTGCAAAACGCGGTACC<br />
|-<br />
| sgt1_R || AGCAGGTACCGCGTTTTGCAGCAGCTTCTTTAGCAGCTGCTTCTGCACCACC<br />
|-<br />
| sgt2_F || TGTAGGTGGTGCTGAAGCTGCAGCAAAAGCTGCAGCACATCCGGAAGCTGCAGAAGCTGCAGCTAAACGCGGTACC<br />
|-<br />
| sgt2_R || AGCAGGTACCGCGTTTAGCTGCAGCTTCTGCAGCTTCCGGATGTGCTGCAGCTTTTGCTGCAGCTTCAGCACCACC<br />
|-<br />
| sho1_F || TGTAGGTGGTCGCGGTACC<br />
|-<br />
| sho1_R || AGCAGGTACCGCGACCACC<br />
|-<br />
| sho2_F || TGTAGGTGGTGCAGAAGCAGCTGCTAAACGCGGTACC<br />
|-<br />
| sho2_R || AGCAGGTACCGCGTTTAGCAGCTGCTTCTGCACCACC<br />
|-<br />
| LacI_F_VR || CAGCTCACTCAAAGGCGGTAATACTTTACGGCTAGCTCAGTCCTAGG<br />
|-<br />
| LacI_R_pSB*C3 || GTTATCCCCTGATTCTGTGGATAACCTTATTACTGCCCGCTTTCCAGTC<br />
|-<br />
| pSB*C3_F || GGTTATCCACAGAATCAGGGG<br />
|-<br />
| pSB*C3_R || GTATTACCGCCTTTGAGTGAGC<br />
|-<br />
| mRFP169-225_F_GSGIDECHT || GATCTGGTATCGACGAATGCCACACCGACGGTGGTCACTACGACGC<br />
|-<br />
| mRFP169-225_F_GSGIDECHT-Jalpha || GATCTGGTATCGACGAATGCCACACCGCGAACCTGGACGGTGGTCACTACGACGC<br />
|-<br />
| mRFP2-168_R_GSGIDECHT || GGTGTGGCATTCGTCGATACCAGATCCTTTCAGTTTCAGACGCATTTTG<br />
|-<br />
| DNMT1lnk_0917/1r_p1F || CGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGTAAATC<br />
|-<br />
| DNMT1lnk_0917/1r_p1R || GTAAGATTTACTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGC<br />
|-<br />
| DNMT1lnk_0917/1r_p2F || TTACAGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAA<br />
|-<br />
| DNMT1lnk_0917/1r_p2R || TTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCTGCT<br />
|-<br />
| DNMT1lnk_0917/1r_p3F || AAGAAGCAGCAGCAAAAGCTGTAAATCTTACAGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAA<br />
|-<br />
| DNMT1lnk_0917/1r_p3R || GAAGTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCTGCTGTAAGATTTACAGCTTTTGCTGCTGC<br />
|-<br />
| DNMT1lnk_0917/2r_p1F || CGCAGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGTAAATCTTACAGCAGCAGAAG<br />
|-<br />
| DNMT1lnk_0917/2r_p1R || GCTGCTTCTGCTGCTGTAAGATTTACTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGC<br />
|-<br />
| DNMT1lnk_0917/2r_p2F || CAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGAAGCAGCAGCAAA<br />
|-<br />
| DNMT1lnk_0917/2r_p2R || TTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTTTTGCT<br />
|-<br />
| DNMT1lnk_0917/2r_p3F || AGAAGCAGCAGCAAAAGCAGTAAATCTTACAGCAGCAGAAGCAGCAGCAAAAGCAC<br />
|-<br />
| DNMT1lnk_0917/2r_p3R || TGATGTGCTTTTGCTGCTGCTTCTGCTGCTGTAAGATTTACTGCTTTTGCTGCTGC<br />
|-<br />
| mRFPexp_R_BsmBI=ATCA-H5SGRGT-TGCT=BsaI || CAGAACGGTCTCAAGCAGGTACCACGGCCGCTGTGATGATGATGATGATGGAGACGTATAAACGCAGAAAGGCCCACC<br />
|-<br />
| mut-noPstIT-3A-GateNpuDnaE(C)SN->AG_F || GGCTTCATAGCAGCAGGCAGAGACCCAATAC<br />
|-<br />
| mut-noPstIT-3A-GateNpuDnaE(C)SN->AG_R || CTGCCTGCTGCTATGAAGCCATTTTTGAGTG<br />
|-<br />
| SspDnaE(N)_F_mRFP-NN || GCCTTTCTGCGTTTATAGGTCTCATGCTTAAGTTTTGGTACCGAAATTTTAACC<br />
|-<br />
| SspDnaE(N)_R_NC-ccdB || CCTTATACACAGCCAGTCGTCTCTACCACCACGGGATTTAATTGTACCTGCGTCAAGTAATG<br />
|-<br />
| SSpDnaE(C)_F_ccdB-CN || ATCCACGCGCGTCTCAGGTGGTGTTAAAGTTATCGGTCGTCGATC<br />
|-<br />
| SSpDnaE(C)_R_CC-mRFP || CGGTTTGCGTATTGGGTCTCTGTTGGCGGCGATAGC<br />
|-<br />
| univ#1long_F || TGTAGGTGGTGCAGAAGCAGCAGCTAAAGAAGCT<br />
|-<br />
| univ#1long_R || AGCTGCAGCTTCTTTAGCTGCTGCTTCTGCACCACC<br />
|-<br />
| univ#1short_F || TGTAGGTGGTGCAGAAGCTGCT<br />
|-<br />
| univ#1short_R || CTTTGCAGCAGCTTCTGCACCACC<br />
|-<br />
| univ#3_F || GCTGAAGCAGCTGCTAAAGAAGCAGCAGCTAAAGAAGCTGCTGCTAAAGAAGCTGCAGCTAAAGAAGCAGCTGCT<br />
|-<br />
| univ#3_R || TGCCTTAGCAGCTGCTTCTTTAGCTGCAGCTTCTTTAGCAGCAGCTTCTTTAGCTGCTGCTTCTTTAGCAGCTGC<br />
|-<br />
| bad2#2_F || GCAAAGGTGAACCTGACAGCT<br />
|-<br />
| bad2#2_R || TTCAGCAGCTGTCAGGTTCAC<br />
|-<br />
| bad2#4_F || AAGGCAAAAACCGCAGCTGAAGCTGCTGCAAAAGAAGCTGCAGCTAAAGAAGCTGCTGCAAAAGCTCGTGGTACC<br />
|-<br />
| bad2#4_R || AGCAGGTACCACGAGCTTTTGCAGCAGCTTCTTTAGCTGCAGCTTCTTTTGCAGCAGCTTCAGCTGCGGTTTT<br />
|-<br />
| bad3#2_F || GCAAAGGCATCTCTGCCGGCAGCT<br />
|-<br />
| bad3#2_R || TTCAGCAGCTGCCGGCAGAGATGC<br />
|-<br />
| bad3#4_F || AAGGCAAACGTGCTGGCAGAAGCAGCTGCTAAAGCACGTGGTACC<br />
|-<br />
| bad3#4_R || AGCAGGTACCACGTGCTTTAGCAGCTGCTTCTGCCAGCACGTT<br />
|-<br />
| bad4#2_F || GCAGCTAAAGAAGCTGCTGCTAAAGAAGCAGCTGCTAAAGAAGCAGCAGCTAAAGCTGTGAACCTGACCGCA<br />
|-<br />
| bad4#2_R || TTCAGCTGCGGTCAGGTTCACAGCTTTAGCTGCTGCTTCTTTAGCAGCTGCTTCTTTAGCAGCAGCTTCTTT<br />
|-<br />
| bad4#4_F || AAGGCAGTGAACCTGACCGCAGCTGAAGCTGCAGCTAAAGAAGCAGCTGCTAA<br />
|-<br />
| bad4#4_R || GCTTCTTTAGCAGCTGCTTCTTTAGCTGCAGCTTCAGCTGCGGTCAGGTTCAC<br />
|-<br />
| bad4#5_F || AGAAGCAGCTGCTAAAGAAGCAGCTGCTAAAGAAGCAGCTGCTAAAGCACGTGGTACC<br />
|-<br />
| bad4#5_R || AGCAGGTACCACGTGCTTTAGCAGCTGCTTCTTTAGCAGCTGCTTCTTTAGCAGCT<br />
|-<br />
| may2#2_F || GCAAAGGCTAAAACCGCTGCTGAAGCAGCAGCTAAAGAAGCAGCTGCGAAACGTGGTACC<br />
|-<br />
| may2#2_R || AGCAGGTACCACGTTTCGCAGCTGCTTCTTTAGCTGCTGCTTCAGCAGCGGTTTTAGC<br />
|-<br />
| may3#2_F || GCAGCTAAAGCTACCGGTGATCTGGCTGCAGAAGCAGCTGCAAAAGAAGCTGCTGCAAAAGCTCGCGGTACC<br />
|-<br />
| may3#2_R || AGCAGGTACCGCGAGCTTTTGCAGCAGCTTCTTTTGCAGCTGCTTCTGCAGCCAGATCACCGGTAGCTTT<br />
|-<br />
| ord1#2_F || GCAGCTAAAGCTACCGGTGATCTGGCTGCTGAAGCAGCAGCTAAAGCTGCACGTGGTACC<br />
|-<br />
| ord1#2_R || AGCAGGTACCACGTGCAGCTTTAGCTGCTGCTTCAGCAGCCAGATCACCGGTAGCTTT<br />
|-<br />
| ord2#2_F || GCAAAGGCTGCTGCAGCTGATGGTACCCTGGCAGAAGCTGCTGCTAAAGCAGCTCGTGGTACC<br />
|-<br />
| ord2#2_R || AGCAGGTACCACGAGCTGCTTTAGCAGCAGCTTCTGCCAGGGTACCATCAGCTGCAGCAGC<br />
|-<br />
| ord3#2_F || GCAGCTAAAGCTAGCCTGCCGGCTGCTGCAGAAGCTGCTGCAAAAGAAGCTGCAGCTAAACGTGGTACC<br />
|-<br />
| ord3#2_R || AGCAGGTACCACGTTTAGCTGCAGCTTCTTTTGCAGCAGCTTCTGCAGCAGCCGGCAGGCTAGCTTT<br />
|-<br />
| ord4#2_F || GCAGCTAAAGCTACCGGTGATCTGGCAGCAGAAGCTGCAGCTAAACGTGGTACC<br />
|-<br />
| ord4#2_R || AGCAGGTACCACGTTTAGCTGCAGCTTCTGCTGCCAGATCACCGGTAGCTTT<br />
|-<br />
| ord5#2_F || GCAAAGGCTGCTACCGGTGATCTGGCAGCAGAAGCAGCTGCTAAAGCACGTGGTACC<br />
|-<br />
| ord5#2_R || AGCAGGTACCACGTGCTTTAGCAGCTGCTTCTGCTGCCAGATCACCGGTAGCAGC<br />
|-<br />
| ord6#2_F || GCAAAGGCTAGCCTGCCGGCTGCAGCTGAAGCTGCAGCGAAAGAAGCAGCAGCTAAAGCTCGCGGTACC<br />
|-<br />
| ord6#2_R || AGCAGGTACCGCGAGCTTTAGCTGCTGCTTCTTTCGCTGCAGCTTCAGCTGCAGCCGGCAGGCTAGC<br />
|-<br />
| sgt3#2_F || GCAAAGGTGAACCTGACCGCTGCTGAAGCTGCAGCTAAACGTGGTACC<br />
|-<br />
| sgt3#2_R || AGCAGGTACCACGTTTAGCTGCAGCTTCAGCAGCGGTCAGGTTCAC<br />
|-<br />
| sgt4#2_F || GCAAAGGCTGCAGCACATCCGGAAGCTGCTGAAGCAGCTGCAAAAGCACGTGGTACC<br />
|-<br />
| sgt4#2_R || AGCAGGTACCACGTGCTTTTGCAGCTGCTTCAGCAGCTTCCGGATGTGCTGCAGC<br />
|-<br />
| sho3#2_F || GCAAAGGCTACCGGTGATCTGGCAGAAGCAGCTGCTAAACGTGGTACC<br />
|-<br />
| sho3#2_R || AGCAGGTACCACGTTTAGCAGCTGCTTCTGCCAGATCACCGGTAGC<br />
|-<br />
| rigid_RGT_F || TGTAGGTGGCGCAGAAGCAGCAGCAAAAGAAGCAGCAGCAAAAGCAGCACCGCGTGGTACC<br />
|-<br />
| rigid_RGT_R || AGCAGGTACCACGCGGTGCTGCTTTTGCTGCTGCTTCTTTTGCTGCTGCTTCTGCGCCACC<br />
|-<br />
| ccdB_R_BsmBI=ATCA-H5SGRGT-TGCT=BsaI || CAGAACGGTCTCAAGCAGGTACCACGGCCGCTGTGATGATGATGATGATTGAGACGCGCGTGGATCCGGCTTAC<br />
|-<br />
| ccdB_R_BsmBI=ATCA-H5SGRGT-iGEMHD || CGTGCATTTCACCGATTTATTAGGTACCACGGCCGCTGTGATGATGATGATGATTGAGACGCGCGTGGATCCGGCTTAC<br />
|-<br />
| Smt3_F_T7RBS || TTTGTTTAACTTTAAGAAGGAGATACTAGATGTCGGACTCAGAAGTCAATCAAGAAG<br />
|-<br />
| DNMT1_F_Smt3-CWE || GTGGATGCTGGGAAAAAGATCGCATTAGCTGGCTGG<br />
|-<br />
| Smt3_R_CWE-DNMT1 || TCTTTTTCCCAGCATCCACCAATCTGTTCTCTGTGAGC<br />
|-<br />
| DNMT1_R_H6SGRGT-iGEMHD || CGTGCATTTCACCGATTTATTAGGTACCACGGCCGCTGTGATGATGATGATGATGTGCGCTGCTCAGCAGACAC<br />
|-<br />
| DNMT1_R_RFC10suffix || TGCAGCGGCCGCTACTAGTATTATTATGCGCTGCTCAGCAGAC<br />
|-<br />
| DNMT1/BB1_R_DNMT1/BB2 || CATACTGACCTGCTTGCAGAACACCAAAGG<br />
|-<br />
| DNMT1/BB2_F_DNMT1/BB1 || GGTGTTCTGCAAGCAGGTCAGTATGGTGTTGC<br />
|-<br />
| DNMT1/BB2_R_DNMT1/BB3 || CATCATGAAAGGTATATTGCAGTTTATGTGCAATAAC<br />
|-<br />
| DNMT1/BB3_F_DNMT1/BB2 || GCACATAAACTGCAATATACCTTTCATGATGTG<br />
|-<br />
| pSB**3_F_TAATAA || TAATAATACTAGTAGCGGCCGCTGCAGTCC<br />
|-<br />
| Cas9CtrlSplit1_Fw || TGCTTCAACGGCGATAGCCTGCACGAG<br />
|-<br />
| Cas9CtrlSplit1_Re || GTTGAAGCAGGACACCTGGGCTTTCTGG<br />
|-<br />
| Cas9CtrlSplit2_Fw || GCCAGAGAGTACTGCTTCAACCAGACCACCCAGAAGG<br />
|-<br />
| Cas9CtrlSplit2_Re || CTGGTTGAAGCAGTACTCTCTGGCCATTTCGATC<br />
|-<br />
| Cas9Split1C_F_CFN_NpuDnaEC || CAACTGCTTCAACGGCGATAGTCTGCACGAGCAC<br />
|-<br />
| Cas9Split1N_R_NpuDnaEN || CATAGCTCAAGCAGGACACCTGGGCTTTCTGGATG<br />
|-<br />
| Cas9Split2C_F_CF_NpuDnaEC || CCAACTGCTTCAACCAGACCACCCAGAAGGG<br />
|-<br />
| Cas9Split2N_R_Y_NpuDnaEN || CATAGCTCAAGCAGTACTCTCTGGCCATTTCGATC<br />
|-<br />
| mCherry_Fw_BamHI || ATCGCGGATCCGGCACCATGGTGAGCAAGGGCGAGGAG<br />
|-<br />
| mCherry_Rv_HindIII || GCGATAAGCTTCTACTTGTACAGCTCGTCCATGCCGC<br />
|-<br />
| NpuDnaECSplit1&2C_F_NLS_Flag || AGACGATGACGATAAGCCAAAGAAGAAGCGGAAGGTCGGTGGTATCAAAATAGCCACACGTAAATATTTAGGC<br />
|-<br />
| NpuDnaECSplit1C_R_CFN_Cas9Split1C || CTATCGCCGTTGAAGCAGTTGGAAGCTATGAAGCCATTTTTG<br />
|-<br />
| NpuDnaECSplit2C_R_CF_Cas9Split2C || GTGGTCTGGTTGAAGCAGTTGGAAGCTATGAAGCCATTTTTG<br />
|-<br />
| NpuDnaENSplit1&2N_R_NLS || CTCCGTGGATACCGACCTTCCGCTTCTTCTTTGGGGCACCACCATTCGGCAAATTATCAACCC<br />
|-<br />
| NpuDnaENSplit1N_F_Cas9Split1N || CCAGGTGTCCTGCTTGAGCTATGAAACGG<br />
|-<br />
| NpuDnaENSplit2N_Fw_Y_Cas9Split2N || GCCAGAGAGTACTGCTTGAGCTATGAAACGG<br />
|-<br />
| PCDna3.1Split1&2C_R_Flag_NLS || CTTCTTTGGCTTATCGTCATCGTCTTTGTAATCCATGGTGGCGGATCCACTAG<br />
|-<br />
| PCDna3.1Split1N_F_NLS || GAAGGTCGGTATCCACGGAGTCCCAGCAGCCTGAAAGCTTAAGTTTAAACCGCTGATCAGC<br />
|-<br />
| PCDna3.1Split2N_F_NLS || GAAGGTCGGTATCCACGGAGTCCCAGCAGCCTGAAAGCTTAAGTTTAAACCGCTG<br />
|-<br />
| FS_47_Cas9#49535_BamHI_fw || ATCGCGGATCCGCCACCATGGATTAC<br />
|-<br />
| FS_48_Cas9#49535_HindIII_rv || GCGATAAGCTTTTTCTTTTTCTTAGCTTGACCAGC<br />
|-<br />
| LOV-muta-PstI-middle2_F || GTGAAGAAATTTTGGGAAGAAACTGTAGGTTTCTACAAGGTCCTG<br />
|-<br />
| LOV-muta-PstI-middle2_R || CAGTTTCAGGACCTTGTAGAAACCTACAGTTTCTTCCCAAAATTTC<br />
|}<br />
<br/><br />
<br />
=Plasmids=<br />
<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
!Name!!Date!!Brief Description!!Genotype!!Plasmid Map!!GenBank-File<br />
|-<br />
| pJJDuet30 || https://www.addgene.org/11962/ || || || ||<br />
|-<br />
| pSFBAD09 || https://www.addgene.org/11963/ || || || ||<br />
|-<br />
| pHYRSF1 || https://www.addgene.org/34549/ || || || ||<br />
|-<br />
| pHYRSF1-02 || https://www.addgene.org/24765/ || || || ||<br />
|-<br />
| pGBMCS-SortA || https://www.addgene.org/21931/ || || || ||<br />
<br />
|}<br />
<br />
= Instruments =<br />
<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Instrument !! Type !! Manufacturer<br />
|-<br />
|Table Centrifuge || Microfuge® 18 Centrifuge || Beckman CoulterTM<br />
|-<br />
|Table Centrifuge || Microfuge® 22R Centrifuge || Beckman CoulterTM<br />
|-<br />
|Centrifuge || Allegra X-12R || Beckman CoulterTM<br />
|-<br />
|Shaker || VORTEXGENIE 2 || Scientific Industries, SITM<br />
|-<br />
|Heating plate (magnet stirrer)||MR Hei-Standard ||Heidolph<br />
|-<br />
|Heatblock || QBD4 ||Grant<br />
|-<br />
|Heatblock (shakeing function) || Thermomixer comfort ||Eppendorf<br />
|-<br />
|PCR-Machine||MyCyclerTM thermo cycler||BioRad<br />
|-<br />
|PCR-Machine||T100 Therma Cycler||BioRad<br />
|-<br />
|UV-Chamber || Transluminator ||Vilber Lourmat<br />
|-<br />
|Scale (fine)||PioneerTM PA114C ||OHAUS<br />
|-<br />
|Scale||PioneerTM PA4101C ||OHAUS<br />
|-<br />
|FACS || Cytomics FC 500 MPL || Beckman Coulter<br />
|-<br />
|Fridge ||KTP 1750 Premium ||Liebherr<br />
|-<br />
|Freezer ||GP 1366 Premium ||Liebherr<br />
|-<br />
|-86 Freezer||-86°C Ultralow Freezer ||NUAIRETM<br />
|-<br />
|Hood||Tischabzug||Wesemann® Laboreinrichtung<br />
|-<br />
|Draw-Off Pump||Vacuhand control||Vacubrand<br />
|-<br />
|Incubator ||HT Multitron Version 2 ||INFORS<br />
|-<br />
|Plate Reader || Infinite M200 || Tecan<br />
|-<br />
|Computer || || Sun Microsystems<br />
|-<br />
| UV/VIS Spectrometer ||Ultrospec 3300 pro ||Amersham Biosciences<br />
|-<br />
|Photometer || NanoDrop® ND-1000 Spectrophotometer|| peQLab Biotechnologie GmbH<br />
|-<br />
|Photometer ||NanoVue || General Electric<br />
|-<br />
|Ice Machine || MF22||SCOTSMAN®<br />
|-<br />
|Gel Electrophoresis Chamber || Mupid®-One || Advance<br />
|-<br />
|Mini-PROTEAN Tetra Cell || 165-8001 || BioRad<br />
|-<br />
|Cell Density Meter|| Ultrospec10 || Amersham Biosciences<br />
|-<br />
|PH-Meter|| PH-Meter 765 Calimatic || Knick<br />
|-<br />
|Incubator || Heraeus || Thermo Scientific<br />
|-<br />
|Lyophilizer ||Gefriertrocknungsanlage ALPHA 1-2 LD Plus Best. Nr. 101521 ||Christ<br />
|-<br />
|Ultra Sonification Stick ||Sonoplus Gm 2070 (2002)||Bandelin<br />
|-<br />
|Vacuum Manifold || Qiavac 24 Plus|| QIAGEN<br />
|-<br />
|Gas Cartridge Ventil CV470|| Burner || 13883<br />
|-<br />
|NuPAGE(R) Novex 3-8% Tris-Acetate Gel 1|| SDS-Gel || Life Technologies GmbH<br />
|}<br />
<br/><br />
<br />
=Lab Materials=<br />
<br />
{|class="wikitable sortable table table-hover"<br />
|-<br />
! Material !! Name !! Manufacturer<br />
|-<br />
| Bottle 50 ml, 100 ml, 200 ml, 500 ml, 1000 ml || ||<br />
|-<br />
| Beaker 50 ml, 100 ml, 200 ml, 500 ml 1000 ml || ||<br />
|-<br />
| Conical Flask 500 ml, 1000 ml, 100 ml || ||<br />
|-<br />
| Conical Flask 300 ml || ||<br />
|-<br />
| Single Channel Pipette || Pipetman® P2, P20, P200, P1000 ||Gilson<br />
|-<br />
| Multichannel Pipette || ||<br />
|-<br />
| Multistep Pipette || ||<br />
|-<br />
| Pipette || ||<br />
|-<br />
| Scalpels || Bayha || 13569<br />
|-<br />
| HISTRAP HP 5 X 1 ML, 5 EA || Th. Geyer GmbH || AM/17524701/000001<br />
|-<br />
| neoScrew-Microtubes 1,5 ml|| NEOLAB GMBH || 290174576<br />
|-<br />
| CM SEPHADEX || Sigma-Aldrich Chemie GmbH || C50120-10G<br />
|-<br />
| Dialysis Tubing || 1784.1 || Carl Roth GmbH<br />
|-<br />
| Amicon Ultra 15ml 30K 8pk|| UFC903008 || Merck Chemicals GmbH<br />
|-<br />
| 0.2 ml PCR Tube, Flat Cap, Natural || I1402-8200 || Starlab GmbH<br />
|-<br />
| KLEENEX KIMWIPES || Kimberly-Clark || 4254 <br />
|-<br />
| Microcentrifuge Tubes || ||<br />
|-<br />
| Centrifugetubes || ||<br />
|-<br />
| PCR 8-Strips || ||<br />
|-<br />
| Gloves Nitril Gr. L || Starlab powderfree || Starlab<br />
|-<br />
| Gloves Nitril Gr. M || Starlab powderfree || Starlab<br />
|-<br />
| Gloves Nitril Gr. S || Starlab powderfree || Starlab<br />
|-<br />
| Filtertips || ||<br />
|-<br />
| Inoculating Loop || ||<br />
|-<br />
| Disposal Bags || ||<br />
|-<br />
| Flasks || ||<br />
|-<br />
| Plate || ||<br />
|-<br />
| Petri Dishes || P5731-500EA || Sigma-Aldrich Chemie GmbH<br />
|-<br />
| Petri Dishes || N221.2 || Carl Roth GmbH & Co.KG<br />
|-<br />
| Petri Dishes || 10558071 || Fischer Scientific<br />
|-<br />
| TipOne® Pipette Tip || S1110-1700 || Starlab GmbH<br />
|-<br />
| TipOne® Pipette Tip, 1000µl, Graduated || S1111-2721 || Starlab GmbH<br />
|-<br />
| NeoBox-81 6er Set, je 1 x Transparent, g || 22916 ||<br />
|-<br />
| NeoLab-Marker for Reaction-Flaks || 19079 ||<br />
|-<br />
| Gene Pulser/MicroPulser Cuvettes, 0.1 cm || 165-2089 ||<br />
|-<br />
| NeoLab-Paper Scissors, 23 cm Long, Even || 23272 ||<br />
|-<br />
| TipOne® Pipette Tip, 200µl || S1110-1700 || Starlab GmbH<br />
|-<br />
| TipOne® Pipette Tip, 10µl, Graduated, Re || S1111-3700 || Starlab GmbH<br />
|-<br />
| Pipette, 5 ml || 606180 || Greiner bio-one GmbH<br />
|-<br />
| Micro Plates, 96 well || 655101 || Greiner bio-one GmbH<br />
|-<br />
| Ring out of Plumbum with Vinyl Coating, 57 mm In || 310161013 || NEOLAB GmbH<br />
|-<br />
| Reaction Tube,S.L.1.5 ml,Colorless. || 12682 || Eppendorf, Fisher Scientific GmbH<br />
|-<br />
| Reaction Tube,S.L.,2 ml, Colorless || 12776 || Eppendorf<br />
|-<br />
| NeoTape-Writing Tape, 13 mm, Gray || 280126114 || NEOLAB GMBH<br />
|-<br />
| NeoTape-Writing Tape, 25 mm, Salmon-Colored || 280126229 || NEOLAB GMBH<br />
|-<br />
| 10 ml Serological Pipette, Filter, Sterile || E4860-1011 || Starlab GmbH<br />
|-<br />
| Gloves Latex + Alovera L || 14089 ||<br />
|-<br />
| Gloves Latex + Alovera M || 14088 ||<br />
|-<br />
| Gloves Latex + Alovera S || 14087 ||<br />
|-<br />
| CYTOONE 96W F-BTM TC PLT || CC7682-7596 || Starlab Gmbh<br />
|-<br />
| PH-Stripes || WHAT10362000 || PANPEHA PLUS<br />
|-<br />
| PCR Plates 96 well || GK96HIGH || Kisker Biotec<br />
|-<br />
| 100 Run24Barcode || 20110099-100 || GATC Biotech AG<br />
|-<br />
| Adhesive PCR Film || 82-0558-A || Peqlab GmbH<br />
|-<br />
| Tube Conical, Polypropylen, 50 ml || 352070 || NEOLAB GMBH<br />
|-<br />
| Gene Pulser/MicroPulser Cuvettes, 0.1 cm || 165-2089 || Bio-Rad Laboratories GmbH<br />
|-<br />
| 0.2 ml 8-Tube Strips Without Caps, Nature || TBS-0201 || Bio-Rad Laboratories GmbH<br />
|-<br />
| Round-Bottom Tubule, Polypropylen, 14 ml || 352059 || NEOLAB GMBH<br />
|-<br />
| Optical Flat 8-Cap Strips || TCS-0803 || Bio-Rad Laboratories GmbH<br />
|-<br />
| Inoculation Loop 10 µl, Blue, Sterile || 2900254437 ||<br />
|-<br />
| Corning Serological Pipette 50 ml || 14303 ||<br />
|-<br />
| Weighing Dish 500 ST || 1884.1 || Carl Roth GmbH & Co.KG<br />
|-<br />
| Filter Paper || Z274836-1PAK || Sigma-Aldrich Chemie GmbH<br />
|-<br />
| Inoculation Loop 10 µl|| 2900254437 || NEOLAB GMBH<br />
|-<br />
| Immobilon-PSQ Membran, PVDF || ISEQ00010 || Merck Milipore<br />
<br />
|}<br />
<br/><br />
<br />
= Further Recipies and Stocks=<br />
<br />
== Ampicillin Stock Solution ==<br />
{| style="font-size:14px; width:300px"<br />
|Stock|| Ampicillin 100 mg / ml<br />
|-<br />
|Amount || 50 ml<br />
|-<br />
|Storage || -24°C freezer<br />
|-<br />
|Notes || Use in 1:1000 dilution<br />
|}<br />
<br />
<br />
<br />
== Chloramphenicol Stock Solution ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock || Chloramphenicol 30 mg / ml<br />
|-<br />
|Amount || 10 ml<br />
|-<br />
|Storage || -24°C freezer<br />
|-<br />
|Notes || Solved in 100% ethanol. Use in 1:3000 dilution<br />
|}<br />
<br />
==<i>E.Coli</i> BAP 1 Glycerol Stock ==<br />
<br />
{|style="font-size:14px; width:300px; clear:both;"<br />
|Stock || ''E. coli'' BAP1 glycerol stock<br />
|-<br />
|Amount || 2 x 1.3 ml<br />
|-<br />
|Storage || -80°C freezer<br />
|}<br />
<br />
== <i>E.Coli </i>BAP1, Competent ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock || ''E. coli'' BAP1<br />
|-<br />
|Amount || 18 x 100 µl<br />
|-<br />
|Storage || -80°C freezer<br />
|-<br />
|Notes || Grows extremely fast. Be careful with miniPreps,<br/> at least in cultures with ampicillin it tends<br/> to degrade all available ampicillin<br/> and then lose the respective plasmid.<br />
|}<br />
<br />
== <i> E. coli </i> BAP1-pKD46 Glycerol Stock ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|What || ''E. coli'' BAP1-pKD46 glycerol stock (Amp<sup>r</sup>)<br />
|-<br />
|Amount || 2 x 1.3 ml<br />
|-<br />
|Storage || -80°C freezer<br />
|-<br />
|Notes || '''Grow at 30°C only!''' Growth at 37°C <br/>will lead to loss of pKD46 plasmid.<br />
|}<br />
<br />
== <i>E.Coli</i> BAP1-pLF03 Glycerol Stock ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock || ''E. coli'' BAP1-pLF03 glycerol stock (Amp<sup>r</sup>)<br />
|-<br />
|Amount || 1 x 1.3 ml<br />
|-<br />
|Storage || -80°C freezer<br />
|-<br />
|Notes || Might have low amount of plasmid-carrying bacteria<br/> due to long culturing time<br/> (all Amp in medium cleaved)<br/><br />
|}<br />
<br />
== <i>E. Coli</i> DH5a-pCP20 Glycerol Stock ==<br />
<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock || ''E. coli'' DH5a-pCP20 glycerol stock (Amp<sup>r</sup>, Cm<sup>r</sup>)<br />
|-<br />
|Amount || 2 x 1.3 ml<br />
|-<br />
|Storage || -80°C freezer<br />
|-<br />
|Notes || '''Grow at 30°C only!'''<br/> Growth at 37°C will lead to loss of pCP20 plasmid.<br />
|}<br />
<br />
== Heat-Shock Competent ''E. Coli'' TOP10 ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock|| ''E. coli'' TOP10, Heat-shock competent<br />
|-<br />
|Amount|| 200 x 100 µl<br />
|-<br />
|Storage || -80°C freezer<br />
|-<br />
|Notes ||Verified on 2013-06-07.<br />
|}<br />
<html><br />
<center><br />
<a class="fancybox fancyGraphical" href="https://static.igem.org/mediawiki/2013/2/20/TOP10_test_2013-06-07.jpg" title="Control transformation of competent TOP10 cells with 80 ng pSB4K5 with insert J04450 (IPTG-inducible mRFP production). Left: transformation with plasmid; right: transformation with water."><br />
<img style="width:400px; padding:1%;border-style:solid;border-width:1px;border-radius: 5px;" src="https://static.igem.org/mediawiki/2013/2/20/TOP10_test_2013-06-07.jpg" ></img><br />
<figcaption style="width:400px;align:justify; font-size:14px;"><b>Figure 3</b> Control transformation of competent TOP10 cells with 80 ng pSB4K5 with insert J04450 (IPTG-inducible mRFP production). Left: transformation with plasmid; right: transformation with water.</figcaption><br />
</a><br />
</center><br />
</html><br />
<br />
<div style="clear:both;"></div><br />
<br />
== <i>E. Coli</i> TOP10-BBa I746200/pSB1AK3 Glycerol Stock ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock || ''E. coli'' TOP10-(BBa I746200 in pSB1AK3) (Amp<sup>r</sup>, Kan<sup>r</sup>)<br />
|-<br />
|Amount || 1 x 1.3 ml<br />
|-<br />
|Storage || -80°C freezer<br />
|}<br />
<br />
== <i>E. Coli TOP10</i>-BBa J04450/pSB3C5 Glycerol Stock ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock ||''E. coli'' TOP10-(BBa_J04450 in pSB3C5) glycerol stock (Cm<sup>r</sup>)<br />
|-<br />
|Amount || 1 x 1.3 ml<br />
|-<br />
|Storage || -80°C freezer<br />
|}<br />
<br />
==<i> E. Coli</i> TOP10-pIK1 Glycerol Stock ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock ||''E. coli'' TOP10-pIK1 glycerol stock (Cm<sup>r</sup>)<br />
|-<br />
|Amount || 1 x 1.3 ml<br />
|-<br />
|Storage || -80°C freezer<br />
|}<br />
<br />
== <i>E. Coli</i> TOP10-pKD46 Glycerol Stock ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock ||''E. coli'' TOP10-pKD46 glycerol stock (Amp<sup>r</sup>)<br />
|-<br />
|Amount || 2 x 1.3 ml<br />
|-<br />
|Storage || -80°C freezer<br />
|-<br />
|Notes || '''Grow at 30°C only!''' Growth at 37°C<br/> will lead to loss of pKD46 plasmid.<br />
|}<br />
<br />
==<i>E. Coli</i> TOP10-pMM65 Glycerol Stock ==<br />
<br />
{|style="font-size:14px; width:500px; clear:both;"<br />
|Stock ||''E. coli'' TOP10-pMM65 glycerol stock (Kan<sup>r</sup>)<br />
|-<br />
|Amount || 1 x 1.3 ml<br />
|-<br />
|Storage || -80°C freezer<br />
|}<br />
<br />
== IPTG Stock Solution ==<br />
<br />
{|style="font-size:14px; width:300px; clear:both;"<br />
|Stock ||IPTG 23.8 mg / ml<br />
|-<br />
|Amount || 10 ml<br />
|-<br />
|Storage || -20°C freezer<br />
|-<br />
|Notes || Use 0.1 to 1 mM<br />
|}<br />
<br />
== Kanamycin Stock Solution ==<br />
<br />
<br />
{|style="font-size:14px; width:300px; clear:both;"<br />
|Stock ||Kanamycin 50 mg / ml<br />
|-<br />
|Amount || 10 ml<br />
|-<br />
|Storage || -24°C freezer<br />
|-<br />
|Notes || Use in 1:1000 dilution<br />
|}<br />
<br />
== M9 Medium ==<br />
<br />
{|style="font-size:14px; width:300px; clear:both;"<br />
|Name ||M9 Minimal Salts 5x, Powder<br />
|-<br />
|Amount || 1 l<br />
|-<br />
|Storage || room temperature<br />
|-<br />
|Notes || close tightly, hygroscopic<br />
|}<br />
<html><br />
<ul><br />
<li style="font-size:14px">Add 200 ml of sterile M9 salt solution to 750 ml sterile, distilled H<sub>2</sub>O (45-50°C)</li><br />
<li style="font-size:14px">Add sterile 20 ml 20% Glucose-solution, 2 ml 1 M MgSO<sub>4</sub> and (optionally) 1 M CaCal</li><br />
</ul><br />
</html><br />
<br />
== Reactivation Medium ==<br />
<br />
=== for 1L ===<br />
<html><br />
<ul><br />
<li style="font-size:14px">5.0 g Peptone</li><br />
<li style="font-size:14px">3.0 g Meat extract</li><br />
<li style="font-size:14px">1000.0 ml Distilled water</li><br />
</ul><br />
<br />
Adjust pH to 7.0<br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/Notebook/MethodsTeam:Heidelberg/pages/Notebook/Methods2014-12-08T16:54:40Z<p>Bunnech: </p>
<hr />
<div><html><p>Find here a collection of all the methods we used for cloning our constructs and performing our assays. For the individual experiments visit our Notebook, the <a style="font-weight:bold" href="https://2014.igem.org/Team:Heidelberg/Notebook">MidnightDoc</a>, for the Materials we used, visit <a href="https://2014.igem.org/Team:Heidelberg/Notebook/Materials">Materials</a>.</p></html><br />
<br />
== Make a liquid culture without any plasmid ==<br />
# Inoculate medium<br />
# Grow at the preferred temperature of the organism.<br />
<br />
== Make a liquid culture carrying three plasmids ==<br />
# Inoculate medium<br />
# Grow at the preferred temperature of the organism.<br />
<br />
== Streak bacteria without any plasmid onto an agar plate ==<br />
# Streak the bacteria onto the agar plate<br />
<br />
== Dilute non-plasmid dsDNA ==<br />
# Dilute the DNA.<br />
<br />
== PCA ==<br />
# For a 20 µl reaction, mix equimolar amounts of the DNA fragments (10 ng to 15 ng in total) and add water to a volume of 10 µl.<br />
# Add 10 µl 2X Phusion Flash Master Mix.<br />
# Place the reaction in a thermocycler and run the following program: Initial denaturation at 98 °C for 10 s; 10 cycles of 1 s denaturation at 98 °C, 5 s annealing at 55 °C, extension at 72 °C for 15 to 30 s/kb of the product; final extension at 72 °C for 5 min.<br />
# Add 5 µl of the reaction to 25 µl Phusion Flash Master mix. Add primers to a final concentration of 0.5 µM and water to a final volume of 50 µl.<br />
# Place the reaction in a thermocycler and run the following program: Initial denaturation at 98 °C for 10 s; 20 to 30 cycles of 1 s denaturation at 98 °C, 5 s annealing, extension at 72 °C for 15 to 30 s/kb of the product; final extension at 72 °C for 5 min.<br />
<br />
== DNA purification (Qiagen PCR Purification Kit) ==<br />
# Follow the Qiagen protocol.<br />
# Measure the concentration with a NanoDrop.<br />
<br />
== Make a liquid culture carrying a plasmid ==<br />
# Inoculate medium<br />
# Grow at the preferred temperature of the organism.<br />
<br />
== Dilute plasmid DNA ==<br />
# Dilute the plasmid DNA.<br />
<br />
== Golden Gate Assembly==<br />
# Mix 150 ng of the backbone and equimolar amounts of the insert(s) in water in a PCR tube for a total volume of 15 µl.<br />
# Add 1.5 µl of 10X T4 Ligase Buffer and, when using BsaI or another restriction enzyme that requires it, BSA (Bovine Serum Albumin) at a final concentration of 1X.<br />
# Add 1 µl of each restriction enzyme and 1 µl of T4 DNA Ligase (400,000 cohesive end ligation units/ml). <br />
# Optional: Add 1 µl of T4 Polynucleotide Kinase, if several inserts without 5’-phosphorylation (like annealed oligos) are used. <br />
# Place the reaction in a thermocycler and run the following program: 25 cycles of 4 min ligation at 16 °C and 3 min restriction at 37°C, followed by 5 min at 50 °C for final restriction and 5 min at 80 °C for heat inactivation. <br />
<br />
== Religation after Golden gate Assembly ==<br />
# Important: This will have a drastic effect on the efficiency, since the original backbone will be able to reassemble. If you don’t use a selection marker, a crazy colony PCR screening will be necessary to find the desired plasmid. <br />
# Add 12.5 µl of water, 1.5 µl of T4 Ligase Buffer and 1 µl of T4 DNA Ligase to your Golden Gate reaction. <br />
# Incubate for 20 min at 16 °C, then heat inactivate for 10 min at 65 °C. <br />
<br />
== Make competent cells already carrying a plasmid ==<br />
# Do some stuff<br />
<br />
== Make a glycerol stock of bacteria carrying a plasmid ==<br />
# Mix an aliquot of a LB culture with the same volume of storage buffer<br />
# Freeze at -80 °C<br />
<br />
== Restriction digest (NEB) ==<br />
# Mix purified DNA with water<br />
# Add buffer<br />
# Add restriction enzyme(s)<br />
# Incubate<br />
# Optional heat inactivation<br />
<br />
== Make competent cells not yet carrying any plasmid ==<br />
# Do some stuff<br />
<br />
== Pick a colony carrying three plasmids from an agar plate ==<br />
# Pick up a sterile tip with a pipette. Dip it into a single colony so it attaches to the tip without applying suction.<br />
<br />
== Make a liquid culture carrying two plasmids ==<br />
# Inoculate medium<br />
# Grow at the preferred temperature of the organism.<br />
<br />
== Gel Electrophoresis ==<br />
# Measure out 7.5 g of agarose.<br />
# Pour agarose powder into microwavable flask along with 500mL of 1xTAE.<br />
# Microwave for 1-3min (until the agarose is completely dissolved and there is a nice rolling boil).<br />
# Let agarose solution cool down for 5min.<br />
# Add 10 µl of 10 mg/l ethidium bromide (EtBr) stock solution (final concentration 0.2 mg/l). EtBr binds to the DNA and allows you to visualize the DNA under ultraviolet (UV) light.<br />
# Pour the agarose into a gel tray with the well comb in place.<br />
# Place newly poured gel at 4°C for 10-15 minutes OR let sit at room temperature for 20-30 minutes, until it has completely solidified.<br />
# Add loading buffer to each of your digest samples.<br />
# Once solidified, place the agarose gel into the gel box (electrophoresis unit).<br />
# Fill gel box with 1xTAE until the gel is covered.<br />
# Carefully load your samples into the additional wells of the gel (recommended: 15 µl).<br />
# Run the gel at 80-150 V until the dye line is approximately 75-80 % of the way down the gel.<br />
# Turn OFF power, disconnect the electrodes from the power source, and then carefully remove the gel from the gel box.<br />
# Using any device that has UV light, visualize your DNA fragments.<br />
<br />
== PCR from Bacteria (colony PCR or genomic amplification) ==<br />
# Suspend the picked colony in 10 µl to 20 µl of sterile H2O (or use inoculated medium).<br />
# Mix 12.5 µl OneTaq 2X Master Mix (NEB) with 1 µl of the bacterial suspension.<br />
# Add primers to a final concentration of 0.5 µM.<br />
# Add H2O to a final volume of 25 µl.<br />
# Run your thermocycler.<br />
<br />
== Miniprep ==<br />
# Follow the Qiagen protocol<br />
# Measure the concentration on a NanoDrop<br />
<br />
== Heat shock plasmid transformation (1 -> 2 plasmid) ==<br />
# Set a heat block to 42 °C.<br />
# Thaw an aliquot chemically competent bacteria on ice.<br />
# Add plasmid DNA to the aliquot and mix gently by flicking the tube.<br />
# Incubate the bacteria on ice for 10 min to 30 min.<br />
# Heat shock the bacteria for exactly 30 s (20 s for E. coli BL21(DE3)).<br />
# Incubate the bacteria on ice for approx. 5 min.<br />
# Add 1 ml of SOC or LB medium and recover the plasmids for 1 h at 37 °C while shaking (optional if the new plasmid only adds an Ampicillin resistance).<br />
# Optionally spin down the recovered suspension and resuspend it in a minimal volume of medium.<br />
# Plate the suspension on agar supplemented with the appropriate antibiotics (fill in the appropriate protocol here!).<br />
<br />
== Plasmid purification (Qiagen PCR Purification Kit) ==<br />
# Follow the Qiagen protocol.<br />
# Measure the concentration with a NanoDrop.<br />
<br />
== Anneal complementary oligonucleotides ==<br />
# Mix equal amounts of the oligonucleotides in an appropriate buffer.<br />
# Heat the mixture to 95 °C, then slowly cool it down to room temperature over approx. 45 min (by switching of the heat block or using a ramp-cool method in a thermocycler).<br />
<br />
== Phusion Flash PCR ==<br />
# Add H2O to a final volume of 50 µl.<br />
# Add 25 µl 2X Phusion Flash Master Mix.<br />
# Add primers to a final concentration of 0.5 µM.<br />
# Add 2.5 pg to 25 ng template DNA.<br />
# Run your thermocycler.<br />
<br />
== Recovery of plasmid DNA from filter paper ==<br />
# Use clean gloves and cut the marked circle area that contains the dried plasmid DNA.<br />
# Using clean forceps, insert the filter paper into a 1.5 ml micro centrifuge tube. Add 50 µl of pure water (or until the paper is completely soaked), vortex briefly and incubate at room temperature for 5 minutes. Vortex again and centrifuge the tube for a few seconds.<br />
# Remove about 5 µl of supernatant for use in transfecting E. coli by electroporation or chemical means. Please do not try to use the DNA directly for any application other than to transform bacteria and prepare a plasmid stock.<br />
# Store the remainder of the filter paper/water mix at -20 or -80 °C as a permanent archive in case that your plasmid stock ever gets lost or if something turns out to be wrong with it.<br />
<br />
== Streak bacteria carrying three plasmid onto an agar plate ==<br />
# Streak the bacteria onto the agar plate or use sterile glass beads.<br />
<br />
== Gel extraction of a plasmid ==<br />
# Using a clean scalpel, excise the desired band(s) from the agarose gel.<br />
# Follow the Qiagen protocol.<br />
# Mesaure the concentration on a NanoDrop.<br />
<br />
== Dissolve plasmid DNA from the registry distribution ==<br />
# Add 10 µl H2O to the well of the registry distribution if it was not previously used.<br />
# Use 1-2 µl for transformation.<br />
<br />
== Gel extraction ==<br />
# Using a clean scalpel, excise the desired band(s) from the agarose gel.<br />
# Follow the Qiagen protocol.<br />
# Mesaure the concentration on a NanoDrop.<br />
<br />
== Heat shock plasmid transformation (2 -> 3 plasmids) ==<br />
# Set a heat block to 42 °C.<br />
# Thaw an aliquot chemically competent bacteria on ice.<br />
# Add plasmid DNA to the aliquot and mix gently by flicking the tube.<br />
# Incubate the bacteria on ice for 10 min to 30 min.<br />
# Heat shock the bacteria for exactly 30 s (20 s for E. coli BL21(DE3)).<br />
# Incubate the bacteria on ice for approx. 5 min.<br />
# Add 1 ml of SOC or LB medium and recover the plasmids for 1 h at 37 °C while shaking (optional if the new plasmid only adds an Ampicillin resistance).<br />
# Optionally spin down the recovered suspension and resuspend it in a minimal volume of medium.<br />
# Plate the suspension on agar supplemented with the appropriate antibiotics (fill in the appropriate protocol here!).<br />
<br />
== Streak bacteria carrying two plasmids onto an agar plate ==<br />
# Streak the bacteria onto the agar plate or use sterile glass beads.<br />
<br />
== Streak bacteria carrying a plasmid onto an agar plate ==<br />
# Streak the bacteria onto the agar plate or use sterile glass beads.<br />
<br />
== Heat shock plasmid transformation (0 -> 1 plasmid) ==<br />
# Set a heat block to 42 °C.<br />
# Thaw an aliquot chemically competent bacteria on ice.<br />
# Add plasmid DNA to the aliquot and mix gently by flicking the tube.<br />
# Incubate the bacteria on ice for 10 min to 30 min.<br />
# Heat shock the bacteria for exactly 30 s (20 s for E. coli BL21(DE3)).<br />
# Incubate the bacteria on ice for approx. 5 min.<br />
# Add 1 ml of SOC or LB medium and recover the plasmids for 1 h at 37 °C while shaking (optional if the new plasmid only adds an Ampicillin resistance).<br />
# Optionally spin down the recovered suspension and resuspend it in a minimal volume of medium.<br />
# Plate the suspension on agar supplemented with the appropriate antibiotics (fill in the appropriate protocol here!).<br />
<br />
== Pick a colony carrying a plasmid from an agar plate ==<br />
# Pick up a sterile tip with a pipette. Dip it into a single colony so it attaches to the tip without applying suction.<br />
# Resuspend the colony in sterile medium or water.<br />
<br />
== Make a glycerol stock of bacteria carrying two plasmid ==<br />
# Mix an aliquot of a LB culture with the same volume of storage buffer.<br />
# Freeze at -80 °C.<br />
<br />
== Make Medium ==<br />
# Put appropriate amount of Mediums powder, put it into correct bottle, label it correctly and put in the correct box for autoclavation<br />
<br />
== Plasmid ligation with T4 DNA Ligase (NEB) ==<br />
# Mix water and T4 DNA Ligase Buffer (NEB).<br />
# Add DNA.<br />
# Incubate at room temperature.<br />
<br />
== Gather bacteria carrying a plasmid from an agar plate ==<br />
# Using a sterile item, gather some bacteria from the plate.<br />
<br />
== Heat shock plasmid transformation (0 -> 2 plasmids) ==<br />
# Set a heat block to 42 °C.<br />
# Thaw an aliquot chemically competent bacteria on ice.<br />
# Add plasmid DNA to the aliquot and mix gently by flicking the tube.<br />
# Incubate the bacteria on ice for 10 min to 30 min.<br />
# Heat shock the bacteria for exactly 30 s (20 s for E. coli BL21(DE3)).<br />
# Incubate the bacteria on ice for approx. 5 min.<br />
# Add 1 ml of SOC or LB medium and recover the plasmids for 1 h at 37 °C while shaking.<br />
# Optionally spin down the recovered suspension and resuspend it in a minimal volume of medium.<br />
# Plate the suspension on agar supplemented with the appropriate antibiotics (fill in the appropriate protocol here!).<br />
<br />
== Heat shock plasmid transformation (1 -> 3 plasmids) ==<br />
# Set a heat block to 42 °C.<br />
# Thaw an aliquot chemically competent bacteria on ice.<br />
# Add plasmid DNA to the aliquot and mix gently by flicking the tube.<br />
# Incubate the bacteria on ice for 10 min to 30 min.<br />
# Heat shock the bacteria for exactly 30 s (20 s for E. coli BL21(DE3)).<br />
# Incubate the bacteria on ice for approx. 5 min.<br />
# Add 1 ml of SOC or LB medium and recover the plasmids for 1 h at 37 °C while shaking.<br />
# Optionally spin down the recovered suspension and resuspend it in a minimal volume of medium.<br />
# Plate the suspension on agar supplemented with the appropriate antibiotics (fill in the appropriate protocol here!).<br />
<br />
== Make a glycerol stock of bacteria without any plasmid ==<br />
# Mix an aliquot of a LB culture with the same volume of storage buffer.<br />
# Freeze at -80 °C.<br />
<br />
== Gather bacteria carrying two plasmids from an agar plate ==<br />
# Using a sterile item, gather some bacteria from the plate.<br />
<br />
== Expression of Dnmt1 (linear) ==<br />
# Transform the plasmid harboring DNMT1 (Kanamycin resistant) into Rosetta DE3 competent cells (Chloramphenicol resistant) ( negative control untransformed)<br />
# Inoculate a few colonies to 40 ml LB+Kan+Cm medium to grow the cells overnight at 37 °C (Prepare 4l LB+Kan+Cm medium to autoclave)<br />
# Dispense 10 ml of the growth culture into each 1 l flask and grow the cells at 37 °C. When the cell OD reaches ~0.6, lower the temperature to 15-20 °C<br />
# 30 min later, add IPTG (0.4 mM final concentration) and ZnCl2 (0.1 mM final concentration) into the media and continue to grow the cells overnight.<br />
# Spin down the cells at 4000 rpm for 20 min (4 °C, 5th or 6th floor, fill 500 ml buckets for Ja10 rotor to 375 ml), and resuspend the cell paste in HisTrap loading buffer, with approximately 20 ml buffer for each liter of cell paste. (Take sample S1, accordingly C1 from untransformed control)<br />
# SONICATION of the cells (Lohmann group, cold room 4th floor) while keeping them on ice, disrupt the cells using sonication. To avoid the protein degradation and aggregation, add PMSF and DTT to 1 μM and 0.5 mM respectively.<br />
# Place the sonication tip in the sample, close to the bottom, but not touching the tube. Select the right program: Microtip: yes; Amplitude 60; Working time 2 min; On 0.02; Off 0.05 After 5 minutes, check if the sample did not heat up and repeat the program one more time. Clean the tip with some ethanol after use.<br />
# After the cell is lysed, spin down the cell lysate using high speed or ultracentrifuge (17000 rpm x 45 min, Ti70 rotor, thick wall tubes [355631], filled to 15 ml)<br />
# Collect the supernatant. If any aggregates or particles are visible, filter the supernatant with a 0.2 µm filter using a syringe. (Take sample from supernatant S2 and pellet S3, accordingly C2 and C3 from untransformed control)<br />
# Load the supernatant to pre-equilibrated HisTrap column, wash the column using 200 ml of chilled His trap loading buffer, and elute the fusion protein using elution buffer.<br />
# Collect the eluent and dialyze the protein sample against dialysis buffer overnight at 4C. > Optional: adding protease inhibitor cocktail tablets will help DNMT1 from proteolytic degradation.<br />
# Take out sample from dialysis tube, spin down the sample and remove any precipitate<br />
# Load the supernatant to the Heparin column, then apply the salt gradient with Buffer A and B. The target protein is expected to elute at 0.4-0.5 M NaCl.<br />
# Collect the fractions and run the SDS Page to examine the protein (~100 kD). Pool together the protein fraction with significant purity<br />
# Concentrate the fractions to about 1 ml using concentration spin columns (25MWCO)<br />
# The protein is finally purified through a 16/60 Superdex 200 size exclusion column using Gel filtration buffer<br />
# After the gel filtration, the protein will be examined by SDS page. The fractions with >90% purity will be pooled<br />
# Concentration of sample and storage at -80C freezer.<br />
<br />
== Make competent cells already carrying two plasmid ==<br />
# Do some stuff<br />
<br />
== Pick a colony without any plasmid from an agar plate ==<br />
# Pick a single colony from the agar plate using a sterile pipette tip.<br />
# Resuspend the colony in appropriate medium to make a culture or in sterile water.<br />
<br />
== Pick a colony carrying two plasmids from an agar plate ==<br />
# Pick up a sterile tip with a pipette. Dip it into a single colony so it attaches to the tip without applying suction.<br />
# Resuspend the colony in sterile medium or water.<br />
<br />
== Make a glycerol stock of bacteria carrying three plasmids ==<br />
# Mix an aliquot of a LB culture with the same volume of storage buffer.<br />
# Freeze at -80 °C.<br />
<br />
==CPEC==<br />
# Design of the insert and backbone primers<br />
**Assemble your desired construct in silico by pasting the fragments. Feel free to add tags and other small stuff between them. <br />
**Define a “homology region” with a Tm of 60 °C - 70 °C (~15 - 35 bp) at each fragment border. The Tms of all homology regions should be very similar. It is your choice whether the regions are right next to the border in one fragment, include parts of both fragments, include inserted sequences. These regions should be checked carefully for annoying secondary structures. <br />
**You need a forward and a reverse primer for any fragment. Any primer consists of a part that binds to the template DNA and an overlap. The binding part should have a G or C at the 3’ end and a Tm between 60 °C and 72 °C. The binding part Tms of one primer pair should be similar. In addition to the binding part, any primer must have an overlap part. Just extend the primers until the chosen homology region is fully covered. Check the complete primers for secondary structures. If there are really bad ones, you should change the homology region…<br />
# PCRs of the inserts<br />
**Please follow the [[#Touchdown-Twostep PCR (Phusion Flash)|Touchdown-Twostep PCR protocol]], purify the products and measure their concentration. <br />
#The CPEC<br />
**Mix your fragments. At least 100 ng vector are required, we recommend to use around 500 ng/µl. Add equimolar amounts of your insert(s). A vector: insert ratio of 1:3 works as well. <br />
**Add 10 µl 2X Phusion Flash Master Mix.<br />
**Add H2O to a final volume of 20 µl. <br />
**Run your thermocycler: <br />
<br />
{| class="table table-hover”<br />
|-<br />
! Step !! Temperature !! Time<br />
|-<br />
| Initial denaturation || 98 °C || 10 s<br />
|-<br />
| 1 insert: 10 cycles, >1 insert: 20-30 cycles || ||<br />
|-<br />
| - Denaturation || 98 °C || 1 s<br />
|-<br />
| - Annealing || Slow ramping from 70°C to 55°C (-0.1 °C/ s) || ~3 min<br />
|-<br />
| - Elongation || 72 °C || 15 s / kb (desired plasmid)<br />
|-<br />
| End elongation || 72 °C || 120 s<br />
<br />
<br />
|}<br />
<br />
<br />
==Touchdown-Twostep PCR (Phusion Flash)==<br />
# Add H2O to a final volume of 50 µl.<br />
# Add 25 µl 2X Phusion Flash Master Mix.<br />
# Add primers to a final concentration of 0.5 µM.<br />
# Add 2.5 pg to 25 ng template DNA.<br />
# Run your thermocycler: <br />
<br />
{| class="table table-hover”<br />
|-<br />
! Step !! Temperature !! Time<br />
|-<br />
| Initial denaturation || 98 °C || 10 s<br />
|-<br />
| Touchdown (~12 cycles) || ||<br />
|-<br />
| - Denaturation || 98 °C || 1 s<br />
|-<br />
| - Annealing || Primer Tm + 4 °C, -0.5 °C each cycle || 5 s<br />
|-<br />
| - Elongation || 72 °C || 15 s / kb<br />
|-<br />
| Twostep (~24 cycles) || || <br />
|-<br />
| - Denaturation || 98 °C || 1 s<br />
|-<br />
| - Elongation || 72 °C || 5 s + 15 s /kb<br />
|-<br />
| End elongation || 72 °C || 120 s<br />
<br />
<br />
|}<br />
<br />
<br />
<br />
== Lysozyme Assay ==<br />
<br />
Bacteria were transformed with lambda lysozyme constructs, grown to an OD of 0.6 and induced with 1 mM IPTG.<br />
<br />
After 4 hours of expression, the samples were diluted to the same OD of 2.0 and centrifuged down at 2,850 rpm. The pellet was resuspended in 10 mM potassium phosphate buffer with a pH of 6.24 and sonicated for two minutes on ice. After centrifugation a second time at 2,850 rpm, the supernatant containing the lambda lysozyme was kept.<br />
<br />
For substrate preparation, the lyophilized cells of M.lysodeikticus (Sigma Aldrich), were resuspended in ultrapure water. The supernantant with the protein mix was transfered and aliquoted for biological replicates and to prepare dilution series.<br />
<br />
Subsequently the samples were transfered into the thermocycler to do a one minute heat-shock in a temperature span between 45 and 55°C. After mixing enzyme and substrate the OD was measured every two minutes in a plate reader over 100 minutes at 37°C (figure 4).<br />
=== Flourescence labeled peptidoglycane assay<br />
The expression of the lysozyme samples for the assay using FITC-labeled peptidoglycan was carried out in the same way as we did it in the first assay. We resuspended the pellet in PBS. The protocol of labeling of peptidoglycan with fluorescein isothiocyanate (FITC) you can find in this methods section as well.</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T03:54:54Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}}<br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.<br />
<br />
<html><br />
<style><br />
#propose {text-indent: 40px;<br />
}<br />
#greetings {text-indent: 20px;<br />
}<br />
ul.supporter_team_list { list-style-type: none;<br />
}<br />
ul.supporter_team_list a {text-decoration: none;color: black;}<br />
ul.supporter_team_list a:hover {text-decoration: underline;}<br />
ul.supporter_team_list > li {display:inline;margin: 30px;<br />
}<br />
</style><br />
<div id="socioeconomics"> <br />
<h1>A proposal of the German iGEM Teams concerning Intellectual Property</h1><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br />
</div><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T03:51:59Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}}<br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.<br />
<br />
<html><br />
<style><br />
#propose {text-indent: 40px;<br />
}<br />
#greetings {text-indent: 20px;<br />
}<br />
ul.supporter_team_list { list-style-type: none;<br />
}<br />
ul.supporter_team_list a {text-decoration: none;color: black;}<br />
ul.supporter_team_list a:hover {text-decoration: underline;}<br />
ul.supporter_team_list > li {display:inline;margin: 30px;<br />
}<br />
</style><br />
<div id="socioeconomics"> <br />
<h1>A proposal of the German iGEM Teams concerning Intellectual Property</h1><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br />
</div><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T03:50:53Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}}<br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.<br />
<br />
<html><br />
<style><br />
#propose {text-indent: 40px;<br />
}<br />
#greetings {text-indent: 20px;<br />
}<br />
ul.supporter_team_list { list-style-type: none;<br />
}<br />
ul.supporter_team_list a {text-decoration: none;color: black;}<br />
ul.supporter_team_list a:hover {text-decoration: underline;}<br />
ul.supporter_team_list > li {display:inline;margin: 30px;<br />
}<br />
</style><br />
<div id="socioeconomics"> <br />
<h1>A proposal of the German iGEM Teams concerning Intellectual Property</h1><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br />
</div><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/Templates/BootstrapNavTeam:Heidelberg/Templates/BootstrapNav2014-10-18T03:46:49Z<p>Bunnech: </p>
<hr />
<div>{{#tag:html|<br />
<header id="navbar" role="banner" class="navbar navbar-static-top {{{red{{{red|}}}|navbar-red}}}{{{white{{{white|}}}|navbar-white}}}"><br />
<div class="container" style="{{{header-img{{{header-img|}}}|background-image:url({{{header-img}}});background-position: bottom right; background-repeat:no-repeat; background-size: 100% auto;}}} {{{header-bg{{{header-bg|}}}|background-color:{{{header-bg}}};}}}"><br />
<div class="navbar-header"><br />
<a class="logo" href="/Team:Heidelberg" title="Home" style="padding-top: 15px; padding-left: 15px; display:inline-block;"><br />
<img src="{{{red-logo{{{red-logo|}}}|/wiki/images/4/44/Heidelberg_Logo_header_left.png}}}{{{white-logo{{{white-logo|}}}|/wiki/images/1/1d/Logo_Website_left_white.png}}}" alt="Home"> </a><br />
<!-- .btn-navbar is used as the toggle for collapsed navbar content --><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="sr-only">Toggle navigation</span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
</div><br />
<br />
<div class="navbar-collapse collapse" style="margin-bottom:10px;"><br />
<nav role="navigation"><br />
<ul class="menu nav navbar-nav navbar-right"><br />
<li class="dropdown"><a href="/Team:Heidelberg/Team" class="dropdown-toggle" ><img src="{{{red{{{red|}}}|/wiki/images/d/d3/Team_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/a/aa/Team_icon.png}}}" alt="Team icon">Team</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Team/Members">Members</a></li><br />
<li><a href="/Team:Heidelberg/Team/Collaborations">Collaborations</a></li><br />
<li><a href="/Team:Heidelberg/Team/Attributions">Attributions</a></li><br />
<li><a href="/Team:Heidelberg/Team/Sponsoring">Sponsoring</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Project" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3f/Science_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/da/Science_icon.png}}}" alt="Science icon">Project</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Project">Overview</a></li><br />
<li><a href="/Team:Heidelberg/Project/Background">Background</a></li><br />
<li><a href="/Team:Heidelberg/Project/Toolbox">Toolbox</a></li><br />
<li><a href="/Team:Heidelberg/Toolbox/Circularization">Toolbox: Circularization</a></li><br />
<li><a href="/Team:Heidelberg/Project/PCR_2.0">PCR 2.0</a></li><br />
<li><a href="/Team:Heidelberg/Project/Xylanase">Xylanase</a></li><br />
<li><a href="/Team:Heidelberg/Project/Linker_Screening">Linker Screening</a></li><br />
<li><a href="/Team:Heidelberg/Project/Reconstitution">Fluorescence Assembly</a></li><br />
<li><a href="/Team:Heidelberg/Project/LOV">Light-Induction</a></li><br />
<li><a href="/Team:Heidelberg/Project#Achievements">Achievements</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Parts" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/1d/Parts_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/9/9c/Parts_icon.png}}}" alt="Parts icon">Parts</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Parts/RFC">RFC Heidelberg 2014</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">Favorite Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Sample Data Page">Sample Data Page</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#allParts">Biobricks</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones">Backbones</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Intein Library">Intein Library</a></li><br />
<li><a href="/Team:Heidelberg/Parts/Part_Improvement">Part Improvement</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><br />
<a href="/Team:Heidelberg/Software" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/18/Software_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/1/11/Software_icon.png}}}" alt="Software icon">Software</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Software/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Software/Linker_Software">Linker Software</a></li><br />
<li><a href="/Team:Heidelberg/Software/MidnightDoc">MidnightDoc</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Modeling" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/13/Modeling_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/d8/Modeling_icon.png}}}" alt="Modeling icon">Modeling</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Modeling/Linker_Modeling">Linker Modeling</a></li><br />
<li><a href="/Team:Heidelberg/Modeling/Enzyme_Modeling">Enzyme Kinetics Modeling</a></li><br />
<!--<li><a href="#">Modeling Application</a></li>--><br />
</ul><br />
</li><br />
<li><a href="/Team:Heidelberg/Toolbox_Guide" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/32/Toolbox_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/0/08/Toolbox_icon.png}}}" alt="Toolbox icon">Toolbox Guide</a></li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Human_Practice" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3d/Humanpractice_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/Humanpractice_icon.png}}}" alt="Human Practice icon">Human Practice</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Ethics">Religion & Synthetic Biology</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Education">Education</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Public_Relations">Public Relations</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Experts">Experts</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Notebook" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/0/03/MD_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/e/e9/MD_icon.png}}}" alt="Our Laboratory Notebook icon">Notebook</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Notebook">Notebook</a></li><br />
<li><a href="/Team:Heidelberg/AwesomeSheet">Database for Notebook</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Materials">Materials</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Methods">Methods</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Safety">Safety</a></li><br />
</ul><br />
</li><br />
<li id="logo" ><a href="/" title="Home"><br />
<img src="{{{red{{{red|}}}|/wiki/images/7/79/IGEM_logo_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/IGEM_logo_white.png}}}" alt="Home"><br />
</a></li><br />
</ul><br />
</nav><br />
</div><br />
{{{title{{{title|}}}|<br />
<div class="col-lg-12"><br />
<div class="title-wrapper"><br />
<span class="title">{{{title}}}</span><br />
<span class="special-span"></span><br />
</div><br />
</div><br />
}}}<br />
</div><br />
</header><br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/js/teampageTeam:Heidelberg/js/teampage2014-10-18T03:44:50Z<p>Bunnech: </p>
<hr />
<div>var memberData = {<br />
"Max_H": { <br />
"Name" : "Max Horn", <br />
"img" : "/wiki/images/a/a7/Heidelberg_MaxH.jpg",<br />
"Description" : "'But after this has finished, I also want to do something in the wetlab', was one of the sentences most characterizing Max. He is definitely the software guy of the team. Compared to his programming, what we others coded was playing around with code blocks. For him it was always, the lower the level, the better. Therefore he is writing pure C code, as C++ does already too much by itself, he thinks. But still, he was somehow pressed to this role, as normally he is studying molecular biotechnology in 5th semester now. As iGEM@home was running, and he thought he would have a break from programming, the wiki as a project came upon him. On top, he is a perfectionist on software sides, so not only once he called out: 'Nils, look how smooth the ring is moving!'"<br />
},<br />
"Charlotte": {<br />
"Name" : "Charlotte Bunne", <br />
"img" : "/wiki/images/6/69/Heidelberg_Charlotte.jpg",<br />
"Description" : "Charlotte is our youngest team member and already participated in iGEM in Germany´s first High School team in 2012. Studying Biosciences in her third semester, she impresses all team members with her energy, curiosity and ambition. She is the creative head behind nearly all artworks of our project. The wiki design originates from her imaginations and the BOINC video as well as the cover picture for our theme night “Religion and Synthetic Biology” arose from her hands. In team effort with Nils, she is conducting the linker screening experiments for the lysozyme circularization. In the course of these experiments Charlotte learned huge organisational skills that directs her abilities and energy into the right channels. In this way Charlotte became an indispensable team member."<br />
},<br />
"Nils": {<br />
"Name": "Nils Klughammer", <br />
"img" : "/wiki/images/f/ff/Heidelberg_Nils.jpg",<br />
"Description" : "Nils will always be referred as the physicist in our team, because he implemented the whole CRAUT software and the lysozyme modelling. Furthermore he resigned to stand in the wet lab, and if just in full safety equipment – welling boots, helmet and welding goggles, was everything just to contaminated for him. Nils held the most motivation for circularisation, and were one oft he main leaders for ideas. Due to his structure, coordinate, and healthy life style, involvement in student parties he was very important in pulling the team together."<br />
},<br />
"Silvan": {<br />
"Name": "Silvan Schmitz",<br />
"img" : "/wiki/images/c/cf/Heidelberg_Silvan.jpg",<br />
"Description" : "Silvan is studying Systems biology in his second year. Jakob said once: This guy has the genius talent to really understand programming languages, while everyone else is just typing some aligned codes. Silvan is the designer of our MidnightDoc, and the name was not only but to quite a large extend influenced by his favourite working hour."<br />
},<br />
"Jan": {<br />
"Name": "Jan Gleixner",<br />
"img" : "/wiki/images/d/dd/Heidelberg_Jan.jpg",<br />
"Description" : "Jan – the internal instructor. He was the clever cloud above this whole project, gathering information from all subprojects and was therefore responsible for spreading the interdisciplinary work in the lab. Although sometimes hidden in his quite appearance, when you listen closer, you will get blown away by his extraordinary mind."<br />
},<br />
"Magdalena": {<br />
"Name": "Magdalena Büscher",<br />
"img" : "/wiki/images/f/f7/Heidelberg_Magdalena.jpg",<br />
"Description" : "Magdalena (23) is studying in the second semester of the master program Molecular Biosciences with Major Cancer Biology. Together with Anna and Silvan, she worked on the circularization of mDNMT1 (731-1602) and the establishment of the methylation maintaining PCR2.0. Magdalena has been successfully contacting experts and organizing intein as well as the DNMT1 construct. Whenever external facilities had to be used for protein purification or mass spectroscopy, she knew who to contact."<br />
},<br />
"Carolin": {<br />
"Name": "Carolin Schmelas",<br />
"img" : "/wiki/images/4/49/Heidelberg_Carolin.jpg",<br />
"Description" : "Caro is studying both biology with focus on neuroscience and Psychologies. When hearing her Whohoo exclamation, the whole team started to smile. It meant Caro was happy, because her CPEC cloning had worked, the split fluorescence protein gloomed, or she was deeply inLOV. For the youngest of us she was somehow the mummy oft he lab, sometimes demanding, sometimes treating, forgiving, sometimes the princess, always the winner."<br />
},<br />
"Elisabeth": {<br />
"Name": "Elisabeth Schäfer",<br />
"img" : "/wiki/images/7/71/Heidelberg_Elisabeth.jpg",<br />
"Description" : "Elisabeth is a 3rd year bachelor student in Molecular Biotechnology, Philosophy and Jewish Studies. She designed and cloned huge parts of the toolbox, but also organized the theme evening on synthetic biology, ethics and religion. Outside the lab she enjoys literature, learning new languages and traveling."<br />
},<br />
"Jakob": {<br />
"Name": "Jakob Kreft",<br />
"img" : "/wiki/images/9/92/Heidelberg_Jakob.jpg",<br />
"Description" : "Together with Charlotte and Anna he has participated in the iGEM team High school 2012. Now he is a medicine student in his second year. Synthetic Biology is one of his main interests and he hopes to continue working in this field of science. This summer he felt inLOV with inteins. Furthermore he was part of the wiki force."<br />
},<br />
"Max_W": {<br />
"Name": "Max Waldhauer",<br />
"img" : "/wiki/images/5/5a/Heidelberg_MaxW.jpg",<br />
"Description" : "Max also called Captain Sharky,is a 3rd year student in Molecular Biotechnology. He was responsible for a huge load of cloning stuff and the expert when it comes to circularization. He is not only the most successfull team member when it comes to handling 40 minipreps at one time (NEVER mixing up samples), but also the most sporty one. Outside the lab he enjoys sports and learning Russian."<br />
},<br />
"Anna": {<br />
"Name": "Anna Huhn",<br />
"img" : "/wiki/images/c/c9/Heidelberg_Anna.jpg",<br />
"Description" : "Anna is a 2nd year student in Molecular Biotechnology and the expert for DNMT1. She has been fascinated about this protein (and of course especially about its circularization) from beginning until the very end of the project: The last days before wikifreeze she eveb moved into the lab - bringing her tooth brush and sleeping bag. Outside the lab she enjoys sailing on the Neckar in Heidelberg."<br />
},<br />
"Constantin": {<br />
"Name": "Constantin Ahlmann", <br />
"img" : "/wiki/images/5/5a/Heidelberg_Constantin.jpg",<br />
"Description" : "Constantin is a hybrid of programming and lab guy: Not only has iGEM@home been his idea and he could demonstrate his programming skills working on this project, but also he managed to circularize Xylanase – again his idea. In his free time he gives Java classes to high-school students. His secret talent: dancing."<br />
},<br />
"Julia": {<br />
"Name": "Julia Neugebauer",<br />
"img" : "/wiki/images/b/b6/Heidelberg_Julia.jpg",<br />
"Description" : "I have done my bachelor and master studies in molecular biosciences at the University of Heidelberg. Currently, I am developing new confocal microscopy based screening methods using 3D cell culture. In the iGEM project, I was mainly involved in the DNMT1 project and helped in the setup of the different assays to measure xylanase, lysozyme and DNMT1 activity."<br />
},<br />
"Joel": {<br />
"Name": "Joel Beaudouin",<br />
"img" : "/wiki/images/7/7f/Heidelberg_Joel.jpg",<br />
"Description" : "I'm an experimentalist, originally physicist and now specialized in quantitative cell biology using imaging techniques. I've advised the students on the design of their experiments and on the techniques that have allowed them to quantitatively characterize their new proteins. I was also involved in the modeling parts of the project and their feedback to experimental data."<br />
},<br />
"Stefen": {<br />
"Name": "Stephen Krämer",<br />
"img" : "/wiki/images/c/c0/Heidelberg_Stefen.jpg",<br />
"Description" : "Stephen has just finished his master studies in Molecular Biosciences in the major “Systems Biology” at the University of Heidelberg and is starting his PhD in the “Computational Oncology” group within the department of Prof. Roland Eils. He was part of the iGEM Team Heidelberg in 2008. This year Stephen was mainly involved in the modeling parts of the project."<br />
},<br />
"Pierre": {<br />
"Name": "Pierre Wehler", <br />
"img" : "/wiki/images/d/d5/Heidelberg_Piere.jpg",<br />
"Description" : "During his master studies in Molecular Biosciences at the University of Heidelberg, Pierre focused on Molecular Cell Biology. Now he is doing his PhD in the group “Synthetic Biology” led by Dr. Barbara DiVentura and investigates light-induced p53 regulation in mammalian cells. During the iGEM project, Pierre was supervising the project part dealing with light-induced induction of intein splicing."<br />
},<br />
"Philipp": {<br />
"Name": "Philipp Bayer", <br />
"img" : "/wiki/images/0/09/Heidelberg_Philipp.jpg",<br />
"Description" : "Philipp started his career as a biologist in the iGEM lab Heidelberg in 2008. Being a stalwart iGEM enthusiast he never failed in finding himself trapped in the next iGEM experience. After rejoining the team of 2010, he graduated in Heidelberg and today is a master student in molecular biotechnology with focuses on infectious disease and viral vectors for gene therapy. Now he's back to iGEM and looking forward to the giant jamboree. Besides iGEM, Philipp likes travelling between various scientific disciplines and arts and is member of a group of biohackers that develop low-cost lab equipment for schools and amateur biologists."<br />
},<br />
"Barbara": {<br />
"Name": "Dr. Barbara Di Ventura", <br />
"img" : "/wiki/images/c/c5/Heidelberg_Barbara_DiVentura.jpg",<br />
"Description" : "Computer engineer by university training (carried out in the University of Rome “La Sapienza”), Barbara has done her Ph.D. in molecular biology in the laboratory of Luis Serrano, at the EMBL. Her Ph.D. project consisted in constructing a synthetic human p53 network in the yeast Saccharomyces cerevisiae. She was post-doc in the laboratory of Victor Sourjik, at the ZMBH. During this time she investigated the self-organizing properties of the Min system, the protein machinery that in Escherichia coli defines mid-cell. Since November 2011, Barbara heads the Synthetic Biology group in the department of Roland Eils, at the BioQuant. Barbara believes in the power of synthetic biology to create new functional devises and to teach important lessons about real biological systems. She also thinks that combining theory and experiments is the best strategy to understand the molecular mechanisms driving biological processes. Barbara finds the iGEM competition truly exciting and she is very happy to mentor the young, motivated and enthusiastic students of the Heidelberg iGEM 2014 team!"<br />
},<br />
"Eils": {<br />
"Name": "Prof. Dr. Roland Eils", <br />
"img" : "/wiki/images/1/19/Heidelberg_Roland_Eils.jpg",<br />
"Description" : "Prof. Eils is again the head of the iGEM Heidelberg team. He provides the laboratories and all the required equipment. Besides, he will sponsor the traveling and participation costs. Thank you very much! The research interests of Prof. Eils lies in the field of the analysis and mathematical modeling of complex pathways in molecular biology. He can look back at a very successful career, as he is the head of the Department of Theoretical Bioinformatics in the DKFZ and working on computational oncology. Furthermore, he is the director of the Department of Bioinformatics and Functional Genomics of the IPMB at the University of Heidelberg. Alongside Prof. Kräusslich and Prof. Wolfrum, he is one of three founding directors of the BioQuant, as well as the leader of the Systems Biology Center and the representative of the FORSYS-Initiative of Heidelberg’s research network, the ViroQuant. He has won numerous awards; in particular he has been awarded the Biofuture price (approx. 1.2 Million €) by the BMBF for innovations allowing the graphical reconstruction of the eukaryotic mitosis process from 4D microscopy images and in the year 2005 he won the award for new innovative research by Helmholtz Society: “SystemsBiology of Complex Diseases”. Besides, he was one of the main organizers of the International Conference on Systems Biology in Heidelberg 2004 and he organized the German Symposium on Systems Biology 2009. His new engagement in the up-coming field of Synthetic Biology underlines the need for tight interdisciplinary work between experimentalists and theoreticians."<br />
}<br />
<br />
};<br />
<br />
<br />
var teamView = true;<br />
<br />
<br />
function updateHeights(){<br />
$('#memberSelector').stop(true);<br />
var height = 0;<br />
if(teamView){<br />
height = $('.team-overlay').outerHeight();<br />
}<br />
else {<br />
height = $('#memberImage').height();<br />
}<br />
$('#memberSelector').animate({height: height}, 300, "swing", function(){<br />
updateSlick($('#memberSelector').height());<br />
});<br />
<br />
}<br />
<br />
function updateSlick(height){<br />
elementHeight = $('#memberSelector .row:first').outerHeight();<br />
numElements = Math.floor(height/elementHeight);<br />
memberselector = $('#memberSelector');<br />
memberselector.slickSetOption("slidesToShow", numElements, false);<br />
memberselector.slickSetOption("slidesToScroll", numElements, true);<br />
}<br />
<br />
function smoothLoadImage(src){<br />
$('.imageBorder').height($('#memberImage').height());<br />
$('#memberImageOverlay').attr("src", src);<br />
$('#memberImageOverlay').load(function(){<br />
$(this).fadeIn(400, "swing", function(){<br />
$('#memberImage').attr("src", src);<br />
$('#memberImage').load(function(){<br />
$('#memberImageOverlay').hide();<br />
$('.imageBorder').css("height", "");<br />
});<br />
});<br />
<br />
});<br />
}<br />
<br />
function hideTeamOverlay(callback){<br />
$('.team-overlay').animate({ opacity: 0}, 200, "swing", function(){$('.team-overlay').css("display","none");});<br />
$('.memberview').animate({ opacity: 1}, 200, "swing", function(){<br />
teamView = false;<br />
updateHeights();<br />
});<br />
}<br />
<br />
<br />
$(document).ready(function(){<br />
$('#memberImage').load(function(){<br />
updateHeights();<br />
});<br />
$('.team-overlay img').load(function(){<br />
updateHeights();<br />
});<br />
<br />
$('#memberSelector a').click(function(){<br />
if(teamView){<br />
hideTeamOverlay();<br />
<br />
$('#FilterButtons label').removeClass("active");<br />
if($(this).parent().parent().hasClass("Team"))<br />
$('#Teammembers-btn').addClass("active");<br />
else<br />
$('#Supervisors-btn').addClass("active");<br />
}<br />
$('#memberSelector a').removeClass("active");<br />
$(this).addClass("active");<br />
var memberKey = this.id.split("-")[1];<br />
member = memberData[memberKey];<br />
$("#Name").text(member.Name);<br />
<br />
smoothLoadImage(member.img);<br />
$('#Description').text(member.Description);<br />
});<br />
<br />
$('#Teamfoto-btn').click(function(){<br />
if(teamView == false){<br />
$('.team-overlay').css("display", "block");<br />
$('.team-overlay').animate({ opacity: 1}, 200);<br />
$('.memberview').animate({ opacity: 0}, 200);<br />
teamView = true;<br />
updateHeights();<br />
}<br />
});<br />
<br />
memberselector = $('#memberSelector');<br />
<br />
$('#Teammembers-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Supervisors-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Team');<br />
});<br />
<br />
$('#Supervisors-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Teammembers-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Supervisor');<br />
});<br />
<br />
$('#memberSelector').slick({<br />
prevArrow: '<img src="/wiki/images/3/3f/Heidelberg_prev-arrow.png" alt="prev-arrow" class="arrow arrow-prev"/>',<br />
nextArrow: '<img src="/wiki/images/e/e0/Heidelberg_next-arrow.png" alt="next-arrow" class="arrow arrow-next"/>',<br />
vertical: true,<br />
infinite: false,<br />
slidesToShow: 5,<br />
slidesToScroll: 5<br />
});<br />
$('#memberSelector').slickFilter('.Team');<br />
});<br />
<br />
$(window).resize(function(){<br />
updateHeights();<br />
});</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/Team/MembersTeam:Heidelberg/Team/Members2014-10-18T03:41:01Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/templates/wikipage_new|<br />
title=TEAM<br />
|<br />
red=<br />
|<br />
subtitle=<br />
|<br />
red-logo=<br />
|<br />
white-logo=true<br />
|<br />
container-style=background-color:white;<br />
|<br />
header-img=<br />
|<br />
header-bg=black<br />
|<br />
body-style=background-color:black;<br />
|<br />
content=<br />
<html><br />
<div class="row"><br />
<div class="col-lg-offset-9 col-lg-3 col-md-offset-6 col-md-6 col-sm-offset-6 col-sm-6" style="margin-bottom: 15px; text-align:right;"><button id="Teammembers-btn" class="btn btn-lg btn-hd active" style="margin-right:15px;">Students</button><button id="Supervisors-btn" class="btn btn-lg btn-hd">Supervisors</button></div><br />
</div><br />
<div class="row" style="position:relative"><br />
<div id="memberSelector" class="col-lg-3 col-md-6 col-sm-4 col-xs-3"><br />
<div class="row Team"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Anna" href="#Anna" class="thumbnail"><br />
<img src="/wiki/images/3/36/Heidelberg_Anna_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Nils" href="#Nils" class="thumbnail"><br />
<img src="/wiki/images/e/ed/Heidelberg_Nils_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
<div class="row Team"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Elisabeth" href="#Elisabeth" class="thumbnail"><br />
<img src="/wiki/images/1/15/Heidelberg_Elisabeth_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Max_H" href="#MaxH" class="thumbnail"><br />
<img src="/wiki/images/9/9b/Heidelberg_MaxH_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
<div class="row Team"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Charlotte" href="#Charlotte" class="thumbnail"><br />
<img src="/wiki/images/1/18/Heidelberg_Charlotte_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Jakob" href="#Jakob" class="thumbnail"><br />
<img src="/wiki/images/3/3e/Heidelberg_Jakob_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
<div class="row Team"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Magdalena" href="#Magdalena" class="thumbnail"><br />
<img src="/wiki/images/1/1b/Heidelberg_Magdalena_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Silvan" href="#Silvan" class="thumbnail"><br />
<img src="/wiki/images/4/4f/Heidelberg_Silvan_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
<div class="row Team"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Max_W" href="#MaxW" class="thumbnail"><br />
<img src="/wiki/images/4/4a/Heidelberg_MaxW_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Carolin" href="#Carolin" class="thumbnail"><br />
<img src="/wiki/images/5/51/Heidelberg_Carolin_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
<div class="row Team"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Constantin" href="#Constantin" class="thumbnail"><br />
<img src="/wiki/images/d/d6/Heidelberg_Constantin_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Jan" href="#Jan" class="thumbnail"><br />
<img src="/wiki/images/2/23/Heidelberg_Jan_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
<div class="row Supervisor"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Eils" href="#Roland_Eils" class="thumbnail"><br />
<img src="/wiki/images/b/be/Heidelberg_Roland_Eils_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Barbara" href="#Barbara_DiVentura" class="thumbnail"><br />
<img src="/wiki/images/3/3a/Heidelberg_Barbara_DiVentura_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
<div class="row Supervisor"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Julia" href="#Julia" class="thumbnail"><br />
<img src="/wiki/images/1/1b/Heidelberg_Julia_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Philipp" href="#Philipp" class="thumbnail"><br />
<img src="/wiki/images/9/95/Heidelberg_Philipp_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
<div class="row Supervisor"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Joel" href="#Joel" class="thumbnail"><br />
<img src="/wiki/images/1/12/Heidelberg_Joel_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Stefen" href="#Stefen" class="thumbnail"><br />
<img src="/wiki/images/a/a2/Heidelberg_Stefen_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
<div class="row Supervisor"><br />
<div class="col-lg-6 col-md-6 col-sm-6"><br />
<a id="Member-Pierre" href="#Pierre" class="thumbnail"><br />
<img src="/wiki/images/1/1d/Heidelberg_Piere_Thumbnail.jpg" alt="..."><br />
</a><br />
</div><br />
</div><br />
</div><br />
<div class="col-lg-4 col-md-6 col-sm-8 col-xs-9 col-lg-push-5 memberview"><br />
<div class="imageBorder"><br />
<img id="memberImageOverlay" src="/wiki/images/7/71/Heidelberg_Placeholder.jpg" alt="Image Overlay" class="img-responsive"/><br />
<img id="memberImage" src="/wiki/images/7/71/Heidelberg_Placeholder.jpg" alt="placeholder" class="img-responsive"/><br />
</div><br />
</div><br />
<div class="col-lg-5 col-md-12 col-sm-12 col-xs-12 col-lg-pull-4 memberview well"><br />
<h2 id="Name"></h2><br />
<p id="Description">Placeholder<br />
</p><br />
</div><br />
<div class="col-lg-9 col-md-6 col-sm-8 col-xs-9 col-md-offset-6 col-sm-offset-4 col-xs-offset-3 col-lg-offset-3 team-overlay"><br />
<div class="row" ><br />
<div class="col-lg-12"><br />
<img class="img-responsive border" src="/wiki/images/b/be/Heidelberg_Team.jpg" /><br />
</div><br />
<div class="col-lg-12"><br />
<h2>Our Team</h2><br />
<p><br />
We are a group of young and motivated students, and patient and <br />
motivated supervisors, who love synthetic biology and wish to make an <br />
important contribution to its advancement and acceptance by society. <br />
This year we have a nice mix of wet-lab experts (who made tons and <br />
tons of assays) and computer freaks (who wrote millions of code <br />
lines). Plus a crazy physicist (who did many, many things – but not <br />
involving a pipette!).<br />
Like good split inteins, we like to work only when assembled in a team!<br />
</p><br />
</div><br />
</div><br />
</div><br />
<div class="clearfix"></div><br />
</div><br />
</html><br />
|<br />
titles=<br />
|<br />
white=true<br />
|<br />
abstract=<br />
}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/slick}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/teampage}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/teampage}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/slick}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/js/teampageTeam:Heidelberg/js/teampage2014-10-18T03:39:36Z<p>Bunnech: </p>
<hr />
<div>var memberData = {<br />
"Max_H": { <br />
"Name" : "Max Horn", <br />
"img" : "/wiki/images/a/a7/Heidelberg_MaxH.jpg",<br />
"Description" : "'But after this has finished, I also want to do something in the wetlab', was one of the sentences most characterizing Max. He is definitely the software guy of the team. Compared to his programming, what we others coded was playing around with code blocks. For him it was always, the lower the level, the better. Therefore he is writing pure C code, as C++ does already too much by itself, he thinks. But still, he was somehow pressed to this role, as normally he is studying molecular biotechnology in 5th semester now. As iGEM@home was running, and he thought he would have a break from programming, the wiki as a project came upon him. On top, he is a perfectionist on software sides, so not only once he called out: 'Nils, look how smooth the ring is moving!'"<br />
},<br />
"Charlotte": {<br />
"Name" : "Charlotte Bunne", <br />
"img" : "/wiki/images/6/69/Heidelberg_Charlotte.jpg",<br />
"Description" : "Charlotte is our youngest team member and already participated in iGEM in Germany´s first High School team in 2012. Studying Biosciences in her third semester, she impresses all team members with her energy, curiosity and ambition. She is the creative head behind nearly all artworks of our project. The wiki design originates from her imaginations and the BOINC video as well as the cover picture for our theme night “Religion and Synthetic Biology” arose from her hands. In team effort with Nils, she is conducting the linker screening experiments for the lysozyme circularization. In the course of these experiments Charlotte learned huge organisational skills that directs her abilities and energy into the right channels. In this way Charlotte became an indispensable team member."<br />
},<br />
"Nils": {<br />
"Name": "Nils Klughammer", <br />
"img" : "/wiki/images/f/ff/Heidelberg_Nils.jpg",<br />
"Description" : "Nils will always be referred as the physicist in our team, because he implemented the whole CRAUT software and the lysozyme modelling. Furthermore he resigned to stand in the wet lab, and if just in full safety equipment – welling boots, helmet and welding goggles, was everything just to contaminated for him. Nils held the most motivation for circularisation, and were one oft he main leaders for ideas. Due to his structure, coordinate, and healthy life style, involvement in student parties he was very important in pulling the team together."<br />
},<br />
"Silvan": {<br />
"Name": "Silvan Schmitz",<br />
"img" : "/wiki/images/c/cf/Heidelberg_Silvan.jpg",<br />
"Description" : "Silvan is studying Systems biology in his second year. Jakob said once: This guy has the genius talent to really understand programming languages, while everyone else is just typing some aligned codes. Silvan is the designer of our MidnightDoc, and the name was not only but to quite a large extend influenced by his favourite working hour."<br />
},<br />
"Jan": {<br />
"Name": "Jan Gleixner",<br />
"img" : "/wiki/images/d/dd/Heidelberg_Jan.jpg",<br />
"Description" : "Jan – the internal instructor. He was the clever cloud above this whole project, gathering information from all subprojects and was therefore responsible for spreading the interdisciplinary work in the lab. Although sometimes hidden in his quite appearance, when you listen closer, you will get blown away by his extraordinary mind."<br />
},<br />
"Magdalena": {<br />
"Name": "Magdalena Büscher",<br />
"img" : "/wiki/images/f/f7/Heidelberg_Magdalena.jpg",<br />
"Description" : "Magdalena (23) is studying in the second semester of the master program Molecular Biosciences with Major Cancer Biology. Together with Anna and Silvan, she worked on the circularization of mDNMT1 (731-1602) and the establishment of the methylation maintaining PCR2.0. Magdalena has been successfully contacting experts and organizing intein as well as the DNMT1 construct. Whenever external facilities had to be used for protein purification or mass spectroscopy, she knew who to contact."<br />
},<br />
"Carolin": {<br />
"Name": "Carolin Schmelas",<br />
"img" : "/wiki/images/4/49/Heidelberg_Carolin.jpg",<br />
"Description" : "Caro is studying both biology with focus on neuroscience and Psychologies. When hearing her Whohoo exclamation, the whole team started to smile. It meant Caro was happy, because her CPEC cloning had worked, the split fluorescence protein gloomed, or she was deeply inLOV. For the youngest of us she was somehow the mummy oft he lab, sometimes demanding, sometimes treating, forgiving, sometimes the princess, always the winner."<br />
},<br />
"Elisabeth": {<br />
"Name": "Elisabeth Schäfer",<br />
"img" : "/wiki/images/7/71/Heidelberg_Elisabeth.jpg",<br />
"Description" : "Elisabeth is a 3rd year bachelor student in Molecular Biotechnology, Philosophy and Jewish Studies. She designed and cloned huge parts of the toolbox, but also organized the theme evening on synthetic biology, ethics and religion. Outside the lab she enjoys literature, learning new languages and traveling."<br />
},<br />
"Jakob": {<br />
"Name": "Jakob Kreft",<br />
"img" : "/wiki/images/9/92/Heidelberg_Jakob.jpg",<br />
"Description" : "Together with Charlotte and Anna he has participated in the iGEM team High school 2012. Now he is a medicine student in his second year. Synthetic Biology is one of his main interests and he hopes to continue working in this field of science. This summer he felt inLOV with inteins. Furthermore he was part of the wiki force."<br />
},<br />
"Max_W": {<br />
"Name": "Max Waldhauer",<br />
"img" : "/wiki/images/5/5a/Heidelberg_MaxW.jpg",<br />
"Description" : "Max also called Captain Sharky,is a 3rd year student in Molecular Biotechnology. He was responsible for a huge load of cloning stuff and the expert when it comes to circularization. He is not only the most successfull team member when it comes to handling 40 minipreps at one time (NEVER mixing up samples), but also the most sporty one. Outside the lab he enjoys sports and learning Russian."<br />
},<br />
"Anna": {<br />
"Name": "Anna Huhn",<br />
"img" : "/wiki/images/c/c9/Heidelberg_Anna.jpg",<br />
"Description" : "Anna is a 2nd year student in Molecular Biotechnology and the expert for DNMT1. She has been fascinated about this protein (and of course especially about its circularization) from beginning until the very end of the project: The last days before wikifreeze she eveb moved into the lab - bringing her tooth brush and sleeping bag. Outside the lab she enjoys sailing on the Neckar in Heidelberg."<br />
},<br />
"Constantin": {<br />
"Name": "Constantin Ahlmann", <br />
"img" : "/wiki/images/5/5a/Heidelberg_Constantin.jpg",<br />
"Description" : "Constantin is a hybrid of programming and lab guy: Not only has iGEM@home been his idea and he could demonstrate his programming skills working on this project, but also he managed to circularize Xylanase – again his idea. In his free time he gives Java classes to high-school students. His secret talent: dancing."<br />
},<br />
"Julia": {<br />
"Name": "Julia Neugebauer",<br />
"img" : "/wiki/images/b/b6/Heidelberg_Julia.jpg",<br />
"Description" : "I have done my bachelor and master studies in molecular biosciences at the University of Heidelberg. Currently, I am developing new confocal microscopy based screening methods using 3D cell culture. In the iGEM project, I was mainly involved in the DNMT1 project and helped in the setup of the different assays to measure xylanase, lysozyme and DNMT1 activity."<br />
},<br />
"Joel": {<br />
"Name": "Joel Beaudouin",<br />
"img" : "/wiki/images/7/7f/Heidelberg_Joel.jpg",<br />
"Description" : "I'm an experimentalist, originally physicist and now specialized in quantitative cell biology using imaging techniques. I've advised the students on the design of their experiments and on the techniques that have allowed them to quantitatively characterize their new proteins. I was also involved in the modeling parts of the project and their feedback to experimental data."<br />
},<br />
"Stephen": {<br />
"Name": "Stephen Krämer",<br />
"img" : "/wiki/images/c/c0/Heidelberg_Stefen.jpg",<br />
"Description" : "Stephen has just finished his master studies in Molecular Biosciences in the major “Systems Biology” at the University of Heidelberg and is starting his PhD in the “Computational Oncology” group within the department of Prof. Roland Eils. He was part of the iGEM Team Heidelberg in 2008. This year Stephen was mainly involved in the modeling parts of the project."<br />
},<br />
"Pierre": {<br />
"Name": "Pierre Wehler", <br />
"img" : "/wiki/images/d/d5/Heidelberg_Piere.jpg",<br />
"Description" : "During his master studies in Molecular Biosciences at the University of Heidelberg, Pierre focused on Molecular Cell Biology. Now he is doing his PhD in the group “Synthetic Biology” led by Dr. Barbara DiVentura and investigates light-induced p53 regulation in mammalian cells. During the iGEM project, Pierre was supervising the project part dealing with light-induced induction of intein splicing."<br />
},<br />
"Philipp": {<br />
"Name": "Philipp Bayer", <br />
"img" : "/wiki/images/0/09/Heidelberg_Philipp.jpg",<br />
"Description" : "Philipp started his career as a biologist in the iGEM lab Heidelberg in 2008. Being a stalwart iGEM enthusiast he never failed in finding himself trapped in the next iGEM experience. After rejoining the team of 2010, he graduated in Heidelberg and today is a master student in molecular biotechnology with focuses on infectious disease and viral vectors for gene therapy. Now he's back to iGEM and looking forward to the giant jamboree. Besides iGEM, Philipp likes travelling between various scientific disciplines and arts and is member of a group of biohackers that develop low-cost lab equipment for schools and amateur biologists."<br />
},<br />
"Barbara": {<br />
"Name": "Dr. Barbara Di Ventura", <br />
"img" : "/wiki/images/c/c5/Heidelberg_Barbara_DiVentura.jpg",<br />
"Description" : "Computer engineer by university training (carried out in the University of Rome “La Sapienza”), Barbara has done her Ph.D. in molecular biology in the laboratory of Luis Serrano, at the EMBL. Her Ph.D. project consisted in constructing a synthetic human p53 network in the yeast Saccharomyces cerevisiae. She was post-doc in the laboratory of Victor Sourjik, at the ZMBH. During this time she investigated the self-organizing properties of the Min system, the protein machinery that in Escherichia coli defines mid-cell. Since November 2011, Barbara heads the Synthetic Biology group in the department of Roland Eils, at the BioQuant. Barbara believes in the power of synthetic biology to create new functional devises and to teach important lessons about real biological systems. She also thinks that combining theory and experiments is the best strategy to understand the molecular mechanisms driving biological processes. Barbara finds the iGEM competition truly exciting and she is very happy to mentor the young, motivated and enthusiastic students of the Heidelberg iGEM 2014 team!"<br />
},<br />
"Eils": {<br />
"Name": "Prof. Dr. Roland Eils", <br />
"img" : "/wiki/images/1/19/Heidelberg_Roland_Eils.jpg",<br />
"Description" : "Prof. Eils is again the head of the iGEM Heidelberg team. He provides the laboratories and all the required equipment. Besides, he will sponsor the traveling and participation costs. Thank you very much! The research interests of Prof. Eils lies in the field of the analysis and mathematical modeling of complex pathways in molecular biology. He can look back at a very successful career, as he is the head of the Department of Theoretical Bioinformatics in the DKFZ and working on computational oncology. Furthermore, he is the director of the Department of Bioinformatics and Functional Genomics of the IPMB at the University of Heidelberg. Alongside Prof. Kräusslich and Prof. Wolfrum, he is one of three founding directors of the BioQuant, as well as the leader of the Systems Biology Center and the representative of the FORSYS-Initiative of Heidelberg’s research network, the ViroQuant. He has won numerous awards; in particular he has been awarded the Biofuture price (approx. 1.2 Million €) by the BMBF for innovations allowing the graphical reconstruction of the eukaryotic mitosis process from 4D microscopy images and in the year 2005 he won the award for new innovative research by Helmholtz Society: “SystemsBiology of Complex Diseases”. Besides, he was one of the main organizers of the International Conference on Systems Biology in Heidelberg 2004 and he organized the German Symposium on Systems Biology 2009. His new engagement in the up-coming field of Synthetic Biology underlines the need for tight interdisciplinary work between experimentalists and theoreticians."<br />
}<br />
<br />
};<br />
<br />
<br />
var teamView = true;<br />
<br />
<br />
function updateHeights(){<br />
$('#memberSelector').stop(true);<br />
var height = 0;<br />
if(teamView){<br />
height = $('.team-overlay').outerHeight();<br />
}<br />
else {<br />
height = $('#memberImage').height();<br />
}<br />
$('#memberSelector').animate({height: height}, 300, "swing", function(){<br />
updateSlick($('#memberSelector').height());<br />
});<br />
<br />
}<br />
<br />
function updateSlick(height){<br />
elementHeight = $('#memberSelector .row:first').outerHeight();<br />
numElements = Math.floor(height/elementHeight);<br />
memberselector = $('#memberSelector');<br />
memberselector.slickSetOption("slidesToShow", numElements, false);<br />
memberselector.slickSetOption("slidesToScroll", numElements, true);<br />
}<br />
<br />
function smoothLoadImage(src){<br />
$('.imageBorder').height($('#memberImage').height());<br />
$('#memberImageOverlay').attr("src", src);<br />
$('#memberImageOverlay').load(function(){<br />
$(this).fadeIn(400, "swing", function(){<br />
$('#memberImage').attr("src", src);<br />
$('#memberImage').load(function(){<br />
$('#memberImageOverlay').hide();<br />
$('.imageBorder').css("height", "");<br />
});<br />
});<br />
<br />
});<br />
}<br />
<br />
function hideTeamOverlay(callback){<br />
$('.team-overlay').animate({ opacity: 0}, 200, "swing", function(){$('.team-overlay').css("display","none");});<br />
$('.memberview').animate({ opacity: 1}, 200, "swing", function(){<br />
teamView = false;<br />
updateHeights();<br />
});<br />
}<br />
<br />
<br />
$(document).ready(function(){<br />
$('#memberImage').load(function(){<br />
updateHeights();<br />
});<br />
$('.team-overlay img').load(function(){<br />
updateHeights();<br />
});<br />
<br />
$('#memberSelector a').click(function(){<br />
if(teamView){<br />
hideTeamOverlay();<br />
<br />
$('#FilterButtons label').removeClass("active");<br />
if($(this).parent().parent().hasClass("Team"))<br />
$('#Teammembers-btn').addClass("active");<br />
else<br />
$('#Supervisors-btn').addClass("active");<br />
}<br />
$('#memberSelector a').removeClass("active");<br />
$(this).addClass("active");<br />
var memberKey = this.id.split("-")[1];<br />
member = memberData[memberKey];<br />
$("#Name").text(member.Name);<br />
<br />
smoothLoadImage(member.img);<br />
$('#Description').text(member.Description);<br />
});<br />
<br />
$('#Teamfoto-btn').click(function(){<br />
if(teamView == false){<br />
$('.team-overlay').css("display", "block");<br />
$('.team-overlay').animate({ opacity: 1}, 200);<br />
$('.memberview').animate({ opacity: 0}, 200);<br />
teamView = true;<br />
updateHeights();<br />
}<br />
});<br />
<br />
memberselector = $('#memberSelector');<br />
<br />
$('#Teammembers-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Supervisors-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Team');<br />
});<br />
<br />
$('#Supervisors-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Teammembers-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Supervisor');<br />
});<br />
<br />
$('#memberSelector').slick({<br />
prevArrow: '<img src="/wiki/images/3/3f/Heidelberg_prev-arrow.png" alt="prev-arrow" class="arrow arrow-prev"/>',<br />
nextArrow: '<img src="/wiki/images/e/e0/Heidelberg_next-arrow.png" alt="next-arrow" class="arrow arrow-next"/>',<br />
vertical: true,<br />
infinite: false,<br />
slidesToShow: 5,<br />
slidesToScroll: 5<br />
});<br />
$('#memberSelector').slickFilter('.Team');<br />
});<br />
<br />
$(window).resize(function(){<br />
updateHeights();<br />
});</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T03:26:06Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<html><br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
</html><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="/wiki/images/6/68/Freiburg_Cellculture2.JPG" target="_blank"><img src="/wiki/images/6/68/Freiburg_Cellculture2.JPG" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}<br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.<br />
<br />
{{#tag:html|<br />
<br />
<head><br />
<meta charset="utf-8"><br />
<style><br />
#propose {text-indent: 40px;<br />
}<br />
#greetings {text-indent: 20px;<br />
}<br />
ul.supporter_team_list { list-style-type: none;<br />
}<br />
ul.supporter_team_list a {text-decoration: none;color: black;}<br />
ul.supporter_team_list a:hover {text-decoration: underline;}<br />
ul.supporter_team_list > li {display:inline;margin: 30px;<br />
}<br />
</style><br />
</head><br />
<body><br />
<div id="socioeconomics"> <br />
<h1>A proposal of the German iGEM Teams concerning Intellectual Property</h1><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br />
</div><br />
</body><br />
}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T03:25:15Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<html><br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
</html><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="/wiki/images/6/68/Freiburg_Cellculture2.JPG" target="_blank"><img src="/wiki/images/6/68/Freiburg_Cellculture2.JPG" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}}<br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.<br />
<br />
{{#tag:html|<br />
<!doctype html><br />
<html><br />
<head><br />
<meta charset="utf-8"><br />
<style><br />
#propose {text-indent: 40px;<br />
}<br />
#greetings {text-indent: 20px;<br />
}<br />
ul.supporter_team_list { list-style-type: none;<br />
}<br />
ul.supporter_team_list a {text-decoration: none;color: black;}<br />
ul.supporter_team_list a:hover {text-decoration: underline;}<br />
ul.supporter_team_list > li {display:inline;margin: 30px;<br />
}<br />
</style><br />
</head><br />
<body><br />
<div id="socioeconomics"> <br />
<h1>A proposal of the German iGEM Teams concerning Intellectual Property</h1><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br />
</div><br />
</body><br />
}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T03:24:37Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<html><br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
</html><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="/wiki/images/6/68/Freiburg_Cellculture2.JPG" target="_blank"><img src="/wiki/images/6/68/Freiburg_Cellculture2.JPG" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}}<br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.<br />
<br />
<html><br />
<!doctype html><br />
<html><br />
<head><br />
<meta charset="utf-8"><br />
<style><br />
#propose {text-indent: 40px;<br />
}<br />
#greetings {text-indent: 20px;<br />
}<br />
ul.supporter_team_list { list-style-type: none;<br />
}<br />
ul.supporter_team_list a {text-decoration: none;color: black;}<br />
ul.supporter_team_list a:hover {text-decoration: underline;}<br />
ul.supporter_team_list > li {display:inline;margin: 30px;<br />
}<br />
</style><br />
</head><br />
<body><br />
<div id="socioeconomics"> <br />
<h1>A proposal of the German iGEM Teams concerning Intellectual Property</h1><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br />
</div><br />
</body><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T03:23:49Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<html><br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
</html><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
<html><br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="/wiki/images/6/68/Freiburg_Cellculture2.JPG" target="_blank"><img src="/wiki/images/6/68/Freiburg_Cellculture2.JPG" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}}<br />
</html><br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.<br />
<br />
<html><br />
<!doctype html><br />
<html><br />
<head><br />
<meta charset="utf-8"><br />
<style><br />
#propose {text-indent: 40px;<br />
}<br />
#greetings {text-indent: 20px;<br />
}<br />
ul.supporter_team_list { list-style-type: none;<br />
}<br />
ul.supporter_team_list a {text-decoration: none;color: black;}<br />
ul.supporter_team_list a:hover {text-decoration: underline;}<br />
ul.supporter_team_list > li {display:inline;margin: 30px;<br />
}<br />
</style><br />
</head><br />
<body><br />
<div id="socioeconomics"> <br />
<h1>A proposal of the German iGEM Teams concerning Intellectual Property</h1><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br />
</div><br />
</body><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T03:22:02Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="/wiki/images/6/68/Freiburg_Cellculture2.JPG" target="_blank"><img src="/wiki/images/6/68/Freiburg_Cellculture2.JPG" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}}<br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.<br />
<br />
<html><br />
<!doctype html><br />
<html><br />
<head><br />
<meta charset="utf-8"><br />
<style><br />
#propose {text-indent: 40px;<br />
}<br />
#greetings {text-indent: 20px;<br />
}<br />
ul.supporter_team_list { list-style-type: none;<br />
}<br />
ul.supporter_team_list a {text-decoration: none;color: black;}<br />
ul.supporter_team_list a:hover {text-decoration: underline;}<br />
ul.supporter_team_list > li {display:inline;margin: 30px;<br />
}<br />
</style><br />
</head><br />
<body><br />
<div id="socioeconomics"> <br />
<h1>A proposal of the German iGEM Teams concerning Intellectual Property</h1><br />
<p>During the meetup of the German iGEM teams from 23rd to 25th May also <a href="https://2014.igem.org/Meetups:May_LMU-Munich/Workshops">workshops</a> took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
</p><br />
<p><br />
Especially the topic of an open source vs. patent controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear and that there are parts (e.g. <a href="http://parts.igem.org/Part:BBa_K180009">BBa_K180009</a>) where only upon a closer look it becomes clear that the rights are company–owned. The issue that the legal status of parts in the registry remains uncertain is also mentioned in a recent article published by Nature (<a href="http://www.nature.com/news/synthetic-biology-cultural-divide-1.15149">Bryn Nelson ‘Synthetic Biology: Cultural Divide ’, Nature 509, 152–154, 08 May 2014</a>) :<br />
</p><br />
<p><br />
<i>"[N]o one can say with any certainty how many of these parts are themselves entirely free of patent claims."</i><br />
</p><br />
<p><br />
We, the German iGEM teams, therefore like to suggest the addition of a new feature to the parts registry:<br />
</p><br />
<p id="propose"> A dedicated data field of license information for each BioBrick part.</p><br />
<p> <br />
For the implementation, we propose to introduce two new fields to BioBrick part entries in the registry:<br />
</p><br />
<ol><br />
<li>A string property "LicenseInfo"</li><br />
<li>A traffic light property (grey, green, yellow, red) to indicate the level of legal protection (unknown, BPA-like, free for research purposes, heavily protected)</li><br />
</ol><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2014/6/69/TU-BS_Part_licence_info.png" alt="This image shows a how the proposed field LicenceInfo could look like in the registry."> <br />
<br />
<p><br />
Implementing this feature would in our opinion further clarify and extend the parts info, provide a machine-readable format and thus improve future entries. With the emerging Entrepreneurship track and applications getting closer to industrial realization, the legal status becomes more and more important. Also it would raise awareness to the topic of the legal status of parts, leading to a debate which could further promote the idea of open source. At the same time we hope that examination of most parts will show that they are indeed free of restrictive legal protections.<br />
</p><br />
<p id="greetings"><br />
The German iGEM Teams,<br />
</p><br />
<ul class="supporter_team_list"><br />
<li><a href="https://2014.igem.org/Team:Aachen">Aachen </a></li><br />
<li><a href="https://2014.igem.org/Team:Berlin">Berlin </a></li><br />
<li><a href="https://2014.igem.org/Team:Bielefeld-CeBiTec">Bielefeld-CeBiTec </a></li><br />
<li><a href="https://2014.igem.org/Team:Braunschweig">Braunschweig </a></li><br />
<li><a href="https://2014.igem.org/Team:Freiburg">Freiburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Goettingen">Goettingen </a></li><br />
<li><a href="https://2014.igem.org/Team:Hannover">Hannover </a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg">Heidelberg </a></li><br />
<li><a href="https://2014.igem.org/Team:LMU-Munich">LMU-Munich </a></li><br />
<li><a href="https://2014.igem.org/Team:Marburg">Marburg </a></li><br />
<li><a href="https://2014.igem.org/Team:Saarland">Saarland </a></li><br />
<li><a href="https://2014.igem.org/Team:Tuebingen">Tuebingen </a></li><br />
<li><a href="https://2014.igem.org/Team:TU_Darmstadt">TU&nbsp;Darmstadt </a></li><br />
</ul><br />
</div><br />
</body><br />
</html><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/Templates/BootstrapNavTeam:Heidelberg/Templates/BootstrapNav2014-10-18T03:11:26Z<p>Bunnech: </p>
<hr />
<div>{{#tag:html|<br />
<header id="navbar" role="banner" class="navbar navbar-static-top {{{red{{{red|}}}|navbar-red}}}{{{white{{{white|}}}|navbar-white}}}"><br />
<div class="container" style="{{{header-img{{{header-img|}}}|background-image:url({{{header-img}}});background-position: bottom right; background-repeat:no-repeat; background-size: 100% auto;}}} {{{header-bg{{{header-bg|}}}|background-color:{{{header-bg}}};}}}"><br />
<div class="navbar-header"><br />
<a class="logo" href="/Team:Heidelberg" title="Home" style="padding-top: 15px; padding-left: 15px; display:inline-block;"><br />
<img src="{{{red-logo{{{red-logo|}}}|/wiki/images/4/44/Heidelberg_Logo_header_left.png}}}{{{white-logo{{{white-logo|}}}|/wiki/images/1/1d/Logo_Website_left_white.png}}}" alt="Home"> </a><br />
<!-- .btn-navbar is used as the toggle for collapsed navbar content --><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="sr-only">Toggle navigation</span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
</div><br />
<br />
<div class="navbar-collapse collapse" style="margin-bottom:10px;"><br />
<nav role="navigation"><br />
<ul class="menu nav navbar-nav navbar-right"><br />
<li class="dropdown"><a href="/Team:Heidelberg/Team" class="dropdown-toggle" ><img src="{{{red{{{red|}}}|/wiki/images/d/d3/Team_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/a/aa/Team_icon.png}}}" alt="Team icon">Team</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Team/Members">Members</a></li><br />
<li><a href="/Team:Heidelberg/Team/Collaborations">Collaborations</a></li><br />
<li><a href="/Team:Heidelberg/Team/Attributions">Attributions</a></li><br />
<li><a href="/Team:Heidelberg/Team/Sponsoring">Sponsoring</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Project" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3f/Science_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/da/Science_icon.png}}}" alt="Science icon">Project</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Project">Overview</a></li><br />
<li><a href="/Team:Heidelberg/Project/Background">Background</a></li><br />
<li><a href="/Team:Heidelberg/Project/Toolbox">Toolbox</a></li><br />
<li><a href="/Team:Heidelberg/Toolbox/Circularization">Toolbox: Circularization</a></li><br />
<li><a href="/Team:Heidelberg/Project/PCR_2.0">PCR 2.0</a></li><br />
<li><a href="/Team:Heidelberg/Project/Xylanase">Xylanase</a></li><br />
<li><a href="/Team:Heidelberg/Project/Linker_Screening">Linker Screening</a></li><br />
<li><a href="/Team:Heidelberg/Project/Reconstitution">Fluorescence Assembly</a></li><br />
<li><a href="/Team:Heidelberg/Project/LOV">Light-Induction</a></li><br />
<li><a href="/Team:Heidelberg/Project#Achievements">Achievements</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Parts" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/1d/Parts_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/9/9c/Parts_icon.png}}}" alt="Parts icon">Parts</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Parts/RFC">RFC Heidelberg 2014</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">Favorite Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Sample Data Page">Sample Data Page</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Biobricks">Biobricks</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones">Backbones</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Intein Library">Intein Library</a></li><br />
<li><a href="/Team:Heidelberg/Parts/Part_Improvement">Part Improvement</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><br />
<a href="/Team:Heidelberg/Software" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/18/Software_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/1/11/Software_icon.png}}}" alt="Software icon">Software</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Software/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Software/Linker_Software">Linker Software</a></li><br />
<li><a href="/Team:Heidelberg/Software/MidnightDoc">MidnightDoc</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Modeling" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/13/Modeling_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/d8/Modeling_icon.png}}}" alt="Modeling icon">Modeling</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Modeling/Linker_Modeling">Linker Modeling</a></li><br />
<li><a href="/Team:Heidelberg/Modeling/Enzyme_Modeling">Enzyme Kinetics Modeling</a></li><br />
<!--<li><a href="#">Modeling Application</a></li>--><br />
</ul><br />
</li><br />
<li><a href="/Team:Heidelberg/Toolbox_Guide" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/32/Toolbox_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/0/08/Toolbox_icon.png}}}" alt="Toolbox icon">Toolbox Guide</a></li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Human_Practice" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3d/Humanpractice_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/Humanpractice_icon.png}}}" alt="Human Practice icon">Human Practice</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Ethics">Religion & Synthetic Biology</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Education">Education</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Public_Relations">Public Relations</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Experts">Experts</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Notebook" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/0/03/MD_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/e/e9/MD_icon.png}}}" alt="Our Laboratory Notebook icon">Notebook</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Notebook">Notebook</a></li><br />
<li><a href="/Team:Heidelberg/AwesomeSheet">Database for Notebook</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Materials">Materials</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Methods">Methods</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Safety">Safety</a></li><br />
</ul><br />
</li><br />
<li id="logo" ><a href="/" title="Home"><br />
<img src="{{{red{{{red|}}}|/wiki/images/7/79/IGEM_logo_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/IGEM_logo_white.png}}}" alt="Home"><br />
</a></li><br />
</ul><br />
</nav><br />
</div><br />
{{{title{{{title|}}}|<br />
<div class="col-lg-12"><br />
<div class="title-wrapper"><br />
<span class="title">{{{title}}}</span><br />
<span class="special-span"></span><br />
</div><br />
</div><br />
}}}<br />
</div><br />
</header><br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/AwesomeSheetTeam:Heidelberg/AwesomeSheet2014-10-18T03:10:35Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/templates/wikipage_new|<br />
title=Database for Notebook<br />
|<br />
white=true<br />
|<br />
red-logo=true<br />
|<br />
header-img=/wiki/images/6/6a/Heidelberg_epic_background.jpg<br />
|<br />
header-bg=black<br />
|<br />
subtitle= The Awesome Sheet<br />
|<br />
container-style=background-color:white;<br />
|<br />
titles=<br />
|<br />
abstract=<br />
|<br />
content=<br />
{{:Team:Heidelberg/Templates/Awesomesheet}}<br />
<div class="col-lg-12 notebook-awesomesheet"><br />
<br />
<html><br />
</html><br />
<br />
</div><br />
|<br />
white-logo=<br />
|<br />
red=<br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/Templates/BootstrapNavTeam:Heidelberg/Templates/BootstrapNav2014-10-18T03:08:15Z<p>Bunnech: </p>
<hr />
<div>{{#tag:html|<br />
<header id="navbar" role="banner" class="navbar navbar-static-top {{{red{{{red|}}}|navbar-red}}}{{{white{{{white|}}}|navbar-white}}}"><br />
<div class="container" style="{{{header-img{{{header-img|}}}|background-image:url({{{header-img}}});background-position: bottom right; background-repeat:no-repeat; background-size: 100% auto;}}} {{{header-bg{{{header-bg|}}}|background-color:{{{header-bg}}};}}}"><br />
<div class="navbar-header"><br />
<a class="logo" href="/Team:Heidelberg" title="Home" style="padding-top: 15px; padding-left: 15px; display:inline-block;"><br />
<img src="{{{red-logo{{{red-logo|}}}|/wiki/images/4/44/Heidelberg_Logo_header_left.png}}}{{{white-logo{{{white-logo|}}}|/wiki/images/1/1d/Logo_Website_left_white.png}}}" alt="Home"> </a><br />
<!-- .btn-navbar is used as the toggle for collapsed navbar content --><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="sr-only">Toggle navigation</span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
</div><br />
<br />
<div class="navbar-collapse collapse" style="margin-bottom:10px;"><br />
<nav role="navigation"><br />
<ul class="menu nav navbar-nav navbar-right"><br />
<li class="dropdown"><a href="/Team:Heidelberg/Team" class="dropdown-toggle" ><img src="{{{red{{{red|}}}|/wiki/images/d/d3/Team_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/a/aa/Team_icon.png}}}" alt="Team icon">Team</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Team/Members">Members</a></li><br />
<li><a href="/Team:Heidelberg/Team/Collaborations">Collaborations</a></li><br />
<li><a href="/Team:Heidelberg/Team/Attributions">Attributions</a></li><br />
<li><a href="/Team:Heidelberg/Team/Sponsoring">Sponsoring</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Project" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3f/Science_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/da/Science_icon.png}}}" alt="Science icon">Project</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Project">Overview</a></li><br />
<li><a href="/Team:Heidelberg/Project/Background">Background</a></li><br />
<li><a href="/Team:Heidelberg/Project/Toolbox">Toolbox</a></li><br />
<li><a href="/Team:Heidelberg/Toolbox/Circularization">Toolbox: Circularization</a></li><br />
<li><a href="/Team:Heidelberg/Project/PCR_2.0">PCR 2.0</a></li><br />
<li><a href="/Team:Heidelberg/Project/Xylanase">Xylanase</a></li><br />
<li><a href="/Team:Heidelberg/Project/Linker_Screening">Linker Screening</a></li><br />
<li><a href="/Team:Heidelberg/Project/Reconstitution">Fluorescence Assembly</a></li><br />
<li><a href="/Team:Heidelberg/Project/LOV">Light-Induction</a></li><br />
<li><a href="/Team:Heidelberg/Project#Achievements">Achievements</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Parts" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/1d/Parts_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/9/9c/Parts_icon.png}}}" alt="Parts icon">Parts</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Parts/RFC">RFC Heidelberg 2014</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">Favorite Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Sample Data Page">Sample Data Page</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Biobricks">Biobricks</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones">Backbones</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Intein Library">Intein Library</a></li><br />
<li><a href="/Team:Heidelberg/Parts/Part_Improvement">Part Improvement</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><br />
<a href="/Team:Heidelberg/Software" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/18/Software_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/1/11/Software_icon.png}}}" alt="Software icon">Software</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Software/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Software/Linker_Software">Linker Software</a></li><br />
<li><a href="/Team:Heidelberg/Software/MidnightDoc">MidnightDoc</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Modeling" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/13/Modeling_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/d8/Modeling_icon.png}}}" alt="Modeling icon">Modeling</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Modeling/Linker_Modeling">Linker Modeling</a></li><br />
<li><a href="/Team:Heidelberg/Modeling/Enzyme_Modeling">Enzyme Kinetics Modeling</a></li><br />
<!--<li><a href="#">Modeling Application</a></li>--><br />
</ul><br />
</li><br />
<li><a href="/Team:Heidelberg/Toolbox_Guide" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/32/Toolbox_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/0/08/Toolbox_icon.png}}}" alt="Toolbox icon">Toolbox Guide</a></li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Human_Practice" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3d/Humanpractice_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/Humanpractice_icon.png}}}" alt="Human Practice icon">Human Practice</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Ethics">Religion & Synthetic Biology</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Education">Education</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Public_Relations">Public Relations</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Experts">Experts</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Notebook" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/0/03/MD_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/e/e9/MD_icon.png}}}" alt="Our Laboratory Notebook icon">Notebook</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Notebook">Notebook</a></li><br />
<li><a href="/Team:Heidelberg/awesomesheet">Database for Notebook</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Materials">Materials</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Methods">Methods</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Safety">Safety</a></li><br />
</ul><br />
</li><br />
<li id="logo" ><a href="/" title="Home"><br />
<img src="{{{red{{{red|}}}|/wiki/images/7/79/IGEM_logo_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/IGEM_logo_white.png}}}" alt="Home"><br />
</a></li><br />
</ul><br />
</nav><br />
</div><br />
{{{title{{{title|}}}|<br />
<div class="col-lg-12"><br />
<div class="title-wrapper"><br />
<span class="title">{{{title}}}</span><br />
<span class="special-span"></span><br />
</div><br />
</div><br />
}}}<br />
</div><br />
</header><br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/Templates/BootstrapNavTeam:Heidelberg/Templates/BootstrapNav2014-10-18T03:03:57Z<p>Bunnech: </p>
<hr />
<div>{{#tag:html|<br />
<header id="navbar" role="banner" class="navbar navbar-static-top {{{red{{{red|}}}|navbar-red}}}{{{white{{{white|}}}|navbar-white}}}"><br />
<div class="container" style="{{{header-img{{{header-img|}}}|background-image:url({{{header-img}}});background-position: bottom right; background-repeat:no-repeat; background-size: 100% auto;}}} {{{header-bg{{{header-bg|}}}|background-color:{{{header-bg}}};}}}"><br />
<div class="navbar-header"><br />
<a class="logo" href="/Team:Heidelberg" title="Home" style="padding-top: 15px; padding-left: 15px; display:inline-block;"><br />
<img src="{{{red-logo{{{red-logo|}}}|/wiki/images/4/44/Heidelberg_Logo_header_left.png}}}{{{white-logo{{{white-logo|}}}|/wiki/images/1/1d/Logo_Website_left_white.png}}}" alt="Home"> </a><br />
<!-- .btn-navbar is used as the toggle for collapsed navbar content --><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="sr-only">Toggle navigation</span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
</div><br />
<br />
<div class="navbar-collapse collapse" style="margin-bottom:10px;"><br />
<nav role="navigation"><br />
<ul class="menu nav navbar-nav navbar-right"><br />
<li class="dropdown"><a href="/Team:Heidelberg/Team" class="dropdown-toggle" ><img src="{{{red{{{red|}}}|/wiki/images/d/d3/Team_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/a/aa/Team_icon.png}}}" alt="Team icon">Team</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Team/Members">Members</a></li><br />
<li><a href="/Team:Heidelberg/Team/Collaborations">Collaborations</a></li><br />
<li><a href="/Team:Heidelberg/Team/Attributions">Attributions</a></li><br />
<li><a href="/Team:Heidelberg/Team/Sponsoring">Sponsoring</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Project" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3f/Science_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/da/Science_icon.png}}}" alt="Science icon">Project</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Project">Overview</a></li><br />
<li><a href="/Team:Heidelberg/Project/Background">Background</a></li><br />
<li><a href="/Team:Heidelberg/Project/Toolbox">Toolbox</a></li><br />
<li><a href="/Team:Heidelberg/Toolbox/Circularization">Toolbox: Circularization</a></li><br />
<li><a href="/Team:Heidelberg/Project/PCR_2.0">PCR 2.0</a></li><br />
<li><a href="/Team:Heidelberg/Project/Xylanase">Xylanase</a></li><br />
<li><a href="/Team:Heidelberg/Project/Linker_Screening">Linker Screening</a></li><br />
<li><a href="/Team:Heidelberg/Project/Reconstitution">Fluorescence Assembly</a></li><br />
<li><a href="/Team:Heidelberg/Project/LOV">Light-Induction</a></li><br />
<li><a href="/Team:Heidelberg/Project#Achievements">Achievements</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Parts" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/1d/Parts_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/9/9c/Parts_icon.png}}}" alt="Parts icon">Parts</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Parts/RFC">RFC Heidelberg 2014</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">Favorite Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Sample Data Page">Sample Data Page</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Biobricks">Biobricks</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones">Backbones</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Intein Library">Intein Library</a></li><br />
<li><a href="/Team:Heidelberg/Parts/Part_Improvement">Part Improvement</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><br />
<a href="/Team:Heidelberg/Software" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/18/Software_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/1/11/Software_icon.png}}}" alt="Software icon">Software</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Software/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Software/Linker_Software">Linker Software</a></li><br />
<li><a href="/Team:Heidelberg/Software/MidnightDoc">MidnightDoc</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Modeling" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/13/Modeling_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/d8/Modeling_icon.png}}}" alt="Modeling icon">Modeling</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Modeling/Linker_Modeling">Linker Modeling</a></li><br />
<li><a href="/Team:Heidelberg/Modeling/Enzyme_Modeling">Enzyme Kinetics Modeling</a></li><br />
<!--<li><a href="#">Modeling Application</a></li>--><br />
</ul><br />
</li><br />
<li><a href="/Team:Heidelberg/Toolbox_Guide" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/32/Toolbox_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/0/08/Toolbox_icon.png}}}" alt="Toolbox icon">Toolbox Guide</a></li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Human_Practice" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3d/Humanpractice_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/Humanpractice_icon.png}}}" alt="Human Practice icon">Human Practice</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Ethics">Religion & Synthetic Biology</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Education">Education</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Public_Relations">Public Relations</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Experts">Experts</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Notebook" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/0/03/MD_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/e/e9/MD_icon.png}}}" alt="Our Laboratory Notebook icon">Notebook</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Notebook">Notebook</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Database">Notebook</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Materials">Materials</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Methods">Methods</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Safety">Safety</a></li><br />
</ul><br />
</li><br />
<li id="logo" ><a href="/" title="Home"><br />
<img src="{{{red{{{red|}}}|/wiki/images/7/79/IGEM_logo_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/IGEM_logo_white.png}}}" alt="Home"><br />
</a></li><br />
</ul><br />
</nav><br />
</div><br />
{{{title{{{title|}}}|<br />
<div class="col-lg-12"><br />
<div class="title-wrapper"><br />
<span class="title">{{{title}}}</span><br />
<span class="special-span"></span><br />
</div><br />
</div><br />
}}}<br />
</div><br />
</header><br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/SafetyTeam:Heidelberg/pages/Safety2014-10-18T02:47:38Z<p>Bunnech: </p>
<hr />
<div>In the everyday life of a scientist in the lab safety is the most important issue. Lab safety has two different aspects. It encompasses the steps and precautions necessary to only protect oneself from any potential hazard, but also to prevent undesired release of engineered (and potentially harmful) organisms or chemical reagents in the environment. Especially the latter point is often addressed in discussions about genetic engineering and synthetic biology. The anxiety of those who do not deal with genetically modified organisms often stems from biosafety issues. Here we want to shed light upon the daily handling and precautions that biologists take to prevent danger that can arise from the mishandling of biological material. Since distributed computation plays a major role in our project, we would like to discuss here also “software safety”.<br />
<br />
In both safety areas, we actively searched communication with safety advisors and eventually put useful approaches into practice. We used all the received advice to shape our projects and think about precautions that are crucial to fulfill the claims of biosafety.<br />
<br />
[https://igem.org/Safety/Safety_Form?team_id=1362 Here] you can find our Safety form!<br />
<br />
=Lab Safety=<br />
At the beginning of our project, we were given the safety introduction by the responsible safety coordinator Dr. Nicole Metzendorf, who explained to us how to work in the lab and how to apply good laboratory practice. By observing personal safety precautions, such as wearing a lab coat and gloves when working on the bench, or wearing safety goggles when using dangerous chemicals, we protect ourselves from the daily hazards in the lab.<br />
<br />
To prevent contamination within the lab, we devised separated workspaces for running gels with ethidium bromide, and an area to work with genetically modified organisms. To protect ourselves from exposure to toxic fumes, chemicals were only used under the fume hood. The documentation of the daily lab work was done only on the desks, were no biological or chemical material is allowed. <br />
<br />
In addition to the general lab safety, we talked to the safety advisor on our campus, Dr. Willi Siller, with whom we double-checked the feasibility of the project concerning its safety. <br />
Together we examined the donor- and chassis- organisms that we are using for our project and ranked them in their biosafety level. Fortunately, all bacteria strains that we use in the lab were classified as safety level 1, meaning that our bacteria are not harmful. <br />
<br />
Indeed, the bacterial species used in our experiments - several E. coli strains, Bacillus subtillis and Micrococcus lysodeikticus – are categorized as safety level 1 (S1) (link). The cell line HEK293T, a human kidney cell line used for phototoxicity is also at safety level 1. Even though none of the organisms we are working with cause any threat to the environment, we were careful in handling them, always wearing the proper protection and disinfecting and autoclaving anything which got in contact with living organisms, or discarded it in the S1-waste. These steps assure containment of any bioactive material within the lab and prevent contamination of the environment. <br />
<br />
To reduce anxiety in society about synthetic biology, it is of major concern to discuss the issue of biosafety with the public and elucidate which precautions and regulations are practiced in the lab. Therefore this issue was broadly discussed in our theme night “Synthetic Biology, Religion and Ethics”, during which, once again, it became clear that genetically modified organisms and their release in the environment are delicate issues among non-scientists. <br />
<br />
<br />
=Software Safety=<br />
One essential part of our project is computational, using not only our own PCs, but computers around the world via distributed computing. By providing their PCs, our users trust us not to provide them with any malware or virus, as well as not spying on their private data. To guarantee the safety of our users’ PC, we used a security mechanism called code signing. The BOINC software will only run software code, which is signed by the correct certificate. Essentially, code signing is based on two unique keys, a public and a private key. The private key is kept on a PC or Medium, in our case on a CD, with no access to the Internet, to keep it secure. Whenever there is an update on software code, you need the private key to generate a new certificate. The end user receives the new certificate, and using the public key, compares the check sum from the software code and the certificate. The program can only be executed, when this matching is successful. Since the public key cannot be used to alter the code itself, this system assures that the BOINC client only runs software created by the developer. This solution was discussed with some of the developers of BOINC itself and was deemed sufficient to allow us to have our software sponsored on their official webpage.<br />
<br />
Despite all our efforts to ensure the safety of our software, we noticed that the numbers of visitors of our iGEM@home page largely exceeded the number of those effectively downloading the program to calculate linkers on their computers. We interpret this as a clear sign of fear and suspicion and, while we discussed a lot about what more we could do to tempt people to download the program and trust us, we could not find any better idea and realized that it is almost impossible to guarantee software safety at 100% and that very often it is a matter of trust towards those who realize a piece of software.</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/ToolboxTeam:Heidelberg/pages/Toolbox2014-10-18T02:46:12Z<p>Bunnech: /* On */</p>
<hr />
<div><br />
A primary mission of the iGEM team Heidelberg 2014 is to provide a new toolbox based on appropriate standards that introduces the highly functional [https://2014.igem.org/Team:Heidelberg/Project/Background INTEINS] to the parts registry and thereby paving the way to a new level of posttranslational modification possibilities for the iGEM community. Inteins are self-excising peptide segments that mediate the reaction of protein trans-splicing. They don't require any additional energy sources to perform the splicing reaction. Another valuable feature of inteins is their specific recognition, also in the presence of other proteins, which makes them functional in vitro as well as in vivo. On this page we describe experimental approaches to provide and evaluate five related but still quite different applications using inteins and their splicing capabilities. Thereby we present scientific prove of the diversity and efficiency of an intein toolbox that can be used for a wide range of posttranslational modifications of proteins. Explore the new possibilities, intein usage provides! On this page we describe the scientific work in form of modeling and experiments that lead to the establishment of the first intein toolbox in the history of iGEM! <br />
<br />
''Jump right into splicing and use the [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to design your intein-equipped proteins of choice!''<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icons a:hover img {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icons a img {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.toolbox-icons {<br />
text-align: center;<br />
}<br />
<br />
.toolbox-icons a {<br />
display:block;<br />
margin-bottom:0px;<br />
white-space: nowrap;<br />
color: black;<br />
font-size: 15px;<br />
}<br />
<br />
.toolbox-icons a:hover {<br />
color: #DE4230;<br />
}<br />
<br />
.toolbox-icons img {<br />
margin-bottom: 0px;<br />
}<br />
<br />
.linie {<br />
margin:50px 40px;<br />
border: solid 1px black;<br />
}<br />
</style><br />
<br />
<div class="row toolbox-icons"><br />
<div class="col-lg-2 col-lg-offset-1 col-md-offset-1 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" class="img-responsive" /></span>CIRCULARIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/4/40/Oligomerization.png" class="img-responsive" /></span>OLIGOMERIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" class="img-responsive" /></span>FUSING & TAGGING</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" class="img-responsive" /></span>PURIFICATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" class="img-responsive" /></span>ON OFF</a><br />
</div><br />
</div><br />
</html><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Circularization=<br />
<br />
Millions of years of evolution have allowed proteins to performed extremely specific chemical modifications that are not only essential for living organisms but can also be of great benefit to produce useful molecules for our life, efficiently and at low cost. A major limitation of the use of enzyme for industrial application and in general for usage out of their natural environment is their stability. They can be destroyed by other enzymes and they can unfold and take non-functional conformation when exposed to non-physiological temperature and pH. Such limitations has motivated research in species that can grow at extreme temperatures [6]. Another major area of chemical research if the design of strategies to stabilize enzymes, and more generally proteins and peptides. Protein circularization, meaning ligation of the N- and C-terminal ends of a protein, represents a promising way to achieve this stabilization. While conserving the functionality of their linear counterpart, circular proteins can be superior to linear proteins in terms of thermostability [1][2][3], resistance against chemical denaturation [4] and protection from exopeptidases [2][4]. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides [5]. These remarkable properties motivated us to develop new tools to circularize any protein of interest.<br />
<br />
Our Toolbox Guide provides a step-by-step strategy to clone a circularization linker and express it in e. Coli. Moreover, in case of complex structures where the protein extremities are far from each other, we have developed a software that will design the appropriate rigid linkers.<br />
<br />
''Please find more information and results of the experiments that laid the foundation for the circularization kit of the toolbox on the [https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization Circularization pages]''. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Oligomerization=<br />
<br />
Split inteins constitute a useful tool to produce huge polymers in vivo: Hauptmann et al. managed to fabricate synthetic spider silk with microfiber structure. The results using an easy-to-handle split intein system were stunning: The polymers had a molecular weight of 250 kDa and more [7]. Further application of oligomerization by inteins includes the posttranslational complexation of multi-domain proteins, after their domains have been expressed individually. This approach is very valuable considering great difficulities of expressing large eukaryotic proteins in <i>E.coli</i>.<br />
<br />
==== Standardization of oligomerization ====<br />
The valuable properties of spider silk, for example its exceptional strength and elasticity, result from numerous repeats of certain protein motifs. Convenitonal methods to multimerize these motifs bear a lot of difficulties: Often genetic and mRNA instability constitute a barrier for the production of multimers as fusion proteins.[1] Posttranslational assembly through split inteins is therefore the solution to overcome these problems. The successfull polimerization of spider silk potein motifs demonstrates the potential of split inteins to be a useful tool for the production of new biomaterials by performing oligomerization reactions with split inteins. The iGEM team Heidelberg standardized (lik to toolbox guide) the oligomerization procedure with split inteins to allow easy handling with different proteins.<br />
<br />
The use of non-orthogonal split inteins can further be exploited to direct the oligomerisation of several protein domains at once.<br />
<br />
==== The mechanism ====<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Oligomerization with inteins.|file=Oligomerization.png}}<br />
Oligomerization reactions require the same constructs as the ones used for protein circularization.<br />
<br />
Circularization is achieved by bringing the N and C terminus of a protein very close together, so both intein parts can asseble, cut out off the protein and thereby circularize it. In contrast, oligomerization occurs when both termini of a protein cannot reach each other and the intein parts of two neighbouring proteins assemble. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Fusion and Tagging=<br />
<br />
====Introduction====<br />
Post-translational modifications are present in nature in great numbers.Synthetic Biology, however, has not yet made use of the innumerable possibilities nature has developed. With our collection of intein assembly constructs we expand the arsenal of synthetic biology by enabling unlimited changes of a protein's amino acid sequence even after translation. <br />
<br />
====Standard Construction====<br />
<br />
To be able <b>to fuse</b> any two halves of a protein together can have many different uses. We therefore saw the need for a standardised construct, the intein assembly part. This BioBrick part allows the user to clone two DNA-sequences coding for two parts of a peptide into a plasmid prepared with selection markers and standardised overhangs. Those parts were all send in with additional hexahistidine-tags to enable quick analysis on a western blot, however there are highly customisable parts available as well.Visit our [https://2014.igem.org/Team:Heidelberg/Parts#allParts parts page] to get an overview of our assembly constructs.<br />
In an extensive assay we proved the principle behind split protein assembly by showing that GFP can be artificially split into two halves and thereafter be reassembled so the fluorescence is restored. Visit the [https://2014.igem.org/Team:Heidelberg/Project/Reconstitution split Fluorescent Protein].<br />
<br />
<br />
<br />
=== Posttranslational Modifications ===<br />
<br />
====Introduction====<br />
Posttranslational modifications are highly prevalent in nature: Almost every protein in a cell is modified after having been translated, adding numerous varieties of the protein to the mere protein backbone.<br />
Synthetic Biology, however, can expand the possibilities offered by nature and introduce synthetic posttranslational modifications or attachments, such as biophysical probes. As the two parts of a split intein assemble in a highly specific manner, the modifications are introduced controllable a certain locus.<br />
There are different publications on intein-based introduction of posttranslational modifications, including phosphorylation, lipidation, glycosylation, acetylation and ubiquitination [A].<br />
Phosphorylation, for example has been applied with tyrosine kinase C-terminal Src kinase (Csk) in order to be able to study the structure and function of this specifically modified protein [B].<br />
<br />
====Standard construction====<br />
Applying the intein assembly constructs the iGEM team Heidelberg provides a tool for all kinds of natural as well as synthetic posttranslational modifications by chemoselective addition of a peptide to a recombinant protein.<br />
The principle is based on intein-mediated protein fusion using the [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362141 SspDnaB] split intein for N-terminal modifications and SspDnaX-S11 for C-terminal ones. The split SspDnaB intein has a very short N-terminal part, consisting of only 11 amino acids intein and 5 amino acids extein sequence and a much longer C-terminal part. By contrast, [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362110 SspDnaX-S11] has a C-terminal part consisting of only 6 amino acids intein and 3 amino acids extein sequence, but a much longer N-terminal part.<br />
The short part including the desired modification is easy to obtain by chemical synthesis. This offers the possibility to introduce this modification at a specific locus.<br />
<br />
<br />
''In general, split inteins are powerful tools to easily introduce all kinds of posttranslational modifications in a highly chemoselective manner.<br />
Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to attach posttranslational modifications and attachments to your protein of interest!''<br />
<br />
===Translocation===<br />
<br />
====Introduction====<br />
Adding and removal of translocation tags is one application example for split intein-mediated fusion of two protein domains. Translocation tags offer the possibility to transfer proteins to a certain locus inside the cell by attaching a short tag sequence to the terminus of one's protein of interest. Expressed fused to the protein, which is the conventional way, such a tag is neither removable nor attachable to a protein at a certain time point. Usage of split inteins for tagging offers new dimensions of mobility and control: Tags can be attached (using fusion constructs) or removed (using the intein protease) posttranslationally at a specific time point.<br />
<br />
====Standard construction====<br />
<br />
Regulated targeting of proteins to certain loci inside the cell can be achieved using the iGEM Heidelberg 2014 translocation tags for either E. coli or eucaryotic expression systems. Many of them are based on parts created by previous iGEM teams, but with split intein usage now can be applied in much diverser ways.<br />
We provide following tags:<br />
<br />
{| class="table table-hover"<br />
|+ <b>Our toolbox provides the following tags:</b><br />
|-<br />
| MinD membrane targeting sequence: [http://parts.igem.org/Part:BBa_K1362055 BBa_K1362055] || → membrane localization (E. coli)<br />
|-<br />
| OmpA: [http://parts.igem.org/Part:BBa_K1362060 BBa_K1362060] || → surface display (E. coli)<br />
|-<br />
| pelB leader sequence: [http://parts.igem.org/Part:BBa_K1362058 BBa_K1362058] || → periplasmic localization (E. coli)<br />
|-<br />
| myristooilation signal sequence: [http://parts.igem.org/Part:BBa_K1362056 BBa_K1362056] || → membrane localization (eucaryotic)<br />
|-<br />
| PKI-NES: [http://parts.igem.org/Part:BBa_K1362059 BBa_K1362059] || → cytoplasmic localization (eucaryotic)<br />
|-<br />
| NLS: [http://parts.igem.org/Part:BBa_K1362057 BBa_K1362057] || → nuclear localization (eucaryotic)<br />
|}<br />
<br />
''Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to post-translationally assemble proteins, attach tags or change the location of your protein!''<br />
<br />
All translocation tags except from the OmpA surface protein tag were ordered as DNA oligos containing the tag sequence, extein sequence and BsaI oberhangs. OmpA surface protein was obtained from the Spring Distribution 2012 and also PCR amplified with overhangs. By Golden Gate Assembly the tags were cloned into the carrier constructs BBa_K1362052 (for C-terminal tags) and BBa_K1362053 (for N-terminal tags). These carrier constructs, pSB1C3 backbones with two BsaI sites as an insert, were used to send the tags to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tags from the carrier constructs into intein assembly constructs.<br />
<br />
====Results====<br />
The parts were sequenced, the results were positive. You can obtian them here:<br />
<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8d/Heidelberg_orig_MTS.png" target="_blank" >MinD MTS:</a></html>BBa_K1362055 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/4/48/Heidelberg_orig_pelB.png" target="_blank" >pelB leader sequence:</a> </html> BBa_K1362058<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/de/Heidelberg_orig_myristoilation.png" target="_blank" >myristoilation signal sequence:</a> </html> BBa_K1362056<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/57/Heidelberg_orig_PKI_NES.png" target="_blank" >PKI-NES:</a> </html> BBa_K1362059<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/5c/Heidelberg_orig_NLS.png" target="_blank" >NLS:</a> </html> BBa_K1362057<br />
<br />
OmpA (<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d7/Heidelberg_orig_ompa-1.png" target="_blank" >part1</a></html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/0/02/Heidelberg_orig_ompa1.png" target="_blank" >part2</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/1/1b/Heidelberg_orig_ompa2.png" target="_blank" >part3</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/bd/Heidelberg_orig_ompa3.png" target="_blank" >part4</a> </html>): BBa_K1362060<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Purification=<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Purification with inteins.|file=Purification.png}}<br />
<br />
Therapeutic proteins have changed modern medicine. For instance, the monoclonal antibody Trastuzumab, is used to treat breast cancers that are positive for the epidermal growth factor HER2/neu (Ref. Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy). <br />
For application in medicine proteins have to be of very high purity. However, purification at industrial scale remains time consuming and cost intensive. The purification procedure includes numerous steps: First of which is the binding of the protein to an affinity matrix, followed by washing and finally release of the protein from the affinity column. The affinity tag, used to achieve selective binding of the intended protein to the matrix remains bound to the protein of interest and has to be selectively removed by protease cleavage. This often leads to undesirable secondary cleavage within the sequence of the protein. Proteases are the most expensive component of a industrial scale purification process. Eventually, the affinity tag has to be separated from the protein causing further effort and costs.<br />
The split-intein based system is manifold easier: All these steps can be combined into one by using Ssp DnaB mini-intein, an artificial split intein. It performs the trans-splicing reaction only under certain pH and temperature conditions. A mutation of the SspDnaB N-intein at Cys1 to Ala prevents cleavage at the N-terminus, cleavage at the C-terminus still occurs. The N-terminal intein part, attached to a chitin binding domain can be used as an affinity ligand, while the C-terminal part, fused to a protein of interest, can be used as an affinity tag binding highly specific to the ligand part. After loading the protein of interest on a chitin column, the trans-splicing reaction can be induced by adjusting temperature and pH: the both split inteins fuse together, disrupting the fusion to the protein of interest in one single step [C]. <br />
Thereby, split-inteins simplify conventional protein purification in many aspects: The system is cheaper, faster and more efficient than other purification procedures (Ref.). In fact, only a single chromatographic step is necessary for both, binding of the protein fused to an affinity tag to the affinity column and tag removal. Also, there is no need for expensive proteases. <br />
<br />
We standardized this split-intein purification system, so it is easy applicable to all kinds of proteins. Visit our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to purify your protein!<br />
<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=On Off=<br />
==On==<br />
{{:Team:Heidelberg/templates/image-quarter| align=right| caption=NpuDnaE N-intein assembly construct| descr=Illustration of the part BBa_K1362100, the N-construct. | file=BBa_K1362100.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right| caption=NpuDnaE C-intein assembly construct| descr=Illustration of the part BBa_K1362101, the C-construct. | file=BBa_K1362101.png}}<br />
In many systems biology projects, it is desirable to have an external trigger to turn a protein’s function ON and OFF in cells at a specific time point. The most prominent approach to achieve the ON-OFF switch is the regulation via gene expression. However this method is unfavorable in terms of temporal and spatial resolution. Using our intein toolbox it could become possible to activate a specific protein in a shorter period of time in single cell resolution. Imaging the most prominent system currently used in molecular biology- the CRISPR/Cas technology temporal and spatial activated within a single cell. This could be achieved using our assembly construct with two insertion sides to fuse proteins or protein domains combined with our light induction approach. Cas9 could be split in two parts resulting in an inactive state of each half. Upon splicing reaction the protein can be reassembled and its functionality restored. Unfortunately, we ran out of time to apply our assembly construct for the experiments with Cas9. However using our toolbox this can easily be achieved within few days. As proof of principle for the fusion and activation of proteins, we showed the reconstitution of fluorescence of [https://2014.igem.org/Team:Heidelberg/Project/Reconstitution superfold GFP] that was previously split and connected to split NpuDnaE inteins. <br />
<br />
Our assembly construct with two insertion sides provides an easy to handle approach to clone in front and behind of each split intein. Initially N- and C-terminal parts are separated on two plasmids and each intein provides the two insertion sides. The iGEM team Heidelberg 2014 created both constructs: [http://parts.igem.org/Part:BBa_K1362100 BBa_K1362100], the N-construct and [http://parts.igem.org/Part:BBa_K1362101 BBa_K1362101], the C-construct. As place holder for the insertion sides mRFP selection markers were included that are easily exchangeable via Golden Gate cloning using the restriction enzyme BsaI. The user only needs to make sure to clone the protein halves, which should reassemble, into the correct insertion sides; namely the N-terminal protein half into the N-terminal “gate” and the C-terminal protein into the C-terminal “gate”. <br />
<br />
Confused? All your questions will be answered once looking into our [https://2014.igem.org/Team:Heidelberg/Parts/RFC RFC]!<br />
<br />
In this manner the separated plasmids containing either N- or C-terminal splicing construct can be coexpressed by transforming both plasmid into one cell. Alternatively they can be assembled onto one plasmid by standard Biobrick cloning. <br />
<br />
We generated the assembly construct by joining and amplification of the three inserts – first insertion side, Npu DnaE intein and second insertion side- via polymerase cycling assembly (PCA) cloning method. PCA is a modification of CPEC cloning, resulting only in the amplification of the assembled insert fragment. Using CPEC this fragment was incorporated in our expression vector. <br />
The sequencing of our assembly construct with two insertion sides is available.<br />
<br />
==Off==<br />
<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=The intein protease construct.|file=Intein_Protease_1.png}}<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Principle of the intein protease.|file=Intein_Protease_3.png}}<br />
<br />
We provide two different tools for deactivation of proteins. One of them is the C-terminal degradation tag SsrA, the other one the intein protease.The SsrA tag directs the tagged protein to the ClpXP protease, causing degradation of this protein (1). <br />
The intein protease is a singular tool for site-specific in vivo protein cleavage. Under in vitro conditions, protease usage is relatively easy compared to in vivo conditions. The inside of a cell constitutes a very complex environment, so that conventional proteases would simply cleave not only the desired site of the protein of interest, but also other proteins inside this cell, causing huge interference with pathways crucial for cell functions. So far, only the tobacco etch virus (TEV) protease has been used with success for in-vivo cleavage without severe decline of cell viability.(3)<br />
Volkmann et al. first showed in vitro functionality of the intein protease. (2) Later it was shown, that the intein proteease is also applicable in vivo in E. coli and yeast cells without impairment of cell functions. (3)<br />
<br />
The intein protease consists of the 144-aa SspDnaB S1 C-intein (with an Asn-to-Ala mutation at the end of the C-intein to prevent protein splicing) followed by the extein sequence. This C-terminal part of the split intein recognizes its counterpart, the N-terminal split intein inserted into the sequence of the proteine to be cleaved, and cleaces there between extein and intein sequence. <br />
<br />
====Intein protease standard construction====<br />
SspDnaB C intein was PCR amplified from a plasmid (pCL20) received from Prof. Dr. Henning Mootz. The PCR primers contained overhangs to get the following constuct:<br />
<br />
XbaI site – T7RBS - His6 – SspDnaB C intein (N → A) – SspDnaB C extein – SpeI site – PstI site<br />
<br />
<br />
This PCR product and pSB1C3 were digested with XbaI and PstI. The digested PCR product was ligated into pSB1C3. The resulting plasmid is BBa_K1362050 (Intein protease – T7RBS-His-SspDnaBC ).<br />
<br />
The next step was to add a promotor. Therefore, BBa_K1362050 was digested with EcoRI and XbaI. BBa_K808000, an Ara promotor, was digested with SpeI and PstI. These two parts were ligated, resulting in BBa_K1362051 (Intein protease with arabinose inducible regulatory promoter/ repressor araC-Pbad-T7RBS-His-SspDnaBC).<br />
<br />
<br />
====Results====<br />
Both intein protease constructs BBa_K1362050 and BBa_K1362051 were sequenced. We obtained positive results. Here you can see the sequencing results of BBa_K1362051, the longer of the constructs (and including BBa_K1362050),<br />
<br />
<br />
BBa_K1362051 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8c/Heidelberg_orig_ARA1.png" target="_blank" >part1:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/23/Heidelberg_orig_ARA2.png" target="_blank" >part2:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/be/Heidelberg_orig_ARA3.png" target="_blank" >part3:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9e/Heidelberg_orig_ARA4.png" target="_blank" >part4:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/b6/Heidelberg_orig_ARA5.png" target="_blank" >part5:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/72/Heidelberg_orig_ARA6.png" target="_blank" >part6:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/25/Heidelberg_orig_ARA7.png" target="_blank" >part7:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9d/Heidelberg_orig_ARA8.png" target="_blank" >part8:</a> </html><br /><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
====SsrA degradation tag standard construction====<br />
The SsrA degradation tag was ordered as DNA oligos containing the tag sequence, extein sequence and BsaI overhangs. By Golden Gate Assembly the tag was cloned into the carrier construct BBa_K1362052 (for C-terminal tags). This carrier construct consists of a pSB1C3 backbone with two BsaI sites as an insert. It was used to send the tag to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tag from the carrier constructs into intein assembly constructs.<br />
<br />
====Results====<br />
The part was sequenced, the results were positive. You can see the sequencing results here:<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/3/3c/Heidelberg_orig_Ssra.png" target="_blank" >SsrA:</a> </html>BBa_K1362054<br />
<br />
=References=<br />
[1] McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
[2] Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
[3] Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.<br />
<br />
[7] Hauptmann, V. et al.: Native-sized spider silk proteins synthesized in planta via intein-based multimerization. Transgenic Res (2013) 22:369–377. DOI 10.1007/s11248-012-9655-6.<br />
<br />
[A] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[B] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. <br />
Natl. Acad. Sci. USA 95 (1998). <br />
<br />
[C] Lu, Wei et al.: Split intein facilitated tag affinity purification for recombinant proteins with controllable tag removal by inducible auto-cleavage. J. Chromatogr. A 1218 (2011) <br />
<br />
[D] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[E] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. Natl. Acad. Sci. USA 95 (1998).<br />
<br />
(1) McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
(2) Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
(3) Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/ToolboxTeam:Heidelberg/pages/Toolbox2014-10-18T02:45:44Z<p>Bunnech: /* On */</p>
<hr />
<div><br />
A primary mission of the iGEM team Heidelberg 2014 is to provide a new toolbox based on appropriate standards that introduces the highly functional [https://2014.igem.org/Team:Heidelberg/Project/Background INTEINS] to the parts registry and thereby paving the way to a new level of posttranslational modification possibilities for the iGEM community. Inteins are self-excising peptide segments that mediate the reaction of protein trans-splicing. They don't require any additional energy sources to perform the splicing reaction. Another valuable feature of inteins is their specific recognition, also in the presence of other proteins, which makes them functional in vitro as well as in vivo. On this page we describe experimental approaches to provide and evaluate five related but still quite different applications using inteins and their splicing capabilities. Thereby we present scientific prove of the diversity and efficiency of an intein toolbox that can be used for a wide range of posttranslational modifications of proteins. Explore the new possibilities, intein usage provides! On this page we describe the scientific work in form of modeling and experiments that lead to the establishment of the first intein toolbox in the history of iGEM! <br />
<br />
''Jump right into splicing and use the [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to design your intein-equipped proteins of choice!''<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icons a:hover img {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icons a img {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.toolbox-icons {<br />
text-align: center;<br />
}<br />
<br />
.toolbox-icons a {<br />
display:block;<br />
margin-bottom:0px;<br />
white-space: nowrap;<br />
color: black;<br />
font-size: 15px;<br />
}<br />
<br />
.toolbox-icons a:hover {<br />
color: #DE4230;<br />
}<br />
<br />
.toolbox-icons img {<br />
margin-bottom: 0px;<br />
}<br />
<br />
.linie {<br />
margin:50px 40px;<br />
border: solid 1px black;<br />
}<br />
</style><br />
<br />
<div class="row toolbox-icons"><br />
<div class="col-lg-2 col-lg-offset-1 col-md-offset-1 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" class="img-responsive" /></span>CIRCULARIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/4/40/Oligomerization.png" class="img-responsive" /></span>OLIGOMERIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" class="img-responsive" /></span>FUSING & TAGGING</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" class="img-responsive" /></span>PURIFICATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" class="img-responsive" /></span>ON OFF</a><br />
</div><br />
</div><br />
</html><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Circularization=<br />
<br />
Millions of years of evolution have allowed proteins to performed extremely specific chemical modifications that are not only essential for living organisms but can also be of great benefit to produce useful molecules for our life, efficiently and at low cost. A major limitation of the use of enzyme for industrial application and in general for usage out of their natural environment is their stability. They can be destroyed by other enzymes and they can unfold and take non-functional conformation when exposed to non-physiological temperature and pH. Such limitations has motivated research in species that can grow at extreme temperatures [6]. Another major area of chemical research if the design of strategies to stabilize enzymes, and more generally proteins and peptides. Protein circularization, meaning ligation of the N- and C-terminal ends of a protein, represents a promising way to achieve this stabilization. While conserving the functionality of their linear counterpart, circular proteins can be superior to linear proteins in terms of thermostability [1][2][3], resistance against chemical denaturation [4] and protection from exopeptidases [2][4]. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides [5]. These remarkable properties motivated us to develop new tools to circularize any protein of interest.<br />
<br />
Our Toolbox Guide provides a step-by-step strategy to clone a circularization linker and express it in e. Coli. Moreover, in case of complex structures where the protein extremities are far from each other, we have developed a software that will design the appropriate rigid linkers.<br />
<br />
''Please find more information and results of the experiments that laid the foundation for the circularization kit of the toolbox on the [https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization Circularization pages]''. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Oligomerization=<br />
<br />
Split inteins constitute a useful tool to produce huge polymers in vivo: Hauptmann et al. managed to fabricate synthetic spider silk with microfiber structure. The results using an easy-to-handle split intein system were stunning: The polymers had a molecular weight of 250 kDa and more [7]. Further application of oligomerization by inteins includes the posttranslational complexation of multi-domain proteins, after their domains have been expressed individually. This approach is very valuable considering great difficulities of expressing large eukaryotic proteins in <i>E.coli</i>.<br />
<br />
==== Standardization of oligomerization ====<br />
The valuable properties of spider silk, for example its exceptional strength and elasticity, result from numerous repeats of certain protein motifs. Convenitonal methods to multimerize these motifs bear a lot of difficulties: Often genetic and mRNA instability constitute a barrier for the production of multimers as fusion proteins.[1] Posttranslational assembly through split inteins is therefore the solution to overcome these problems. The successfull polimerization of spider silk potein motifs demonstrates the potential of split inteins to be a useful tool for the production of new biomaterials by performing oligomerization reactions with split inteins. The iGEM team Heidelberg standardized (lik to toolbox guide) the oligomerization procedure with split inteins to allow easy handling with different proteins.<br />
<br />
The use of non-orthogonal split inteins can further be exploited to direct the oligomerisation of several protein domains at once.<br />
<br />
==== The mechanism ====<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Oligomerization with inteins.|file=Oligomerization.png}}<br />
Oligomerization reactions require the same constructs as the ones used for protein circularization.<br />
<br />
Circularization is achieved by bringing the N and C terminus of a protein very close together, so both intein parts can asseble, cut out off the protein and thereby circularize it. In contrast, oligomerization occurs when both termini of a protein cannot reach each other and the intein parts of two neighbouring proteins assemble. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Fusion and Tagging=<br />
<br />
====Introduction====<br />
Post-translational modifications are present in nature in great numbers.Synthetic Biology, however, has not yet made use of the innumerable possibilities nature has developed. With our collection of intein assembly constructs we expand the arsenal of synthetic biology by enabling unlimited changes of a protein's amino acid sequence even after translation. <br />
<br />
====Standard Construction====<br />
<br />
To be able <b>to fuse</b> any two halves of a protein together can have many different uses. We therefore saw the need for a standardised construct, the intein assembly part. This BioBrick part allows the user to clone two DNA-sequences coding for two parts of a peptide into a plasmid prepared with selection markers and standardised overhangs. Those parts were all send in with additional hexahistidine-tags to enable quick analysis on a western blot, however there are highly customisable parts available as well.Visit our [https://2014.igem.org/Team:Heidelberg/Parts#allParts parts page] to get an overview of our assembly constructs.<br />
In an extensive assay we proved the principle behind split protein assembly by showing that GFP can be artificially split into two halves and thereafter be reassembled so the fluorescence is restored. Visit the [https://2014.igem.org/Team:Heidelberg/Project/Reconstitution split Fluorescent Protein].<br />
<br />
<br />
<br />
=== Posttranslational Modifications ===<br />
<br />
====Introduction====<br />
Posttranslational modifications are highly prevalent in nature: Almost every protein in a cell is modified after having been translated, adding numerous varieties of the protein to the mere protein backbone.<br />
Synthetic Biology, however, can expand the possibilities offered by nature and introduce synthetic posttranslational modifications or attachments, such as biophysical probes. As the two parts of a split intein assemble in a highly specific manner, the modifications are introduced controllable a certain locus.<br />
There are different publications on intein-based introduction of posttranslational modifications, including phosphorylation, lipidation, glycosylation, acetylation and ubiquitination [A].<br />
Phosphorylation, for example has been applied with tyrosine kinase C-terminal Src kinase (Csk) in order to be able to study the structure and function of this specifically modified protein [B].<br />
<br />
====Standard construction====<br />
Applying the intein assembly constructs the iGEM team Heidelberg provides a tool for all kinds of natural as well as synthetic posttranslational modifications by chemoselective addition of a peptide to a recombinant protein.<br />
The principle is based on intein-mediated protein fusion using the [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362141 SspDnaB] split intein for N-terminal modifications and SspDnaX-S11 for C-terminal ones. The split SspDnaB intein has a very short N-terminal part, consisting of only 11 amino acids intein and 5 amino acids extein sequence and a much longer C-terminal part. By contrast, [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362110 SspDnaX-S11] has a C-terminal part consisting of only 6 amino acids intein and 3 amino acids extein sequence, but a much longer N-terminal part.<br />
The short part including the desired modification is easy to obtain by chemical synthesis. This offers the possibility to introduce this modification at a specific locus.<br />
<br />
<br />
''In general, split inteins are powerful tools to easily introduce all kinds of posttranslational modifications in a highly chemoselective manner.<br />
Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to attach posttranslational modifications and attachments to your protein of interest!''<br />
<br />
===Translocation===<br />
<br />
====Introduction====<br />
Adding and removal of translocation tags is one application example for split intein-mediated fusion of two protein domains. Translocation tags offer the possibility to transfer proteins to a certain locus inside the cell by attaching a short tag sequence to the terminus of one's protein of interest. Expressed fused to the protein, which is the conventional way, such a tag is neither removable nor attachable to a protein at a certain time point. Usage of split inteins for tagging offers new dimensions of mobility and control: Tags can be attached (using fusion constructs) or removed (using the intein protease) posttranslationally at a specific time point.<br />
<br />
====Standard construction====<br />
<br />
Regulated targeting of proteins to certain loci inside the cell can be achieved using the iGEM Heidelberg 2014 translocation tags for either E. coli or eucaryotic expression systems. Many of them are based on parts created by previous iGEM teams, but with split intein usage now can be applied in much diverser ways.<br />
We provide following tags:<br />
<br />
{| class="table table-hover"<br />
|+ <b>Our toolbox provides the following tags:</b><br />
|-<br />
| MinD membrane targeting sequence: [http://parts.igem.org/Part:BBa_K1362055 BBa_K1362055] || → membrane localization (E. coli)<br />
|-<br />
| OmpA: [http://parts.igem.org/Part:BBa_K1362060 BBa_K1362060] || → surface display (E. coli)<br />
|-<br />
| pelB leader sequence: [http://parts.igem.org/Part:BBa_K1362058 BBa_K1362058] || → periplasmic localization (E. coli)<br />
|-<br />
| myristooilation signal sequence: [http://parts.igem.org/Part:BBa_K1362056 BBa_K1362056] || → membrane localization (eucaryotic)<br />
|-<br />
| PKI-NES: [http://parts.igem.org/Part:BBa_K1362059 BBa_K1362059] || → cytoplasmic localization (eucaryotic)<br />
|-<br />
| NLS: [http://parts.igem.org/Part:BBa_K1362057 BBa_K1362057] || → nuclear localization (eucaryotic)<br />
|}<br />
<br />
''Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to post-translationally assemble proteins, attach tags or change the location of your protein!''<br />
<br />
All translocation tags except from the OmpA surface protein tag were ordered as DNA oligos containing the tag sequence, extein sequence and BsaI oberhangs. OmpA surface protein was obtained from the Spring Distribution 2012 and also PCR amplified with overhangs. By Golden Gate Assembly the tags were cloned into the carrier constructs BBa_K1362052 (for C-terminal tags) and BBa_K1362053 (for N-terminal tags). These carrier constructs, pSB1C3 backbones with two BsaI sites as an insert, were used to send the tags to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tags from the carrier constructs into intein assembly constructs.<br />
<br />
====Results====<br />
The parts were sequenced, the results were positive. You can obtian them here:<br />
<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8d/Heidelberg_orig_MTS.png" target="_blank" >MinD MTS:</a></html>BBa_K1362055 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/4/48/Heidelberg_orig_pelB.png" target="_blank" >pelB leader sequence:</a> </html> BBa_K1362058<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/de/Heidelberg_orig_myristoilation.png" target="_blank" >myristoilation signal sequence:</a> </html> BBa_K1362056<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/57/Heidelberg_orig_PKI_NES.png" target="_blank" >PKI-NES:</a> </html> BBa_K1362059<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/5c/Heidelberg_orig_NLS.png" target="_blank" >NLS:</a> </html> BBa_K1362057<br />
<br />
OmpA (<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d7/Heidelberg_orig_ompa-1.png" target="_blank" >part1</a></html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/0/02/Heidelberg_orig_ompa1.png" target="_blank" >part2</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/1/1b/Heidelberg_orig_ompa2.png" target="_blank" >part3</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/bd/Heidelberg_orig_ompa3.png" target="_blank" >part4</a> </html>): BBa_K1362060<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Purification=<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Purification with inteins.|file=Purification.png}}<br />
<br />
Therapeutic proteins have changed modern medicine. For instance, the monoclonal antibody Trastuzumab, is used to treat breast cancers that are positive for the epidermal growth factor HER2/neu (Ref. Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy). <br />
For application in medicine proteins have to be of very high purity. However, purification at industrial scale remains time consuming and cost intensive. The purification procedure includes numerous steps: First of which is the binding of the protein to an affinity matrix, followed by washing and finally release of the protein from the affinity column. The affinity tag, used to achieve selective binding of the intended protein to the matrix remains bound to the protein of interest and has to be selectively removed by protease cleavage. This often leads to undesirable secondary cleavage within the sequence of the protein. Proteases are the most expensive component of a industrial scale purification process. Eventually, the affinity tag has to be separated from the protein causing further effort and costs.<br />
The split-intein based system is manifold easier: All these steps can be combined into one by using Ssp DnaB mini-intein, an artificial split intein. It performs the trans-splicing reaction only under certain pH and temperature conditions. A mutation of the SspDnaB N-intein at Cys1 to Ala prevents cleavage at the N-terminus, cleavage at the C-terminus still occurs. The N-terminal intein part, attached to a chitin binding domain can be used as an affinity ligand, while the C-terminal part, fused to a protein of interest, can be used as an affinity tag binding highly specific to the ligand part. After loading the protein of interest on a chitin column, the trans-splicing reaction can be induced by adjusting temperature and pH: the both split inteins fuse together, disrupting the fusion to the protein of interest in one single step [C]. <br />
Thereby, split-inteins simplify conventional protein purification in many aspects: The system is cheaper, faster and more efficient than other purification procedures (Ref.). In fact, only a single chromatographic step is necessary for both, binding of the protein fused to an affinity tag to the affinity column and tag removal. Also, there is no need for expensive proteases. <br />
<br />
We standardized this split-intein purification system, so it is easy applicable to all kinds of proteins. Visit our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to purify your protein!<br />
<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=On Off=<br />
==On==<br />
{{:Team:Heidelberg/templates/image-quarter| align=right| caption=NpuDnaE N-intein assembly construct| descr=Illustration of the part BBa_K1362100, the N-construct. | file=BBa_K1362100.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right| caption=NpuDnaE C-intein assembly construct| descr=Illustration of the part BBa_K1362101, the C-construct. | file=BBa_K1362101.png}}<br />
In many systems biology projects, it is desirable to have an external trigger to turn a protein’s function ON and OFF in cells at a specific time point. The most prominent approach to achieve the ON-OFF switch is the regulation via gene expression. However this method is unfavorable in terms of temporal and spatial resolution. Using our intein toolbox it could become possible to activate a specific protein in a shorter period of time in single cell resolution. Imaging the most prominent system currently used in molecular biology- the CRISPR/Cas technology temporal and spatial activated within a single cell. This could be achieved using our assembly construct with two insertion sides to fuse proteins or protein domains combined with our light induction approach. Cas9 could be split in two parts resulting in an inactive state of each half. Upon splicing reaction the protein can be reassembled and its functionality restored. Unfortunately, we ran out of time to apply our assembly construct for the experiments with Cas9. However using our toolbox this can easily be achieved within few days. As proof of principle for the fusion and activation of proteins, we showed the reconstitution of fluorescence of [https://2014.igem.org/Team:Heidelberg/Project/Reconstitution superfold GFP] that was previously split and connected to split NpuDnaE inteins. <br />
<br />
Our assembly construct with two insertion sides provides an easy to handle approach to clone in front and behind of each split intein. Initially N- and C-terminal parts are separated on two plasmids and each intein provides the two insertion sides. The iGEM team Heidelberg 2014 created both constructs: [http://parts.igem.org/Part:BBa_K1362100 BBa_K1362100], the N-construct and [http://parts.igem.org/Part:BBa_K1362101 BBa_K1362101], the C-construct. As place holder for the insertion sides mRFP selection markers were included that are easily exchangeable via Golden Gate cloning using the restriction enzyme BsaI. The user only needs to make sure to clone the protein halves, which should reassemble, into the correct insertion sides; namely the N-terminal protein half into the N-terminal “gate” and the C-terminal protein into the C-terminal “gate”. <br />
<br />
Confused? All your questions will be answered once looking into our [https://2014.igem.org/Team:Heidelberg/Parts/RFC RFC]!<br />
<br />
In this manner the separated plasmids containing either N- or C-terminal splicing construct can be coexpressed by transforming both plasmid into one cell. Alternatively they can be assembled onto one plasmid by standard Biobrick cloning. <br />
<br />
We generated the assembly construct by joining and amplification of the three inserts – first insertion side, Npu DnaE intein and second insertion side- via polymerase cycling assembly (PCA) cloning method. PCA is a modification of CPEC cloning, resulting only in the amplification of the assembled insert fragment. Using CPEC this fragment was incorporated in our expression vector. <br />
The sequencing of our assembly construct with two insertion sides is available.<br />
<br />
''Please find more information and results of the experiments that laid the foundation for the assembly construct of the toolbox on the .''<br />
<br />
==Off==<br />
<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=The intein protease construct.|file=Intein_Protease_1.png}}<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Principle of the intein protease.|file=Intein_Protease_3.png}}<br />
<br />
We provide two different tools for deactivation of proteins. One of them is the C-terminal degradation tag SsrA, the other one the intein protease.The SsrA tag directs the tagged protein to the ClpXP protease, causing degradation of this protein (1). <br />
The intein protease is a singular tool for site-specific in vivo protein cleavage. Under in vitro conditions, protease usage is relatively easy compared to in vivo conditions. The inside of a cell constitutes a very complex environment, so that conventional proteases would simply cleave not only the desired site of the protein of interest, but also other proteins inside this cell, causing huge interference with pathways crucial for cell functions. So far, only the tobacco etch virus (TEV) protease has been used with success for in-vivo cleavage without severe decline of cell viability.(3)<br />
Volkmann et al. first showed in vitro functionality of the intein protease. (2) Later it was shown, that the intein proteease is also applicable in vivo in E. coli and yeast cells without impairment of cell functions. (3)<br />
<br />
The intein protease consists of the 144-aa SspDnaB S1 C-intein (with an Asn-to-Ala mutation at the end of the C-intein to prevent protein splicing) followed by the extein sequence. This C-terminal part of the split intein recognizes its counterpart, the N-terminal split intein inserted into the sequence of the proteine to be cleaved, and cleaces there between extein and intein sequence. <br />
<br />
====Intein protease standard construction====<br />
SspDnaB C intein was PCR amplified from a plasmid (pCL20) received from Prof. Dr. Henning Mootz. The PCR primers contained overhangs to get the following constuct:<br />
<br />
XbaI site – T7RBS - His6 – SspDnaB C intein (N → A) – SspDnaB C extein – SpeI site – PstI site<br />
<br />
<br />
This PCR product and pSB1C3 were digested with XbaI and PstI. The digested PCR product was ligated into pSB1C3. The resulting plasmid is BBa_K1362050 (Intein protease – T7RBS-His-SspDnaBC ).<br />
<br />
The next step was to add a promotor. Therefore, BBa_K1362050 was digested with EcoRI and XbaI. BBa_K808000, an Ara promotor, was digested with SpeI and PstI. These two parts were ligated, resulting in BBa_K1362051 (Intein protease with arabinose inducible regulatory promoter/ repressor araC-Pbad-T7RBS-His-SspDnaBC).<br />
<br />
<br />
====Results====<br />
Both intein protease constructs BBa_K1362050 and BBa_K1362051 were sequenced. We obtained positive results. Here you can see the sequencing results of BBa_K1362051, the longer of the constructs (and including BBa_K1362050),<br />
<br />
<br />
BBa_K1362051 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8c/Heidelberg_orig_ARA1.png" target="_blank" >part1:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/23/Heidelberg_orig_ARA2.png" target="_blank" >part2:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/be/Heidelberg_orig_ARA3.png" target="_blank" >part3:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9e/Heidelberg_orig_ARA4.png" target="_blank" >part4:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/b6/Heidelberg_orig_ARA5.png" target="_blank" >part5:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/72/Heidelberg_orig_ARA6.png" target="_blank" >part6:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/25/Heidelberg_orig_ARA7.png" target="_blank" >part7:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9d/Heidelberg_orig_ARA8.png" target="_blank" >part8:</a> </html><br /><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
====SsrA degradation tag standard construction====<br />
The SsrA degradation tag was ordered as DNA oligos containing the tag sequence, extein sequence and BsaI overhangs. By Golden Gate Assembly the tag was cloned into the carrier construct BBa_K1362052 (for C-terminal tags). This carrier construct consists of a pSB1C3 backbone with two BsaI sites as an insert. It was used to send the tag to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tag from the carrier constructs into intein assembly constructs.<br />
<br />
====Results====<br />
The part was sequenced, the results were positive. You can see the sequencing results here:<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/3/3c/Heidelberg_orig_Ssra.png" target="_blank" >SsrA:</a> </html>BBa_K1362054<br />
<br />
=References=<br />
[1] McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
[2] Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
[3] Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.<br />
<br />
[7] Hauptmann, V. et al.: Native-sized spider silk proteins synthesized in planta via intein-based multimerization. Transgenic Res (2013) 22:369–377. DOI 10.1007/s11248-012-9655-6.<br />
<br />
[A] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[B] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. <br />
Natl. Acad. Sci. USA 95 (1998). <br />
<br />
[C] Lu, Wei et al.: Split intein facilitated tag affinity purification for recombinant proteins with controllable tag removal by inducible auto-cleavage. J. Chromatogr. A 1218 (2011) <br />
<br />
[D] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[E] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. Natl. Acad. Sci. USA 95 (1998).<br />
<br />
(1) McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
(2) Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
(3) Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/ToolboxTeam:Heidelberg/pages/Toolbox2014-10-18T02:41:42Z<p>Bunnech: /* On */</p>
<hr />
<div><br />
A primary mission of the iGEM team Heidelberg 2014 is to provide a new toolbox based on appropriate standards that introduces the highly functional [https://2014.igem.org/Team:Heidelberg/Project/Background INTEINS] to the parts registry and thereby paving the way to a new level of posttranslational modification possibilities for the iGEM community. Inteins are self-excising peptide segments that mediate the reaction of protein trans-splicing. They don't require any additional energy sources to perform the splicing reaction. Another valuable feature of inteins is their specific recognition, also in the presence of other proteins, which makes them functional in vitro as well as in vivo. On this page we describe experimental approaches to provide and evaluate five related but still quite different applications using inteins and their splicing capabilities. Thereby we present scientific prove of the diversity and efficiency of an intein toolbox that can be used for a wide range of posttranslational modifications of proteins. Explore the new possibilities, intein usage provides! On this page we describe the scientific work in form of modeling and experiments that lead to the establishment of the first intein toolbox in the history of iGEM! <br />
<br />
''Jump right into splicing and use the [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to design your intein-equipped proteins of choice!''<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icons a:hover img {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icons a img {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.toolbox-icons {<br />
text-align: center;<br />
}<br />
<br />
.toolbox-icons a {<br />
display:block;<br />
margin-bottom:0px;<br />
white-space: nowrap;<br />
color: black;<br />
font-size: 15px;<br />
}<br />
<br />
.toolbox-icons a:hover {<br />
color: #DE4230;<br />
}<br />
<br />
.toolbox-icons img {<br />
margin-bottom: 0px;<br />
}<br />
<br />
.linie {<br />
margin:50px 40px;<br />
border: solid 1px black;<br />
}<br />
</style><br />
<br />
<div class="row toolbox-icons"><br />
<div class="col-lg-2 col-lg-offset-1 col-md-offset-1 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" class="img-responsive" /></span>CIRCULARIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/4/40/Oligomerization.png" class="img-responsive" /></span>OLIGOMERIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" class="img-responsive" /></span>FUSING & TAGGING</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" class="img-responsive" /></span>PURIFICATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" class="img-responsive" /></span>ON OFF</a><br />
</div><br />
</div><br />
</html><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Circularization=<br />
<br />
Millions of years of evolution have allowed proteins to performed extremely specific chemical modifications that are not only essential for living organisms but can also be of great benefit to produce useful molecules for our life, efficiently and at low cost. A major limitation of the use of enzyme for industrial application and in general for usage out of their natural environment is their stability. They can be destroyed by other enzymes and they can unfold and take non-functional conformation when exposed to non-physiological temperature and pH. Such limitations has motivated research in species that can grow at extreme temperatures [6]. Another major area of chemical research if the design of strategies to stabilize enzymes, and more generally proteins and peptides. Protein circularization, meaning ligation of the N- and C-terminal ends of a protein, represents a promising way to achieve this stabilization. While conserving the functionality of their linear counterpart, circular proteins can be superior to linear proteins in terms of thermostability [1][2][3], resistance against chemical denaturation [4] and protection from exopeptidases [2][4]. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides [5]. These remarkable properties motivated us to develop new tools to circularize any protein of interest.<br />
<br />
Our Toolbox Guide provides a step-by-step strategy to clone a circularization linker and express it in e. Coli. Moreover, in case of complex structures where the protein extremities are far from each other, we have developed a software that will design the appropriate rigid linkers.<br />
<br />
''Please find more information and results of the experiments that laid the foundation for the circularization kit of the toolbox on the [https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization Circularization pages]''. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Oligomerization=<br />
<br />
Split inteins constitute a useful tool to produce huge polymers in vivo: Hauptmann et al. managed to fabricate synthetic spider silk with microfiber structure. The results using an easy-to-handle split intein system were stunning: The polymers had a molecular weight of 250 kDa and more [7]. Further application of oligomerization by inteins includes the posttranslational complexation of multi-domain proteins, after their domains have been expressed individually. This approach is very valuable considering great difficulities of expressing large eukaryotic proteins in <i>E.coli</i>.<br />
<br />
==== Standardization of oligomerization ====<br />
The valuable properties of spider silk, for example its exceptional strength and elasticity, result from numerous repeats of certain protein motifs. Convenitonal methods to multimerize these motifs bear a lot of difficulties: Often genetic and mRNA instability constitute a barrier for the production of multimers as fusion proteins.[1] Posttranslational assembly through split inteins is therefore the solution to overcome these problems. The successfull polimerization of spider silk potein motifs demonstrates the potential of split inteins to be a useful tool for the production of new biomaterials by performing oligomerization reactions with split inteins. The iGEM team Heidelberg standardized (lik to toolbox guide) the oligomerization procedure with split inteins to allow easy handling with different proteins.<br />
<br />
The use of non-orthogonal split inteins can further be exploited to direct the oligomerisation of several protein domains at once.<br />
<br />
==== The mechanism ====<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Oligomerization with inteins.|file=Oligomerization.png}}<br />
Oligomerization reactions require the same constructs as the ones used for protein circularization.<br />
<br />
Circularization is achieved by bringing the N and C terminus of a protein very close together, so both intein parts can asseble, cut out off the protein and thereby circularize it. In contrast, oligomerization occurs when both termini of a protein cannot reach each other and the intein parts of two neighbouring proteins assemble. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Fusion and Tagging=<br />
<br />
====Introduction====<br />
Post-translational modifications are present in nature in great numbers.Synthetic Biology, however, has not yet made use of the innumerable possibilities nature has developed. With our collection of intein assembly constructs we expand the arsenal of synthetic biology by enabling unlimited changes of a protein's amino acid sequence even after translation. <br />
<br />
====Standard Construction====<br />
<br />
To be able <b>to fuse</b> any two halves of a protein together can have many different uses. We therefore saw the need for a standardised construct, the intein assembly part. This BioBrick part allows the user to clone two DNA-sequences coding for two parts of a peptide into a plasmid prepared with selection markers and standardised overhangs. Those parts were all send in with additional hexahistidine-tags to enable quick analysis on a western blot, however there are highly customisable parts available as well.Visit our [https://2014.igem.org/Team:Heidelberg/Parts#allParts parts page] to get an overview of our assembly constructs.<br />
In an extensive assay we proved the principle behind split protein assembly by showing that GFP can be artificially split into two halves and thereafter be reassembled so the fluorescence is restored. Visit the [https://2014.igem.org/Team:Heidelberg/Project/Reconstitution split Fluorescent Protein].<br />
<br />
<br />
<br />
=== Posttranslational Modifications ===<br />
<br />
====Introduction====<br />
Posttranslational modifications are highly prevalent in nature: Almost every protein in a cell is modified after having been translated, adding numerous varieties of the protein to the mere protein backbone.<br />
Synthetic Biology, however, can expand the possibilities offered by nature and introduce synthetic posttranslational modifications or attachments, such as biophysical probes. As the two parts of a split intein assemble in a highly specific manner, the modifications are introduced controllable a certain locus.<br />
There are different publications on intein-based introduction of posttranslational modifications, including phosphorylation, lipidation, glycosylation, acetylation and ubiquitination [A].<br />
Phosphorylation, for example has been applied with tyrosine kinase C-terminal Src kinase (Csk) in order to be able to study the structure and function of this specifically modified protein [B].<br />
<br />
====Standard construction====<br />
Applying the intein assembly constructs the iGEM team Heidelberg provides a tool for all kinds of natural as well as synthetic posttranslational modifications by chemoselective addition of a peptide to a recombinant protein.<br />
The principle is based on intein-mediated protein fusion using the [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362141 SspDnaB] split intein for N-terminal modifications and SspDnaX-S11 for C-terminal ones. The split SspDnaB intein has a very short N-terminal part, consisting of only 11 amino acids intein and 5 amino acids extein sequence and a much longer C-terminal part. By contrast, [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362110 SspDnaX-S11] has a C-terminal part consisting of only 6 amino acids intein and 3 amino acids extein sequence, but a much longer N-terminal part.<br />
The short part including the desired modification is easy to obtain by chemical synthesis. This offers the possibility to introduce this modification at a specific locus.<br />
<br />
<br />
''In general, split inteins are powerful tools to easily introduce all kinds of posttranslational modifications in a highly chemoselective manner.<br />
Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to attach posttranslational modifications and attachments to your protein of interest!''<br />
<br />
===Translocation===<br />
<br />
====Introduction====<br />
Adding and removal of translocation tags is one application example for split intein-mediated fusion of two protein domains. Translocation tags offer the possibility to transfer proteins to a certain locus inside the cell by attaching a short tag sequence to the terminus of one's protein of interest. Expressed fused to the protein, which is the conventional way, such a tag is neither removable nor attachable to a protein at a certain time point. Usage of split inteins for tagging offers new dimensions of mobility and control: Tags can be attached (using fusion constructs) or removed (using the intein protease) posttranslationally at a specific time point.<br />
<br />
====Standard construction====<br />
<br />
Regulated targeting of proteins to certain loci inside the cell can be achieved using the iGEM Heidelberg 2014 translocation tags for either E. coli or eucaryotic expression systems. Many of them are based on parts created by previous iGEM teams, but with split intein usage now can be applied in much diverser ways.<br />
We provide following tags:<br />
<br />
{| class="table table-hover"<br />
|+ <b>Our toolbox provides the following tags:</b><br />
|-<br />
| MinD membrane targeting sequence: [http://parts.igem.org/Part:BBa_K1362055 BBa_K1362055] || → membrane localization (E. coli)<br />
|-<br />
| OmpA: [http://parts.igem.org/Part:BBa_K1362060 BBa_K1362060] || → surface display (E. coli)<br />
|-<br />
| pelB leader sequence: [http://parts.igem.org/Part:BBa_K1362058 BBa_K1362058] || → periplasmic localization (E. coli)<br />
|-<br />
| myristooilation signal sequence: [http://parts.igem.org/Part:BBa_K1362056 BBa_K1362056] || → membrane localization (eucaryotic)<br />
|-<br />
| PKI-NES: [http://parts.igem.org/Part:BBa_K1362059 BBa_K1362059] || → cytoplasmic localization (eucaryotic)<br />
|-<br />
| NLS: [http://parts.igem.org/Part:BBa_K1362057 BBa_K1362057] || → nuclear localization (eucaryotic)<br />
|}<br />
<br />
''Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to post-translationally assemble proteins, attach tags or change the location of your protein!''<br />
<br />
All translocation tags except from the OmpA surface protein tag were ordered as DNA oligos containing the tag sequence, extein sequence and BsaI oberhangs. OmpA surface protein was obtained from the Spring Distribution 2012 and also PCR amplified with overhangs. By Golden Gate Assembly the tags were cloned into the carrier constructs BBa_K1362052 (for C-terminal tags) and BBa_K1362053 (for N-terminal tags). These carrier constructs, pSB1C3 backbones with two BsaI sites as an insert, were used to send the tags to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tags from the carrier constructs into intein assembly constructs.<br />
<br />
====Results====<br />
The parts were sequenced, the results were positive. You can obtian them here:<br />
<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8d/Heidelberg_orig_MTS.png" target="_blank" >MinD MTS:</a></html>BBa_K1362055 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/4/48/Heidelberg_orig_pelB.png" target="_blank" >pelB leader sequence:</a> </html> BBa_K1362058<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/de/Heidelberg_orig_myristoilation.png" target="_blank" >myristoilation signal sequence:</a> </html> BBa_K1362056<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/57/Heidelberg_orig_PKI_NES.png" target="_blank" >PKI-NES:</a> </html> BBa_K1362059<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/5c/Heidelberg_orig_NLS.png" target="_blank" >NLS:</a> </html> BBa_K1362057<br />
<br />
OmpA (<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d7/Heidelberg_orig_ompa-1.png" target="_blank" >part1</a></html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/0/02/Heidelberg_orig_ompa1.png" target="_blank" >part2</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/1/1b/Heidelberg_orig_ompa2.png" target="_blank" >part3</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/bd/Heidelberg_orig_ompa3.png" target="_blank" >part4</a> </html>): BBa_K1362060<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Purification=<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Purification with inteins.|file=Purification.png}}<br />
<br />
Therapeutic proteins have changed modern medicine. For instance, the monoclonal antibody Trastuzumab, is used to treat breast cancers that are positive for the epidermal growth factor HER2/neu (Ref. Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy). <br />
For application in medicine proteins have to be of very high purity. However, purification at industrial scale remains time consuming and cost intensive. The purification procedure includes numerous steps: First of which is the binding of the protein to an affinity matrix, followed by washing and finally release of the protein from the affinity column. The affinity tag, used to achieve selective binding of the intended protein to the matrix remains bound to the protein of interest and has to be selectively removed by protease cleavage. This often leads to undesirable secondary cleavage within the sequence of the protein. Proteases are the most expensive component of a industrial scale purification process. Eventually, the affinity tag has to be separated from the protein causing further effort and costs.<br />
The split-intein based system is manifold easier: All these steps can be combined into one by using Ssp DnaB mini-intein, an artificial split intein. It performs the trans-splicing reaction only under certain pH and temperature conditions. A mutation of the SspDnaB N-intein at Cys1 to Ala prevents cleavage at the N-terminus, cleavage at the C-terminus still occurs. The N-terminal intein part, attached to a chitin binding domain can be used as an affinity ligand, while the C-terminal part, fused to a protein of interest, can be used as an affinity tag binding highly specific to the ligand part. After loading the protein of interest on a chitin column, the trans-splicing reaction can be induced by adjusting temperature and pH: the both split inteins fuse together, disrupting the fusion to the protein of interest in one single step [C]. <br />
Thereby, split-inteins simplify conventional protein purification in many aspects: The system is cheaper, faster and more efficient than other purification procedures (Ref.). In fact, only a single chromatographic step is necessary for both, binding of the protein fused to an affinity tag to the affinity column and tag removal. Also, there is no need for expensive proteases. <br />
<br />
We standardized this split-intein purification system, so it is easy applicable to all kinds of proteins. Visit our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to purify your protein!<br />
<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=On Off=<br />
==On==<br />
{{:Team:Heidelberg/templates/image-quarter| align=right| caption=NpuDnaE N-intein assembly construct| descr=Illustration of the part BBa_K1362100, the N-construct. | file=BBa_K1362100.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right| caption=NpuDnaE C-intein assembly construct| descr=Illustration of the part BBa_K1362101, the C-construct. | file=BBa_K1362101.png}}<br />
In many systems biology projects, it is desirable to have an external trigger to turn a protein’s function ON and OFF in cells at a specific time point. The most prominent approach to achieve the ON-OFF switch is the regulation via gene expression. However this method is unfavorable in terms of temporal and spatial resolution. Using our intein toolbox it could become possible to activate a specific protein in a shorter period of time in single cell resolution. Imaging the most prominent system currently used in molecular biology- the CRISPR/Cas technology temporal and spatial activated within a single cell. This could be achieved using our assembly construct with two insertion sides to fuse proteins or protein domains combined with our light induction approach. Cas9 could be split in two parts resulting in an inactive state of each half. Upon splicing reaction the protein can be reassembled and its functionality restored. Unfortunately, we ran out of time to apply our assembly construct for the experiments with Cas9. However using our toolbox this can easily be achieved within few days. As proof of principle for the fusion and activation of proteins, we showed the reconstitution of fluorescence of [https://2014.igem.org/Team:Heidelberg/Project/Reconstitution superfold GFP] that was previously split and connected to split NpuDnaE inteins. <br />
<br />
Our assembly construct with two insertion sides provides an easy to handle approach to clone in front and behind of each split intein. Initially N- and C-terminal parts are separated on two plasmids and each intein provides the two insertion sides. As place holder for the insertion sides mRFP selection markers were included that are easily exchangeable via Golden Gate cloning using the restriction enzyme BsaI. The user only needs to make sure to clone the protein halves, which should reassemble, into the correct insertion sides; namely the N-terminal protein half into the N-terminal “gate” and the C-terminal protein into the C-terminal “gate”. <br />
<br />
Confused? All your questions will be answered once looking into our [https://2014.igem.org/Team:Heidelberg/Parts/RFC RFC]!<br />
<br />
In this manner the separated plasmids containing either N- or C-terminal splicing construct can be coexpressed by transforming both plasmid into one cell. Alternatively they can be assembled onto one plasmid by standard Biobrick cloning. <br />
<br />
We generated the assembly construct by joining and amplification of the three inserts – first insertion side, Npu DnaE intein and second insertion side- via polymerase cycling assembly (PCA) cloning method. PCA is a modification of CPEC cloning, resulting only in the amplification of the assembled insert fragment. Using CPEC this fragment was incorporated in our expression vector. <br />
The sequencing of our assembly construct with two insertion sides is available.<br />
<br />
Please find more information and results of the experiments that laid the foundation for the assembly construct of the toolbox on the …<br />
<br />
==Off==<br />
<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=The intein protease construct.|file=Intein_Protease_1.png}}<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Principle of the intein protease.|file=Intein_Protease_3.png}}<br />
<br />
We provide two different tools for deactivation of proteins. One of them is the C-terminal degradation tag SsrA, the other one the intein protease.The SsrA tag directs the tagged protein to the ClpXP protease, causing degradation of this protein (1). <br />
The intein protease is a singular tool for site-specific in vivo protein cleavage. Under in vitro conditions, protease usage is relatively easy compared to in vivo conditions. The inside of a cell constitutes a very complex environment, so that conventional proteases would simply cleave not only the desired site of the protein of interest, but also other proteins inside this cell, causing huge interference with pathways crucial for cell functions. So far, only the tobacco etch virus (TEV) protease has been used with success for in-vivo cleavage without severe decline of cell viability.(3)<br />
Volkmann et al. first showed in vitro functionality of the intein protease. (2) Later it was shown, that the intein proteease is also applicable in vivo in E. coli and yeast cells without impairment of cell functions. (3)<br />
<br />
The intein protease consists of the 144-aa SspDnaB S1 C-intein (with an Asn-to-Ala mutation at the end of the C-intein to prevent protein splicing) followed by the extein sequence. This C-terminal part of the split intein recognizes its counterpart, the N-terminal split intein inserted into the sequence of the proteine to be cleaved, and cleaces there between extein and intein sequence. <br />
<br />
====Intein protease standard construction====<br />
SspDnaB C intein was PCR amplified from a plasmid (pCL20) received from Prof. Dr. Henning Mootz. The PCR primers contained overhangs to get the following constuct:<br />
<br />
XbaI site – T7RBS - His6 – SspDnaB C intein (N → A) – SspDnaB C extein – SpeI site – PstI site<br />
<br />
<br />
This PCR product and pSB1C3 were digested with XbaI and PstI. The digested PCR product was ligated into pSB1C3. The resulting plasmid is BBa_K1362050 (Intein protease – T7RBS-His-SspDnaBC ).<br />
<br />
The next step was to add a promotor. Therefore, BBa_K1362050 was digested with EcoRI and XbaI. BBa_K808000, an Ara promotor, was digested with SpeI and PstI. These two parts were ligated, resulting in BBa_K1362051 (Intein protease with arabinose inducible regulatory promoter/ repressor araC-Pbad-T7RBS-His-SspDnaBC).<br />
<br />
<br />
====Results====<br />
Both intein protease constructs BBa_K1362050 and BBa_K1362051 were sequenced. We obtained positive results. Here you can see the sequencing results of BBa_K1362051, the longer of the constructs (and including BBa_K1362050),<br />
<br />
<br />
BBa_K1362051 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8c/Heidelberg_orig_ARA1.png" target="_blank" >part1:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/23/Heidelberg_orig_ARA2.png" target="_blank" >part2:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/be/Heidelberg_orig_ARA3.png" target="_blank" >part3:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9e/Heidelberg_orig_ARA4.png" target="_blank" >part4:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/b6/Heidelberg_orig_ARA5.png" target="_blank" >part5:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/72/Heidelberg_orig_ARA6.png" target="_blank" >part6:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/25/Heidelberg_orig_ARA7.png" target="_blank" >part7:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9d/Heidelberg_orig_ARA8.png" target="_blank" >part8:</a> </html><br /><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
====SsrA degradation tag standard construction====<br />
The SsrA degradation tag was ordered as DNA oligos containing the tag sequence, extein sequence and BsaI overhangs. By Golden Gate Assembly the tag was cloned into the carrier construct BBa_K1362052 (for C-terminal tags). This carrier construct consists of a pSB1C3 backbone with two BsaI sites as an insert. It was used to send the tag to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tag from the carrier constructs into intein assembly constructs.<br />
<br />
====Results====<br />
The part was sequenced, the results were positive. You can see the sequencing results here:<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/3/3c/Heidelberg_orig_Ssra.png" target="_blank" >SsrA:</a> </html>BBa_K1362054<br />
<br />
=References=<br />
[1] McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
[2] Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
[3] Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.<br />
<br />
[7] Hauptmann, V. et al.: Native-sized spider silk proteins synthesized in planta via intein-based multimerization. Transgenic Res (2013) 22:369–377. DOI 10.1007/s11248-012-9655-6.<br />
<br />
[A] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[B] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. <br />
Natl. Acad. Sci. USA 95 (1998). <br />
<br />
[C] Lu, Wei et al.: Split intein facilitated tag affinity purification for recombinant proteins with controllable tag removal by inducible auto-cleavage. J. Chromatogr. A 1218 (2011) <br />
<br />
[D] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[E] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. Natl. Acad. Sci. USA 95 (1998).<br />
<br />
(1) McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
(2) Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
(3) Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/Templates/BootstrapNavTeam:Heidelberg/Templates/BootstrapNav2014-10-18T02:41:35Z<p>Bunnech: </p>
<hr />
<div>{{#tag:html|<br />
<header id="navbar" role="banner" class="navbar navbar-static-top {{{red{{{red|}}}|navbar-red}}}{{{white{{{white|}}}|navbar-white}}}"><br />
<div class="container" style="{{{header-img{{{header-img|}}}|background-image:url({{{header-img}}});background-position: bottom right; background-repeat:no-repeat; background-size: 100% auto;}}} {{{header-bg{{{header-bg|}}}|background-color:{{{header-bg}}};}}}"><br />
<div class="navbar-header"><br />
<a class="logo" href="/Team:Heidelberg" title="Home" style="padding-top: 15px; padding-left: 15px; display:inline-block;"><br />
<img src="{{{red-logo{{{red-logo|}}}|/wiki/images/4/44/Heidelberg_Logo_header_left.png}}}{{{white-logo{{{white-logo|}}}|/wiki/images/1/1d/Logo_Website_left_white.png}}}" alt="Home"> </a><br />
<!-- .btn-navbar is used as the toggle for collapsed navbar content --><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="sr-only">Toggle navigation</span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
</div><br />
<br />
<div class="navbar-collapse collapse" style="margin-bottom:10px;"><br />
<nav role="navigation"><br />
<ul class="menu nav navbar-nav navbar-right"><br />
<li class="dropdown"><a href="/Team:Heidelberg/Team" class="dropdown-toggle" ><img src="{{{red{{{red|}}}|/wiki/images/d/d3/Team_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/a/aa/Team_icon.png}}}" alt="Team icon">Team</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Team/Members">Members</a></li><br />
<li><a href="/Team:Heidelberg/Team/Collaborations">Collaborations</a></li><br />
<li><a href="/Team:Heidelberg/Team/Attributions">Attributions</a></li><br />
<li><a href="/Team:Heidelberg/Team/Sponsoring">Sponsoring</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Project" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3f/Science_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/da/Science_icon.png}}}" alt="Science icon">Project</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Project">Overview</a></li><br />
<li><a href="/Team:Heidelberg/Project/Background">Background</a></li><br />
<li><a href="/Team:Heidelberg/Project/Toolbox">Toolbox</a></li><br />
<li><a href="/Team:Heidelberg/Toolbox/Circularization">Toolbox: Circularization</a></li><br />
<li><a href="/Team:Heidelberg/Project/PCR_2.0">PCR 2.0</a></li><br />
<li><a href="/Team:Heidelberg/Project/Xylanase">Xylanase</a></li><br />
<li><a href="/Team:Heidelberg/Project/Linker_Screening">Linker Screening</a></li><br />
<li><a href="/Team:Heidelberg/Project/Reconstitution">Fluorescence Assembly</a></li><br />
<li><a href="/Team:Heidelberg/Project/LOV">Light-Induction</a></li><br />
<li><a href="/Team:Heidelberg/Project#Achievements">Achievements</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Parts" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/1d/Parts_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/9/9c/Parts_icon.png}}}" alt="Parts icon">Parts</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Parts/RFC">RFC Heidelberg 2014</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">Favorite Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Sample Data Page">Sample Data Page</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Biobricks">Biobricks</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones">Backbones</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Intein Library">Intein Library</a></li><br />
<li><a href="/Team:Heidelberg/Parts/Part_Improvement">Part Improvement</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><br />
<a href="/Team:Heidelberg/Software" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/18/Software_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/1/11/Software_icon.png}}}" alt="Software icon">Software</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Software/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Software/Linker_Software">Linker Software</a></li><br />
<li><a href="/Team:Heidelberg/Software/MidnightDoc">MidnightDoc</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Modeling" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/13/Modeling_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/d8/Modeling_icon.png}}}" alt="Modeling icon">Modeling</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Modeling/Linker_Modeling">Linker Modeling</a></li><br />
<li><a href="/Team:Heidelberg/Modeling/Enzyme_Modeling">Enzyme Kinetics Modeling</a></li><br />
<!--<li><a href="#">Modeling Application</a></li>--><br />
</ul><br />
</li><br />
<li><a href="/Team:Heidelberg/Toolbox_Guide" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/32/Toolbox_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/0/08/Toolbox_icon.png}}}" alt="Toolbox icon">Toolbox Guide</a></li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Human_Practice" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3d/Humanpractice_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/Humanpractice_icon.png}}}" alt="Human Practice icon">Human Practice</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Ethics">Religion & Synthetic Biology</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Education">Education</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Public_Relations">Public Relations</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Experts">Experts</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Notebook" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/0/03/MD_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/e/e9/MD_icon.png}}}" alt="Our Laboratory Notebook icon">Notebook</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Notebook">Notebook</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Materials">Materials</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Methods">Methods</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Safety">Safety</a></li><br />
</ul><br />
</li><br />
<li id="logo" ><a href="/" title="Home"><br />
<img src="{{{red{{{red|}}}|/wiki/images/7/79/IGEM_logo_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/IGEM_logo_white.png}}}" alt="Home"><br />
</a></li><br />
</ul><br />
</nav><br />
</div><br />
{{{title{{{title|}}}|<br />
<div class="col-lg-12"><br />
<div class="title-wrapper"><br />
<span class="title">{{{title}}}</span><br />
<span class="special-span"></span><br />
</div><br />
</div><br />
}}}<br />
</div><br />
</header><br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/ToolboxTeam:Heidelberg/pages/Toolbox2014-10-18T02:37:15Z<p>Bunnech: /* On */</p>
<hr />
<div><br />
A primary mission of the iGEM team Heidelberg 2014 is to provide a new toolbox based on appropriate standards that introduces the highly functional [https://2014.igem.org/Team:Heidelberg/Project/Background INTEINS] to the parts registry and thereby paving the way to a new level of posttranslational modification possibilities for the iGEM community. Inteins are self-excising peptide segments that mediate the reaction of protein trans-splicing. They don't require any additional energy sources to perform the splicing reaction. Another valuable feature of inteins is their specific recognition, also in the presence of other proteins, which makes them functional in vitro as well as in vivo. On this page we describe experimental approaches to provide and evaluate five related but still quite different applications using inteins and their splicing capabilities. Thereby we present scientific prove of the diversity and efficiency of an intein toolbox that can be used for a wide range of posttranslational modifications of proteins. Explore the new possibilities, intein usage provides! On this page we describe the scientific work in form of modeling and experiments that lead to the establishment of the first intein toolbox in the history of iGEM! <br />
<br />
''Jump right into splicing and use the [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to design your intein-equipped proteins of choice!''<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icons a:hover img {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icons a img {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.toolbox-icons {<br />
text-align: center;<br />
}<br />
<br />
.toolbox-icons a {<br />
display:block;<br />
margin-bottom:0px;<br />
white-space: nowrap;<br />
color: black;<br />
font-size: 15px;<br />
}<br />
<br />
.toolbox-icons a:hover {<br />
color: #DE4230;<br />
}<br />
<br />
.toolbox-icons img {<br />
margin-bottom: 0px;<br />
}<br />
<br />
.linie {<br />
margin:50px 40px;<br />
border: solid 1px black;<br />
}<br />
</style><br />
<br />
<div class="row toolbox-icons"><br />
<div class="col-lg-2 col-lg-offset-1 col-md-offset-1 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" class="img-responsive" /></span>CIRCULARIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/4/40/Oligomerization.png" class="img-responsive" /></span>OLIGOMERIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" class="img-responsive" /></span>FUSING & TAGGING</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" class="img-responsive" /></span>PURIFICATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" class="img-responsive" /></span>ON OFF</a><br />
</div><br />
</div><br />
</html><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Circularization=<br />
<br />
Millions of years of evolution have allowed proteins to performed extremely specific chemical modifications that are not only essential for living organisms but can also be of great benefit to produce useful molecules for our life, efficiently and at low cost. A major limitation of the use of enzyme for industrial application and in general for usage out of their natural environment is their stability. They can be destroyed by other enzymes and they can unfold and take non-functional conformation when exposed to non-physiological temperature and pH. Such limitations has motivated research in species that can grow at extreme temperatures [6]. Another major area of chemical research if the design of strategies to stabilize enzymes, and more generally proteins and peptides. Protein circularization, meaning ligation of the N- and C-terminal ends of a protein, represents a promising way to achieve this stabilization. While conserving the functionality of their linear counterpart, circular proteins can be superior to linear proteins in terms of thermostability [1][2][3], resistance against chemical denaturation [4] and protection from exopeptidases [2][4]. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides [5]. These remarkable properties motivated us to develop new tools to circularize any protein of interest.<br />
<br />
Our Toolbox Guide provides a step-by-step strategy to clone a circularization linker and express it in e. Coli. Moreover, in case of complex structures where the protein extremities are far from each other, we have developed a software that will design the appropriate rigid linkers.<br />
<br />
''Please find more information and results of the experiments that laid the foundation for the circularization kit of the toolbox on the [https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization Circularization pages]''. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Oligomerization=<br />
<br />
Split inteins constitute a useful tool to produce huge polymers in vivo: Hauptmann et al. managed to fabricate synthetic spider silk with microfiber structure. The results using an easy-to-handle split intein system were stunning: The polymers had a molecular weight of 250 kDa and more [7]. Further application of oligomerization by inteins includes the posttranslational complexation of multi-domain proteins, after their domains have been expressed individually. This approach is very valuable considering great difficulities of expressing large eukaryotic proteins in <i>E.coli</i>.<br />
<br />
==== Standardization of oligomerization ====<br />
The valuable properties of spider silk, for example its exceptional strength and elasticity, result from numerous repeats of certain protein motifs. Convenitonal methods to multimerize these motifs bear a lot of difficulties: Often genetic and mRNA instability constitute a barrier for the production of multimers as fusion proteins.[1] Posttranslational assembly through split inteins is therefore the solution to overcome these problems. The successfull polimerization of spider silk potein motifs demonstrates the potential of split inteins to be a useful tool for the production of new biomaterials by performing oligomerization reactions with split inteins. The iGEM team Heidelberg standardized (lik to toolbox guide) the oligomerization procedure with split inteins to allow easy handling with different proteins.<br />
<br />
The use of non-orthogonal split inteins can further be exploited to direct the oligomerisation of several protein domains at once.<br />
<br />
==== The mechanism ====<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Oligomerization with inteins.|file=Oligomerization.png}}<br />
Oligomerization reactions require the same constructs as the ones used for protein circularization.<br />
<br />
Circularization is achieved by bringing the N and C terminus of a protein very close together, so both intein parts can asseble, cut out off the protein and thereby circularize it. In contrast, oligomerization occurs when both termini of a protein cannot reach each other and the intein parts of two neighbouring proteins assemble. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Fusion and Tagging=<br />
<br />
====Introduction====<br />
Post-translational modifications are present in nature in great numbers.Synthetic Biology, however, has not yet made use of the innumerable possibilities nature has developed. With our collection of intein assembly constructs we expand the arsenal of synthetic biology by enabling unlimited changes of a protein's amino acid sequence even after translation. <br />
<br />
====Standard Construction====<br />
<br />
To be able <b>to fuse</b> any two halves of a protein together can have many different uses. We therefore saw the need for a standardised construct, the intein assembly part. This BioBrick part allows the user to clone two DNA-sequences coding for two parts of a peptide into a plasmid prepared with selection markers and standardised overhangs. Those parts were all send in with additional hexahistidine-tags to enable quick analysis on a western blot, however there are highly customisable parts available as well.Visit our [https://2014.igem.org/Team:Heidelberg/Parts#allParts parts page] to get an overview of our assembly constructs.<br />
In an extensive assay we proved the principle behind split protein assembly by showing that GFP can be artificially split into two halves and thereafter be reassembled so the fluorescence is restored. Visit the [https://2014.igem.org/Team:Heidelberg/Project/Reconstitution split Fluorescent Protein].<br />
<br />
<br />
<br />
=== Posttranslational Modifications ===<br />
<br />
====Introduction====<br />
Posttranslational modifications are highly prevalent in nature: Almost every protein in a cell is modified after having been translated, adding numerous varieties of the protein to the mere protein backbone.<br />
Synthetic Biology, however, can expand the possibilities offered by nature and introduce synthetic posttranslational modifications or attachments, such as biophysical probes. As the two parts of a split intein assemble in a highly specific manner, the modifications are introduced controllable a certain locus.<br />
There are different publications on intein-based introduction of posttranslational modifications, including phosphorylation, lipidation, glycosylation, acetylation and ubiquitination [A].<br />
Phosphorylation, for example has been applied with tyrosine kinase C-terminal Src kinase (Csk) in order to be able to study the structure and function of this specifically modified protein [B].<br />
<br />
====Standard construction====<br />
Applying the intein assembly constructs the iGEM team Heidelberg provides a tool for all kinds of natural as well as synthetic posttranslational modifications by chemoselective addition of a peptide to a recombinant protein.<br />
The principle is based on intein-mediated protein fusion using the [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362141 SspDnaB] split intein for N-terminal modifications and SspDnaX-S11 for C-terminal ones. The split SspDnaB intein has a very short N-terminal part, consisting of only 11 amino acids intein and 5 amino acids extein sequence and a much longer C-terminal part. By contrast, [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362110 SspDnaX-S11] has a C-terminal part consisting of only 6 amino acids intein and 3 amino acids extein sequence, but a much longer N-terminal part.<br />
The short part including the desired modification is easy to obtain by chemical synthesis. This offers the possibility to introduce this modification at a specific locus.<br />
<br />
<br />
''In general, split inteins are powerful tools to easily introduce all kinds of posttranslational modifications in a highly chemoselective manner.<br />
Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to attach posttranslational modifications and attachments to your protein of interest!''<br />
<br />
===Translocation===<br />
<br />
====Introduction====<br />
Adding and removal of translocation tags is one application example for split intein-mediated fusion of two protein domains. Translocation tags offer the possibility to transfer proteins to a certain locus inside the cell by attaching a short tag sequence to the terminus of one's protein of interest. Expressed fused to the protein, which is the conventional way, such a tag is neither removable nor attachable to a protein at a certain time point. Usage of split inteins for tagging offers new dimensions of mobility and control: Tags can be attached (using fusion constructs) or removed (using the intein protease) posttranslationally at a specific time point.<br />
<br />
====Standard construction====<br />
<br />
Regulated targeting of proteins to certain loci inside the cell can be achieved using the iGEM Heidelberg 2014 translocation tags for either E. coli or eucaryotic expression systems. Many of them are based on parts created by previous iGEM teams, but with split intein usage now can be applied in much diverser ways.<br />
We provide following tags:<br />
<br />
{| class="table table-hover"<br />
|+ <b>Our toolbox provides the following tags:</b><br />
|-<br />
| MinD membrane targeting sequence: [http://parts.igem.org/Part:BBa_K1362055 BBa_K1362055] || → membrane localization (E. coli)<br />
|-<br />
| OmpA: [http://parts.igem.org/Part:BBa_K1362060 BBa_K1362060] || → surface display (E. coli)<br />
|-<br />
| pelB leader sequence: [http://parts.igem.org/Part:BBa_K1362058 BBa_K1362058] || → periplasmic localization (E. coli)<br />
|-<br />
| myristooilation signal sequence: [http://parts.igem.org/Part:BBa_K1362056 BBa_K1362056] || → membrane localization (eucaryotic)<br />
|-<br />
| PKI-NES: [http://parts.igem.org/Part:BBa_K1362059 BBa_K1362059] || → cytoplasmic localization (eucaryotic)<br />
|-<br />
| NLS: [http://parts.igem.org/Part:BBa_K1362057 BBa_K1362057] || → nuclear localization (eucaryotic)<br />
|}<br />
<br />
''Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to post-translationally assemble proteins, attach tags or change the location of your protein!''<br />
<br />
All translocation tags except from the OmpA surface protein tag were ordered as DNA oligos containing the tag sequence, extein sequence and BsaI oberhangs. OmpA surface protein was obtained from the Spring Distribution 2012 and also PCR amplified with overhangs. By Golden Gate Assembly the tags were cloned into the carrier constructs BBa_K1362052 (for C-terminal tags) and BBa_K1362053 (for N-terminal tags). These carrier constructs, pSB1C3 backbones with two BsaI sites as an insert, were used to send the tags to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tags from the carrier constructs into intein assembly constructs.<br />
<br />
====Results====<br />
The parts were sequenced, the results were positive. You can obtian them here:<br />
<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8d/Heidelberg_orig_MTS.png" target="_blank" >MinD MTS:</a></html>BBa_K1362055 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/4/48/Heidelberg_orig_pelB.png" target="_blank" >pelB leader sequence:</a> </html> BBa_K1362058<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/de/Heidelberg_orig_myristoilation.png" target="_blank" >myristoilation signal sequence:</a> </html> BBa_K1362056<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/57/Heidelberg_orig_PKI_NES.png" target="_blank" >PKI-NES:</a> </html> BBa_K1362059<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/5c/Heidelberg_orig_NLS.png" target="_blank" >NLS:</a> </html> BBa_K1362057<br />
<br />
OmpA (<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d7/Heidelberg_orig_ompa-1.png" target="_blank" >part1</a></html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/0/02/Heidelberg_orig_ompa1.png" target="_blank" >part2</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/1/1b/Heidelberg_orig_ompa2.png" target="_blank" >part3</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/bd/Heidelberg_orig_ompa3.png" target="_blank" >part4</a> </html>): BBa_K1362060<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Purification=<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Purification with inteins.|file=Purification.png}}<br />
<br />
Therapeutic proteins have changed modern medicine. For instance, the monoclonal antibody Trastuzumab, is used to treat breast cancers that are positive for the epidermal growth factor HER2/neu (Ref. Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy). <br />
For application in medicine proteins have to be of very high purity. However, purification at industrial scale remains time consuming and cost intensive. The purification procedure includes numerous steps: First of which is the binding of the protein to an affinity matrix, followed by washing and finally release of the protein from the affinity column. The affinity tag, used to achieve selective binding of the intended protein to the matrix remains bound to the protein of interest and has to be selectively removed by protease cleavage. This often leads to undesirable secondary cleavage within the sequence of the protein. Proteases are the most expensive component of a industrial scale purification process. Eventually, the affinity tag has to be separated from the protein causing further effort and costs.<br />
The split-intein based system is manifold easier: All these steps can be combined into one by using Ssp DnaB mini-intein, an artificial split intein. It performs the trans-splicing reaction only under certain pH and temperature conditions. A mutation of the SspDnaB N-intein at Cys1 to Ala prevents cleavage at the N-terminus, cleavage at the C-terminus still occurs. The N-terminal intein part, attached to a chitin binding domain can be used as an affinity ligand, while the C-terminal part, fused to a protein of interest, can be used as an affinity tag binding highly specific to the ligand part. After loading the protein of interest on a chitin column, the trans-splicing reaction can be induced by adjusting temperature and pH: the both split inteins fuse together, disrupting the fusion to the protein of interest in one single step [C]. <br />
Thereby, split-inteins simplify conventional protein purification in many aspects: The system is cheaper, faster and more efficient than other purification procedures (Ref.). In fact, only a single chromatographic step is necessary for both, binding of the protein fused to an affinity tag to the affinity column and tag removal. Also, there is no need for expensive proteases. <br />
<br />
We standardized this split-intein purification system, so it is easy applicable to all kinds of proteins. Visit our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to purify your protein!<br />
<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=On Off=<br />
==On==<br />
In many systems biology projects, it is desirable to have an external trigger to turn a protein’s function ON and OFF in cells at a specific time point. The most prominent approach to achieve the ON-OFF switch is the regulation via gene expression. However this method is unfavorable in terms of temporal and spatial resolution. Using our intein toolbox it could become possible to activate a specific protein in a shorter period of time in single cell resolution. Imaging the most prominent system currently used in molecular biology- the CRISPR/Cas technology temporal and spatial activated within a single cell. This could be achieved using our assembly construct with two insertion sides to fuse proteins or protein domains combined with our light induction approach. Cas9 could be split in two parts resulting in an inactive state of each half. Upon splicing reaction the protein can be reassembled and its functionality restored. Unfortunately, we ran out of time to apply our assembly construct for the experiments with Cas9. However using our toolbox this can easily be achieved within few days. As proof of principle for the fusion and activation of proteins, we showed the reconstitution of fluorescence of superfold GFP that was previously split and connected to split NpuDnaE inteins. (link) <br />
<br />
<br />
Our assembly construct with two insertion sides provides an easy to handle approach to clone in front and behind of each split intein. Initially N- and C-terminal parts are separated on two plasmids and each intein provides the two insertion sides. As place holder for the insertion sides mRFP selection markers were included that are easily exchangeable via Golden Gate cloning using the restriction enzyme BsaI. The user only needs to make sure to clone the protein halves, which should reassemble, into the correct insertion sides; namely the N-terminal protein half into the N-terminal “gate” and the C-terminal protein into the C-terminal “gate”. <br />
<br />
Confused? All your questions will be answered once looking into our [https://2014.igem.org/Team:Heidelberg/Parts/RFC RFC]!<br />
<br />
In this manner the separated plasmids containing either N- or C-terminal splicing construct can be coexpressed by transforming both plasmid into one cell. Alternatively they can be assembled onto one plasmid by standard Biobrick cloning. <br />
<br />
We generated the assembly construct by joining and amplification of the three inserts – first insertion side, Npu DnaE intein and second insertion side- via polymerase cycling assembly (PCA) cloning method. PCA is a modification of CPEC cloning, resulting only in the amplification of the assembled insert fragment. Using CPEC this fragment was incorporated in our expression vector. <br />
The sequencing of our assembly construct with two insertion sides is available.<br />
<br />
Please find more information and results of the experiments that laid the foundation for the assembly construct of the toolbox on the …<br />
<br />
==Off==<br />
<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Oligomerization with inteins.|file=Intein_Protease_1.png}}<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Principle of the intein protease.|file=Intein_Protease_3.png}}<br />
<br />
We provide two different tools for deactivation of proteins. One of them is the C-terminal degradation tag SsrA, the other one the intein protease.The SsrA tag directs the tagged protein to the ClpXP protease, causing degradation of this protein (1). <br />
The intein protease is a singular tool for site-specific in vivo protein cleavage. Under in vitro conditions, protease usage is relatively easy compared to in vivo conditions. The inside of a cell constitutes a very complex environment, so that conventional proteases would simply cleave not only the desired site of the protein of interest, but also other proteins inside this cell, causing huge interference with pathways crucial for cell functions. So far, only the tobacco etch virus (TEV) protease has been used with success for in-vivo cleavage without severe decline of cell viability.(3)<br />
Volkmann et al. first showed in vitro functionality of the intein protease. (2) Later it was shown, that the intein proteease is also applicable in vivo in E. coli and yeast cells without impairment of cell functions. (3)<br />
<br />
The intein protease consists of the 144-aa SspDnaB S1 C-intein (with an Asn-to-Ala mutation at the end of the C-intein to prevent protein splicing) followed by the extein sequence. This C-terminal part of the split intein recognizes its counterpart, the N-terminal split intein inserted into the sequence of the proteine to be cleaved, and cleaces there between extein and intein sequence. <br />
<br />
====Intein protease standard construction====<br />
SspDnaB C intein was PCR amplified from a plasmid (pCL20) received from Prof. Dr. Henning Mootz. The PCR primers contained overhangs to get the following constuct:<br />
<br />
XbaI site – T7RBS - His6 – SspDnaB C intein (N → A) – SspDnaB C extein – SpeI site – PstI site<br />
<br />
<br />
This PCR product and pSB1C3 were digested with XbaI and PstI. The digested PCR product was ligated into pSB1C3. The resulting plasmid is BBa_K1362050 (Intein protease – T7RBS-His-SspDnaBC ).<br />
<br />
The next step was to add a promotor. Therefore, BBa_K1362050 was digested with EcoRI and XbaI. BBa_K808000, an Ara promotor, was digested with SpeI and PstI. These two parts were ligated, resulting in BBa_K1362051 (Intein protease with arabinose inducible regulatory promoter/ repressor araC-Pbad-T7RBS-His-SspDnaBC).<br />
<br />
<br />
====Results====<br />
Both intein protease constructs BBa_K1362050 and BBa_K1362051 were sequenced. We obtained positive results. Here you can see the sequencing results of BBa_K1362051, the longer of the constructs (and including BBa_K1362050),<br />
<br />
<br />
BBa_K1362051 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8c/Heidelberg_orig_ARA1.png" target="_blank" >part1:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/23/Heidelberg_orig_ARA2.png" target="_blank" >part2:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/be/Heidelberg_orig_ARA3.png" target="_blank" >part3:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9e/Heidelberg_orig_ARA4.png" target="_blank" >part4:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/b6/Heidelberg_orig_ARA5.png" target="_blank" >part5:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/72/Heidelberg_orig_ARA6.png" target="_blank" >part6:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/25/Heidelberg_orig_ARA7.png" target="_blank" >part7:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9d/Heidelberg_orig_ARA8.png" target="_blank" >part8:</a> </html><br /><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
====SsrA degradation tag standard construction====<br />
The SsrA degradation tag was ordered as DNA oligos containing the tag sequence, extein sequence and BsaI overhangs. By Golden Gate Assembly the tag was cloned into the carrier construct BBa_K1362052 (for C-terminal tags). This carrier construct consists of a pSB1C3 backbone with two BsaI sites as an insert. It was used to send the tag to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tag from the carrier constructs into intein assembly constructs.<br />
<br />
====Results====<br />
The part was sequenced, the results were positive. You can see the sequencing results here:<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/3/3c/Heidelberg_orig_Ssra.png" target="_blank" >SsrA:</a> </html>BBa_K1362054<br />
<br />
=References=<br />
[1] McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
[2] Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
[3] Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.<br />
<br />
[7] Hauptmann, V. et al.: Native-sized spider silk proteins synthesized in planta via intein-based multimerization. Transgenic Res (2013) 22:369–377. DOI 10.1007/s11248-012-9655-6.<br />
<br />
[A] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[B] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. <br />
Natl. Acad. Sci. USA 95 (1998). <br />
<br />
[C] Lu, Wei et al.: Split intein facilitated tag affinity purification for recombinant proteins with controllable tag removal by inducible auto-cleavage. J. Chromatogr. A 1218 (2011) <br />
<br />
[D] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[E] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. Natl. Acad. Sci. USA 95 (1998).<br />
<br />
(1) McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
(2) Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
(3) Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/ToolboxTeam:Heidelberg/pages/Toolbox2014-10-18T02:35:14Z<p>Bunnech: /* On */</p>
<hr />
<div><br />
A primary mission of the iGEM team Heidelberg 2014 is to provide a new toolbox based on appropriate standards that introduces the highly functional [https://2014.igem.org/Team:Heidelberg/Project/Background INTEINS] to the parts registry and thereby paving the way to a new level of posttranslational modification possibilities for the iGEM community. Inteins are self-excising peptide segments that mediate the reaction of protein trans-splicing. They don't require any additional energy sources to perform the splicing reaction. Another valuable feature of inteins is their specific recognition, also in the presence of other proteins, which makes them functional in vitro as well as in vivo. On this page we describe experimental approaches to provide and evaluate five related but still quite different applications using inteins and their splicing capabilities. Thereby we present scientific prove of the diversity and efficiency of an intein toolbox that can be used for a wide range of posttranslational modifications of proteins. Explore the new possibilities, intein usage provides! On this page we describe the scientific work in form of modeling and experiments that lead to the establishment of the first intein toolbox in the history of iGEM! <br />
<br />
''Jump right into splicing and use the [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to design your intein-equipped proteins of choice!''<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icons a:hover img {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icons a img {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.toolbox-icons {<br />
text-align: center;<br />
}<br />
<br />
.toolbox-icons a {<br />
display:block;<br />
margin-bottom:0px;<br />
white-space: nowrap;<br />
color: black;<br />
font-size: 15px;<br />
}<br />
<br />
.toolbox-icons a:hover {<br />
color: #DE4230;<br />
}<br />
<br />
.toolbox-icons img {<br />
margin-bottom: 0px;<br />
}<br />
<br />
.linie {<br />
margin:50px 40px;<br />
border: solid 1px black;<br />
}<br />
</style><br />
<br />
<div class="row toolbox-icons"><br />
<div class="col-lg-2 col-lg-offset-1 col-md-offset-1 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" class="img-responsive" /></span>CIRCULARIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/4/40/Oligomerization.png" class="img-responsive" /></span>OLIGOMERIZATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" class="img-responsive" /></span>FUSING & TAGGING</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" class="img-responsive" /></span>PURIFICATION</a><br />
</div><br />
<div class="col-lg-2 col-md-2 col-sm-4 col-xs-6"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><span class="col-lg-offset-3 col-lg-6 col-md-offset-2 col-md-8 col-sm-12 nopadding nofloat"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" class="img-responsive" /></span>ON OFF</a><br />
</div><br />
</div><br />
</html><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Circularization=<br />
<br />
Millions of years of evolution have allowed proteins to performed extremely specific chemical modifications that are not only essential for living organisms but can also be of great benefit to produce useful molecules for our life, efficiently and at low cost. A major limitation of the use of enzyme for industrial application and in general for usage out of their natural environment is their stability. They can be destroyed by other enzymes and they can unfold and take non-functional conformation when exposed to non-physiological temperature and pH. Such limitations has motivated research in species that can grow at extreme temperatures [6]. Another major area of chemical research if the design of strategies to stabilize enzymes, and more generally proteins and peptides. Protein circularization, meaning ligation of the N- and C-terminal ends of a protein, represents a promising way to achieve this stabilization. While conserving the functionality of their linear counterpart, circular proteins can be superior to linear proteins in terms of thermostability [1][2][3], resistance against chemical denaturation [4] and protection from exopeptidases [2][4]. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides [5]. These remarkable properties motivated us to develop new tools to circularize any protein of interest.<br />
<br />
Our Toolbox Guide provides a step-by-step strategy to clone a circularization linker and express it in e. Coli. Moreover, in case of complex structures where the protein extremities are far from each other, we have developed a software that will design the appropriate rigid linkers.<br />
<br />
''Please find more information and results of the experiments that laid the foundation for the circularization kit of the toolbox on the [https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization Circularization pages]''. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Oligomerization=<br />
<br />
Split inteins constitute a useful tool to produce huge polymers in vivo: Hauptmann et al. managed to fabricate synthetic spider silk with microfiber structure. The results using an easy-to-handle split intein system were stunning: The polymers had a molecular weight of 250 kDa and more [7]. Further application of oligomerization by inteins includes the posttranslational complexation of multi-domain proteins, after their domains have been expressed individually. This approach is very valuable considering great difficulities of expressing large eukaryotic proteins in <i>E.coli</i>.<br />
<br />
==== Standardization of oligomerization ====<br />
The valuable properties of spider silk, for example its exceptional strength and elasticity, result from numerous repeats of certain protein motifs. Convenitonal methods to multimerize these motifs bear a lot of difficulties: Often genetic and mRNA instability constitute a barrier for the production of multimers as fusion proteins.[1] Posttranslational assembly through split inteins is therefore the solution to overcome these problems. The successfull polimerization of spider silk potein motifs demonstrates the potential of split inteins to be a useful tool for the production of new biomaterials by performing oligomerization reactions with split inteins. The iGEM team Heidelberg standardized (lik to toolbox guide) the oligomerization procedure with split inteins to allow easy handling with different proteins.<br />
<br />
The use of non-orthogonal split inteins can further be exploited to direct the oligomerisation of several protein domains at once.<br />
<br />
==== The mechanism ====<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Oligomerization with inteins.|file=Oligomerization.png}}<br />
Oligomerization reactions require the same constructs as the ones used for protein circularization.<br />
<br />
Circularization is achieved by bringing the N and C terminus of a protein very close together, so both intein parts can asseble, cut out off the protein and thereby circularize it. In contrast, oligomerization occurs when both termini of a protein cannot reach each other and the intein parts of two neighbouring proteins assemble. <br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Fusion and Tagging=<br />
<br />
====Introduction====<br />
Post-translational modifications are present in nature in great numbers.Synthetic Biology, however, has not yet made use of the innumerable possibilities nature has developed. With our collection of intein assembly constructs we expand the arsenal of synthetic biology by enabling unlimited changes of a protein's amino acid sequence even after translation. <br />
<br />
====Standard Construction====<br />
<br />
To be able <b>to fuse</b> any two halves of a protein together can have many different uses. We therefore saw the need for a standardised construct, the intein assembly part. This BioBrick part allows the user to clone two DNA-sequences coding for two parts of a peptide into a plasmid prepared with selection markers and standardised overhangs. Those parts were all send in with additional hexahistidine-tags to enable quick analysis on a western blot, however there are highly customisable parts available as well.Visit our [https://2014.igem.org/Team:Heidelberg/Parts#allParts parts page] to get an overview of our assembly constructs.<br />
In an extensive assay we proved the principle behind split protein assembly by showing that GFP can be artificially split into two halves and thereafter be reassembled so the fluorescence is restored. Visit the [https://2014.igem.org/Team:Heidelberg/Project/Reconstitution split Fluorescent Protein].<br />
<br />
<br />
<br />
=== Posttranslational Modifications ===<br />
<br />
====Introduction====<br />
Posttranslational modifications are highly prevalent in nature: Almost every protein in a cell is modified after having been translated, adding numerous varieties of the protein to the mere protein backbone.<br />
Synthetic Biology, however, can expand the possibilities offered by nature and introduce synthetic posttranslational modifications or attachments, such as biophysical probes. As the two parts of a split intein assemble in a highly specific manner, the modifications are introduced controllable a certain locus.<br />
There are different publications on intein-based introduction of posttranslational modifications, including phosphorylation, lipidation, glycosylation, acetylation and ubiquitination [A].<br />
Phosphorylation, for example has been applied with tyrosine kinase C-terminal Src kinase (Csk) in order to be able to study the structure and function of this specifically modified protein [B].<br />
<br />
====Standard construction====<br />
Applying the intein assembly constructs the iGEM team Heidelberg provides a tool for all kinds of natural as well as synthetic posttranslational modifications by chemoselective addition of a peptide to a recombinant protein.<br />
The principle is based on intein-mediated protein fusion using the [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362141 SspDnaB] split intein for N-terminal modifications and SspDnaX-S11 for C-terminal ones. The split SspDnaB intein has a very short N-terminal part, consisting of only 11 amino acids intein and 5 amino acids extein sequence and a much longer C-terminal part. By contrast, [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362110 SspDnaX-S11] has a C-terminal part consisting of only 6 amino acids intein and 3 amino acids extein sequence, but a much longer N-terminal part.<br />
The short part including the desired modification is easy to obtain by chemical synthesis. This offers the possibility to introduce this modification at a specific locus.<br />
<br />
<br />
''In general, split inteins are powerful tools to easily introduce all kinds of posttranslational modifications in a highly chemoselective manner.<br />
Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to attach posttranslational modifications and attachments to your protein of interest!''<br />
<br />
===Translocation===<br />
<br />
====Introduction====<br />
Adding and removal of translocation tags is one application example for split intein-mediated fusion of two protein domains. Translocation tags offer the possibility to transfer proteins to a certain locus inside the cell by attaching a short tag sequence to the terminus of one's protein of interest. Expressed fused to the protein, which is the conventional way, such a tag is neither removable nor attachable to a protein at a certain time point. Usage of split inteins for tagging offers new dimensions of mobility and control: Tags can be attached (using fusion constructs) or removed (using the intein protease) posttranslationally at a specific time point.<br />
<br />
====Standard construction====<br />
<br />
Regulated targeting of proteins to certain loci inside the cell can be achieved using the iGEM Heidelberg 2014 translocation tags for either E. coli or eucaryotic expression systems. Many of them are based on parts created by previous iGEM teams, but with split intein usage now can be applied in much diverser ways.<br />
We provide following tags:<br />
<br />
{| class="table table-hover"<br />
|+ <b>Our toolbox provides the following tags:</b><br />
|-<br />
| MinD membrane targeting sequence: [http://parts.igem.org/Part:BBa_K1362055 BBa_K1362055] || → membrane localization (E. coli)<br />
|-<br />
| OmpA: [http://parts.igem.org/Part:BBa_K1362060 BBa_K1362060] || → surface display (E. coli)<br />
|-<br />
| pelB leader sequence: [http://parts.igem.org/Part:BBa_K1362058 BBa_K1362058] || → periplasmic localization (E. coli)<br />
|-<br />
| myristooilation signal sequence: [http://parts.igem.org/Part:BBa_K1362056 BBa_K1362056] || → membrane localization (eucaryotic)<br />
|-<br />
| PKI-NES: [http://parts.igem.org/Part:BBa_K1362059 BBa_K1362059] || → cytoplasmic localization (eucaryotic)<br />
|-<br />
| NLS: [http://parts.igem.org/Part:BBa_K1362057 BBa_K1362057] || → nuclear localization (eucaryotic)<br />
|}<br />
<br />
''Use our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to post-translationally assemble proteins, attach tags or change the location of your protein!''<br />
<br />
All translocation tags except from the OmpA surface protein tag were ordered as DNA oligos containing the tag sequence, extein sequence and BsaI oberhangs. OmpA surface protein was obtained from the Spring Distribution 2012 and also PCR amplified with overhangs. By Golden Gate Assembly the tags were cloned into the carrier constructs BBa_K1362052 (for C-terminal tags) and BBa_K1362053 (for N-terminal tags). These carrier constructs, pSB1C3 backbones with two BsaI sites as an insert, were used to send the tags to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tags from the carrier constructs into intein assembly constructs.<br />
<br />
====Results====<br />
The parts were sequenced, the results were positive. You can obtian them here:<br />
<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8d/Heidelberg_orig_MTS.png" target="_blank" >MinD MTS:</a></html>BBa_K1362055 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/4/48/Heidelberg_orig_pelB.png" target="_blank" >pelB leader sequence:</a> </html> BBa_K1362058<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/de/Heidelberg_orig_myristoilation.png" target="_blank" >myristoilation signal sequence:</a> </html> BBa_K1362056<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/57/Heidelberg_orig_PKI_NES.png" target="_blank" >PKI-NES:</a> </html> BBa_K1362059<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/5/5c/Heidelberg_orig_NLS.png" target="_blank" >NLS:</a> </html> BBa_K1362057<br />
<br />
OmpA (<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d7/Heidelberg_orig_ompa-1.png" target="_blank" >part1</a></html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/0/02/Heidelberg_orig_ompa1.png" target="_blank" >part2</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/1/1b/Heidelberg_orig_ompa2.png" target="_blank" >part3</a> </html>, <html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/bd/Heidelberg_orig_ompa3.png" target="_blank" >part4</a> </html>): BBa_K1362060<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=Purification=<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Purification with inteins.|file=Purification.png}}<br />
<br />
Therapeutic proteins have changed modern medicine. For instance, the monoclonal antibody Trastuzumab, is used to treat breast cancers that are positive for the epidermal growth factor HER2/neu (Ref. Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy). <br />
For application in medicine proteins have to be of very high purity. However, purification at industrial scale remains time consuming and cost intensive. The purification procedure includes numerous steps: First of which is the binding of the protein to an affinity matrix, followed by washing and finally release of the protein from the affinity column. The affinity tag, used to achieve selective binding of the intended protein to the matrix remains bound to the protein of interest and has to be selectively removed by protease cleavage. This often leads to undesirable secondary cleavage within the sequence of the protein. Proteases are the most expensive component of a industrial scale purification process. Eventually, the affinity tag has to be separated from the protein causing further effort and costs.<br />
The split-intein based system is manifold easier: All these steps can be combined into one by using Ssp DnaB mini-intein, an artificial split intein. It performs the trans-splicing reaction only under certain pH and temperature conditions. A mutation of the SspDnaB N-intein at Cys1 to Ala prevents cleavage at the N-terminus, cleavage at the C-terminus still occurs. The N-terminal intein part, attached to a chitin binding domain can be used as an affinity ligand, while the C-terminal part, fused to a protein of interest, can be used as an affinity tag binding highly specific to the ligand part. After loading the protein of interest on a chitin column, the trans-splicing reaction can be induced by adjusting temperature and pH: the both split inteins fuse together, disrupting the fusion to the protein of interest in one single step [C]. <br />
Thereby, split-inteins simplify conventional protein purification in many aspects: The system is cheaper, faster and more efficient than other purification procedures (Ref.). In fact, only a single chromatographic step is necessary for both, binding of the protein fused to an affinity tag to the affinity column and tag removal. Also, there is no need for expensive proteases. <br />
<br />
We standardized this split-intein purification system, so it is easy applicable to all kinds of proteins. Visit our [https://2014.igem.org/Team:Heidelberg/Toolbox_Guide toolbox guide] to purify your protein!<br />
<br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
=On Off=<br />
==On==<br />
In many systems biology projects, it is desirable to have an external trigger to turn a protein’s function ON and OFF in cells at a specific time point. The most prominent approach to achieve the ON-OFF switch is the regulation via gene expression. However this method is unfavorable in terms of temporal and spatial resolution. Using our intein toolbox it could become possible to activate a specific protein in a shorter period of time in single cell resolution. Imaging the most prominent system currently used in molecular biology- the CRISPR/Cas technology temporal and spatial activated within a single cell. This could be achieved using our assembly construct with two insertion sides to fuse proteins or protein domains combined with our light induction approach. Cas9 could be split in two parts resulting in an inactive state of each half. Upon splicing reaction the protein can be reassembled and its functionality restored. Unfortunately, we ran out of time to apply our assembly construct for the experiments with Cas9. However using our toolbox this can easily be achieved within few days. As proof of principle for the fusion and activation of proteins, we showed the reconstitution of fluorescence of superfold GFP that was previously split and connected to split NpuDnaE inteins. (link) <br />
<br />
Figure<br />
<br />
Our assembly construct with two insertion sides provides an easy to handle approach to clone in front and behind of each split intein. Initially N- and C-terminal parts are separated on two plasmids and each intein provides the two insertion sides. As place holder for the insertion sides mRFP selection markers were included that are easily exchangeable via Golden Gate cloning using the restriction enzyme BsaI. The user only needs to make sure to clone the protein halves, which should reassemble, into the correct insertion sides; namely the N-terminal protein half into the N-terminal “gate” and the C-terminal protein into the C-terminal “gate”. <br />
<br />
Confused? All your questions will be answered once looking into our [https://2014.igem.org/Team:Heidelberg/Parts/RFC RFC]!<br />
<br />
In this manner the separated plasmids containing either N- or C-terminal splicing construct can be coexpressed by transforming both plasmid into one cell. Alternatively they can be assembled onto one plasmid by standard Biobrick cloning. <br />
<br />
We generated the assembly construct by joining and amplification of the three inserts – first insertion side, Npu DnaE intein and second insertion side- via polymerase cycling assembly (PCA) cloning method. PCA is a modification of CPEC cloning, resulting only in the amplification of the assembled insert fragment. Using CPEC this fragment was incorporated in our expression vector. <br />
The sequencing of our [https://2014.igem.org/Team:Heidelberg/Parts#Assembly assembly construct] with two insertion sides is available.<br />
<br />
Please find more information and results of the experiments that laid the foundation for the assembly construct of the toolbox on the …<br />
<br />
==Off==<br />
<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Oligomerization with inteins.|file=Intein_Protease_1.png}}<br />
{{:Team:Heidelberg/templates/image-half|align=right|descr=|caption=Principle of the intein protease.|file=Intein_Protease_3.png}}<br />
<br />
We provide two different tools for deactivation of proteins. One of them is the C-terminal degradation tag SsrA, the other one the intein protease.The SsrA tag directs the tagged protein to the ClpXP protease, causing degradation of this protein (1). <br />
The intein protease is a singular tool for site-specific in vivo protein cleavage. Under in vitro conditions, protease usage is relatively easy compared to in vivo conditions. The inside of a cell constitutes a very complex environment, so that conventional proteases would simply cleave not only the desired site of the protein of interest, but also other proteins inside this cell, causing huge interference with pathways crucial for cell functions. So far, only the tobacco etch virus (TEV) protease has been used with success for in-vivo cleavage without severe decline of cell viability.(3)<br />
Volkmann et al. first showed in vitro functionality of the intein protease. (2) Later it was shown, that the intein proteease is also applicable in vivo in E. coli and yeast cells without impairment of cell functions. (3)<br />
<br />
The intein protease consists of the 144-aa SspDnaB S1 C-intein (with an Asn-to-Ala mutation at the end of the C-intein to prevent protein splicing) followed by the extein sequence. This C-terminal part of the split intein recognizes its counterpart, the N-terminal split intein inserted into the sequence of the proteine to be cleaved, and cleaces there between extein and intein sequence. <br />
<br />
===Intein protease cloning strategy===<br />
SspDnaB C intein was PCR amplified from a plasmid (pCL20) received from Prof. Dr. Henning Mootz. The PCR primers contained overhangs to get the following constuct:<br />
<br />
XbaI site – T7RBS - His6 – SspDnaB C intein (N → A) – SspDnaB C extein – SpeI site – PstI site<br />
<br />
<br />
This PCR product and pSB1C3 were digested with XbaI and PstI. The digested PCR product was ligated into pSB1C3. The resulting plasmid is BBa_K1362050 (Intein protease – T7RBS-His-SspDnaBC ).<br />
<br />
The next step was to add a promotor. Therefore, BBa_K1362050 was digested with EcoRI and XbaI. BBa_K808000, an Ara promotor, was digested with SpeI and PstI. These two parts were ligated, resulting in BBa_K1362051 (Intein protease with arabinose inducible regulatory promoter/ repressor araC-Pbad-T7RBS-His-SspDnaBC).<br />
<br />
<br />
===Results===<br />
Both intein protease constructs BBa_K1362050 and BBa_K1362051 were sequenced. We obtained positive results. Here you can see the sequencing results of BBa_K1362051, the longer of the constructs (and including BBa_K1362050),<br />
<br />
<br />
BBa_K1362051 <br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/8c/Heidelberg_orig_ARA1.png" target="_blank" >part1:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/23/Heidelberg_orig_ARA2.png" target="_blank" >part2:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/be/Heidelberg_orig_ARA3.png" target="_blank" >part3:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9e/Heidelberg_orig_ARA4.png" target="_blank" >part4:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/b/b6/Heidelberg_orig_ARA5.png" target="_blank" >part5:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/72/Heidelberg_orig_ARA6.png" target="_blank" >part6:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/25/Heidelberg_orig_ARA7.png" target="_blank" >part7:</a> </html><br /><br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/9/9d/Heidelberg_orig_ARA8.png" target="_blank" >part8:</a> </html><br /><br />
<br />
<html><br />
<div class="linie"></div><br />
</html><br />
<br />
===SsrA degradation tag cloning strategy===<br />
The SsrA degradation tag was ordered as DNA oligos containing the tag sequence, extein sequence and BsaI overhangs. By Golden Gate Assembly the tag was cloned into the carrier construct BBa_K1362052 (for C-terminal tags). This carrier construct consists of a pSB1C3 backbone with two BsaI sites as an insert. It was used to send the tag to the registry of standard biological parts. The user can afterwards easily use Golden Gate Assembly to clone the tag from the carrier constructs into intein assembly constructs.<br />
<br />
===Results===<br />
The part was sequenced, the results were positive. You can see the sequencing results here:<br />
<br />
<html><a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/3/3c/Heidelberg_orig_Ssra.png" target="_blank" >SsrA:</a> </html>BBa_K1362054<br />
<br />
=References=<br />
[1] McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
[2] Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
[3] Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.<br />
<br />
[7] Hauptmann, V. et al.: Native-sized spider silk proteins synthesized in planta via intein-based multimerization. Transgenic Res (2013) 22:369–377. DOI 10.1007/s11248-012-9655-6.<br />
<br />
[A] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[B] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. <br />
Natl. Acad. Sci. USA 95 (1998). <br />
<br />
[C] Lu, Wei et al.: Split intein facilitated tag affinity purification for recombinant proteins with controllable tag removal by inducible auto-cleavage. J. Chromatogr. A 1218 (2011) <br />
<br />
[D] Vila-Perello, Miquel et al.: Biological Applications of Protein Splicing. Cell 143. October 15, <br />
2010. DOI 10.1016/j.cell.2010.09.031.<br />
<br />
[E] Muir, Tom W. et al.: Expressed protein ligation: A general method for protein engineering. Proc. Natl. Acad. Sci. USA 95 (1998).<br />
<br />
(1) McGinness, KE et al.: Engineering controllable protein degradation. Molecular Cell<br />
22, 701–707, June 9, 2006. DOI 10.1016/j.molcel.2006.04.027<br />
<br />
(2) Volkmann, G. et al: Controllable protein cleavages through intein fragment complementation. Protein Sci, 18 (2009), pp. 2393–2402. DOI: 10.1002/pro.249<br />
<br />
(3) Volkmann, Gerrit et al.: Site-specific protein cleavage in vivo by an intein-derived protease. <br />
FEBS Letters 586 (2012) 79–84. doi:10.1016/j.febslet.2011.11.028.</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/PartsTeam:Heidelberg/pages/Parts2014-10-18T02:34:55Z<p>Bunnech: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
div.margin-top { margin-top: 100px; }<br />
</style><br />
<br />
<br />
<h1 id="Favorite Parts">Favorite Parts.</h1><br />
<p>The iGEM Team Heidelberg 2014 had built a new biological system for the iGEM community integrating split-inteins. <br />
Intein splicing is a natural process that excises one part of a protein and leaves the remaining parts irreversibly attached. This great function allows you to modify your protein in numerous ways.</p><br />
<p>Creating a toolbox including all great functions and possibilities of inteins, we need a new standard for the scientific world of iGEM. This standard, the RFC of the iGEM Team Heidelberg 2014, allows us to easily and modulary work with split inteins.</p><br />
<br />
<p>Our favorite Parts represent the basic constructs of our toolbox – the Assembly and the Circularization construct, which are both tested in many methods and applications. </p><br />
<p>In the following we present you <br />
<a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the construct for circularization, <br />
<a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100</a> and <br />
<a href="http://parts.igem.org/BBa_K1362101">BBa_K1362101</a>, the N- and the C-construct for assembly. Take a look and visit the Partsregistry to read the associated documentation.</p><br />
<br/><br />
<br/><br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<h4>BBa_K1362000</h4><br />
Placeholder<br />
<br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/7/7c/BBa_K1362000.png" class="img-responsive" alt="Circularization Construct"><br />
<br />
</div><br />
</div><br />
<br />
<br/><br />
<br />
<h3 id="Assembly"> Assembly Constructs. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362100</h4><br />
<p>This intein assembly construct is part of our strategy for cloning with split inteins. Inteins are naturally occuring peptide sequences that splice out of a precursor protein and attach the remaining ends together to form a new protein. When splitting those intein sequence into an N-terminal and a C-terminal split intein one is left with a powerful tool to post-translationally modify whole proteins on the amino-acid sequence level. This construct was designed to express any protein of interest fused to the Nostoc punctiforme DnaE N-terminal split intein. </p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/8/81/BBa_K1362100.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
<br />
</div><br />
<br />
<br/><br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362101</h4><br />
BBa_K1362101 is the corresponding C-terminal construct to BBa_K1362100. Upon coexpression or mixture of the N- and C-constructs protein splicing takes place and the N- and C-terminal proteins of interest are irreversibly assembled via a newly formed peptide bond.</p><p><br />
This mechanism can be applied for a variety of different uses such as the activation of a protein through reconstitution of individually expressed split halves. See our split sfGFP experiment and the respective parts in the registry for more information. Protein splicing offers many new possibilities and we hope to have set a foundation that you guys can build on!</p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/3/3f/BBa_K1362101.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
</div><br />
<br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br />
<br />
<h1 id="Sample Data Page">Sample Data Page for our favorite Parts.</h1><br />
<br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/9/9b/SampleData_Circularization.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<!-- <div class="margin-top"> --><br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
<h3> Assembly Construct. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<br />
<br />
<br/><br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/5/5c/SampleData_Assembly.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br/><br />
<br />
<h1 id="Intein Library">Intein Library.</h1><br />
<br/><br />
</html><br />
Inteins are the basic unity of our toolbox. They are integrated as extraneous polypeptide sequences into habitual proteins and do not follow the original protein function. Inteins perform an autocatalytic splicing reaction, where they excite themselves out of the host protein while reconnecting the remaining chains on both end, so called N and C exteins, via a new peptide bond. Read more about it in our [https://2014.igem.org/Team:Heidelberg/Project/Background| project background]!<br />
<br />
To characterize the different types and groups of split-inteins and inteins we collect many details about them to develop a intein library. It gives you a great and clear overview about the most important facts.<br />
<br />
{| class="table table-hover"<br />
|-<br />
!Split intein<br />
!Special features<br />
!Nint<br />
!Cint<br />
!Reaction properties<br />
!Origin<br />
!References<br />
|-<br />
| Npu DnaE||fast; robust at high temperature range and high-yielding trans-splicing activity, well characterised requirements||102||36||t1/2 = 63s , 37°C , k=~1x10^-2 (s^-1); activity range 6 to 37°C||S1 natural split intein, Nostoc punctiforme||[[#References|[1]]] [[#References|[2]]] <br />
|-<br />
| Ssp DnaX||cross-reactivity with other N-inteins, transsplicing in vivo and in vitro, high yields||||||k=~1.7x10^-4(s^-1); efficiency 96%||engineered from Synechocystis species||[[#References|[3]]] [[#References|[4]]] <br />
|-<br />
| Ssp GyrB|| very short Nint facilitates trans-splicing of synthetic peptides||6||150||k=~1x10^-4(s^-1), efficiency 40-80%||S11 split intein enginered from Synechocystis species, strain PCC6803||[[#References|[4]]] [[#References|[5]]] <br />
|-<br />
| Ter DnaE3||trans-splicing activity with high yields||102||36||k=~2x10^-4(s^-1), efficiency 87%||natural split intein, Trichodesmium erythraeum||[[#References|[4]]] [[#References|[6]]] <br />
|-<br />
| Ssp DnaB||relatively fast||||||t1/2=12min, 25°C, k=~1x10^-3(s^-1)||engineered from Synechocystis species, strain PCC6803||[[#References|[2]]] <br />
|-<br />
| Gp41-1||fastes known reaction ||88||38||t1/2=20-30s, 37°C, k=~1.8x10^-1 (s^-1); activity range 0 to 60°C||natural split intein, Cyanophage||[[#References|[7]]] [[#References|[8]]] <br />
|-<br />
|}<br />
<br />
<html><br />
<h3>References</h3><br />
<p>[1] Iwai, H., Züger, S., Jin, J. & Tam, P.-H. Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme. FEBS Lett. 580, 1853–8 (2006).</p><br />
<br />
<p>[2] Zettler, J., Schütz, V. & Mootz, H. D. The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction. FEBS Lett. 583, 909–14 (2009).</p><br />
<br />
<p>[3] Song, H., Meng, Q. & Liu, X.-Q. Protein trans-splicing of an atypical split intein showing structural flexibility and cross-reactivity. PLoS One 7, e45355 (2012).</p><br />
<br />
<p>[4] Lin, Y. et al. Protein trans-splicing of multiple atypical split inteins engineered from natural inteins. PLoS One 8, e59516 (2013).</p><br />
<br />
<p>[5] Appleby, J. H., Zhou, K., Volkmann, G. & Liu, X.-Q. Novel Split Intein for trans-Splicing Synthetic Peptide onto C Terminus of Protein. J. Biol. Chem. 284, 6194–6199 (2009).</p><br />
<br />
<p>[6] Liu, X.-Q. & Yang, J. Split dnaE genes encoding multiple novel inteins in Trichodesmium erythraeum. J. Biol. Chem. 278, 26315–8 (2003).</p><br />
<br />
<p>[7] Carvajal-Vallejos, P., Pallissé, R., Mootz, H. D. & Schmidt, S. R. Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. J. Biol. Chem. 287, 28686–96 (2012).</p><br />
<br />
<p>[8] Dassa, B., London, N., Stoddard, B. L., Schueler-Furman, O. & Pietrokovski, S. Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family. Nucleic Acids Res. 37, 2560–73 (2009).</p><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
<br />
<h1 id="Backbones">Our Backbones.</h1><br />
<p>Standard BioBrick cloning is a universal way of putting two BioBrick parts together to build a new BioBrick part. Despite several alternative cloning methods allow the assembly of multiple parts at one its simplicity and the broad availability of compatible parts keep it the 'de facto' standard of the iGEM-community.</p><br />
<p>Using standard BioBrick cloning, the generation of translationally active parts requires often more than one round of cloning. The ability to easily test the functionality of a protein before cloning them into complicated circuits has the potential to prevent many unsuccessful experiments of iGEM teams and may improve the characterization of the parts in the parts registry. However the extra amount of work required to clone such an additional construct may inhibit this behavior. We therefore improved the standard plasmids pSB1X3 and pSB4X5 by inserting a lacI repressible T7 promoter directly upstream to the BioBrick prefix of those plasmids. This promoter is completely inactive in 'E. coli' strains lacking a T7 RNA polymerase such as TOP10 or DH10beta bute inducible in strains carrying the T7 RNA polymerase under a lacI repressible promoter such as DE3 strains. This enables the use of the same backbone for cloning and over expression. Using 3A assembly a translational active part can be cloned from an RBS and a coding part in one step while maintaining the full flexibility of standard BioBrick assembly. These new RFC 10 conform backbones eliminate one cloning step needed for the expression and thus the characterization of a newly BioBricked protein. Version number 30 was claimed for the high copy variants and version number 50 for the low copy variants.</p><br />
<p>High copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091">pSB1A30</a>(Part:BBa_K1362091): High copy BioBrick cloning/expression backbone carrying Amp resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362092">pSB1C30</a>(Part:BBa_K1362092): High copy BioBrick cloning/expression backbone carrying Cm resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093">pSB1CK30</a>(Part:BBa_K1362093): High copy BioBrick cloning/expression backbone carrying Kan resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362094">pSB1CT30</a>(Part:BBa_K1362094): High copy BioBrick cloning/expression backbone carrying Tet resistance</li><br />
</ul><br />
<p>Low copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362095">pSB4A50</a>(Part:BBa_K1362095): High copy BioBrick cloning/expression backbone carrying Amp resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362096">pSB4C50</a>(Part:BBa_K1362096): High copy BioBrick cloning/expression backbone carrying Cm resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097">pSB4K50</a>(Part:BBa_K1362097): High copy BioBrick cloning/expression backbone carrying Kan resistance</li><br />
</ul><br />
<p>Because of the great experience we had using our expression vectors, we sent them to the iGEM team Aachen and Tuebingen. <a href="https://2014.igem.org/Team:Heidelberg/Team/Collaborations">We helped them</a> solving their problems with the expression of their products.</p> <br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<h1 id="allParts"><span style="font-size:170%;">List of Parts</span style="font-size:170%;"> <!-- – <span style="font-size":50%">Placeholder --></h1><br />
<div class="col-xs-12"><br />
<div id="partsTable">Loading...</div><br />
</div><br />
<br />
<br />
<script type="text/javascript"><br />
var keepParts = ['BBa_K1362000', 'BBa_K1362001', 'BBa_K1362003', 'BBa_K1362004', 'BBa_K1362005', 'BBa_K1362011', 'BBa_K1362012', 'BBa_K1362013', 'BBa_K1362020', 'BBa_K1362021', 'BBa_K1362022', 'BBa_K1362023', 'BBa_K1362050', 'BBa_K1362051', 'BBa_K1362052', 'BBa_K1362053', 'BBa_K1362054', 'BBa_K1362055', 'BBa_K1362056', 'BBa_K1362057', 'BBa_K1362058', 'BBa_K1362059', 'BBa_K1362060', 'BBa_K1362090', 'BBa_K1362091', 'BBa_K1362092', 'BBa_K1362093', 'BBa_K1362094', 'BBa_K1362095', 'BBa_K1362096', 'BBa_K1362097', 'BBa_K1362100', 'BBa_K1362101', 'BBa_K1362102', 'BBa_K1362103', 'BBa_K1362104', 'BBa_K1362105', 'BBa_K1362106', 'BBa_K1362107', 'BBa_K1362108', 'BBa_K1362109', 'BBa_K1362110', 'BBa_K1362111', 'BBa_K1362120', 'BBa_K1362121', 'BBa_K1362130', 'BBa_K1362131', 'BBa_K1362140', 'BBa_K1362141', 'BBa_K1362142', 'BBa_K1362143', 'BBa_K1362150', 'BBa_K1362151', 'BBa_K1362160', 'BBa_K1362161', 'BBa_K1362166', 'BBa_K1362167', 'BBa_K1362170', 'BBa_K1362171', 'BBa_K1362172', 'BBa_K1362173', 'BBa_K1362174', 'BBa_K1362202', 'BBa_K1362203', 'BBa_K1362204', 'BBa_K1362205', 'BBa_K1362500'];<br />
<br />
$( document ).ready(function() {<br />
jQuery("#partsTable").load("https://2014.igem.org/cgi/api/groupparts.cgi?t=iGEM014&amp;g=Heidelberg", function(){<br />
$('.pgrouptable tr td:nth-child(4) a').each(function(){<br />
var text = $(this).text();<br />
if($.inArray(text, keepParts) == -1){<br />
$(this).parent().parent().remove();<br />
}<br />
});<br />
$('.pgrouptable tr td:nth-child(7)').remove();<br />
$('.pgrouptable tr th:nth-child(7)').remove();<br />
$('.pgrouptable').removeClass('pgrouptable tablesorter').addClass('table table-hover');<br />
$('.heart13').removeClass('heart13').addClass('glyphicon glyphicon-heart');<br />
<br />
});<br />
<br />
});<br />
<br />
</script><br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/Templates/BootstrapNavTeam:Heidelberg/Templates/BootstrapNav2014-10-18T02:33:49Z<p>Bunnech: </p>
<hr />
<div>{{#tag:html|<br />
<header id="navbar" role="banner" class="navbar navbar-static-top {{{red{{{red|}}}|navbar-red}}}{{{white{{{white|}}}|navbar-white}}}"><br />
<div class="container" style="{{{header-img{{{header-img|}}}|background-image:url({{{header-img}}});background-position: bottom right; background-repeat:no-repeat; background-size: 100% auto;}}} {{{header-bg{{{header-bg|}}}|background-color:{{{header-bg}}};}}}"><br />
<div class="navbar-header"><br />
<a class="logo" href="/Team:Heidelberg" title="Home" style="padding-top: 15px; padding-left: 15px; display:inline-block;"><br />
<img src="{{{red-logo{{{red-logo|}}}|/wiki/images/4/44/Heidelberg_Logo_header_left.png}}}{{{white-logo{{{white-logo|}}}|/wiki/images/1/1d/Logo_Website_left_white.png}}}" alt="Home"> </a><br />
<!-- .btn-navbar is used as the toggle for collapsed navbar content --><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="sr-only">Toggle navigation</span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
</div><br />
<br />
<div class="navbar-collapse collapse" style="margin-bottom:10px;"><br />
<nav role="navigation"><br />
<ul class="menu nav navbar-nav navbar-right"><br />
<li class="dropdown"><a href="/Team:Heidelberg/Team" class="dropdown-toggle" ><img src="{{{red{{{red|}}}|/wiki/images/d/d3/Team_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/a/aa/Team_icon.png}}}" alt="Team icon">Team</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Team/Members">Members</a></li><br />
<li><a href="/Team:Heidelberg/Team/Collaborations">Collaborations</a></li><br />
<li><a href="/Team:Heidelberg/Team/Attributions">Attributions</a></li><br />
<li><a href="/Team:Heidelberg/Team/Sponsoring">Sponsoring</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Project" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3f/Science_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/da/Science_icon.png}}}" alt="Science icon">Project</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Project">Overview</a></li><br />
<li><a href="/Team:Heidelberg/Project/Background">Background</a></li><br />
<li><a href="/Team:Heidelberg/Project/Toolbox">Toolbox</a></li><br />
<li><a href="/Team:Heidelberg/Toolbox/Circularization">Toolbox: Circularization</a></li><br />
<li><a href="/Team:Heidelberg/Project/PCR_2.0">PCR 2.0</a></li><br />
<li><a href="/Team:Heidelberg/Project/Xylanase">Industrial Application</a></li><br />
<li><a href="/Team:Heidelberg/Project/Linker_Screening">Linker Screening</a></li><br />
<li><a href="/Team:Heidelberg/Project/Reconstitution">Fluorescence Assembly</a></li><br />
<li><a href="/Team:Heidelberg/Project/LOV">Light-Induction</a></li><br />
<li><a href="/Team:Heidelberg/Project#Achievements">Achievements</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><a href="/Team:Heidelberg/Parts" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/1d/Parts_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/9/9c/Parts_icon.png}}}" alt="Parts icon">Parts</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Parts/RFC">RFC Heidelberg 2014</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">Favorite Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Sample Data Page">Sample Data Page</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Biobricks">Biobricks</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones">Backbones</a></li><br />
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts#Intein Library">Intein Library</a></li><br />
<li><a href="/Team:Heidelberg/Parts/Part_Improvement">Part Improvement</a></li><br />
</ul><br />
</li><br />
<li class="dropdown"><br />
<a href="/Team:Heidelberg/Software" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/18/Software_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/1/11/Software_icon.png}}}" alt="Software icon">Software</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Software/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Software/Linker_Software">Linker Software</a></li><br />
<li><a href="/Team:Heidelberg/Software/MidnightDoc">MidnightDoc</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Modeling" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/1/13/Modeling_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/d/d8/Modeling_icon.png}}}" alt="Modeling icon">Modeling</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Modeling/Linker_Modeling">Linker Modeling</a></li><br />
<li><a href="/Team:Heidelberg/Modeling/Enzyme_Modeling">Enzyme Kinetics Modeling</a></li><br />
<!--<li><a href="#">Modeling Application</a></li>--><br />
</ul><br />
</li><br />
<li><a href="/Team:Heidelberg/Toolbox_Guide" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/32/Toolbox_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/0/08/Toolbox_icon.png}}}" alt="Toolbox icon">Toolbox Guide</a></li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Human_Practice" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/3/3d/Humanpractice_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/Humanpractice_icon.png}}}" alt="Human Practice icon">Human Practice</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Ethics">Religion & Synthetic Biology</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Education">Education</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Public_Relations">Public Relations</a></li><br />
<li><a href="/Team:Heidelberg/Human_Practice/Experts">Experts</a></li><br />
</ul><br />
</li><br />
<li class="dropdown" ><a href="/Team:Heidelberg/Notebook" class="dropdown-toggle"><img src="{{{red{{{red|}}}|/wiki/images/0/03/MD_icon_red.png}}}{{{white{{{white|}}}|/wiki/images/e/e9/MD_icon.png}}}" alt="Our Laboratory Notebook icon">Notebook</a><br />
<ul class="dropdown-menu centerDropdown" role="menu"><br />
<li><a href="/Team:Heidelberg/Notebook">Notebook</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Materials">Materials</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Methods">Methods</a></li><br />
<li><a href="/Team:Heidelberg/Notebook/Safety">Safety</a></li><br />
</ul><br />
</li><br />
<li id="logo" ><a href="/" title="Home"><br />
<img src="{{{red{{{red|}}}|/wiki/images/7/79/IGEM_logo_red.png}}}{{{white{{{white|}}}|/wiki/images/5/5d/IGEM_logo_white.png}}}" alt="Home"><br />
</a></li><br />
</ul><br />
</nav><br />
</div><br />
{{{title{{{title|}}}|<br />
<div class="col-lg-12"><br />
<div class="title-wrapper"><br />
<span class="title">{{{title}}}</span><br />
<span class="special-span"></span><br />
</div><br />
</div><br />
}}}<br />
</div><br />
</header><br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/Parts/RFCTeam:Heidelberg/Parts/RFC2014-10-18T02:31:38Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/templates/wikipage_new|<br />
title=BBF RFC[i]<br />
|<br />
white=true<br />
|<br />
red-logo=true<br />
|<br />
header-img=<br />
|<br />
header=background-color:#DE4230<br />
|<br />
header-bg=black<br />
|<br />
subtitle= making inteins easy to use<br />
|<br />
container-style=background-color:white;<br />
|<br />
titles=<br />
|<br />
abstract=Here we introduce a new and standardized way for applying all the methods and applications of the intein world to the iGEM community.<br />
|<br />
content=<br />
<div class="col-lg-12"><br />
<html><br />
<object data="/wiki/images/6/69/Team_Heidelberg_RFC_draft.pdf" type="application/pdf" width="100%" height="875"><br />
<br />
<p>It appears you don't have a PDF plugin for this browser.<br />
No biggie... you can <a href="/wiki/images/6/69/Team_Heidelberg_RFC_draft.pdf">click here to<br />
download the PDF file.</a></p><br />
<br />
</object><br />
</html><br />
</div><br />
|<br />
white-logo=<br />
|<br />
red=<br />
}}<br />
<br />
{{:Team:Heidelberg/templates/mathjax}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/PartsTeam:Heidelberg/pages/Parts2014-10-18T02:15:42Z<p>Bunnech: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
div.margin-top { margin-top: 100px; }<br />
</style><br />
<br />
<br />
<h1 id="Favorite Parts">Favorite Parts.</h1><br />
<p>The iGEM Team Heidelberg 2014 had built a new biological system for the iGEM community integrating split-inteins. <br />
Intein splicing is a natural process that excises one part of a protein and leaves the remaining parts irreversibly attached. This great function allows you to modify your protein in numerous ways.</p><br />
<p>Creating a toolbox including all great functions and possibilities of inteins, we need a new standard for the scientific world of iGEM. This standard, the RFC of the iGEM Team Heidelberg 2014, allows us to easily and modulary work with split inteins.</p><br />
<br />
<p>Our favorite Parts represent the basic constructs of our toolbox – the Assembly and the Circularization construct, which are both tested in many methods and applications. </p><br />
<p>In the following we present you <br />
<a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the construct for circularization, <br />
<a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100</a> and <br />
<a href="http://parts.igem.org/BBa_K1362101">BBa_K1362101</a>, the N- and the C-construct for assembly. Take a look and visit the Partsregistry to read the associated documentation.</p><br />
<br/><br />
<br/><br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<h4>BBa_K1362000</h4><br />
Placeholder<br />
<br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/7/7c/BBa_K1362000.png" class="img-responsive" alt="Circularization Construct"><br />
<br />
</div><br />
</div><br />
<br />
<br/><br />
<br />
<h3> Assembly Constructs. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362100</h4><br />
<p>This intein assembly construct is part of our strategy for cloning with split inteins. Inteins are naturally occuring peptide sequences that splice out of a precursor protein and attach the remaining ends together to form a new protein. When splitting those intein sequence into an N-terminal and a C-terminal split intein one is left with a powerful tool to post-translationally modify whole proteins on the amino-acid sequence level. This construct was designed to express any protein of interest fused to the Nostoc punctiforme DnaE N-terminal split intein. </p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/8/81/BBa_K1362100.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
<br />
</div><br />
<br />
<br/><br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362101</h4><br />
BBa_K1362101 is the corresponding C-terminal construct to BBa_K1362100. Upon coexpression or mixture of the N- and C-constructs protein splicing takes place and the N- and C-terminal proteins of interest are irreversibly assembled via a newly formed peptide bond.</p><p><br />
This mechanism can be applied for a variety of different uses such as the activation of a protein through reconstitution of individually expressed split halves. See our split sfGFP experiment and the respective parts in the registry for more information. Protein splicing offers many new possibilities and we hope to have set a foundation that you guys can build on!</p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/3/3f/BBa_K1362101.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
</div><br />
<br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br />
<br />
<h1 id="Sample Data Page">Sample Data Page for our favorite Parts.</h1><br />
<br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/9/9b/SampleData_Circularization.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<!-- <div class="margin-top"> --><br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
<h3> Assembly Construct. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<br />
<br />
<br/><br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/5/5c/SampleData_Assembly.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br/><br />
<br />
<h1 id="Intein Library">Intein Library.</h1><br />
<br/><br />
</html><br />
Inteins are the basic unity of our toolbox. They are integrated as extraneous polypeptide sequences into habitual proteins and do not follow the original protein function. Inteins perform an autocatalytic splicing reaction, where they excite themselves out of the host protein while reconnecting the remaining chains on both end, so called N and C exteins, via a new peptide bond. Read more about it in our [https://2014.igem.org/Team:Heidelberg/Project/Background| project background]!<br />
<br />
To characterize the different types and groups of split-inteins and inteins we collect many details about them to develop a intein library. It gives you a great and clear overview about the most important facts.<br />
<br />
{| class="table table-hover"<br />
|-<br />
!Split intein<br />
!Special features<br />
!Nint<br />
!Cint<br />
!Reaction properties<br />
!Origin<br />
!References<br />
|-<br />
| Npu DnaE||fast; robust at high temperature range and high-yielding trans-splicing activity, well characterised requirements||102||36||t1/2 = 63s , 37°C , k=~1x10^-2 (s^-1); activity range 6 to 37°C||S1 natural split intein, Nostoc punctiforme||[[#References|[1]]] [[#References|[2]]] <br />
|-<br />
| Ssp DnaX||cross-reactivity with other N-inteins, transsplicing in vivo and in vitro, high yields||||||k=~1.7x10^-4(s^-1); efficiency 96%||engineered from Synechocystis species||[[#References|[3]]] [[#References|[4]]] <br />
|-<br />
| Ssp GyrB|| very short Nint facilitates trans-splicing of synthetic peptides||6||150||k=~1x10^-4(s^-1), efficiency 40-80%||S11 split intein enginered from Synechocystis species, strain PCC6803||[[#References|[4]]] [[#References|[5]]] <br />
|-<br />
| Ter DnaE3||trans-splicing activity with high yields||102||36||k=~2x10^-4(s^-1), efficiency 87%||natural split intein, Trichodesmium erythraeum||[[#References|[4]]] [[#References|[6]]] <br />
|-<br />
| Ssp DnaB||relatively fast||||||t1/2=12min, 25°C, k=~1x10^-3(s^-1)||engineered from Synechocystis species, strain PCC6803||[[#References|[2]]] <br />
|-<br />
| Gp41-1||fastes known reaction ||88||38||t1/2=20-30s, 37°C, k=~1.8x10^-1 (s^-1); activity range 0 to 60°C||natural split intein, Cyanophage||[[#References|[7]]] [[#References|[8]]] <br />
|-<br />
|}<br />
<br />
<html><br />
<h3>References</h3><br />
<p>[1] Iwai, H., Züger, S., Jin, J. & Tam, P.-H. Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme. FEBS Lett. 580, 1853–8 (2006).</p><br />
<br />
<p>[2] Zettler, J., Schütz, V. & Mootz, H. D. The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction. FEBS Lett. 583, 909–14 (2009).</p><br />
<br />
<p>[3] Song, H., Meng, Q. & Liu, X.-Q. Protein trans-splicing of an atypical split intein showing structural flexibility and cross-reactivity. PLoS One 7, e45355 (2012).</p><br />
<br />
<p>[4] Lin, Y. et al. Protein trans-splicing of multiple atypical split inteins engineered from natural inteins. PLoS One 8, e59516 (2013).</p><br />
<br />
<p>[5] Appleby, J. H., Zhou, K., Volkmann, G. & Liu, X.-Q. Novel Split Intein for trans-Splicing Synthetic Peptide onto C Terminus of Protein. J. Biol. Chem. 284, 6194–6199 (2009).</p><br />
<br />
<p>[6] Liu, X.-Q. & Yang, J. Split dnaE genes encoding multiple novel inteins in Trichodesmium erythraeum. J. Biol. Chem. 278, 26315–8 (2003).</p><br />
<br />
<p>[7] Carvajal-Vallejos, P., Pallissé, R., Mootz, H. D. & Schmidt, S. R. Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. J. Biol. Chem. 287, 28686–96 (2012).</p><br />
<br />
<p>[8] Dassa, B., London, N., Stoddard, B. L., Schueler-Furman, O. & Pietrokovski, S. Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family. Nucleic Acids Res. 37, 2560–73 (2009).</p><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
<br />
<h1 id="Backbones">Our Backbones.</h1><br />
<p>Standard BioBrick cloning is a universal way of putting two BioBrick parts together to build a new BioBrick part. Despite several alternative cloning methods allow the assembly of multiple parts at one its simplicity and the broad availability of compatible parts keep it the 'de facto' standard of the iGEM-community.</p><br />
<p>Using standard BioBrick cloning, the generation of translationally active parts requires often more than one round of cloning. The ability to easily test the functionality of a protein before cloning them into complicated circuits has the potential to prevent many unsuccessful experiments of iGEM teams and may improve the characterization of the parts in the parts registry. However the extra amount of work required to clone such an additional construct may inhibit this behavior. We therefore improved the standard plasmids pSB1X3 and pSB4X5 by inserting a lacI repressible T7 promoter directly upstream to the BioBrick prefix of those plasmids. This promoter is completely inactive in 'E. coli' strains lacking a T7 RNA polymerase such as TOP10 or DH10beta bute inducible in strains carrying the T7 RNA polymerase under a lacI repressible promoter such as DE3 strains. This enables the use of the same backbone for cloning and over expression. Using 3A assembly a translational active part can be cloned from an RBS and a coding part in one step while maintaining the full flexibility of standard BioBrick assembly. These new RFC 10 conform backbones eliminate one cloning step needed for the expression and thus the characterization of a newly BioBricked protein. Version number 30 was claimed for the high copy variants and version number 50 for the low copy variants.</p><br />
<p>High copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091">pSB1A30</a>(Part:BBa_K1362091): High copy BioBrick cloning/expression backbone carrying Amp resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362092">pSB1C30</a>(Part:BBa_K1362092): High copy BioBrick cloning/expression backbone carrying Cm resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093">pSB1CK30</a>(Part:BBa_K1362093): High copy BioBrick cloning/expression backbone carrying Kan resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362094">pSB1CT30</a>(Part:BBa_K1362094): High copy BioBrick cloning/expression backbone carrying Tet resistance</li><br />
</ul><br />
<p>Low copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362095">pSB4A50</a>(Part:BBa_K1362095): High copy BioBrick cloning/expression backbone carrying Amp resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362096">pSB4C50</a>(Part:BBa_K1362096): High copy BioBrick cloning/expression backbone carrying Cm resistance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097">pSB4K50</a>(Part:BBa_K1362097): High copy BioBrick cloning/expression backbone carrying Kan resistance</li><br />
</ul><br />
<p>Because of the great experience we had using our expression vectors, we sent them to the iGEM team Aachen and Tuebingen. <a href="https://2014.igem.org/Team:Heidelberg/Team/Collaborations">We helped them</a> solving their problems with the expression of their products.</p> <br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<h1 id="allParts"><span style="font-size:170%;">List of Parts</span style="font-size:170%;"> <!-- – <span style="font-size":50%">Placeholder --></h1><br />
<div class="col-xs-12"><br />
<div id="partsTable">Loading...</div><br />
</div><br />
<br />
<br />
<script type="text/javascript"><br />
var keepParts = ['BBa_K1362000', 'BBa_K1362001', 'BBa_K1362003', 'BBa_K1362004', 'BBa_K1362005', 'BBa_K1362011', 'BBa_K1362012', 'BBa_K1362013', 'BBa_K1362020', 'BBa_K1362021', 'BBa_K1362022', 'BBa_K1362023', 'BBa_K1362050', 'BBa_K1362051', 'BBa_K1362052', 'BBa_K1362053', 'BBa_K1362054', 'BBa_K1362055', 'BBa_K1362056', 'BBa_K1362057', 'BBa_K1362058', 'BBa_K1362059', 'BBa_K1362060', 'BBa_K1362090', 'BBa_K1362091', 'BBa_K1362092', 'BBa_K1362093', 'BBa_K1362094', 'BBa_K1362095', 'BBa_K1362096', 'BBa_K1362097', 'BBa_K1362100', 'BBa_K1362101', 'BBa_K1362102', 'BBa_K1362103', 'BBa_K1362104', 'BBa_K1362105', 'BBa_K1362106', 'BBa_K1362107', 'BBa_K1362108', 'BBa_K1362109', 'BBa_K1362110', 'BBa_K1362111', 'BBa_K1362120', 'BBa_K1362121', 'BBa_K1362130', 'BBa_K1362131', 'BBa_K1362140', 'BBa_K1362141', 'BBa_K1362142', 'BBa_K1362143', 'BBa_K1362150', 'BBa_K1362151', 'BBa_K1362160', 'BBa_K1362161', 'BBa_K1362166', 'BBa_K1362167', 'BBa_K1362170', 'BBa_K1362171', 'BBa_K1362172', 'BBa_K1362173', 'BBa_K1362174', 'BBa_K1362202', 'BBa_K1362203', 'BBa_K1362204', 'BBa_K1362205', 'BBa_K1362500'];<br />
<br />
$( document ).ready(function() {<br />
jQuery("#partsTable").load("https://2014.igem.org/cgi/api/groupparts.cgi?t=iGEM014&amp;g=Heidelberg", function(){<br />
$('.pgrouptable tr td:nth-child(4) a').each(function(){<br />
var text = $(this).text();<br />
if($.inArray(text, keepParts) == -1){<br />
$(this).parent().parent().remove();<br />
}<br />
});<br />
$('.pgrouptable tr td:nth-child(7)').remove();<br />
$('.pgrouptable tr th:nth-child(7)').remove();<br />
$('.pgrouptable').removeClass('pgrouptable tablesorter').addClass('table table-hover');<br />
$('.heart13').removeClass('heart13').addClass('glyphicon glyphicon-heart');<br />
<br />
});<br />
<br />
});<br />
<br />
</script><br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/PartsTeam:Heidelberg/pages/Parts2014-10-18T01:59:42Z<p>Bunnech: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
div.margin-top { margin-top: 100px; }<br />
</style><br />
<br />
<br />
<h1 id="Favorite Parts">Favorite Parts.</h1><br />
<p>The iGEM Team Heidelberg 2014 had built a new biological system for the iGEM community integrating split-inteins. <br />
Intein splicing is a natural process that excises one part of a protein and leaves the remaining parts irreversibly attached. This great function allows you to modify your protein in numerous ways.</p><br />
<p>Creating a toolbox including all great functions and possibilities of inteins, we need a new standard for the scientific world of iGEM. This standard, the RFC of the iGEM Team Heidelberg 2014, allows us to easily and modulary work with split inteins.</p><br />
<br />
<p>Our favorite Parts represent the basic constructs of our toolbox – the Assembly and the Circularization construct, which are both tested in many methods and applications. </p><br />
<p>In the following we present you <br />
<a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the construct for circularization, <br />
<a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100</a> and <br />
<a href="http://parts.igem.org/BBa_K1362101">BBa_K1362101</a>, the N- and the C-construct for assembly. Take a look and visit the Partsregistry to read the associated documentation.</p><br />
<br/><br />
<br/><br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<h4>BBa_K1362000</h4><br />
Placeholder<br />
<br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/7/7c/BBa_K1362000.png" class="img-responsive" alt="Circularization Construct"><br />
<br />
</div><br />
</div><br />
<br />
<br/><br />
<br />
<h3> Assembly Constructs. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362100</h4><br />
<p>This intein assembly construct is part of our strategy for cloning with split inteins. Inteins are naturally occuring peptide sequences that splice out of a precursor protein and attach the remaining ends together to form a new protein. When splitting those intein sequence into an N-terminal and a C-terminal split intein one is left with a powerful tool to post-translationally modify whole proteins on the amino-acid sequence level. This construct was designed to express any protein of interest fused to the Nostoc punctiforme DnaE N-terminal split intein. </p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/8/81/BBa_K1362100.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
<br />
</div><br />
<br />
<br/><br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362101</h4><br />
BBa_K1362101 is the corresponding C-terminal construct to BBa_K1362100. Upon coexpression or mixture of the N- and C-constructs protein splicing takes place and the N- and C-terminal proteins of interest are irreversibly assembled via a newly formed peptide bond.</p><p><br />
This mechanism can be applied for a variety of different uses such as the activation of a protein through reconstitution of individually expressed split halves. See our split sfGFP experiment and the respective parts in the registry for more information. Protein splicing offers many new possibilities and we hope to have set a foundation that you guys can build on!</p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/3/3f/BBa_K1362101.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
</div><br />
<br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br />
<br />
<h1 id="Sample Data Page">Sample Data Page for our favorite Parts.</h1><br />
<br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/9/9b/SampleData_Circularization.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<!-- <div class="margin-top"> --><br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
<h3> Assembly Construct. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<br />
<br />
<br/><br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/5/5c/SampleData_Assembly.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br/><br />
<br />
<h1 id="Intein Library">Intein Library.</h1><br />
<br/><br />
</html><br />
Inteins are the basic unity of our toolbox. They are integrated as extraneous polypeptide sequences into habitual proteins and do not follow the original protein function. Inteins perform an autocatalytic splicing reaction, where they excite themselves out of the host protein while reconnecting the remaining chains on both end, so called N and C exteins, via a new peptide bond. Read more about it in our [https://2014.igem.org/Team:Heidelberg/Project/Background| project background]!<br />
<br />
To characterize the different types and groups of split-inteins and inteins we collect many details about them to develop a intein library. It gives you a great and clear overview about the most important facts.<br />
<br />
{| class="table table-hover"<br />
|-<br />
!Split intein<br />
!Special features<br />
!Nint<br />
!Cint<br />
!Reaction properties<br />
!Origin<br />
!References<br />
|-<br />
| Npu DnaE||fast; robust at high temperature range and high-yielding trans-splicing activity, well characterised requirements||102||36||t1/2 = 63s , 37°C , k=~1x10^-2 (s^-1); activity range 6 to 37°C||S1 natural split intein, Nostoc punctiforme||[[#References|[1]]] [[#References|[2]]] <br />
|-<br />
| Ssp DnaX||cross-reactivity with other N-inteins, transsplicing in vivo and in vitro, high yields||||||k=~1.7x10^-4(s^-1); efficiency 96%||engineered from Synechocystis species||[[#References|[3]]] [[#References|[4]]] <br />
|-<br />
| Ssp GyrB|| very short Nint facilitates trans-splicing of synthetic peptides||6||150||k=~1x10^-4(s^-1), efficiency 40-80%||S11 split intein enginered from Synechocystis species, strain PCC6803||[[#References|[4]]] [[#References|[5]]] <br />
|-<br />
| Ter DnaE3||trans-splicing activity with high yields||102||36||k=~2x10^-4(s^-1), efficiency 87%||natural split intein, Trichodesmium erythraeum||[[#References|[4]]] [[#References|[6]]] <br />
|-<br />
| Ssp DnaB||relatively fast||||||t1/2=12min, 25°C, k=~1x10^-3(s^-1)||engineered from Synechocystis species, strain PCC6803||[[#References|[2]]] <br />
|-<br />
| Gp41-1||fastes known reaction ||88||38||t1/2=20-30s, 37°C, k=~1.8x10^-1 (s^-1); activity range 0 to 60°C||natural split intein, Cyanophage||[[#References|[7]]] [[#References|[8]]] <br />
|-<br />
|}<br />
<br />
<html><br />
<h3>References</h3><br />
<p>[1] Iwai, H., Züger, S., Jin, J. & Tam, P.-H. Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme. FEBS Lett. 580, 1853–8 (2006).</p><br />
<br />
<p>[2] Zettler, J., Schütz, V. & Mootz, H. D. The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction. FEBS Lett. 583, 909–14 (2009).</p><br />
<br />
<p>[3] Song, H., Meng, Q. & Liu, X.-Q. Protein trans-splicing of an atypical split intein showing structural flexibility and cross-reactivity. PLoS One 7, e45355 (2012).</p><br />
<br />
<p>[4] Lin, Y. et al. Protein trans-splicing of multiple atypical split inteins engineered from natural inteins. PLoS One 8, e59516 (2013).</p><br />
<br />
<p>[5] Appleby, J. H., Zhou, K., Volkmann, G. & Liu, X.-Q. Novel Split Intein for trans-Splicing Synthetic Peptide onto C Terminus of Protein. J. Biol. Chem. 284, 6194–6199 (2009).</p><br />
<br />
<p>[6] Liu, X.-Q. & Yang, J. Split dnaE genes encoding multiple novel inteins in Trichodesmium erythraeum. J. Biol. Chem. 278, 26315–8 (2003).</p><br />
<br />
<p>[7] Carvajal-Vallejos, P., Pallissé, R., Mootz, H. D. & Schmidt, S. R. Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. J. Biol. Chem. 287, 28686–96 (2012).</p><br />
<br />
<p>[8] Dassa, B., London, N., Stoddard, B. L., Schueler-Furman, O. & Pietrokovski, S. Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family. Nucleic Acids Res. 37, 2560–73 (2009).</p><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
<br />
<h1 id="Backbones">Our Backbones.</h1><br />
<p>Standard BioBrick cloning is a universal way of putting two BioBrick parts together to build a new BioBrick part. Despite several alternative cloning methods allow the assembly of multiple parts at one its simplicity and the broad availability of compatible parts keep it the 'de facto' standard of the iGEM-community.</p><br />
<p>Using standard BioBrick cloning, the generation of translationally active parts requires often more than one round of cloning. The ability to easily test the functionality of a protein before cloning them into complicated circuits has the potential to prevent many unsuccessful experiments of iGEM teams and may improve the characterization of the parts in the parts registry. However the extra amount of work required to clone such an additional construct may inhibit this behavior. We therefore improved the standard plasmids pSB1X3 and pSB4X5 by inserting a lacI repressible T7 promoter directly upstream to the BioBrick prefix of those plasmids. This promoter is completely inactive in 'E. coli' strains lacking a T7 RNA polymerase such as TOP10 or DH10beta bute inducible in strains carrying the T7 RNA polymerase under a lacI repressible promoter such as DE3 strains. This enables the use of the same backbone for cloning and over expression. Using 3A assembly a translational active part can be cloned from an RBS and a coding part in one step while maintaining the full flexibility of standard BioBrick assembly. These new RFC 10 conform backbones eliminate one cloning step needed for the expression and thus the characterization of a newly BioBricked protein. Version number 30 was claimed for the high copy variants and version number 50 for the low copy variants.</p><br />
<p>High copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091">pSB1A30</a>(Part:BBa_K1362091): High copy BioBrick cloning/expression backbone carrying Amp resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362092">pSB1C30</a>(Part:BBa_K1362092): High copy BioBrick cloning/expression backbone carrying Cm resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093">pSB1CK30</a>(Part:BBa_K1362093): High copy BioBrick cloning/expression backbone carrying Kan resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362094">pSB1CT30</a>(Part:BBa_K1362094): High copy BioBrick cloning/expression backbone carrying Tet resitance</li><br />
</ul><br />
<p>Low copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362095">pSB4A50</a>(Part:BBa_K1362095): High copy BioBrick cloning/expression backbone carrying Amp resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362096">pSB4C50</a>(Part:BBa_K1362096): High copy BioBrick cloning/expression backbone carrying Cm resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097">pSB4K50</a>(Part:BBa_K1362097): High copy BioBrick cloning/expression backbone carrying Kan resitance</li><br />
</ul><br />
<br />
<br/><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<h1 id="allParts"><span style="font-size:170%;">List of Parts</span style="font-size:170%;"> <!-- – <span style="font-size":50%">Placeholder --></h1><br />
<div class="col-xs-12"><br />
<div id="partsTable">Loading...</div><br />
</div><br />
<br />
<br />
<script type="text/javascript"><br />
var keepParts = ['BBa_K1362000', 'BBa_K1362001', 'BBa_K1362003', 'BBa_K1362004', 'BBa_K1362005', 'BBa_K1362011', 'BBa_K1362012', 'BBa_K1362013', 'BBa_K1362020', 'BBa_K1362021', 'BBa_K1362022', 'BBa_K1362023', 'BBa_K1362050', 'BBa_K1362051', 'BBa_K1362052', 'BBa_K1362053', 'BBa_K1362054', 'BBa_K1362055', 'BBa_K1362056', 'BBa_K1362057', 'BBa_K1362058', 'BBa_K1362059', 'BBa_K1362060', 'BBa_K1362090', 'BBa_K1362091', 'BBa_K1362092', 'BBa_K1362093', 'BBa_K1362094', 'BBa_K1362095', 'BBa_K1362096', 'BBa_K1362097', 'BBa_K1362100', 'BBa_K1362101', 'BBa_K1362102', 'BBa_K1362103', 'BBa_K1362104', 'BBa_K1362105', 'BBa_K1362106', 'BBa_K1362107', 'BBa_K1362108', 'BBa_K1362109', 'BBa_K1362110', 'BBa_K1362111', 'BBa_K1362120', 'BBa_K1362121', 'BBa_K1362130', 'BBa_K1362131', 'BBa_K1362140', 'BBa_K1362141', 'BBa_K1362142', 'BBa_K1362143', 'BBa_K1362150', 'BBa_K1362151', 'BBa_K1362160', 'BBa_K1362161', 'BBa_K1362166', 'BBa_K1362167', 'BBa_K1362170', 'BBa_K1362171', 'BBa_K1362172', 'BBa_K1362173', 'BBa_K1362174', 'BBa_K1362202', 'BBa_K1362203', 'BBa_K1362204', 'BBa_K1362205', 'BBa_K1362500'];<br />
<br />
$( document ).ready(function() {<br />
jQuery("#partsTable").load("https://2014.igem.org/cgi/api/groupparts.cgi?t=iGEM014&amp;g=Heidelberg", function(){<br />
$('.pgrouptable tr td:nth-child(4) a').each(function(){<br />
var text = $(this).text();<br />
if($.inArray(text, keepParts) == -1){<br />
$(this).parent().parent().remove();<br />
}<br />
});<br />
$('.pgrouptable tr td:nth-child(7)').remove();<br />
$('.pgrouptable tr th:nth-child(7)').remove();<br />
$('.pgrouptable').removeClass('pgrouptable tablesorter').addClass('table table-hover');<br />
$('.heart13').removeClass('heart13').addClass('glyphicon glyphicon-heart');<br />
<br />
});<br />
<br />
});<br />
<br />
</script><br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2014-10-18T01:57:43Z<p>Bunnech: Undo revision 385449 by Bunnech (talk)</p>
<hr />
<div>{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/boxes}}<br />
<html><style type="text/css"><br />
.subtitle h2 {<br />
color: white;<br />
padding-left: 15px;<br />
}<br />
</style></html><br />
{{:Team:Heidelberg/templates/wikipage_new|<br />
|<br />
container-style=background-color: black; background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg); background-repeat: no-repeat; background-size: 100% auto;<br />
|<br />
title=PARTS<br />
|<br />
white=true<br />
|<br />
red-logo=true<br />
|<br />
subtitle=Discover our workpieces and standards<br />
|<br />
abstract=<br />
|<br />
content=<br />
<html><br />
<div class="col-lg-3 col-md-2 hidden-sm hidden-xs" style="text-align: center;"><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/Heidelberg_Parts_bg.png" class="img-responsive" /><br />
</div><br />
<div class="col-lg-9 col-md-10 col-sm-12 col-xs-12"><br />
<div class="col-lg-12" style="margin: -15px; margin-bottom:15px;"><br />
<div class="boxes-table"><br />
<div class="cell" style="width:60%;"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC" class="box" style="margin-bottom:15px; display:block;"><br />
<h3>New <span>RFC</span> iGEM_HD14</h3><br />
To use inteins as easy and standarized tools to modify proteins after translation we developed a new RFC for the iGEM community. Take a closer look on our new intein standard!<br />
</a><br />
<a href="#Intein Library" class="box" style="display:block;"><br />
<h3>The <span>Intein</span> Library</h3><br />
Protein splicing by inteins is a natural process in which the catalytically active polypeptide termed intein excises itself from a precursor protein leaving the flanking chains reconnected. Deployed in our system inteins are modular instruments for several protein modifications. In our intein library you can find a list of all inteins we used, popular and really fast ones.<br />
</a><br />
</div><br />
<div class="cell" style="width:60%;"><br />
<br />
<a href="#Favorite Parts" class="box" style="display:block; position:relative; margin-bottom:15px;"><br />
<h3>Our <span>favorite</span> Parts</h3><br />
The intein toolbox built by the iGEM Team Heidelberg includes three basic mechanisms. With our favorite parts we want to introduce you to the constructs enabling these priciples! <br />
<img src="/wiki/images/9/9b/Heidelberg_Favoriteparts_star.png" class="star" alt="Favorite Parts Image" /> <br />
</a><br />
<br />
<a href="#Sample Data Page" class="box" style="display:block;"><br />
<h3>Sample <span>Data</span> Page</h3><br />
Take a look at our favorite Parts for circularization, fusion or tagging and see how our system works in the living cell. For that visit our Sample Data Page. <br />
</a><br />
</div><br />
</div><br />
<div class="boxes-table"><br />
<a href="#allParts" class="box cell" style="width: 55%;"><br />
<h3>Our <span>BioBricks</span></h3><br />
Creating a new standard and basic constructs of our toolbox, we sent in 67 new Parts for the Registry of Biological parts! Next to parts for intein-splicing we built sortase constructs to modify proteins post-translationally, too. Here you can find a List of all Parts!</a><br />
<a href="#Backbones" class="box cell" ><br />
<h3>Our <span>Backbones</span></h3><br />
Creating a new series of Backbones including a T7 promoter with a lac operon, expressing our constructs and sharing them with other iGEM teams, you have to take a closer look on BBa_K1362091-97! Read more about it under Collaborations.<br />
</a><br />
</div><br />
<div class="boxes-table"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Parts/Part_Improvement" class="box cell" style="padding-right:100px;position:relative;" ><br />
<h3><span>Improving</span> an existing Part</h3><br />
Standardization and building up on existing parts are the fundaments of iGEM. We improved a Xylanase (wood degrading enzyme) by improving its sequence for the expression in <i>E. coli</i> and further characterized its function in respect to heat stability. <br />
<img class="small-igem-logo" src="/wiki/images/7/79/IGEM_logo_red.png" alt="igem-icon" /><br />
</a><br />
</div><br />
</div><br />
</div><br />
</div></div><!-- close container div of template --><br />
<div class="container" style="background-color:white;margin-top:75px;"><br />
<div class="col-lg-12"><br />
<!-- für meine allerliebste Charlotte <3 --><br />
</html><br />
{{:Team:Heidelberg/pages/Parts}}<br />
<html><br />
</div><br />
</div><br />
</html><br />
|<br />
header-img=<br />
|<br />
header-bg=<br />
|<br />
red=<br />
|<br />
titles=<br />
|<br />
white-logo=<br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/PartsTeam:Heidelberg/pages/Parts2014-10-18T01:57:11Z<p>Bunnech: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
div.margin-top { margin-top: 100px; }<br />
</style><br />
<br />
<br />
<h1 id="Favorite Parts">Favorite Parts.</h1><br />
<p>The iGEM Team Heidelberg 2014 had built a new biological system for the iGEM community integrating split-inteins. <br />
Intein splicing is a natural process that excises one part of a protein and leaves the remaining parts irreversibly attached. This great function allows you to modify your protein in numerous ways.</p><br />
<p>Creating a toolbox including all great functions and possibilities of inteins, we need a new standard for the scientific world of iGEM. This standard, the RFC of the iGEM Team Heidelberg 2014, allows us to easily and modulary work with split inteins.</p><br />
<br />
<p>Our favorite Parts represent the basic constructs of our toolbox – the Assembly and the Circularization construct, which are both tested in many methods and applications. </p><br />
<p>In the following we present you <br />
<a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the construct for circularization, <br />
<a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100</a> and <br />
<a href="http://parts.igem.org/BBa_K1362101">BBa_K1362101</a>, the N- and the C-construct for assembly. Take a look and visit the Partsregistry to read the associated documentation.</p><br />
<br/><br />
<br/><br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<h4>BBa_K1362000</h4><br />
Placeholder<br />
<br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/7/7c/BBa_K1362000.png" class="img-responsive" alt="Circularization Construct"><br />
<br />
</div><br />
</div><br />
<br />
<br/><br />
<br />
<h3> Assembly Constructs. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362100</h4><br />
<p>This intein assembly construct is part of our strategy for cloning with split inteins. Inteins are naturally occuring peptide sequences that splice out of a precursor protein and attach the remaining ends together to form a new protein. When splitting those intein sequence into an N-terminal and a C-terminal split intein one is left with a powerful tool to post-translationally modify whole proteins on the amino-acid sequence level. This construct was designed to express any protein of interest fused to the Nostoc punctiforme DnaE N-terminal split intein. </p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/8/81/BBa_K1362100.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
<br />
</div><br />
<br />
<br/><br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362101</h4><br />
BBa_K1362101 is the corresponding C-terminal construct to BBa_K1362100. Upon coexpression or mixture of the N- and C-constructs protein splicing takes place and the N- and C-terminal proteins of interest are irreversibly assembled via a newly formed peptide bond.</p><p><br />
This mechanism can be applied for a variety of different uses such as the activation of a protein through reconstitution of individually expressed split halves. See our split sfGFP experiment and the respective parts in the registry for more information. Protein splicing offers many new possibilities and we hope to have set a foundation that you guys can build on!</p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/3/3f/BBa_K1362101.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
</div><br />
<br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br />
<br />
<h1 id="Sample Data Page">Sample Data Page for our favorite Parts.</h1><br />
<br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/9/9b/SampleData_Circularization.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<!-- <div class="margin-top"> --><br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
<h3> Assembly Construct. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<br />
<br />
<br/><br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/5/5c/SampleData_Assembly.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br/><br />
<br />
<h1 id="Intein Library">Intein Library.</h1><br />
<br/><br />
</html><br />
Inteins are the basic unity of our toolbox. They are integrated as extraneous polypeptide sequences into habitual proteins and do not follow the original protein function. Inteins perform an autocatalytic splicing reaction, where they excite themselves out of the host protein while reconnecting the remaining chains on both end, so called N and C exteins, via a new peptide bond. Read more about it in our [https://2014.igem.org/Team:Heidelberg/Project/Background| project background]!<br />
<br />
To characterize the different types and groups of split-inteins and inteins we collect many details about them to develop a intein library. It gives you a great and clear overview about the most important facts.<br />
<br />
{| class="table table-hover"<br />
|-<br />
!Split intein<br />
!Special features<br />
!Nint<br />
!Cint<br />
!Reaction properties<br />
!Origin<br />
!References<br />
|-<br />
| Npu DnaE||fast; robust at high temperature range and high-yielding trans-splicing activity, well characterised requirements||102||36||t1/2 = 63s , 37°C , k=~1x10^-2 (s^-1); activity range 6 to 37°C||S1 natural split intein, Nostoc punctiforme||[[#References|[1]]] [[#References|[2]]] <br />
|-<br />
| Ssp DnaX||cross-reactivity with other N-inteins, transsplicing in vivo and in vitro, high yields||||||k=~1.7x10^-4(s^-1); efficiency 96%||engineered from Synechocystis species||[[#References|[3]]] [[#References|[4]]] <br />
|-<br />
| Ssp GyrB|| very short Nint facilitates trans-splicing of synthetic peptides||6||150||k=~1x10^-4(s^-1), efficiency 40-80%||S11 split intein enginered from Synechocystis species, strain PCC6803||[[#References|[4]]] [[#References|[5]]] <br />
|-<br />
| Ter DnaE3||trans-splicing activity with high yields||102||36||k=~2x10^-4(s^-1), efficiency 87%||natural split intein, Trichodesmium erythraeum||[[#References|[4]]] [[#References|[6]]] <br />
|-<br />
| Ssp DnaB||relatively fast||||||t1/2=12min, 25°C, k=~1x10^-3(s^-1)||engineered from Synechocystis species, strain PCC6803||[[#References|[2]]] <br />
|-<br />
| Gp41-1||fastes known reaction ||88||38||t1/2=20-30s, 37°C, k=~1.8x10^-1 (s^-1); activity range 0 to 60°C||natural split intein, Cyanophage||[[#References|[7]]] [[#References|[8]]] <br />
|-<br />
|}<br />
<br />
{{#tag:html|<br />
<h3>References</h3><br />
<p>[1] Iwai, H., Züger, S., Jin, J. & Tam, P.-H. Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme. FEBS Lett. 580, 1853–8 (2006).</p><br />
<br />
<p>[2] Zettler, J., Schütz, V. & Mootz, H. D. The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction. FEBS Lett. 583, 909–14 (2009).</p><br />
<br />
<p>[3] Song, H., Meng, Q. & Liu, X.-Q. Protein trans-splicing of an atypical split intein showing structural flexibility and cross-reactivity. PLoS One 7, e45355 (2012).</p><br />
<br />
<p>[4] Lin, Y. et al. Protein trans-splicing of multiple atypical split inteins engineered from natural inteins. PLoS One 8, e59516 (2013).</p><br />
<br />
<p>[5] Appleby, J. H., Zhou, K., Volkmann, G. & Liu, X.-Q. Novel Split Intein for trans-Splicing Synthetic Peptide onto C Terminus of Protein. J. Biol. Chem. 284, 6194–6199 (2009).</p><br />
<br />
<p>[6] Liu, X.-Q. & Yang, J. Split dnaE genes encoding multiple novel inteins in Trichodesmium erythraeum. J. Biol. Chem. 278, 26315–8 (2003).</p><br />
<br />
<p>[7] Carvajal-Vallejos, P., Pallissé, R., Mootz, H. D. & Schmidt, S. R. Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. J. Biol. Chem. 287, 28686–96 (2012).</p><br />
<br />
<p>[8] Dassa, B., London, N., Stoddard, B. L., Schueler-Furman, O. & Pietrokovski, S. Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family. Nucleic Acids Res. 37, 2560–73 (2009).</p><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
<br />
<h1 id="Backbones">Our Backbones.</h1><br />
<p>Standard BioBrick cloning is a universal way of putting two BioBrick parts together to build a new BioBrick part. Despite several alternative cloning methods allow the assembly of multiple parts at one its simplicity and the broad availability of compatible parts keep it the 'de facto' standard of the iGEM-community.</p><br />
<p>Using standard BioBrick cloning, the generation of translationally active parts requires often more than one round of cloning. The ability to easily test the functionality of a protein before cloning them into complicated circuits has the potential to prevent many unsuccessful experiments of iGEM teams and may improve the characterization of the parts in the parts registry. However the extra amount of work required to clone such an additional construct may inhibit this behavior. We therefore improved the standard plasmids pSB1X3 and pSB4X5 by inserting a lacI repressible T7 promoter directly upstream to the BioBrick prefix of those plasmids. This promoter is completely inactive in 'E. coli' strains lacking a T7 RNA polymerase such as TOP10 or DH10beta bute inducible in strains carrying the T7 RNA polymerase under a lacI repressible promoter such as DE3 strains. This enables the use of the same backbone for cloning and over expression. Using 3A assembly a translational active part can be cloned from an RBS and a coding part in one step while maintaining the full flexibility of standard BioBrick assembly. These new RFC 10 conform backbones eliminate one cloning step needed for the expression and thus the characterization of a newly BioBricked protein. Version number 30 was claimed for the high copy variants and version number 50 for the low copy variants.</p><br />
<p>High copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091">pSB1A30</a>(Part:BBa_K1362091): High copy BioBrick cloning/expression backbone carrying Amp resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362092">pSB1C30</a>(Part:BBa_K1362092): High copy BioBrick cloning/expression backbone carrying Cm resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093">pSB1CK30</a>(Part:BBa_K1362093): High copy BioBrick cloning/expression backbone carrying Kan resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362094">pSB1CT30</a>(Part:BBa_K1362094): High copy BioBrick cloning/expression backbone carrying Tet resitance</li><br />
</ul><br />
<p>Low copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362095">pSB4A50</a>(Part:BBa_K1362095): High copy BioBrick cloning/expression backbone carrying Amp resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362096">pSB4C50</a>(Part:BBa_K1362096): High copy BioBrick cloning/expression backbone carrying Cm resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097">pSB4K50</a>(Part:BBa_K1362097): High copy BioBrick cloning/expression backbone carrying Kan resitance</li><br />
</ul><br />
<br />
<br/><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<h1 id="allParts"><span style="font-size:170%;">List of Parts</span style="font-size:170%;"> <!-- – <span style="font-size":50%">Placeholder --></h1><br />
<div class="col-xs-12"><br />
<div id="partsTable">Loading...</div><br />
</div><br />
<br />
<br />
<script type="text/javascript"><br />
var keepParts = ['BBa_K1362000', 'BBa_K1362001', 'BBa_K1362003', 'BBa_K1362004', 'BBa_K1362005', 'BBa_K1362011', 'BBa_K1362012', 'BBa_K1362013', 'BBa_K1362020', 'BBa_K1362021', 'BBa_K1362022', 'BBa_K1362023', 'BBa_K1362050', 'BBa_K1362051', 'BBa_K1362052', 'BBa_K1362053', 'BBa_K1362054', 'BBa_K1362055', 'BBa_K1362056', 'BBa_K1362057', 'BBa_K1362058', 'BBa_K1362059', 'BBa_K1362060', 'BBa_K1362090', 'BBa_K1362091', 'BBa_K1362092', 'BBa_K1362093', 'BBa_K1362094', 'BBa_K1362095', 'BBa_K1362096', 'BBa_K1362097', 'BBa_K1362100', 'BBa_K1362101', 'BBa_K1362102', 'BBa_K1362103', 'BBa_K1362104', 'BBa_K1362105', 'BBa_K1362106', 'BBa_K1362107', 'BBa_K1362108', 'BBa_K1362109', 'BBa_K1362110', 'BBa_K1362111', 'BBa_K1362120', 'BBa_K1362121', 'BBa_K1362130', 'BBa_K1362131', 'BBa_K1362140', 'BBa_K1362141', 'BBa_K1362142', 'BBa_K1362143', 'BBa_K1362150', 'BBa_K1362151', 'BBa_K1362160', 'BBa_K1362161', 'BBa_K1362166', 'BBa_K1362167', 'BBa_K1362170', 'BBa_K1362171', 'BBa_K1362172', 'BBa_K1362173', 'BBa_K1362174', 'BBa_K1362202', 'BBa_K1362203', 'BBa_K1362204', 'BBa_K1362205', 'BBa_K1362500'];<br />
<br />
$( document ).ready(function() {<br />
jQuery("#partsTable").load("https://2014.igem.org/cgi/api/groupparts.cgi?t=iGEM014&amp;g=Heidelberg", function(){<br />
$('.pgrouptable tr td:nth-child(4) a').each(function(){<br />
var text = $(this).text();<br />
if($.inArray(text, keepParts) == -1){<br />
$(this).parent().parent().remove();<br />
}<br />
});<br />
$('.pgrouptable tr td:nth-child(7)').remove();<br />
$('.pgrouptable tr th:nth-child(7)').remove();<br />
$('.pgrouptable').removeClass('pgrouptable tablesorter').addClass('table table-hover');<br />
$('.heart13').removeClass('heart13').addClass('glyphicon glyphicon-heart');<br />
<br />
});<br />
<br />
});<br />
<br />
</script><br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2014-10-18T01:56:28Z<p>Bunnech: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
div.margin-top { margin-top: 100px; }<br />
</style><br />
<br />
<br />
<h1 id="Favorite Parts">Favorite Parts.</h1><br />
<p>The iGEM Team Heidelberg 2014 had built a new biological system for the iGEM community integrating split-inteins. <br />
Intein splicing is a natural process that excises one part of a protein and leaves the remaining parts irreversibly attached. This great function allows you to modify your protein in numerous ways.</p><br />
<p>Creating a toolbox including all great functions and possibilities of inteins, we need a new standard for the scientific world of iGEM. This standard, the RFC of the iGEM Team Heidelberg 2014, allows us to easily and modulary work with split inteins.</p><br />
<br />
<p>Our favorite Parts represent the basic constructs of our toolbox – the Assembly and the Circularization construct, which are both tested in many methods and applications. </p><br />
<p>In the following we present you <br />
<a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the construct for circularization, <br />
<a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100</a> and <br />
<a href="http://parts.igem.org/BBa_K1362101">BBa_K1362101</a>, the N- and the C-construct for assembly. Take a look and visit the Partsregistry to read the associated documentation.</p><br />
<br/><br />
<br/><br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<h4>BBa_K1362000</h4><br />
Placeholder<br />
<br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/7/7c/BBa_K1362000.png" class="img-responsive" alt="Circularization Construct"><br />
<br />
</div><br />
</div><br />
<br />
<br/><br />
<br />
<h3> Assembly Constructs. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362100</h4><br />
<p>This intein assembly construct is part of our strategy for cloning with split inteins. Inteins are naturally occuring peptide sequences that splice out of a precursor protein and attach the remaining ends together to form a new protein. When splitting those intein sequence into an N-terminal and a C-terminal split intein one is left with a powerful tool to post-translationally modify whole proteins on the amino-acid sequence level. This construct was designed to express any protein of interest fused to the Nostoc punctiforme DnaE N-terminal split intein. </p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/8/81/BBa_K1362100.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
<br />
</div><br />
<br />
<br/><br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362101</h4><br />
BBa_K1362101 is the corresponding C-terminal construct to BBa_K1362100. Upon coexpression or mixture of the N- and C-constructs protein splicing takes place and the N- and C-terminal proteins of interest are irreversibly assembled via a newly formed peptide bond.</p><p><br />
This mechanism can be applied for a variety of different uses such as the activation of a protein through reconstitution of individually expressed split halves. See our split sfGFP experiment and the respective parts in the registry for more information. Protein splicing offers many new possibilities and we hope to have set a foundation that you guys can build on!</p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/3/3f/BBa_K1362101.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
</div><br />
<br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br />
<br />
<h1 id="Sample Data Page">Sample Data Page for our favorite Parts.</h1><br />
<br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/9/9b/SampleData_Circularization.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<!-- <div class="margin-top"> --><br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
<h3> Assembly Construct. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<br />
<br />
<br/><br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/5/5c/SampleData_Assembly.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br/><br />
<br />
<h1 id="Intein Library">Intein Library.</h1><br />
<br/><br />
</html><br />
Inteins are the basic unity of our toolbox. They are integrated as extraneous polypeptide sequences into habitual proteins and do not follow the original protein function. Inteins perform an autocatalytic splicing reaction, where they excite themselves out of the host protein while reconnecting the remaining chains on both end, so called N and C exteins, via a new peptide bond. Read more about it in our [https://2014.igem.org/Team:Heidelberg/Project/Background| project background]!<br />
<br />
To characterize the different types and groups of split-inteins and inteins we collect many details about them to develop a intein library. It gives you a great and clear overview about the most important facts.<br />
<br />
{| class="table table-hover"<br />
|-<br />
!Split intein<br />
!Special features<br />
!Nint<br />
!Cint<br />
!Reaction properties<br />
!Origin<br />
!References<br />
|-<br />
| Npu DnaE||fast; robust at high temperature range and high-yielding trans-splicing activity, well characterised requirements||102||36||t1/2 = 63s , 37°C , k=~1x10^-2 (s^-1); activity range 6 to 37°C||S1 natural split intein, Nostoc punctiforme||[[#References|[1]]] [[#References|[2]]] <br />
|-<br />
| Ssp DnaX||cross-reactivity with other N-inteins, transsplicing in vivo and in vitro, high yields||||||k=~1.7x10^-4(s^-1); efficiency 96%||engineered from Synechocystis species||[[#References|[3]]] [[#References|[4]]] <br />
|-<br />
| Ssp GyrB|| very short Nint facilitates trans-splicing of synthetic peptides||6||150||k=~1x10^-4(s^-1), efficiency 40-80%||S11 split intein enginered from Synechocystis species, strain PCC6803||[[#References|[4]]] [[#References|[5]]] <br />
|-<br />
| Ter DnaE3||trans-splicing activity with high yields||102||36||k=~2x10^-4(s^-1), efficiency 87%||natural split intein, Trichodesmium erythraeum||[[#References|[4]]] [[#References|[6]]] <br />
|-<br />
| Ssp DnaB||relatively fast||||||t1/2=12min, 25°C, k=~1x10^-3(s^-1)||engineered from Synechocystis species, strain PCC6803||[[#References|[2]]] <br />
|-<br />
| Gp41-1||fastes known reaction ||88||38||t1/2=20-30s, 37°C, k=~1.8x10^-1 (s^-1); activity range 0 to 60°C||natural split intein, Cyanophage||[[#References|[7]]] [[#References|[8]]] <br />
|-<br />
|}<br />
<br />
{{#tag:html|<br />
<h3>References</h3><br />
<p>[1] Iwai, H., Züger, S., Jin, J. & Tam, P.-H. Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme. FEBS Lett. 580, 1853–8 (2006).</p><br />
<br />
<p>[2] Zettler, J., Schütz, V. & Mootz, H. D. The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction. FEBS Lett. 583, 909–14 (2009).</p><br />
<br />
<p>[3] Song, H., Meng, Q. & Liu, X.-Q. Protein trans-splicing of an atypical split intein showing structural flexibility and cross-reactivity. PLoS One 7, e45355 (2012).</p><br />
<br />
<p>[4] Lin, Y. et al. Protein trans-splicing of multiple atypical split inteins engineered from natural inteins. PLoS One 8, e59516 (2013).</p><br />
<br />
<p>[5] Appleby, J. H., Zhou, K., Volkmann, G. & Liu, X.-Q. Novel Split Intein for trans-Splicing Synthetic Peptide onto C Terminus of Protein. J. Biol. Chem. 284, 6194–6199 (2009).</p><br />
<br />
<p>[6] Liu, X.-Q. & Yang, J. Split dnaE genes encoding multiple novel inteins in Trichodesmium erythraeum. J. Biol. Chem. 278, 26315–8 (2003).</p><br />
<br />
<p>[7] Carvajal-Vallejos, P., Pallissé, R., Mootz, H. D. & Schmidt, S. R. Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. J. Biol. Chem. 287, 28686–96 (2012).</p><br />
<br />
<p>[8] Dassa, B., London, N., Stoddard, B. L., Schueler-Furman, O. & Pietrokovski, S. Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family. Nucleic Acids Res. 37, 2560–73 (2009).</p><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
<br />
<h1 id="Backbones">Our Backbones.</h1><br />
<p>Standard BioBrick cloning is a universal way of putting two BioBrick parts together to build a new BioBrick part. Despite several alternative cloning methods allow the assembly of multiple parts at one its simplicity and the broad availability of compatible parts keep it the 'de facto' standard of the iGEM-community.</p><br />
<p>Using standard BioBrick cloning, the generation of translationally active parts requires often more than one round of cloning. The ability to easily test the functionality of a protein before cloning them into complicated circuits has the potential to prevent many unsuccessful experiments of iGEM teams and may improve the characterization of the parts in the parts registry. However the extra amount of work required to clone such an additional construct may inhibit this behavior. We therefore improved the standard plasmids pSB1X3 and pSB4X5 by inserting a lacI repressible T7 promoter directly upstream to the BioBrick prefix of those plasmids. This promoter is completely inactive in 'E. coli' strains lacking a T7 RNA polymerase such as TOP10 or DH10beta bute inducible in strains carrying the T7 RNA polymerase under a lacI repressible promoter such as DE3 strains. This enables the use of the same backbone for cloning and over expression. Using 3A assembly a translational active part can be cloned from an RBS and a coding part in one step while maintaining the full flexibility of standard BioBrick assembly. These new RFC 10 conform backbones eliminate one cloning step needed for the expression and thus the characterization of a newly BioBricked protein. Version number 30 was claimed for the high copy variants and version number 50 for the low copy variants.</p><br />
<p>High copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091">pSB1A30</a>(Part:BBa_K1362091): High copy BioBrick cloning/expression backbone carrying Amp resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362092">pSB1C30</a>(Part:BBa_K1362092): High copy BioBrick cloning/expression backbone carrying Cm resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093">pSB1CK30</a>(Part:BBa_K1362093): High copy BioBrick cloning/expression backbone carrying Kan resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362094">pSB1CT30</a>(Part:BBa_K1362094): High copy BioBrick cloning/expression backbone carrying Tet resitance</li><br />
</ul><br />
<p>Low copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362095">pSB4A50</a>(Part:BBa_K1362095): High copy BioBrick cloning/expression backbone carrying Amp resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362096">pSB4C50</a>(Part:BBa_K1362096): High copy BioBrick cloning/expression backbone carrying Cm resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097">pSB4K50</a>(Part:BBa_K1362097): High copy BioBrick cloning/expression backbone carrying Kan resitance</li><br />
</ul><br />
<br />
<br/><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<h1 id="allParts"><span style="font-size:170%;">List of Parts</span style="font-size:170%;"> <!-- – <span style="font-size":50%">Placeholder --></h1><br />
<div class="col-xs-12"><br />
<div id="partsTable">Loading...</div><br />
</div><br />
<br />
<br />
<script type="text/javascript"><br />
var keepParts = ['BBa_K1362000', 'BBa_K1362001', 'BBa_K1362003', 'BBa_K1362004', 'BBa_K1362005', 'BBa_K1362011', 'BBa_K1362012', 'BBa_K1362013', 'BBa_K1362020', 'BBa_K1362021', 'BBa_K1362022', 'BBa_K1362023', 'BBa_K1362050', 'BBa_K1362051', 'BBa_K1362052', 'BBa_K1362053', 'BBa_K1362054', 'BBa_K1362055', 'BBa_K1362056', 'BBa_K1362057', 'BBa_K1362058', 'BBa_K1362059', 'BBa_K1362060', 'BBa_K1362090', 'BBa_K1362091', 'BBa_K1362092', 'BBa_K1362093', 'BBa_K1362094', 'BBa_K1362095', 'BBa_K1362096', 'BBa_K1362097', 'BBa_K1362100', 'BBa_K1362101', 'BBa_K1362102', 'BBa_K1362103', 'BBa_K1362104', 'BBa_K1362105', 'BBa_K1362106', 'BBa_K1362107', 'BBa_K1362108', 'BBa_K1362109', 'BBa_K1362110', 'BBa_K1362111', 'BBa_K1362120', 'BBa_K1362121', 'BBa_K1362130', 'BBa_K1362131', 'BBa_K1362140', 'BBa_K1362141', 'BBa_K1362142', 'BBa_K1362143', 'BBa_K1362150', 'BBa_K1362151', 'BBa_K1362160', 'BBa_K1362161', 'BBa_K1362166', 'BBa_K1362167', 'BBa_K1362170', 'BBa_K1362171', 'BBa_K1362172', 'BBa_K1362173', 'BBa_K1362174', 'BBa_K1362202', 'BBa_K1362203', 'BBa_K1362204', 'BBa_K1362205', 'BBa_K1362500'];<br />
<br />
$( document ).ready(function() {<br />
jQuery("#partsTable").load("https://2014.igem.org/cgi/api/groupparts.cgi?t=iGEM014&amp;g=Heidelberg", function(){<br />
$('.pgrouptable tr td:nth-child(4) a').each(function(){<br />
var text = $(this).text();<br />
if($.inArray(text, keepParts) == -1){<br />
$(this).parent().parent().remove();<br />
}<br />
});<br />
$('.pgrouptable tr td:nth-child(7)').remove();<br />
$('.pgrouptable tr th:nth-child(7)').remove();<br />
$('.pgrouptable').removeClass('pgrouptable tablesorter').addClass('table table-hover');<br />
$('.heart13').removeClass('heart13').addClass('glyphicon glyphicon-heart');<br />
<br />
});<br />
<br />
});<br />
<br />
</script><br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2014-10-18T01:54:03Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/boxes}}<br />
<html><style type="text/css"><br />
.subtitle h2 {<br />
color: white;<br />
padding-left: 15px;<br />
}<br />
</style></html><br />
{{:Team:Heidelberg/templates/wikipage_new|<br />
|<br />
container-style=background-color: black; background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg); background-repeat: no-repeat; background-size: 100% auto;<br />
|<br />
title=PARTS<br />
|<br />
white=true<br />
|<br />
red-logo=true<br />
|<br />
subtitle=Discover our workpieces and standards<br />
|<br />
abstract=<br />
|<br />
content=<br />
<html><br />
<div class="col-lg-3 col-md-2 hidden-sm hidden-xs" style="text-align: center;"><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/Heidelberg_Parts_bg.png" class="img-responsive" /><br />
</div><br />
<div class="col-lg-9 col-md-10 col-sm-12 col-xs-12"><br />
<div class="col-lg-12" style="margin: -15px; margin-bottom:15px;"><br />
<div class="boxes-table"><br />
<div class="cell" style="width:60%;"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC" class="box" style="margin-bottom:15px; display:block;"><br />
<h3>New <span>RFC</span> iGEM_HD14</h3><br />
To use inteins as easy and standarized tools to modify proteins after translation we developed a new RFC for the iGEM community. Take a closer look on our new intein standard!<br />
</a><br />
<a href="#Intein Library" class="box" style="display:block;"><br />
<h3>The <span>Intein</span> Library</h3><br />
Protein splicing by inteins is a natural process in which the catalytically active polypeptide termed intein excises itself from a precursor protein leaving the flanking chains reconnected. Deployed in our system inteins are modular instruments for several protein modifications. In our intein library you can find a list of all inteins we used, popular and really fast ones.<br />
</a><br />
</div><br />
<div class="cell" style="width:60%;"><br />
<br />
<a href="#Favorite Parts" class="box" style="display:block; position:relative; margin-bottom:15px;"><br />
<h3>Our <span>favorite</span> Parts</h3><br />
The intein toolbox built by the iGEM Team Heidelberg includes three basic mechanisms. With our favorite parts we want to introduce you to the constructs enabling these priciples! <br />
<img src="/wiki/images/9/9b/Heidelberg_Favoriteparts_star.png" class="star" alt="Favorite Parts Image" /> <br />
</a><br />
<br />
<a href="#Sample Data Page" class="box" style="display:block;"><br />
<h3>Sample <span>Data</span> Page</h3><br />
Take a look at our favorite Parts for circularization, fusion or tagging and see how our system works in the living cell. For that visit our Sample Data Page. <br />
</a><br />
</div><br />
</div><br />
<div class="boxes-table"><br />
<a href="#allParts" class="box cell" style="width: 55%;"><br />
<h3>Our <span>BioBricks</span></h3><br />
Creating a new standard and basic constructs of our toolbox, we sent in 67 new Parts for the Registry of Biological parts! Next to parts for intein-splicing we built sortase constructs to modify proteins post-translationally, too. Here you can find a List of all Parts!</a><br />
<a href="#Backbones" class="box cell" ><br />
<h3>Our <span>Backbones</span></h3><br />
Creating a new series of Backbones including a T7 promoter with a lac operon, expressing our constructs and sharing them with other iGEM teams, you have to take a closer look on BBa_K1362091-97! Read more about it under Collaborations.<br />
</a><br />
</div><br />
<div class="boxes-table"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Parts/Part_Improvement" class="box cell" style="padding-right:100px;position:relative;" ><br />
<h3><span>Improving</span> an existing Part</h3><br />
Standardization and building up on existing parts are the fundaments of iGEM. We improved a Xylanase (wood degrading enzyme) by improving its sequence for the expression in <i>E. coli</i> and further characterized its function in respect to heat stability. <br />
<img class="small-igem-logo" src="/wiki/images/7/79/IGEM_logo_red.png" alt="igem-icon" /><br />
</a><br />
</div><br />
</div><br />
</div><br />
</div></div><!-- close container div of template --><br />
<div class="container" style="background-color:white;margin-top:75px;"><br />
<div class="col-lg-12"><br />
<!-- für meine allerliebste Charlotte <3 --><br />
</html><br />
{{:Team:Heidelberg/pages/Parts}}<br />
<html><br />
</div><br />
</div><br />
</html><br />
|<br />
header-img=<br />
|<br />
header-bg=<br />
|<br />
red=<br />
|<br />
titles=<br />
|<br />
white-logo=<br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/PartsTeam:Heidelberg/pages/Parts2014-10-18T01:53:36Z<p>Bunnech: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
div.margin-top { margin-top: 100px; }<br />
</style><br />
<br />
<br />
<h1 id="Favorite Parts">Favorite Parts.</h1><br />
<p>The iGEM Team Heidelberg 2014 had built a new biological system for the iGEM community integrating split-inteins. <br />
Intein splicing is a natural process that excises one part of a protein and leaves the remaining parts irreversibly attached. This great function allows you to modify your protein in numerous ways.</p><br />
<p>Creating a toolbox including all great functions and possibilities of inteins, we need a new standard for the scientific world of iGEM. This standard, the RFC of the iGEM Team Heidelberg 2014, allows us to easily and modulary work with split inteins.</p><br />
<br />
<p>Our favorite Parts represent the basic constructs of our toolbox – the Assembly and the Circularization construct, which are both tested in many methods and applications. </p><br />
<p>In the following we present you <br />
<a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the construct for circularization, <br />
<a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100</a> and <br />
<a href="http://parts.igem.org/BBa_K1362101">BBa_K1362101</a>, the N- and the C-construct for assembly. Take a look and visit the Partsregistry to read the associated documentation.</p><br />
<br/><br />
<br/><br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<h4>BBa_K1362000</h4><br />
Placeholder<br />
<br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/7/7c/BBa_K1362000.png" class="img-responsive" alt="Circularization Construct"><br />
<br />
</div><br />
</div><br />
<br />
<br/><br />
<br />
<h3> Assembly Constructs. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362100</h4><br />
<p>This intein assembly construct is part of our strategy for cloning with split inteins. Inteins are naturally occuring peptide sequences that splice out of a precursor protein and attach the remaining ends together to form a new protein. When splitting those intein sequence into an N-terminal and a C-terminal split intein one is left with a powerful tool to post-translationally modify whole proteins on the amino-acid sequence level. This construct was designed to express any protein of interest fused to the Nostoc punctiforme DnaE N-terminal split intein. </p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/8/81/BBa_K1362100.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
<br />
</div><br />
<br />
<br/><br />
<div class="row"><br />
<div class="col-md-4 col-sm-12 col-xs-12"> <br />
<br />
<h4>BBa_K1362101</h4><br />
BBa_K1362101 is the corresponding C-terminal construct to BBa_K1362100. Upon coexpression or mixture of the N- and C-constructs protein splicing takes place and the N- and C-terminal proteins of interest are irreversibly assembled via a newly formed peptide bond.</p><p><br />
This mechanism can be applied for a variety of different uses such as the activation of a protein through reconstitution of individually expressed split halves. See our split sfGFP experiment and the respective parts in the registry for more information. Protein splicing offers many new possibilities and we hope to have set a foundation that you guys can build on!</p><br />
</div><br />
<div class="col-md-8 col-sm-12 col-xs-12"><br />
<img src="/wiki/images/3/3f/BBa_K1362101.png" class="img-responsive" alt="Assembly Constructs"><br />
</div><br />
</div><br />
<br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br />
<br />
<h1 id="Sample Data Page">Sample Data Page for our favorite Parts.</h1><br />
<br />
<h3> Circularization Construct. BBa_K1362000 </h3> <br />
<br />
<br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/9/9b/SampleData_Circularization.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<!-- <div class="margin-top"> --><br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
<h3> Assembly Construct. BBa_K1362100 and BBa_K1362101 </h3> <br />
<br />
<br />
<br />
<br/><br />
<br/><br />
<br />
<div class="row"><br />
<div class="col-md-7 col-sm-12 col-xs-12"> <br />
<img src="/wiki/images/5/5c/SampleData_Assembly.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<div class="col-md-5 col-sm-12 col-xs-12"><br />
<br />
<div class="well well-sm"><br />
This part represents an easy way to circularize any protein. In a single step you can clone your protein in the split intein circularization construct. Exteins, RFC [i] standard overhangs and BsaI sites have to be added to the coding sequence of the protein to be circularized without start- and stop codons by PCR. By Golden Gate assembly, the mRFP selection marker has to be replaced with the protein insert.<br />
If the distance of the ends of your protein of interest aren't close enough to connect them you will need a linker. <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, the split intein circularization construct, includes a strong T7 RBS (<a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362090">BBa_K1362090</a>), we sent to the parts registry as well, and the split intein Npu DnaE. The T7 RBS derived from the T7 phage gene 10a (major capsid protein). </div> <br />
<!-- </div> --><br />
<div class="well well-sm"><br />
The resulting plasmid can be used to express the protein of interest with the obligatory linker and the N- and C-intein.<br />
</div><br />
<div class="well well-sm"><br />
In an autocatalytic in vivo reaction, the circular protein is formed. To read more about the trans-splicing reaction visit our <a href="https://2014.igem.org/Team:Heidelberg/Project/Background">Intein Background</a> page. If corresponding split inteins are added to both termini of a protein, the trans-splicing reaction results in a circular backbone. <br />
</div><br />
<div class="well well-sm"><br />
Circular proteins offers many advantages. While conserving the functionality of their linear counterpart, circular proteins can be superior in terms of thermostability, resistance against chemical denaturation and protection from exopeptidases. Moreover, a circular backbone can improve in vivo stability of therapeutical proteins and peptides.<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<br />
<br/><br />
<br />
<h1 id="Intein Library">Intein Library.</h1><br />
<br/><br />
</html><br />
Inteins are the basic unity of our toolbox. They are integrated as extraneous polypeptide sequences into habitual proteins and do not follow the original protein function. Inteins perform an autocatalytic splicing reaction, where they excite themselves out of the host protein while reconnecting the remaining chains on both end, so called N and C exteins, via a new peptide bond. Read more about it in our [https://2014.igem.org/Team:Heidelberg/Project/Background| project background]!<br />
<br />
To characterize the different types and groups of split-inteins and inteins we collect many details about them to develop a intein library. It gives you a great and clear overview about the most important facts.<br />
<br />
{| class="table table-hover"<br />
|-<br />
!Split intein<br />
!Special features<br />
!Nint<br />
!Cint<br />
!Reaction properties<br />
!Origin<br />
!References<br />
|-<br />
| Npu DnaE||fast; robust at high temperature range and high-yielding trans-splicing activity, well characterised requirements||102||36||t1/2 = 63s , 37°C , k=~1x10^-2 (s^-1); activity range 6 to 37°C||S1 natural split intein, Nostoc punctiforme||[[#References|[1]]] [[#References|[2]]] <br />
|-<br />
| Ssp DnaX||cross-reactivity with other N-inteins, transsplicing in vivo and in vitro, high yields||||||k=~1.7x10^-4(s^-1); efficiency 96%||engineered from Synechocystis species||[[#References|[3]]] [[#References|[4]]] <br />
|-<br />
| Ssp GyrB|| very short Nint facilitates trans-splicing of synthetic peptides||6||150||k=~1x10^-4(s^-1), efficiency 40-80%||S11 split intein enginered from Synechocystis species, strain PCC6803||[[#References|[4]]] [[#References|[5]]] <br />
|-<br />
| Ter DnaE3||trans-splicing activity with high yields||102||36||k=~2x10^-4(s^-1), efficiency 87%||natural split intein, Trichodesmium erythraeum||[[#References|[4]]] [[#References|[6]]] <br />
|-<br />
| Ssp DnaB||relatively fast||||||t1/2=12min, 25°C, k=~1x10^-3(s^-1)||engineered from Synechocystis species, strain PCC6803||[[#References|[2]]] <br />
|-<br />
| Gp41-1||fastes known reaction ||88||38||t1/2=20-30s, 37°C, k=~1.8x10^-1 (s^-1); activity range 0 to 60°C||natural split intein, Cyanophage||[[#References|[7]]] [[#References|[8]]] <br />
|-<br />
|}<br />
<br />
<html><br />
<h3>References</h3><br />
<p>[1] Iwai, H., Züger, S., Jin, J. & Tam, P.-H. Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme. FEBS Lett. 580, 1853–8 (2006).</p><br />
<br />
<p>[2] Zettler, J., Schütz, V. & Mootz, H. D. The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction. FEBS Lett. 583, 909–14 (2009).</p><br />
<br />
<p>[3] Song, H., Meng, Q. & Liu, X.-Q. Protein trans-splicing of an atypical split intein showing structural flexibility and cross-reactivity. PLoS One 7, e45355 (2012).</p><br />
<br />
<p>[4] Lin, Y. et al. Protein trans-splicing of multiple atypical split inteins engineered from natural inteins. PLoS One 8, e59516 (2013).</p><br />
<br />
<p>[5] Appleby, J. H., Zhou, K., Volkmann, G. & Liu, X.-Q. Novel Split Intein for trans-Splicing Synthetic Peptide onto C Terminus of Protein. J. Biol. Chem. 284, 6194–6199 (2009).</p><br />
<br />
<p>[6] Liu, X.-Q. & Yang, J. Split dnaE genes encoding multiple novel inteins in Trichodesmium erythraeum. J. Biol. Chem. 278, 26315–8 (2003).</p><br />
<br />
<p>[7] Carvajal-Vallejos, P., Pallissé, R., Mootz, H. D. & Schmidt, S. R. Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. J. Biol. Chem. 287, 28686–96 (2012).</p><br />
<br />
<p>[8] Dassa, B., London, N., Stoddard, B. L., Schueler-Furman, O. & Pietrokovski, S. Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family. Nucleic Acids Res. 37, 2560–73 (2009).</p><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
<br />
<h1 id="Backbones">Our Backbones.</h1><br />
<p>Standard BioBrick cloning is a universal way of putting two BioBrick parts together to build a new BioBrick part. Despite several alternative cloning methods allow the assembly of multiple parts at one its simplicity and the broad availability of compatible parts keep it the 'de facto' standard of the iGEM-community.</p><br />
<p>Using standard BioBrick cloning, the generation of translationally active parts requires often more than one round of cloning. The ability to easily test the functionality of a protein before cloning them into complicated circuits has the potential to prevent many unsuccessful experiments of iGEM teams and may improve the characterization of the parts in the parts registry. However the extra amount of work required to clone such an additional construct may inhibit this behavior. We therefore improved the standard plasmids pSB1X3 and pSB4X5 by inserting a lacI repressible T7 promoter directly upstream to the BioBrick prefix of those plasmids. This promoter is completely inactive in 'E. coli' strains lacking a T7 RNA polymerase such as TOP10 or DH10beta bute inducible in strains carrying the T7 RNA polymerase under a lacI repressible promoter such as DE3 strains. This enables the use of the same backbone for cloning and over expression. Using 3A assembly a translational active part can be cloned from an RBS and a coding part in one step while maintaining the full flexibility of standard BioBrick assembly. These new RFC 10 conform backbones eliminate one cloning step needed for the expression and thus the characterization of a newly BioBricked protein. Version number 30 was claimed for the high copy variants and version number 50 for the low copy variants.</p><br />
<p>High copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091">pSB1A30</a>(Part:BBa_K1362091): High copy BioBrick cloning/expression backbone carrying Amp resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362092">pSB1C30</a>(Part:BBa_K1362092): High copy BioBrick cloning/expression backbone carrying Cm resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093">pSB1CK30</a>(Part:BBa_K1362093): High copy BioBrick cloning/expression backbone carrying Kan resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362094">pSB1CT30</a>(Part:BBa_K1362094): High copy BioBrick cloning/expression backbone carrying Tet resitance</li><br />
</ul><br />
<p>Low copy BioBrick expression backbone:</p><br />
<ul><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362095">pSB4A50</a>(Part:BBa_K1362095): High copy BioBrick cloning/expression backbone carrying Amp resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362096">pSB4C50</a>(Part:BBa_K1362096): High copy BioBrick cloning/expression backbone carrying Cm resitance</li><br />
<li><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097">pSB4K50</a>(Part:BBa_K1362097): High copy BioBrick cloning/expression backbone carrying Kan resitance</li><br />
</ul><br />
<br />
<br/><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive" alt="Circularization Construct"><br />
</div><br />
<h1 id="allParts"><span style="font-size:170%;">List of Parts</span style="font-size:170%;"> <!-- – <span style="font-size":50%">Placeholder --></h1><br />
<div class="col-xs-12"><br />
<div id="partsTable">Loading...</div><br />
</div><br />
<br />
<br />
<script type="text/javascript"><br />
var keepParts = ['BBa_K1362000', 'BBa_K1362001', 'BBa_K1362003', 'BBa_K1362004', 'BBa_K1362005', 'BBa_K1362011', 'BBa_K1362012', 'BBa_K1362013', 'BBa_K1362020', 'BBa_K1362021', 'BBa_K1362022', 'BBa_K1362023', 'BBa_K1362050', 'BBa_K1362051', 'BBa_K1362052', 'BBa_K1362053', 'BBa_K1362054', 'BBa_K1362055', 'BBa_K1362056', 'BBa_K1362057', 'BBa_K1362058', 'BBa_K1362059', 'BBa_K1362060', 'BBa_K1362090', 'BBa_K1362091', 'BBa_K1362092', 'BBa_K1362093', 'BBa_K1362094', 'BBa_K1362095', 'BBa_K1362096', 'BBa_K1362097', 'BBa_K1362100', 'BBa_K1362101', 'BBa_K1362102', 'BBa_K1362103', 'BBa_K1362104', 'BBa_K1362105', 'BBa_K1362106', 'BBa_K1362107', 'BBa_K1362108', 'BBa_K1362109', 'BBa_K1362110', 'BBa_K1362111', 'BBa_K1362120', 'BBa_K1362121', 'BBa_K1362130', 'BBa_K1362131', 'BBa_K1362140', 'BBa_K1362141', 'BBa_K1362142', 'BBa_K1362143', 'BBa_K1362150', 'BBa_K1362151', 'BBa_K1362160', 'BBa_K1362161', 'BBa_K1362166', 'BBa_K1362167', 'BBa_K1362170', 'BBa_K1362171', 'BBa_K1362172', 'BBa_K1362173', 'BBa_K1362174', 'BBa_K1362202', 'BBa_K1362203', 'BBa_K1362204', 'BBa_K1362205', 'BBa_K1362500'];<br />
<br />
$( document ).ready(function() {<br />
jQuery("#partsTable").load("https://2014.igem.org/cgi/api/groupparts.cgi?t=iGEM014&amp;g=Heidelberg", function(){<br />
$('.pgrouptable tr td:nth-child(4) a').each(function(){<br />
var text = $(this).text();<br />
if($.inArray(text, keepParts) == -1){<br />
$(this).parent().parent().remove();<br />
}<br />
});<br />
$('.pgrouptable tr td:nth-child(7)').remove();<br />
$('.pgrouptable tr th:nth-child(7)').remove();<br />
$('.pgrouptable').removeClass('pgrouptable tablesorter').addClass('table table-hover');<br />
$('.heart13').removeClass('heart13').addClass('glyphicon glyphicon-heart');<br />
<br />
});<br />
<br />
});<br />
<br />
</script><br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin: 100px 0;"><br />
<img src="/wiki/images/9/9a/Heidelberg_dna.png" class="img-responsive"><br />
</div><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/js/teampageTeam:Heidelberg/js/teampage2014-10-18T01:01:04Z<p>Bunnech: </p>
<hr />
<div>var memberData = {<br />
"Max_H": { <br />
"Name" : "Max Horn", <br />
"img" : "/wiki/images/a/a7/Heidelberg_MaxH.jpg",<br />
"Description" : "'But after this has finished, I also want to do something in the wetlab', was one of the sentences most characterizing Max. He is definitely the software guy of the team. Compared to his programming, what we others coded was playing around with code blocks. For him it was always, the lower the level, the better. Therefore he is writing pure C code, as C++ does already too much by itself, he thinks. But still, he was somehow pressed to this role, as normally he is studying molecular biotechnology in 5th semester now. As iGEM@home was running, and he thought he would have a break from programming, the wiki as a project came upon him. On top, he is a perfectionist on software sides, so not only once he called out: 'Nils, look how smooth the ring is moving!'"<br />
},<br />
"Charlotte": {<br />
"Name" : "Charlotte Bunne", <br />
"img" : "/wiki/images/6/69/Heidelberg_Charlotte.jpg",<br />
"Description" : "Charlotte is our youngest team member and already participated in iGEM in Germany´s first High School team in 2012. Studying Biosciences in her third semester, she impresses all team members with her energy, curiosity and ambition. She is the creative head behind nearly all artworks of our project. The wiki design originates from her imaginations and the BOINC video as well as the cover picture for our theme night “Religion and Synthetic Biology” arose from her hands. In team effort with Nils, she is conducting the linker screening experiments for the lysozyme circularization. In the course of these experiments Charlotte learned huge organisational skills that directs her abilities and energy into the right channels. In this way Charlotte became an indispensable team member."<br />
},<br />
"Nils": {<br />
"Name": "Nils Klughammer", <br />
"img" : "/wiki/images/f/ff/Heidelberg_Nils.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Silvan": {<br />
"Name": "Silvan Schmitz",<br />
"img" : "/wiki/images/c/cf/Heidelberg_Silvan.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Jan": {<br />
"Name": "Jan Gleixner",<br />
"img" : "/wiki/images/d/dd/Heidelberg_Jan.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Magdalena": {<br />
"Name": "Magdalena Büscher",<br />
"img" : "/wiki/images/f/f7/Heidelberg_Magdalena.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Carolin": {<br />
"Name": "Carolin Schmelas",<br />
"img" : "/wiki/images/4/49/Heidelberg_Carolin.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Elisabeth": {<br />
"Name": "Elisabeth Schäfer",<br />
"img" : "/wiki/images/7/71/Heidelberg_Elisabeth.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Jakob": {<br />
"Name": "Jakob Kreft",<br />
"img" : "/wiki/images/9/92/Heidelberg_Jakob.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Max_W": {<br />
"Name": "Max Waldhauer",<br />
"img" : "/wiki/images/5/5a/Heidelberg_MaxW.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Anna": {<br />
"Name": "Anna Huhn",<br />
"img" : "/wiki/images/c/c9/Heidelberg_Anna.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Constantin": {<br />
"Name": "Constantin Ahlmann", <br />
"img" : "/wiki/images/5/5a/Heidelberg_Constantin.jpg",<br />
"Description" : "Constantin is a hybrid of programming and lab guy: Not only has iGEM@home been his idea and he could demonstrate his programming skills working on this project, but also he managed to circularize Xylanase – again his idea. In his free time he gives Java classes to high-school students. His secret talent: dancing."<br />
},<br />
"Julia": {<br />
"Name": "Julia Neugebauer",<br />
"img" : "/wiki/images/b/b6/Heidelberg_Julia.jpg",<br />
"Description" : "I have done my bachelor and master studies in molecular biosciences at the University of Heidelberg. Currently, I am developing new confocal microscopy based screening methods using 3D cell culture. In the iGEM project, I was mainly involved in the DNMT1 project and helped in the setup of the different assays to measure xylanase, lysozyme and DNMT1 activity."<br />
},<br />
"Joel": {<br />
"Name": "Joel Beaudouin",<br />
"img" : "/wiki/images/7/7f/Heidelberg_Joel.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Stefen": {<br />
"Name": "Stefen Krämer",<br />
"img" : "/wiki/images/c/c0/Heidelberg_Stefen.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Pierre": {<br />
"Name": "Pierre Wehler", <br />
"img" : "/wiki/images/d/d5/Heidelberg_Piere.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Philipp": {<br />
"Name": "Philipp Bayer", <br />
"img" : "/wiki/images/0/09/Heidelberg_Philipp.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Barbara": {<br />
"Name": "Dr. Barbara Di Ventura", <br />
"img" : "/wiki/images/c/c5/Heidelberg_Barbara_DiVentura.jpg",<br />
"Description" : "Computer engineer by university training (carried out in the University of Rome “La Sapienza”), Barbara has done her Ph.D. in molecular biology in the laboratory of Luis Serrano, at the EMBL. Her Ph.D. project consisted in constructing a synthetic human p53 network in the yeast Saccharomyces cerevisiae. She was post-doc in the laboratory of Victor Sourjik, at the ZMBH. During this time she investigated the self-organizing properties of the Min system, the protein machinery that in Escherichia coli defines mid-cell. Since November 2011, Barbara heads the Synthetic Biology group in the department of Roland Eils, at the BioQuant. Barbara believes in the power of synthetic biology to create new functional devises and to teach important lessons about real biological systems. She also thinks that combining theory and experiments is the best strategy to understand the molecular mechanisms driving biological processes. Barbara finds the iGEM competition truly exciting and she is very happy to mentor the young, motivated and enthusiastic students of the Heidelberg iGEM 2014 team!"<br />
},<br />
"Eils": {<br />
"Name": "Prof. Dr. Roland Eils", <br />
"img" : "/wiki/images/1/19/Heidelberg_Roland_Eils.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
}<br />
<br />
};<br />
<br />
<br />
var teamView = true;<br />
<br />
<br />
function updateHeights(){<br />
$('#memberSelector').stop(true);<br />
var height = 0;<br />
if(teamView){<br />
height = $('.team-overlay').outerHeight();<br />
}<br />
else {<br />
height = $('#memberImage').height();<br />
}<br />
$('#memberSelector').animate({height: height}, 300, "swing", function(){<br />
updateSlick($('#memberSelector').height());<br />
});<br />
<br />
}<br />
<br />
function updateSlick(height){<br />
elementHeight = $('#memberSelector .row:first').outerHeight();<br />
numElements = Math.floor(height/elementHeight);<br />
memberselector = $('#memberSelector');<br />
memberselector.slickSetOption("slidesToShow", numElements, false);<br />
memberselector.slickSetOption("slidesToScroll", numElements, true);<br />
}<br />
<br />
function smoothLoadImage(src){<br />
$('.imageBorder').height($('#memberImage').height());<br />
$('#memberImageOverlay').attr("src", src);<br />
$('#memberImageOverlay').load(function(){<br />
$(this).fadeIn(400, "swing", function(){<br />
$('#memberImage').attr("src", src);<br />
$('#memberImage').load(function(){<br />
$('#memberImageOverlay').hide();<br />
$('.imageBorder').css("height", "");<br />
});<br />
});<br />
<br />
});<br />
}<br />
<br />
function hideTeamOverlay(callback){<br />
$('.team-overlay').animate({ opacity: 0}, 200, "swing", function(){$('.team-overlay').css("display","none");});<br />
$('.memberview').animate({ opacity: 1}, 200, "swing", function(){<br />
teamView = false;<br />
updateHeights();<br />
});<br />
}<br />
<br />
<br />
$(document).ready(function(){<br />
$('#memberImage').load(function(){<br />
updateHeights();<br />
});<br />
$('.team-overlay img').load(function(){<br />
updateHeights();<br />
});<br />
<br />
$('#memberSelector a').click(function(){<br />
if(teamView){<br />
hideTeamOverlay();<br />
<br />
$('#FilterButtons label').removeClass("active");<br />
if($(this).parent().parent().hasClass("Team"))<br />
$('#Teammembers-btn').addClass("active");<br />
else<br />
$('#Supervisors-btn').addClass("active");<br />
}<br />
$('#memberSelector a').removeClass("active");<br />
$(this).addClass("active");<br />
var memberKey = this.id.split("-")[1];<br />
member = memberData[memberKey];<br />
$("#Name").text(member.Name);<br />
<br />
smoothLoadImage(member.img);<br />
$('#Description').text(member.Description);<br />
});<br />
<br />
$('#Teamfoto-btn').click(function(){<br />
if(teamView == false){<br />
$('.team-overlay').css("display", "block");<br />
$('.team-overlay').animate({ opacity: 1}, 200);<br />
$('.memberview').animate({ opacity: 0}, 200);<br />
teamView = true;<br />
updateHeights();<br />
}<br />
});<br />
<br />
memberselector = $('#memberSelector');<br />
<br />
$('#Teammembers-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Supervisors-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Team');<br />
});<br />
<br />
$('#Supervisors-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Teammembers-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Supervisor');<br />
});<br />
<br />
$('#memberSelector').slick({<br />
prevArrow: '<img src="/wiki/images/3/3f/Heidelberg_prev-arrow.png" alt="prev-arrow" class="arrow arrow-prev"/>',<br />
nextArrow: '<img src="/wiki/images/e/e0/Heidelberg_next-arrow.png" alt="next-arrow" class="arrow arrow-next"/>',<br />
vertical: true,<br />
infinite: false,<br />
slidesToShow: 5,<br />
slidesToScroll: 5<br />
});<br />
$('#memberSelector').slickFilter('.Team');<br />
});<br />
<br />
$(window).resize(function(){<br />
updateHeights();<br />
});</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/js/teampageTeam:Heidelberg/js/teampage2014-10-18T01:00:03Z<p>Bunnech: </p>
<hr />
<div>var memberData = {<br />
"Max_H": { <br />
"Name" : "Max Horn", <br />
"img" : "/wiki/images/a/a7/Heidelberg_MaxH.jpg",<br />
"Description" : ""But after this has finished, I also want to do something in the wetlab", was one of the sentences most characterizing Max. He is definitely the software guy of the team. Compared to his programming, what we others coded was playing around with code blocks. For him it was always, the lower the level, the better. Therefore he is writing pure C code, as C++ does already too much by itself, he thinks.<br />
But still, he was somehow pressed to this role, as normally he is studying molecular biotechnology in 5th semester now. As iGEM@home was running, and he thought he would have a break from programming, the wiki as a project came upon him. On top, he is a perfectionist on software sides, so not only once he called out: "Nils, look how smooth the ring is moving!"<br />
"<br />
},<br />
"Charlotte": {<br />
"Name" : "Charlotte Bunne", <br />
"img" : "/wiki/images/6/69/Heidelberg_Charlotte.jpg",<br />
"Description" : "Charlotte is our youngest team member and already participated in iGEM in Germany´s first High School team in 2012. Studying Biosciences in her third semester, she impresses all team members with her energy, curiosity and ambition. She is the creative head behind nearly all artworks of our project. The wiki design originates from her imaginations and the BOINC video as well as the cover picture for our theme night “Religion and Synthetic Biology” arose from her hands. In team effort with Nils, she is conducting the linker screening experiments for the lysozyme circularization. In the course of these experiments Charlotte learned huge organisational skills that directs her abilities and energy into the right channels. In this way Charlotte became an indispensable team member."<br />
},<br />
"Nils": {<br />
"Name": "Nils Klughammer", <br />
"img" : "/wiki/images/f/ff/Heidelberg_Nils.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Silvan": {<br />
"Name": "Silvan Schmitz",<br />
"img" : "/wiki/images/c/cf/Heidelberg_Silvan.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Jan": {<br />
"Name": "Jan Gleixner",<br />
"img" : "/wiki/images/d/dd/Heidelberg_Jan.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Magdalena": {<br />
"Name": "Magdalena Büscher",<br />
"img" : "/wiki/images/f/f7/Heidelberg_Magdalena.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Carolin": {<br />
"Name": "Carolin Schmelas",<br />
"img" : "/wiki/images/4/49/Heidelberg_Carolin.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Elisabeth": {<br />
"Name": "Elisabeth Schäfer",<br />
"img" : "/wiki/images/7/71/Heidelberg_Elisabeth.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Jakob": {<br />
"Name": "Jakob Kreft",<br />
"img" : "/wiki/images/9/92/Heidelberg_Jakob.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Max_W": {<br />
"Name": "Max Waldhauer",<br />
"img" : "/wiki/images/5/5a/Heidelberg_MaxW.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Anna": {<br />
"Name": "Anna Huhn",<br />
"img" : "/wiki/images/c/c9/Heidelberg_Anna.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Constantin": {<br />
"Name": "Constantin Ahlmann", <br />
"img" : "/wiki/images/5/5a/Heidelberg_Constantin.jpg",<br />
"Description" : "Constantin is a hybrid of programming and lab guy: Not only has iGEM@home been his idea and he could demonstrate his programming skills working on this project, but also he managed to circularize Xylanase – again his idea. In his free time he gives Java classes to high-school students. His secret talent: dancing."<br />
},<br />
"Julia": {<br />
"Name": "Julia Neugebauer",<br />
"img" : "/wiki/images/b/b6/Heidelberg_Julia.jpg",<br />
"Description" : "I have done my bachelor and master studies in molecular biosciences at the University of Heidelberg. Currently, I am developing new confocal microscopy based screening methods using 3D cell culture. In the iGEM project, I was mainly involved in the DNMT1 project and helped in the setup of the different assays to measure xylanase, lysozyme and DNMT1 activity."<br />
},<br />
"Joel": {<br />
"Name": "Joel Beaudouin",<br />
"img" : "/wiki/images/7/7f/Heidelberg_Joel.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Stefen": {<br />
"Name": "Stefen Krämer",<br />
"img" : "/wiki/images/c/c0/Heidelberg_Stefen.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Pierre": {<br />
"Name": "Pierre Wehler", <br />
"img" : "/wiki/images/d/d5/Heidelberg_Piere.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Philipp": {<br />
"Name": "Philipp Bayer", <br />
"img" : "/wiki/images/0/09/Heidelberg_Philipp.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Barbara": {<br />
"Name": "Dr. Barbara Di Ventura", <br />
"img" : "/wiki/images/c/c5/Heidelberg_Barbara_DiVentura.jpg",<br />
"Description" : "Computer engineer by university training (carried out in the University of Rome “La Sapienza”), Barbara has done her Ph.D. in molecular biology in the laboratory of Luis Serrano, at the EMBL. Her Ph.D. project consisted in constructing a synthetic human p53 network in the yeast Saccharomyces cerevisiae. She was post-doc in the laboratory of Victor Sourjik, at the ZMBH. During this time she investigated the self-organizing properties of the Min system, the protein machinery that in Escherichia coli defines mid-cell. Since November 2011, Barbara heads the Synthetic Biology group in the department of Roland Eils, at the BioQuant. Barbara believes in the power of synthetic biology to create new functional devises and to teach important lessons about real biological systems. She also thinks that combining theory and experiments is the best strategy to understand the molecular mechanisms driving biological processes. Barbara finds the iGEM competition truly exciting and she is very happy to mentor the young, motivated and enthusiastic students of the Heidelberg iGEM 2014 team!"<br />
},<br />
"Eils": {<br />
"Name": "Prof. Dr. Roland Eils", <br />
"img" : "/wiki/images/1/19/Heidelberg_Roland_Eils.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
}<br />
<br />
};<br />
<br />
<br />
var teamView = true;<br />
<br />
<br />
function updateHeights(){<br />
$('#memberSelector').stop(true);<br />
var height = 0;<br />
if(teamView){<br />
height = $('.team-overlay').outerHeight();<br />
}<br />
else {<br />
height = $('#memberImage').height();<br />
}<br />
$('#memberSelector').animate({height: height}, 300, "swing", function(){<br />
updateSlick($('#memberSelector').height());<br />
});<br />
<br />
}<br />
<br />
function updateSlick(height){<br />
elementHeight = $('#memberSelector .row:first').outerHeight();<br />
numElements = Math.floor(height/elementHeight);<br />
memberselector = $('#memberSelector');<br />
memberselector.slickSetOption("slidesToShow", numElements, false);<br />
memberselector.slickSetOption("slidesToScroll", numElements, true);<br />
}<br />
<br />
function smoothLoadImage(src){<br />
$('.imageBorder').height($('#memberImage').height());<br />
$('#memberImageOverlay').attr("src", src);<br />
$('#memberImageOverlay').load(function(){<br />
$(this).fadeIn(400, "swing", function(){<br />
$('#memberImage').attr("src", src);<br />
$('#memberImage').load(function(){<br />
$('#memberImageOverlay').hide();<br />
$('.imageBorder').css("height", "");<br />
});<br />
});<br />
<br />
});<br />
}<br />
<br />
function hideTeamOverlay(callback){<br />
$('.team-overlay').animate({ opacity: 0}, 200, "swing", function(){$('.team-overlay').css("display","none");});<br />
$('.memberview').animate({ opacity: 1}, 200, "swing", function(){<br />
teamView = false;<br />
updateHeights();<br />
});<br />
}<br />
<br />
<br />
$(document).ready(function(){<br />
$('#memberImage').load(function(){<br />
updateHeights();<br />
});<br />
$('.team-overlay img').load(function(){<br />
updateHeights();<br />
});<br />
<br />
$('#memberSelector a').click(function(){<br />
if(teamView){<br />
hideTeamOverlay();<br />
<br />
$('#FilterButtons label').removeClass("active");<br />
if($(this).parent().parent().hasClass("Team"))<br />
$('#Teammembers-btn').addClass("active");<br />
else<br />
$('#Supervisors-btn').addClass("active");<br />
}<br />
$('#memberSelector a').removeClass("active");<br />
$(this).addClass("active");<br />
var memberKey = this.id.split("-")[1];<br />
member = memberData[memberKey];<br />
$("#Name").text(member.Name);<br />
<br />
smoothLoadImage(member.img);<br />
$('#Description').text(member.Description);<br />
});<br />
<br />
$('#Teamfoto-btn').click(function(){<br />
if(teamView == false){<br />
$('.team-overlay').css("display", "block");<br />
$('.team-overlay').animate({ opacity: 1}, 200);<br />
$('.memberview').animate({ opacity: 0}, 200);<br />
teamView = true;<br />
updateHeights();<br />
}<br />
});<br />
<br />
memberselector = $('#memberSelector');<br />
<br />
$('#Teammembers-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Supervisors-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Team');<br />
});<br />
<br />
$('#Supervisors-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Teammembers-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Supervisor');<br />
});<br />
<br />
$('#memberSelector').slick({<br />
prevArrow: '<img src="/wiki/images/3/3f/Heidelberg_prev-arrow.png" alt="prev-arrow" class="arrow arrow-prev"/>',<br />
nextArrow: '<img src="/wiki/images/e/e0/Heidelberg_next-arrow.png" alt="next-arrow" class="arrow arrow-next"/>',<br />
vertical: true,<br />
infinite: false,<br />
slidesToShow: 5,<br />
slidesToScroll: 5<br />
});<br />
$('#memberSelector').slickFilter('.Team');<br />
});<br />
<br />
$(window).resize(function(){<br />
updateHeights();<br />
});</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/js/teampageTeam:Heidelberg/js/teampage2014-10-18T00:57:28Z<p>Bunnech: </p>
<hr />
<div>var memberData = {<br />
"Max_H": { <br />
"Name" : "Max Horn", <br />
"img" : "/wiki/images/a/a7/Heidelberg_MaxH.jpg",<br />
"Description" : ""But after this has finished, I also want to do something in the wetlab", was one of the sentences most characterizing Max. He is definitely the software guy of the team. Compared to his programming, what we others coded was playing around with code blocks. For him it was always, the lower the level, the better. Therefore he is writing pure C code, as C++ does already too much by itself, he thinks.<br />
But still, he was somehow pressed to this role, as normally he is studying molecular biotechnology in 5th semester now. As iGEM@home was running, and he thought he would have a break from programming, the wiki as a project came upon him. On top, he is a perfectionist on software sides, so not only once he called out: "Nils, look how smooth the ring is moving!"<br />
"<br />
},<br />
"Charlotte": {<br />
"Name" : "Charlotte Bunne", <br />
"img" : "/wiki/images/6/69/Heidelberg_Charlotte.jpg",<br />
"Description" : "Charlotte is our youngest team member and already participated in iGEM in Germany´s first High School team in 2012. Studying Biosciences in her third semester, she impresses all team members with her energy, curiosity and ambition. She is the creative head behind nearly all artworks of our project. The wiki design originates from her imaginations and the BOINC video as well as the cover picture for our theme night “Religion and Synthetic Biology” arose from her hands. In team effort with Nils, she is conducting the linker screening experiments for the lysozyme circularization. In the course of these experiments Charlotte learned huge organisational skills that directs her abilities and energy into the right channels. In this way Charlotte became an indispensable team member."<br />
},<br />
"Nils": {<br />
"Name": "Nils Klughammer", <br />
"img" : "/wiki/images/f/ff/Heidelberg_Nils.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Silvan": {<br />
"Name": "Silvan Schmitz",<br />
"img" : "/wiki/images/c/cf/Heidelberg_Silvan.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Jan": {<br />
"Name": "Jan Gleixner",<br />
"img" : "/wiki/images/d/dd/Heidelberg_Jan.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Magdalena": {<br />
"Name": "Magdalena Büscher",<br />
"img" : "/wiki/images/f/f7/Heidelberg_Magdalena.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Carolin": {<br />
"Name": "Carolin Schmelas",<br />
"img" : "/wiki/images/4/49/Heidelberg_Carolin.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Elisabeth": {<br />
"Name": "Elisabeth Schäfer",<br />
"img" : "/wiki/images/7/71/Heidelberg_Elisabeth.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Jakob": {<br />
"Name": "Jakob Kreft",<br />
"img" : "/wiki/images/9/92/Heidelberg_Jakob.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Max_W": {<br />
"Name": "Max Waldhauer",<br />
"img" : "/wiki/images/5/5a/Heidelberg_MaxW.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Anna": {<br />
"Name": "Anna Huhn",<br />
"img" : "/wiki/images/c/c9/Heidelberg_Anna.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Constantin": {<br />
"Name": "Constantin Ahlmann", <br />
"img" : "/wiki/images/5/5a/Heidelberg_Constantin.jpg",<br />
"Description" : "Constantin is a hybrid of programming and lab guy: Not only has iGEM@home been his idea and he could demonstrate his programming skills working on this project, but also he managed to circularize Xylanase – again his idea. In his free time he gives Java classes to high-school students. His secret talent: dancing."<br />
},<br />
"Julia": {<br />
"Name": "Julia Neugebauer",<br />
"img" : "/wiki/images/b/b6/Heidelberg_Julia.jpg",<br />
"Description" : "I have done my bachelor and master studies in molecular biosciences at the University of Heidelberg. Currently, I am developing new confocal microscopy based screening methods using 3D cell culture. In the iGEM project, I was mainly involved in the DNMT1 project and helped in the setup of the different assays to measure xylanase, lysozyme and DNMT1 activity."<br />
},<br />
"Joel": {<br />
"Name": "Joel Beaudouin",<br />
"img" : "/wiki/images/7/7f/Heidelberg_Joel.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Stefen": {<br />
"Name": "Stefen Krämer",<br />
"img" : "/wiki/images/c/c0/Heidelberg_Stefen.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Pierre": {<br />
"Name": "Pierre Wehler", <br />
"img" : "/wiki/images/d/d5/Heidelberg_Piere.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Philipp": {<br />
"Name": "Philipp Bayer", <br />
"img" : "/wiki/images/0/09/Heidelberg_Philipp.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
},<br />
"Barbara": {<br />
"Name": "Dr. Barbara Di Ventura", <br />
"img" : "/wiki/images/c/c5/Heidelberg_Barbara_DiVentura.jpg",<br />
"Description" : "Computer engineer by university training (carried out in the<br />
University of Rome “La Sapienza”), Barbara has done her Ph.D. in<br />
molecular biology in the laboratory of Luis Serrano, at the EMBL. Her<br />
Ph.D. project consisted in constructing a synthetic human p53 network<br />
in the yeast Saccharomyces cerevisiae. She was post-doc in the<br />
laboratory of Victor Sourjik, at the ZMBH. During this time she<br />
investigated the self-organizing properties of the Min system, the<br />
protein machinery that in Escherichia coli defines mid-cell. Since<br />
November 2011, Barbara heads the Synthetic Biology group in the<br />
department of Roland Eils, at the BioQuant. Barbara believes in the<br />
power of synthetic biology to create new functional devises and to<br />
teach important lessons about real biological systems. She also thinks<br />
that combining theory and experiments is the best strategy to<br />
understand the molecular mechanisms driving biological processes.<br />
Barbara finds the iGEM competition truly exciting and she is very<br />
happy to mentor the young, motivated and enthusiastic students of the<br />
Heidelberg iGEM 2014 team!"<br />
},<br />
"Eils": {<br />
"Name": "Prof. Dr. Roland Eils", <br />
"img" : "/wiki/images/1/19/Heidelberg_Roland_Eils.jpg",<br />
"Description" : "Ludwig XIV. gilt als klassischer Vertreter des höfischen Absolutismus. Der Leitsatz des Absolutismus, L’État, c’est moi! (Der Staat bin ich!) wird ihm jedoch fälschlicherweise zugeschrieben.[1] Er festigte die Macht der Krone durch den Ausbau der Verwaltung, die Bekämpfung der Opposition in Kreisen des Adels sowie durch die Förderung der französischen Wirtschaft. Die Hofkultur wurde ganz auf die Person des Herrschers zugeschnitten. Zum Symbol für dessen herausragende Stellung wurde sein prunkvolles Auftreten. Der König förderte Künste und Wissenschaften, was eine Blütezeit der französischen Kultur zur Folge hatte. Ludwig XIV. vertrat eine expansive und kriegerische Außenpolitik, durch die Frankreich unter seiner Regentschaft eine dominierende Stellung in Europa gewann und seine Großmachtstellung in der Neuzeit etablierte."<br />
}<br />
<br />
};<br />
<br />
<br />
var teamView = true;<br />
<br />
<br />
function updateHeights(){<br />
$('#memberSelector').stop(true);<br />
var height = 0;<br />
if(teamView){<br />
height = $('.team-overlay').outerHeight();<br />
}<br />
else {<br />
height = $('#memberImage').height();<br />
}<br />
$('#memberSelector').animate({height: height}, 300, "swing", function(){<br />
updateSlick($('#memberSelector').height());<br />
});<br />
<br />
}<br />
<br />
function updateSlick(height){<br />
elementHeight = $('#memberSelector .row:first').outerHeight();<br />
numElements = Math.floor(height/elementHeight);<br />
memberselector = $('#memberSelector');<br />
memberselector.slickSetOption("slidesToShow", numElements, false);<br />
memberselector.slickSetOption("slidesToScroll", numElements, true);<br />
}<br />
<br />
function smoothLoadImage(src){<br />
$('.imageBorder').height($('#memberImage').height());<br />
$('#memberImageOverlay').attr("src", src);<br />
$('#memberImageOverlay').load(function(){<br />
$(this).fadeIn(400, "swing", function(){<br />
$('#memberImage').attr("src", src);<br />
$('#memberImage').load(function(){<br />
$('#memberImageOverlay').hide();<br />
$('.imageBorder').css("height", "");<br />
});<br />
});<br />
<br />
});<br />
}<br />
<br />
function hideTeamOverlay(callback){<br />
$('.team-overlay').animate({ opacity: 0}, 200, "swing", function(){$('.team-overlay').css("display","none");});<br />
$('.memberview').animate({ opacity: 1}, 200, "swing", function(){<br />
teamView = false;<br />
updateHeights();<br />
});<br />
}<br />
<br />
<br />
$(document).ready(function(){<br />
$('#memberImage').load(function(){<br />
updateHeights();<br />
});<br />
$('.team-overlay img').load(function(){<br />
updateHeights();<br />
});<br />
<br />
$('#memberSelector a').click(function(){<br />
if(teamView){<br />
hideTeamOverlay();<br />
<br />
$('#FilterButtons label').removeClass("active");<br />
if($(this).parent().parent().hasClass("Team"))<br />
$('#Teammembers-btn').addClass("active");<br />
else<br />
$('#Supervisors-btn').addClass("active");<br />
}<br />
$('#memberSelector a').removeClass("active");<br />
$(this).addClass("active");<br />
var memberKey = this.id.split("-")[1];<br />
member = memberData[memberKey];<br />
$("#Name").text(member.Name);<br />
<br />
smoothLoadImage(member.img);<br />
$('#Description').text(member.Description);<br />
});<br />
<br />
$('#Teamfoto-btn').click(function(){<br />
if(teamView == false){<br />
$('.team-overlay').css("display", "block");<br />
$('.team-overlay').animate({ opacity: 1}, 200);<br />
$('.memberview').animate({ opacity: 0}, 200);<br />
teamView = true;<br />
updateHeights();<br />
}<br />
});<br />
<br />
memberselector = $('#memberSelector');<br />
<br />
$('#Teammembers-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Supervisors-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Team');<br />
});<br />
<br />
$('#Supervisors-btn').click(function(){<br />
$('#memberSelector a').removeClass("active");<br />
$('#Teammembers-btn').removeClass("active");<br />
$(this).addClass("active");<br />
memberselector.slickFilter('.Supervisor');<br />
});<br />
<br />
$('#memberSelector').slick({<br />
prevArrow: '<img src="/wiki/images/3/3f/Heidelberg_prev-arrow.png" alt="prev-arrow" class="arrow arrow-prev"/>',<br />
nextArrow: '<img src="/wiki/images/e/e0/Heidelberg_next-arrow.png" alt="next-arrow" class="arrow arrow-next"/>',<br />
vertical: true,<br />
infinite: false,<br />
slidesToShow: 5,<br />
slidesToScroll: 5<br />
});<br />
$('#memberSelector').slickFilter('.Team');<br />
});<br />
<br />
$(window).resize(function(){<br />
updateHeights();<br />
});</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/ProjectTeam:Heidelberg/Project2014-10-18T00:48:24Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/MainTemplate|unresponsive=}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstrapcss}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstraptheme}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/overrides}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/jquery}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/bootstrapjs}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/wikipage}}<br />
<html><br />
<style type="text/css"><br />
#myContainer {<br />
padding:0;<br />
background-color: black;<br />
background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg);<br />
background-repeat: no-repeat;<br />
background-size: 100% auto;<br />
}<br />
<br />
#light:hover {<br />
color: #FF7E25;<br />
}<br />
<br />
.main {<br />
margin-top: 25px;<br />
}<br />
<br />
.middle {<br />
font-size: 3em;<br />
}<br />
<br />
.large {<br />
font-size: 5em;<br />
font-weight: bold;<br />
}<br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icon-scale:hover {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icon-scale {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.ringbox{<br />
/*<br />
width: 750px;<br />
height: 600px;<br />
background-image:url('/wiki/images/d/dc/Ring_Project.png');<br />
background-size: 550px;<br />
background-repeat: no-repeat;<br />
*/<br />
position: absolute;<br />
top:260px;<br />
left:140px;<br />
height:640px;<br />
z-index:3;<br />
}<br />
<br />
.abstract-special {<br />
color: white;<br />
}<br />
<br />
.abstract-special span {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
display: block;<br />
}<br />
<br />
.abstract-special img {<br />
height: 15px;<br />
}<br />
<br />
.toolbox-icon {<br />
height: 90px;<br />
position: absolute;<br />
right:-43px;<br />
bottom:-45px;<br />
}<br />
<br />
#ring-background {<br />
width: 450px;<br />
height: auto;<br />
opacity:0.8;<br />
}<br />
<br />
.block{<br />
display:block;<br />
text-decoration:none;<br />
color: white;<br />
}<br />
<br />
.block:hover{<br />
text-decoration: none;<br />
}<br />
<br />
.box {<br />
background-color: rgba(81,81,81,0.7);<br />
padding: 15px;<br />
position:relative;<br />
}<br />
<br />
.box:hover {<br />
border:solid 2px #DE4230;<br />
padding: 13px;<br />
}<br />
<br />
<br />
.descr-box {<br />
width: 250px;<br />
height: 100px;<br />
position: absolute;<br />
}<br />
<br />
.descr-box h3 {<br />
margin-top: 10px;<br />
margin-bottom: 0;<br />
text-align: left;<br />
}<br />
<br />
.descr-box h3 span {<br />
font-size: 0.8em;<br />
}<br />
<br />
.descr-box div {<br />
border-right: solid white 2px;<br />
border-top: solid white 2px;<br />
padding-right:43px;<br />
}<br />
<br />
.descr-box span {<br />
display: block;<br />
}<br />
<br />
#circ-box {<br />
right: 160px;<br />
top: -120px;<br />
}<br />
<br />
#circ-box img {<br />
bottom: -130px;<br />
height: 120px;<br />
right: -57px;<br />
}<br />
<br />
#circ-box div {<br />
height: 114px;<br />
}<br />
<br />
#oligo-box {<br />
left: -100px;<br />
top: -10px;<br />
width: 200px;<br />
}<br />
<br />
#onoff-box {<br />
left: -105px;<br />
top: 120px;<br />
width: 150px;<br />
}<br />
<br />
#fusion-box {<br />
left: -100px;<br />
top: 330px;<br />
width: 190px;<br />
}<br />
<br />
#fusion-box img {<br />
top: -16px;<br />
}<br />
<br />
#fusion-box div {<br />
border-right: none;<br />
}<br />
<br />
#purification-box {<br />
left: 20px;<br />
top: 445px;<br />
width: 200px;<br />
}<br />
<br />
#purification-box img {<br />
top: -70px;<br />
}<br />
<br />
#purification-box div {<br />
border-top: none;<br />
border-bottom: solid white 2px;<br />
}<br />
<br />
#abstract-content {<br />
display:none;<br />
}<br />
<br />
.graphicalAbstract {<br />
background-image:url('/wiki/images/f/fa/Heidelberg_Project_Background.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
position:relative;<br />
z-index: 1;<br />
height:900px;<br />
}<br />
<br />
#redOverlay {<br />
position:absolute;<br />
width:100%;<br />
height:100%;<br />
left:0;<br />
top:0;<br />
display:none;<br />
background-image:url('/wiki/images/5/51/Heidelberg_project_red_overlay.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
z-index:2;<br />
}<br />
<br />
#lightning {<br />
z-index: 3;<br />
position:absolute;<br />
top: 610px;<br />
left: 460px;<br />
color:white;<br />
}<br />
<br />
<br />
#screened {<br />
z-index: 3;<br />
position:absolute;<br />
left: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#calibrated {<br />
z-index: 3;<br />
position:absolute;<br />
right: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#dnmt1-img {<br />
position: absolute;<br />
height: 155px;<br />
right: 15px;<br />
z-index:4;<br />
}<br />
<br />
a:hover #dnmt1-img {<br />
right: 13px;<br />
}<br />
<br />
#dnmt1-box {<br />
right: 40px;<br />
top: 340px;<br />
position: absolute;<br />
}<br />
<br />
#xylanase-box {<br />
width:250px;<br />
top: 556px;<br />
right:40px;<br />
position:absolute;<br />
}<br />
<br />
#xylanase-img {<br />
height: 140px;<br />
position: absolute;<br />
right: 15px;<br />
}<br />
<br />
a:hover #xylanase-img {<br />
right: 13px;<br />
}<br />
<br />
#toolbox-text{<br />
position: absolute;<br />
top: 145px;<br />
right: -135px;<br />
font-size: 5em;<br />
line-height: 70px;<br />
font-weight: bold;<br />
}<br />
<br />
#linker-links {<br />
position: absolute;<br />
width: 405px;<br />
right: 60px;<br />
top: 35px;<br />
height: 300px;<br />
}<br />
<br />
#toolbox {<br />
position:absolute;<br />
right: 50px;<br />
bottom: 190px;<br />
}<br />
<br />
#toolbox:hover > span {<br />
color: white;<br />
}<br />
<br />
.container {<br />
width: 1170px;<br />
}<br />
<br />
.scheisslinkbleibweiss {<br />
color: white;<br />
}<br />
<br />
.scheisslinkbleibweiss:hover {<br />
color: white;<br />
}<br />
<br />
div.margin-top { margin-top: 100px; }<br />
<br />
img.medal {<br />
height:200px;<br />
margin-top: 40px;<br />
text-align: center;<br />
}<br />
<br />
.center {<br />
text-align:center;<br />
}<br />
<br />
.linie {<br />
margin:20px 40px;<br />
border: solid 1px black;<br />
}<br />
<br />
.vcenter-table{<br />
display: table;<br />
}<br />
<br />
.vcenter-cell {<br />
display: table-cell;<br />
vertical-align: middle;<br />
float: none;<br />
}<br />
<br />
</style><br />
<div id="myContainer" class="container"><br />
</html><br />
{{:Team:Heidelberg/Templates/BootstrapNav|<br />
red=|<br />
white=true|<br />
red-logo=true|<br />
white-logo=|<br />
header-bg=|<br />
header-img=|<br />
title=<br />
}}<br />
<html><br />
<div class="container main" style="color: white;"><br />
<div id="abstract-dropdown" class="row abstract-special dark-grey"><br />
<div class="col-lg-offset-1 col-lg-11"><br />
<h4><img id="dropdownImg" src="/wiki/images/7/70/Heidelberg_Abstract-dropdown.png"/>&nbsp;Project overview</h4><br />
</div><br />
<!--<div class="col-lg-9"><br />
<span>Click to read the project overview</span><br />
</div>--><br />
<div id="abstract-content" class="col-lg-12" ><br />
<p>Proteins are the functional basis of all biological processes and being able to control and improve their functions through design and engineering is one of the fundamental goals of synthetic biology. While conventional proteins subsist as chains of amino acids with defined beginning and end, nature has found a curious way of enhancing a protein capabilities: circularization.<br />
In head to tail circularized peptides the terminal amino acids are joined together just like in the rest of the chain, forming a circular structure. Such peptides have been discovered in all kingdoms of life during the past years and they are unified by an extreme stability towards high temperatures, proteases and changes in pH.</p><br />
<br />
<p>Given these attractive features of circular proteins, methods to circularize otherwise linear proteins have been devised, one of which is based on autocatalytic protein domains called inteins. <br />
We have applied the principle of circular peptides to synthetic biology by introducing a BioBrick-based, standardised method for circularizing any protein using inteins.</p><br />
<br />
<p>Synthetically connecting a protein&apos;s termini without disrupting its 3D structure and function is, however, a delicate task which has so far been accomplished only for relatively small proteins whose ends lie close to each other. We therefore saw the need for a comprehensive software that predicts the process of circularization. With CRAUT we have brought into existence a powerful open-source software to predict an optimal linker to support circularization of a protein preserving its 3D structure and function.<br /><br />
Due to our lack of calculating power we deployed this software on the distributed computing platform BOINC in an initiative we call iGEM@home.</p><br />
<br />
<p>Based on our software predictions, we constructed linkers to circularize the 871 a.a. long methyltransferase Dnmt1 and provide data suggesting that circular DNMT1 is more functional than its linear counterpart at high temperatures. Our results have strong implications for developing an innovative PCR-based technique that could revolutionize epigenetic studies and cancer research by maintaining the methylation pattern of the DNA template during amplification.</p><br />
<br />
<p>Eventually, inteins can be used to post-translationally modify any protein in a multitude of ways going far beyond circularization. We therefore created a BioBrick-based intein toolbox to allow for easy and standardised protein manipulation. We think that our toolbox will be invaluable to many systems biology projects aimed at dissecting or re-engineering the function of cellular networks.</p><br />
</div><br />
</div><br />
<div class="graphicalAbstract"><br />
<div id="redOverlay"></div><br />
<div style="z-index:3;position:relative; height:100%;"><br />
<div id="linker-links"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome" class="block box" id="calibrated"><br />
<img style="height:60px;display: inline-block;" src="/wiki/images/e/ea/Heidelberg_Project_Computer.png"><br />
<span style="position: relative;top: 10px;display: inline-block;"><br />
calibrated<br><br />
<span class="red-text">in silico</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Linker_Screening" class="block box" id="screened"><br />
<span style="position: relative;top:10px;display: inline-block;"><br />
screened <span class="red-text">in vitro</span><br><br />
with lysozyme</span><br />
<img style="height:60px; display:inline-block;" src="/wiki/images/d/df/Heidelberg_Lysozyme.png" /><br />
</a><br />
<a href="/Team:Heidelberg/Software/Linker_Software" class="block box" style="bottom:0; left:-20px; position:absolute;width:170px;"><br />
<img src="/wiki/images/4/42/Craut_small.png" alt="..." style="width:100%;"/><br />
<span class="red-text" >circularize</span> it<br><br />
with calculated linkers<br />
</a><br />
</div><br />
<div class="ringbox"><br />
<img src="/wiki/images/0/0d/Heidelberg_Firering_red.png" id="ring-background" /><br />
<div id="circ-box" class="descr-box"><br />
<a href="/Team:Heidelberg/Toolbox/Circularization"><br />
<img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" id="circ-icon" class="toolbox-icon toolbox-icon-scale"/><br />
</a><br />
<h3>CIRCULARIZATION</h3><br />
<div><span>Create a linker with our crowd computing software and make your protein heat stable</span></div><br />
</div><br />
<div id="oligo-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><img src="/wiki/images/4/40/Oligomerization.png" id="oligo-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>OLIGOMERIZATION</h3><div><span>Fuse multiple Proteins or Domains using Inteins</span></div><br />
</div><br />
<div id="fusion-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" id="fusion-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>FUSION</h3><div><span>Fuse two Proteins or Domains together using Inteins</span></div><br />
</div><br />
<div id="onoff-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" id="onoff-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>ON/OFF</h3><div><span>Activate or deactivate Proteins using Inteins</span></div></div><br />
<div id="purification-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" id="purification-icon" class="toolbox-icon toolbox-icon-scale"/></a><div><h3>PURIFICATION</h3></div><span>Placeholder</span></div><br />
<div id="toolbox-text"><br />
the intein<br><br />
<span><a class="scheisslinkbleibweiss" href="/Team:Heidelberg/Project/Toolbox">toolbox</a><span><br />
</div><br />
</div><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Induction" class="block" id="lightning"><br />
<img class="toolbox-icon-scale" style="height:110px;display: inline-block;" src="/wiki/images/8/83/Heidelberg_Project_Lightning.png"><span style="position: relative;top: 20px;display: inline-block;">&nbsp;inducible via<br><br />
<span style="font-weight:bold;position: relative;left: -18px;" class="red-text">light induction</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/PCR_2.0" class="block box" style="width:250px;" id="dnmt1-box"><br />
<img id="dnmt1-img" src="/wiki/images/a/a6/Heidelberg_Project_Dnmt1.png"><br />
<span style="position:relative; z-index:5;" class="block"><br />
<span style="font-size:1.5em;"><br />
<span class="red-text">Heat-stable</span><br> circular <br><span style="font-weight:bold;">DNA-<br/>Methyltransferase</span><br />
</span><br><br />
<span style="font-weight:bold;font-size: 2.5em; text-align:right;line-height: 35px;"><br />
<span class="red-text">PCR 2.0</span><br />
</span><br />
</span><br />
</a><br />
<a href="/Team:Heidelberg/Toolbox_Guide" class="block" id="toolbox"><br />
<span style="position:relative; display: inline-block;height:110px; width:110px; vertical-align: middle;"><br />
<img style="height:100%; position:absolute; top:0; left:0;" id="toolbox-img" src="/wiki/images/2/24/Heidelberg_Project_Toolbox_guide.png" /><br />
<img style="height:100%; position:absolute; top:0; left:0; display:none;" id="toolbox-img-hover" src="/wiki/images/4/4c/Heidelberg_Toolbox_guide_highlighted.png" /><br />
</span><br />
<span style="position: relative;top: 20px;display: inline-block; vertical-align:middle;"><br />
<span style="font-weight:bold;" class="red-text">modify your protein</span><br/><br />
using the toolbox guide<br />
</span><br />
</a><br />
<div class="clearfix"></div><br />
</div><br />
</div><br />
</div><br />
<div class="container" id="Achievements"><br />
<ul class="nav nav-tabs" role="tablist"><br />
<li class="active" style="font-size:30px"><a href="#Achievements-tab" role="tab" data-toggle="tab"><img src="https://static.igem.org/mediawiki/2014/2/22/Heidelberg_Achievements_red.png" height="50px" alt="Button"> Achievements</a></li><br />
<li style="font-size:30px"><a href="#Medal_Criteria-tab" role="tab" data-toggle="tab"> <img src="https://static.igem.org/mediawiki/2014/3/3f/Heidelberg_Gold_red.png" height="50px" alt="Button"> Medal Criteria</a></li><br />
</ul><br />
<div class="tab-content"><br />
<div class="tab-pane fade in active" style="background-color:white; color:black;" id="Achievements-tab"><br />
<br />
<div class="row" style="margin-top: 20px; background-color:white"><br />
</div><br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Achievements_3.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establishing protein circularization as a NEW BIOENGINEERING TOOL in synthetic biology.</p> <br />
<p style="margin-left:50px; font-size:20px">Contributing to iGEM with a new foundational advance!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/Achievement_1.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Providing a NEW COMPREHENSIVE TOOLBOX based on inteins for modifying proteins post-translationally.</p> <br />
<p style="margin-left:50px; font-size:20px">Sending 67 Biobricks to Registry of Biological parts!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Achievement_2.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Development of a NEW STANDARD to make the use of inteins easy and modular.</p> <br />
<p style="margin-left:50px; font-size:20px">Establishment of a new <a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC">RFC</a>!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/1b/Achievements_toolbox.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Showing that the toolbox WORKS: proteins are circularized and split fluorescent proteins are reconstituted.</p> <br />
<p style="margin-left:50px; font-size:20px">Making Gels, Western Blots, Fluorescence-based Assays and Mass spectrometry to prove it! </p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/2/26/Achievements_4.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating circular DNMT1 and showing that it is ACTIVE.</p> <br />
<p style="margin-left:50px; font-size:20px">For the first time achieving the circularization of a large protein!</p><br />
<p style="margin-left:50px; font-size:20px">Circularizing LYSOZYME and XYLANASE, two very important proteins for<br />
research and industry!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/5/5a/Achievements_craut.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Developing a NEW SOFTWARE to calculate customized linkers to circularize proteins.</p> <br />
<p style="margin-left:50px; font-size:20px">Making CRAUT open-source for the scientific community.</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/e/e5/Heidelberg_Frontpage_igemathome.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px"> Establishing a distributed computing platform called <a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome">iGEM@home</a>.</p> <br />
<p style="margin-left:50px; font-size:20px">Using this platform as an entirely new way to reach out to the world with synthetic biology concepts!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
</div><br />
</div><br />
<div class="linie"></div><br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/Achievements_md.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating a NEW SOFTWARE to display the notebook on the wiki.</p> <br />
<p style="margin-left:50px; font-size:20px">Distributing MidNightDOC to the iGEM community to help future teams organize their protocols!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="tab-pane fade" style="color:white;" id="Medal_Criteria-tab"><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin-top: 20px"><br />
</div><br />
<div class="row vcenter-table"> <br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/6/63/Heidelberg_Bronze.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Bronze</h1><br />
<br><br />
<ul><br />
<li>Please find a comprehensive compilation of <a href="https://2014.igem.org/Team:Heidelberg/Team/Sponsoring">sponsors</a>, partners and scientific contributors on our <a href="https://2014.igem.org/Team:Heidelberg/Team/Attributions">acknowledgements page</a>. </li><br />
<br/><br />
<li>We also encourage you to take notice of the projects “Photo-intein” and “Mito-intein” by <a href="https://2014.igem.org/Team:Queens_Canada/Project">iGEM team Queens from Canada</a> that may supply you with complementary information and tools for the use of inteins in synthetic biology!</li><br />
<br/><br />
<li>A list of links to more than 60 parts in the registry submitted by our team (being or not being part of the new intein toolbox) can be found <a href="https://2014.igem.org/Team:Heidelberg/Parts#allParts">here</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/b/bf/Heidelberg_Silver.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Silver</h1><br />
<br><br />
<ul><br />
<li>We experimentally validated that our biobricks <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, <a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100 </a>and <a href="http://parts.igem.org/Part:BBa_K1362101">BBa_K1362101</a> work as expected. For more information on the <a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">parts</a> please visit the corresponding main pages in the parts registry or explore their involvement in our subprojects.</li><br />
<br/><br />
<li>Religious perceptions of synthetic biology have been part of several surveys during the past ten years of iGEM and Human Practices projects. Since religious groups cover the majority of worlds population, deliver moral values and wield power at the same time, we decided to dedicate a whole event on the topic of religion, philosophy and ethics regarding synthetic biology. Please find an <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/Ethics">evaluation of our event</a> on the corresponding Human Practices pages. <!--In order to reassure ourselves about the acceptability of our project and synthetic biology in general, we also used this opportunity to build up on the work of the iGEM Team Heidelberg 2013 and conducted a survey that addresses basic questions regarding the public reflection of our work.--><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/0/0a/Heidelberg_Gold.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Gold</h1><br />
<ul><br />
<li>We improved the function of the <b>already existing</b> biobrick part <a href="http://parts.igem.org/Part:BBa_K117505">BBa_K1175005 </a>by optimizing and resubmitting the corresponding sequence of B. subtilis xylanase to the registry (Part:<a href="http://parts.igem.org/Part:BBa_K1362020"> BBa_K1362020</a>). In addition, we submitted a new part for expression of <a href="http://parts.igem.org/Part:BBa_K1362022">circularized xylanase </a>(BBa_K1362022) that might be used in future applications with need for refined enzyme stability.</li><br />
<br/><br />
<li>Despite the fact that we focused on building a set of powerful soft- and wetware tools to help future iGEM-teams developing and realizing projects in synthetic biology, we are happy to announce that we were also able to help out several team during the course of our project, aspecially with sending <a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones"> our expression vectors</a>. Read more abou in in our <a href="https://2014.igem.org/Team:Heidelberg/Team/Collaborations">Collaborations</a>.</li><br />
<br/><br />
<li>In the style of of the new iGEM community labs track that involves science amateurs “beyond the accolades of scientific publishing and economic reward”, we sought for a new way to involve laymen in actual science and build a strong community of well informed supporters and communicators of synthetic biology at the same time. Now we proudly present the crowd sourcing and communication platform <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
</div><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
if(window.location.hash) {<br />
var hash = window.location.hash.substring(1); //Puts hash in variable, and removes the # character<br />
if(hash == "Abstract")<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
$('#abstract-dropdown').click(function() {<br />
if($('#abstract-content').css("display") == 'none'){<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
else{<br />
$('#abstract-content').slideUp(400, function() {$('#dropdownImg').attr("src", "/wiki/images/7/70/Heidelberg_Abstract-dropdown.png");});<br />
}<br />
});<br />
<br />
$('#linker-links').mouseenter(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeIn();<br />
});<br />
<br />
$('#linker-links').mouseleave(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeOut();<br />
});<br />
<br />
$('.descr-box span').css("opacity", 0);<br />
$('.descr-box h3, .descr-box > a')<br />
.mouseenter(function(){<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent()<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 1}, 800);<br />
})<br />
.mouseleave(function() {<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent();<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 0}, 800);<br />
});<br />
<br />
$('#toolbox')<br />
.mouseover(function() {<br />
$('#toolbox-img-hover').fadeIn();<br />
})<br />
.mouseleave(function() {<br />
$('#toolbox-img-hover').fadeOut();<br />
});<br />
<br />
$('#myTab a').click(function (e) {<br />
e.preventDefault()<br />
$(this).tab('show')<br />
})<br />
<br />
});<br />
</script><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/ProjectTeam:Heidelberg/Project2014-10-18T00:47:08Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/MainTemplate|unresponsive=}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstrapcss}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstraptheme}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/overrides}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/jquery}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/bootstrapjs}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/wikipage}}<br />
<html><br />
<style type="text/css"><br />
#myContainer {<br />
padding:0;<br />
background-color: black;<br />
background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg);<br />
background-repeat: no-repeat;<br />
background-size: 100% auto;<br />
}<br />
<br />
#light:hover {<br />
color: #FF7E25;<br />
}<br />
<br />
.main {<br />
margin-top: 25px;<br />
}<br />
<br />
.middle {<br />
font-size: 3em;<br />
}<br />
<br />
.large {<br />
font-size: 5em;<br />
font-weight: bold;<br />
}<br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icon-scale:hover {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icon-scale {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.ringbox{<br />
/*<br />
width: 750px;<br />
height: 600px;<br />
background-image:url('/wiki/images/d/dc/Ring_Project.png');<br />
background-size: 550px;<br />
background-repeat: no-repeat;<br />
*/<br />
position: absolute;<br />
top:260px;<br />
left:140px;<br />
height:640px;<br />
z-index:3;<br />
}<br />
<br />
.abstract-special {<br />
color: white;<br />
}<br />
<br />
.abstract-special span {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
display: block;<br />
}<br />
<br />
.abstract-special img {<br />
height: 15px;<br />
}<br />
<br />
.toolbox-icon {<br />
height: 90px;<br />
position: absolute;<br />
right:-43px;<br />
bottom:-45px;<br />
}<br />
<br />
#ring-background {<br />
width: 450px;<br />
height: auto;<br />
opacity:0.8;<br />
}<br />
<br />
.block{<br />
display:block;<br />
text-decoration:none;<br />
color: white;<br />
}<br />
<br />
.block:hover{<br />
text-decoration: none;<br />
}<br />
<br />
.box {<br />
background-color: rgba(81,81,81,0.7);<br />
padding: 15px;<br />
position:relative;<br />
}<br />
<br />
.box:hover {<br />
border:solid 2px #DE4230;<br />
padding: 13px;<br />
}<br />
<br />
<br />
.descr-box {<br />
width: 250px;<br />
height: 100px;<br />
position: absolute;<br />
}<br />
<br />
.descr-box h3 {<br />
margin-top: 10px;<br />
margin-bottom: 0;<br />
text-align: left;<br />
}<br />
<br />
.descr-box h3 span {<br />
font-size: 0.8em;<br />
}<br />
<br />
.descr-box div {<br />
border-right: solid white 2px;<br />
border-top: solid white 2px;<br />
padding-right:43px;<br />
}<br />
<br />
.descr-box span {<br />
display: block;<br />
}<br />
<br />
#circ-box {<br />
right: 160px;<br />
top: -120px;<br />
}<br />
<br />
#circ-box img {<br />
bottom: -130px;<br />
height: 120px;<br />
right: -57px;<br />
}<br />
<br />
#circ-box div {<br />
height: 114px;<br />
}<br />
<br />
#oligo-box {<br />
left: -100px;<br />
top: -10px;<br />
width: 200px;<br />
}<br />
<br />
#onoff-box {<br />
left: -105px;<br />
top: 120px;<br />
width: 150px;<br />
}<br />
<br />
#fusion-box {<br />
left: -100px;<br />
top: 330px;<br />
width: 190px;<br />
}<br />
<br />
#fusion-box img {<br />
top: -16px;<br />
}<br />
<br />
#fusion-box div {<br />
border-right: none;<br />
}<br />
<br />
#purification-box {<br />
left: 20px;<br />
top: 445px;<br />
width: 200px;<br />
}<br />
<br />
#purification-box img {<br />
top: -70px;<br />
}<br />
<br />
#purification-box div {<br />
border-top: none;<br />
border-bottom: solid white 2px;<br />
}<br />
<br />
#abstract-content {<br />
display:none;<br />
}<br />
<br />
.graphicalAbstract {<br />
background-image:url('/wiki/images/f/fa/Heidelberg_Project_Background.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
position:relative;<br />
z-index: 1;<br />
height:900px;<br />
}<br />
<br />
#redOverlay {<br />
position:absolute;<br />
width:100%;<br />
height:100%;<br />
left:0;<br />
top:0;<br />
display:none;<br />
background-image:url('/wiki/images/5/51/Heidelberg_project_red_overlay.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
z-index:2;<br />
}<br />
<br />
#lightning {<br />
z-index: 3;<br />
position:absolute;<br />
top: 610px;<br />
left: 460px;<br />
color:white;<br />
}<br />
<br />
<br />
#screened {<br />
z-index: 3;<br />
position:absolute;<br />
left: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#calibrated {<br />
z-index: 3;<br />
position:absolute;<br />
right: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#dnmt1-img {<br />
position: absolute;<br />
height: 155px;<br />
right: 15px;<br />
z-index:4;<br />
}<br />
<br />
a:hover #dnmt1-img {<br />
right: 13px;<br />
}<br />
<br />
#dnmt1-box {<br />
right: 40px;<br />
top: 340px;<br />
position: absolute;<br />
}<br />
<br />
#xylanase-box {<br />
width:250px;<br />
top: 556px;<br />
right:40px;<br />
position:absolute;<br />
}<br />
<br />
#xylanase-img {<br />
height: 140px;<br />
position: absolute;<br />
right: 15px;<br />
}<br />
<br />
a:hover #xylanase-img {<br />
right: 13px;<br />
}<br />
<br />
#toolbox-text{<br />
position: absolute;<br />
top: 145px;<br />
right: -135px;<br />
font-size: 5em;<br />
line-height: 70px;<br />
font-weight: bold;<br />
}<br />
<br />
#linker-links {<br />
position: absolute;<br />
width: 405px;<br />
right: 60px;<br />
top: 35px;<br />
height: 300px;<br />
}<br />
<br />
#toolbox {<br />
position:absolute;<br />
right: 50px;<br />
bottom: 190px;<br />
}<br />
<br />
#toolbox:hover > span {<br />
color: white;<br />
}<br />
<br />
.container {<br />
width: 1170px;<br />
}<br />
<br />
.scheisslinkbleibweiss {<br />
color: white;<br />
}<br />
<br />
.scheisslinkbleibweiss:hover {<br />
color: white;<br />
}<br />
<br />
div.margin-top { margin-top: 100px; }<br />
<br />
img.medal {<br />
height:200px;<br />
margin-top: 40px;<br />
text-align: center;<br />
}<br />
<br />
.center {<br />
text-align:center;<br />
}<br />
<br />
.linie {<br />
margin:20px 40px;<br />
border: solid 1px black;<br />
}<br />
<br />
.vcenter-table{<br />
display: table;<br />
}<br />
<br />
.vcenter-cell {<br />
display: table-cell;<br />
vertical-align: middle;<br />
float: none;<br />
}<br />
<br />
</style><br />
<div id="myContainer" class="container"><br />
</html><br />
{{:Team:Heidelberg/Templates/BootstrapNav|<br />
red=|<br />
white=true|<br />
red-logo=true|<br />
white-logo=|<br />
header-bg=|<br />
header-img=|<br />
title=<br />
}}<br />
<html><br />
<div class="container main" style="color: white;"><br />
<div id="abstract-dropdown" class="row abstract-special dark-grey"><br />
<div class="col-lg-offset-1 col-lg-11"><br />
<h4><img id="dropdownImg" src="/wiki/images/7/70/Heidelberg_Abstract-dropdown.png"/>&nbsp;Project overview</h4><br />
</div><br />
<!--<div class="col-lg-9"><br />
<span>Click to read the project overview</span><br />
</div>--><br />
<div id="abstract-content" class="col-lg-12" ><br />
<p>Proteins are the functional basis of all biological processes and being able to control and improve their functions through design and engineering is one of the fundamental goals of synthetic biology. While conventional proteins subsist as chains of amino acids with defined beginning and end, nature has found a curious way of enhancing a protein capabilities: circularization.<br />
In head to tail circularized peptides the terminal amino acids are joined together just like in the rest of the chain, forming a circular structure. Such peptides have been discovered in all kingdoms of life during the past years and they are unified by an extreme stability towards high temperatures, proteases and changes in pH.</p><br />
<br />
<p>Given these attractive features of circular proteins, methods to circularize otherwise linear proteins have been devised, one of which is based on autocatalytic protein domains called inteins. <br />
We have applied the principle of circular peptides to synthetic biology by introducing a BioBrick-based, standardised method for circularizing any protein using inteins.</p><br />
<br />
<p>Synthetically connecting a protein&apos;s termini without disrupting its 3D structure and function is, however, a delicate task which has so far been accomplished only for relatively small proteins whose ends lie close to each other. We therefore saw the need for a comprehensive software that predicts the process of circularization. With CRAUT we have brought into existence a powerful open-source software to predict an optimal linker to support circularization of a protein preserving its 3D structure and function.<br /><br />
Due to our lack of calculating power we deployed this software on the distributed computing platform BOINC in an initiative we call iGEM@home.</p><br />
<br />
<p>Based on our software predictions, we constructed linkers to circularize the 871 a.a. long methyltransferase Dnmt1 and provide data suggesting that circular DNMT1 is more functional than its linear counterpart at high temperatures. Our results have strong implications for developing an innovative PCR-based technique that could revolutionize epigenetic studies and cancer research by maintaining the methylation pattern of the DNA template during amplification.</p><br />
<br />
<p>Eventually, inteins can be used to post-translationally modify any protein in a multitude of ways going far beyond circularization. We therefore created a BioBrick-based intein toolbox to allow for easy and standardised protein manipulation. We think that our toolbox will be invaluable to many systems biology projects aimed at dissecting or re-engineering the function of cellular networks.</p><br />
</div><br />
</div><br />
<div class="graphicalAbstract"><br />
<div id="redOverlay"></div><br />
<div style="z-index:3;position:relative; height:100%;"><br />
<div id="linker-links"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome" class="block box" id="calibrated"><br />
<img style="height:60px;display: inline-block;" src="/wiki/images/e/ea/Heidelberg_Project_Computer.png"><br />
<span style="position: relative;top: 10px;display: inline-block;"><br />
calibrated<br><br />
<span class="red-text">in silico</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Linker_Screening" class="block box" id="screened"><br />
<span style="position: relative;top:10px;display: inline-block;"><br />
screened <span class="red-text">in vitro</span><br><br />
with lysozyme</span><br />
<img style="height:60px; display:inline-block;" src="/wiki/images/d/df/Heidelberg_Lysozyme.png" /><br />
</a><br />
<a href="/Team:Heidelberg/Software/Linker_Software" class="block box" style="bottom:0; left:-20px; position:absolute;width:170px;"><br />
<img src="/wiki/images/4/42/Craut_small.png" alt="..." style="width:100%;"/><br />
<span class="red-text" >circularize</span> it<br><br />
with calculated linkers<br />
</a><br />
</div><br />
<div class="ringbox"><br />
<img src="/wiki/images/0/0d/Heidelberg_Firering_red.png" id="ring-background" /><br />
<div id="circ-box" class="descr-box"><br />
<a href="/Team:Heidelberg/Toolbox/Circularization"><br />
<img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" id="circ-icon" class="toolbox-icon toolbox-icon-scale"/><br />
</a><br />
<h3>CIRCULARIZATION</h3><br />
<div><span>Create a linker with our crowd computing software and make your protein heat stable</span></div><br />
</div><br />
<div id="oligo-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><img src="/wiki/images/4/40/Oligomerization.png" id="oligo-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>OLIGOMERIZATION</h3><div><span>Fuse multiple Proteins or Domains using Inteins</span></div><br />
</div><br />
<div id="fusion-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" id="fusion-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>FUSION</h3><div><span>Fuse two Proteins or Domains together using Inteins</span></div><br />
</div><br />
<div id="onoff-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" id="onoff-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>ON/OFF</h3><div><span>Activate or deactivate Proteins using Inteins</span></div></div><br />
<div id="purification-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" id="purification-icon" class="toolbox-icon toolbox-icon-scale"/></a><div><h3>PURIFICATION</h3></div><span>Placeholder</span></div><br />
<div id="toolbox-text"><br />
the intein<br><br />
<span><a class="scheisslinkbleibweiss" href="/Team:Heidelberg/Project/Toolbox">toolbox</a><span><br />
</div><br />
</div><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Induction" class="block" id="lightning"><br />
<img class="toolbox-icon-scale" style="height:110px;display: inline-block;" src="/wiki/images/8/83/Heidelberg_Project_Lightning.png"><span style="position: relative;top: 20px;display: inline-block;">&nbsp;inducible via<br><br />
<span style="font-weight:bold;position: relative;left: -18px;" class="red-text">light induction</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/PCR_2.0" class="block box" style="width:250px;" id="dnmt1-box"><br />
<img id="dnmt1-img" src="/wiki/images/a/a6/Heidelberg_Project_Dnmt1.png"><br />
<span style="position:relative; z-index:5;" class="block"><br />
<span style="font-size:1.5em;"><br />
<span class="red-text">Heat-stable</span><br> circular <br><span style="font-weight:bold;">DNA-<br/>Methyltransferase</span><br />
</span><br><br />
<span style="font-weight:bold;font-size: 2.5em; text-align:right;line-height: 35px;"><br />
<span class="red-text">PCR 2.0</span><br />
</span><br />
</span><br />
</a><br />
<a href="/Team:Heidelberg/Toolbox_Guide" class="block" id="toolbox"><br />
<span style="position:relative; display: inline-block;height:110px; width:110px; vertical-align: middle;"><br />
<img style="height:100%; position:absolute; top:0; left:0;" id="toolbox-img" src="/wiki/images/2/24/Heidelberg_Project_Toolbox_guide.png" /><br />
<img style="height:100%; position:absolute; top:0; left:0; display:none;" id="toolbox-img-hover" src="/wiki/images/4/4c/Heidelberg_Toolbox_guide_highlighted.png" /><br />
</span><br />
<span style="position: relative;top: 20px;display: inline-block; vertical-align:middle;"><br />
<span style="font-weight:bold;" class="red-text">modify your protein</span><br/><br />
using the toolbox guide<br />
</span><br />
</a><br />
<div class="clearfix"></div><br />
</div><br />
</div><br />
</div><br />
<div class="container" id="Achievements"><br />
<ul class="nav nav-tabs" role="tablist"><br />
<li class="active" style="font-size:30px"><a href="#Achievements-tab" role="tab" data-toggle="tab"><img src="https://static.igem.org/mediawiki/2014/2/22/Heidelberg_Achievements_red.png" height="50px" alt="Button"> Achievements</a></li><br />
<li style="font-size:30px"><a href="#Medal_Criteria-tab" role="tab" data-toggle="tab"> <img src="https://static.igem.org/mediawiki/2014/3/3f/Heidelberg_Gold_red.png" height="50px" alt="Button"> Medal Criteria</a></li><br />
</ul><br />
<div class="tab-content"><br />
<div class="tab-pane fade in active" style="background-color:white; color:black;" id="Achievements-tab"><br />
<br />
<div class="row" style="margin-top: 20px; background-color:white"><br />
</div><br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Achievements_3.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establishing protein circularization as a NEW BIOENGINEERING TOOL in synthetic biology.</p> <br />
<p style="margin-left:50px; font-size:20px">Contributing to iGEM with a new foundational advance!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/Achievement_1.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Providing a NEW COMPREHENSIVE TOOLBOX based on inteins for modifying proteins post-translationally.</p> <br />
<p style="margin-left:50px; font-size:20px">Sending 67 Biobricks to Registry of Biological parts!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Achievement_2.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Development of a NEW STANDARD to make the use of inteins easy and modular.</p> <br />
<p style="margin-left:50px; font-size:20px">Establishment of a new <a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC">RFC</a>!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/1b/Achievements_toolbox.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Showing that the toolbox WORKS: proteins are circularized and split fluorescent proteins are reconstituted.</p> <br />
<p style="margin-left:50px; font-size:20px">Making Gels, Western Blots, Fluorescence-based Assays and Mass spectrometry to prove it! </p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/2/26/Achievements_4.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating circular DNMT1 and showing that it is ACTIVE.</p> <br />
<p style="margin-left:50px; font-size:20px">For the first time achieving the circularization of a large protein!</p><br />
<p style="margin-left:50px; font-size:20px">Circularizing LYSOZYME and XYLANASE, two very important proteins for<br />
research and industry!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/5/5a/Achievements_craut.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Developing a NEW SOFTWARE to calculate customized linkers to circularize proteins.</p> <br />
<p style="margin-left:50px; font-size:20px">Making CRAUT open-source for the scientific community.</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/e/e5/Heidelberg_Frontpage_igemathome.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establish a distributed computing platform called <a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome">iGEM@home</a>.</p> <br />
<p style="margin-left:50px; font-size:20px">Using this platform as an entirely new way to reach out to the world with synthetic biology concepts!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
</div><br />
</div><br />
<div class="linie"></div><br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/Achievements_md.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating a NEW SOFTWARE to display the notebook on the wiki.</p> <br />
<p style="margin-left:50px; font-size:20px">Distributing MidNightDOC to the iGEM community to help future teams organize their protocols!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="tab-pane fade" style="color:white;" id="Medal_Criteria-tab"><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin-top: 20px"><br />
</div><br />
<div class="row vcenter-table"> <br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/6/63/Heidelberg_Bronze.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Bronze</h1><br />
<br><br />
<ul><br />
<li>Please find a comprehensive compilation of <a href="https://2014.igem.org/Team:Heidelberg/Team/Sponsoring">sponsors</a>, partners and scientific contributors on our <a href="https://2014.igem.org/Team:Heidelberg/Team/Attributions">acknowledgements page</a>. </li><br />
<br/><br />
<li>We also encourage you to take notice of the projects “Photo-intein” and “Mito-intein” by <a href="https://2014.igem.org/Team:Queens_Canada/Project">iGEM team Queens from Canada</a> that may supply you with complementary information and tools for the use of inteins in synthetic biology!</li><br />
<br/><br />
<li>A list of links to more than 60 parts in the registry submitted by our team (being or not being part of the new intein toolbox) can be found <a href="https://2014.igem.org/Team:Heidelberg/Parts#allParts">here</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/b/bf/Heidelberg_Silver.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Silver</h1><br />
<br><br />
<ul><br />
<li>We experimentally validated that our biobricks <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, <a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100 </a>and <a href="http://parts.igem.org/Part:BBa_K1362101">BBa_K1362101</a> work as expected. For more information on the <a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">parts</a> please visit the corresponding main pages in the parts registry or explore their involvement in our subprojects.</li><br />
<br/><br />
<li>Religious perceptions of synthetic biology have been part of several surveys during the past ten years of iGEM and Human Practices projects. Since religious groups cover the majority of worlds population, deliver moral values and wield power at the same time, we decided to dedicate a whole event on the topic of religion, philosophy and ethics regarding synthetic biology. Please find an <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/Ethics">evaluation of our event</a> on the corresponding Human Practices pages. <!--In order to reassure ourselves about the acceptability of our project and synthetic biology in general, we also used this opportunity to build up on the work of the iGEM Team Heidelberg 2013 and conducted a survey that addresses basic questions regarding the public reflection of our work.--><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/0/0a/Heidelberg_Gold.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Gold</h1><br />
<ul><br />
<li>We improved the function of the <b>already existing</b> biobrick part <a href="http://parts.igem.org/Part:BBa_K117505">BBa_K1175005 </a>by optimizing and resubmitting the corresponding sequence of B. subtilis xylanase to the registry (Part:<a href="http://parts.igem.org/Part:BBa_K1362020"> BBa_K1362020</a>). In addition, we submitted a new part for expression of <a href="http://parts.igem.org/Part:BBa_K1362022">circularized xylanase </a>(BBa_K1362022) that might be used in future applications with need for refined enzyme stability.</li><br />
<br/><br />
<li>Despite the fact that we focused on building a set of powerful soft- and wetware tools to help future iGEM-teams developing and realizing projects in synthetic biology, we are happy to announce that we were also able to help out several team during the course of our project, aspecially with sending <a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones"> our expression vectors</a>. Read more abou in in our <a href="https://2014.igem.org/Team:Heidelberg/Team/Collaborations">Collaborations</a>.</li><br />
<br/><br />
<li>In the style of of the new iGEM community labs track that involves science amateurs “beyond the accolades of scientific publishing and economic reward”, we sought for a new way to involve laymen in actual science and build a strong community of well informed supporters and communicators of synthetic biology at the same time. Now we proudly present the crowd sourcing and communication platform <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
</div><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
if(window.location.hash) {<br />
var hash = window.location.hash.substring(1); //Puts hash in variable, and removes the # character<br />
if(hash == "Abstract")<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
$('#abstract-dropdown').click(function() {<br />
if($('#abstract-content').css("display") == 'none'){<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
else{<br />
$('#abstract-content').slideUp(400, function() {$('#dropdownImg').attr("src", "/wiki/images/7/70/Heidelberg_Abstract-dropdown.png");});<br />
}<br />
});<br />
<br />
$('#linker-links').mouseenter(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeIn();<br />
});<br />
<br />
$('#linker-links').mouseleave(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeOut();<br />
});<br />
<br />
$('.descr-box span').css("opacity", 0);<br />
$('.descr-box h3, .descr-box > a')<br />
.mouseenter(function(){<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent()<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 1}, 800);<br />
})<br />
.mouseleave(function() {<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent();<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 0}, 800);<br />
});<br />
<br />
$('#toolbox')<br />
.mouseover(function() {<br />
$('#toolbox-img-hover').fadeIn();<br />
})<br />
.mouseleave(function() {<br />
$('#toolbox-img-hover').fadeOut();<br />
});<br />
<br />
$('#myTab a').click(function (e) {<br />
e.preventDefault()<br />
$(this).tab('show')<br />
})<br />
<br />
});<br />
</script><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2014-10-18T00:38:56Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/boxes}}<br />
<html><style type="text/css"><br />
.subtitle h2 {<br />
color: white;<br />
padding-left: 15px;<br />
}<br />
</style></html><br />
{{:Team:Heidelberg/templates/wikipage_new|<br />
|<br />
container-style=background-color: black; background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg); background-repeat: no-repeat; background-size: 100% auto;<br />
|<br />
title=PARTS<br />
|<br />
white=true<br />
|<br />
red-logo=true<br />
|<br />
subtitle=Discover our workpieces and standards<br />
|<br />
abstract=<br />
|<br />
content=<br />
<html><br />
<div class="col-lg-3 col-md-2 hidden-sm hidden-xs" style="text-align: center;"><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/Heidelberg_Parts_bg.png" class="img-responsive" /><br />
</div><br />
<div class="col-lg-9 col-md-10 col-sm-12 col-xs-12"><br />
<div class="col-lg-12" style="margin: -15px; margin-bottom:15px;"><br />
<div class="boxes-table"><br />
<div class="cell" style="width:60%;"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC" class="box" style="margin-bottom:15px; display:block;"><br />
<h3>New <span>RFC</span> iGEM_HD14</h3><br />
To use inteins as easy and standarized tools to modify proteins after translation we developed a new RFC for the iGEM community. Take a closer look on our new intein standard!<br />
</a><br />
<a href="#Intein Library" class="box" style="display:block;"><br />
<h3>The <span>Intein</span> Library</h3><br />
Protein splicing by inteins is a natural process in which the catalytically active polypeptide termed intein excises itself from a precursor protein leaving the flanking chains reconnected. Deployed in our system inteins are modular instruments for several protein modifications. In our intein library you can find a list of all inteins we used, popular and really fast ones.<br />
</a><br />
</div><br />
<div class="cell" style="width:60%;"><br />
<br />
<a href="#Favorite Parts" class="box" style="display:block; position:relative; margin-bottom:15px;"><br />
<h3>Our <span>favorite</span> Parts</h3><br />
The intein toolbox built by the iGEM Team Heidelberg includes three basic mechanisms. With our favorite parts we want to introduce you to the constructs enabling these priciples! <br />
<img src="/wiki/images/9/9b/Heidelberg_Favoriteparts_star.png" class="star" alt="Favorite Parts Image" /> <br />
</a><br />
<br />
<a href="#Sample Data Page" class="box" style="display:block;"><br />
<h3>Sample <span>Data</span> Page</h3><br />
Take a look at our favorite Parts for circularization, fusion or tagging and see how our system works in the living cell. For that visit our Sample Data Page. <br />
</a><br />
</div><br />
</div><br />
<div class="boxes-table"><br />
<a href="#allParts" class="box cell" style="width: 55%;"><br />
<h3>Our <span>BioBricks</span></h3><br />
Creating a new standard and basic constructs of our toolbox, we sent in 67 new Parts for the Registry of Biological parts! Next to parts for intein-splicing we built sortase constructs to modify proteins post-translationally, too. Here you can find a List of all Parts!</a><br />
<a href="#Our Backbones" class="box cell" ><br />
<h3>Our <span>Backbones</span></h3><br />
Creating a new series of Backbones including a T7 promoter with a lac operon, expressing our constructs and sharing them with other iGEM teams, you have to take a closer look on BBa_K1362091-97! Read more about it under Collaborations.<br />
</a><br />
</div><br />
<div class="boxes-table"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Parts/Part_Improvement" class="box cell" style="padding-right:100px;position:relative;" ><br />
<h3><span>Improving</span> an existing Part</h3><br />
Standardization and building up on existing parts are the fundaments of iGEM. We improved a Xylanase (wood degrading enzyme) by improving its sequence for the expression in <i>E. coli</i> and further characterized its function in respect to heat stability. <br />
<img class="small-igem-logo" src="/wiki/images/7/79/IGEM_logo_red.png" alt="igem-icon" /><br />
</a><br />
</div><br />
</div><br />
</div><br />
</div></div><!-- close container div of template --><br />
<div class="container" style="background-color:white;margin-top:75px;"><br />
<div class="col-lg-12"><br />
<!-- für meine allerliebste Charlotte <3 --><br />
</html><br />
{{:Team:Heidelberg/pages/Parts}}<br />
<html><br />
</div><br />
</div><br />
</html><br />
|<br />
header-img=<br />
|<br />
header-bg=<br />
|<br />
red=<br />
|<br />
titles=<br />
|<br />
white-logo=<br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2014-10-18T00:37:17Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/boxes}}<br />
<html><style type="text/css"><br />
.subtitle h2 {<br />
color: white;<br />
padding-left: 15px;<br />
}<br />
</style></html><br />
{{:Team:Heidelberg/templates/wikipage_new|<br />
|<br />
container-style=background-color: black; background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg); background-repeat: no-repeat; background-size: 100% auto;<br />
|<br />
title=PARTS<br />
|<br />
white=true<br />
|<br />
red-logo=true<br />
|<br />
subtitle=Discover our workpieces and standards<br />
|<br />
abstract=<br />
|<br />
content=<br />
<html><br />
<div class="col-lg-3 col-md-2 hidden-sm hidden-xs" style="text-align: center;"><br />
<img src="https://static.igem.org/mediawiki/2014/4/4b/Heidelberg_Parts_bg.png" class="img-responsive" /><br />
</div><br />
<div class="col-lg-9 col-md-10 col-sm-12 col-xs-12"><br />
<div class="col-lg-12" style="margin: -15px; margin-bottom:15px;"><br />
<div class="boxes-table"><br />
<div class="cell" style="width:60%;"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC" class="box" style="margin-bottom:15px; display:block;"><br />
<h3>New <span>RFC</span> iGEM_HD14</h3><br />
To use inteins as easy and standarized tools to modify proteins after translation we developed a new RFC for the iGEM community. Take a closer look on our new intein standard!<br />
</a><br />
<a href="#Intein Library" class="box" style="display:block;"><br />
<h3>The <span>Intein</span> Library</h3><br />
Protein splicing by inteins is a natural process in which the catalytically active polypeptide termed intein excises itself from a precursor protein leaving the flanking chains reconnected. Deployed in our system inteins are modular instruments for several protein modifications. In our intein library you can find a list of all inteins we used, popular and really fast ones.<br />
</a><br />
</div><br />
<div class="cell" style="width:60%;"><br />
<br />
<a href="#Favorite Parts" class="box" style="display:block; position:relative; margin-bottom:15px;"><br />
<h3>Our <span>favorite</span> Parts</h3><br />
The intein toolbox built by the iGEM Team Heidelberg includes three basic mechanisms. With our favorite parts we want to introduce you to the constructs enabling these priciples! <br />
<img src="/wiki/images/9/9b/Heidelberg_Favoriteparts_star.png" class="star" alt="Favorite Parts Image" /> <br />
</a><br />
<br />
<a href="#Sample Data Page" class="box" style="display:block;"><br />
<h3>Sample <span>Data</span> Page</h3><br />
Take a look at our favorite Parts for circularization, fusion or tagging and see how our system works in the living cell. For that visit our Sample Data Page. <br />
</a><br />
</div><br />
</div><br />
<div class="boxes-table"><br />
<a href="#Our BioBricks" class="box cell" style="width: 55%;"><br />
<h3>Our <span>BioBricks</span></h3><br />
Creating a new standard and basic constructs of our toolbox, we sent in 67 new Parts for the Registry of Biological parts! Next to parts for intein-splicing we built sortase constructs to modify proteins post-translationally, too. Here you can find a List of all Parts!</a><br />
<a href="#Our Backbones" class="box cell" ><br />
<h3>Our <span>Backbones</span></h3><br />
Creating a new series of Backbones including a T7 promoter with a lac operon, expressing our constructs and sharing them with other iGEM teams, you have to take a closer look on BBa_K1362091-97! Read more about it under Collaborations.<br />
</a><br />
</div><br />
<div class="boxes-table"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Parts/Part_Improvement" class="box cell" style="padding-right:100px;position:relative;" ><br />
<h3><span>Improving</span> an existing Part</h3><br />
Standardization and building up on existing parts are the fundaments of iGEM. We improved a Xylanase (wood degrading enzyme) by improving its sequence for the expression in <i>E. coli</i> and further characterized its function in respect to heat stability. <br />
<img class="small-igem-logo" src="/wiki/images/7/79/IGEM_logo_red.png" alt="igem-icon" /><br />
</a><br />
</div><br />
</div><br />
</div><br />
</div></div><!-- close container div of template --><br />
<div class="container" style="background-color:white;margin-top:75px;"><br />
<div class="col-lg-12"><br />
<!-- für meine allerliebste Charlotte <3 --><br />
</html><br />
{{:Team:Heidelberg/pages/Parts}}<br />
<html><br />
</div><br />
</div><br />
</html><br />
|<br />
header-img=<br />
|<br />
header-bg=<br />
|<br />
red=<br />
|<br />
titles=<br />
|<br />
white-logo=<br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/Human_Practice/Public_RelationsTeam:Heidelberg/Human Practice/Public Relations2014-10-18T00:33:33Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/templates/wikipage_new|<br />
title=PUBLIC RELATIONS<br />
|<br />
white=true<br />
|<br />
red-logo=<br />
|<br />
header-img=<br />
|<br />
body-style=background-color:black;<br />
|<br />
header-bg=black<br />
|<br />
subtitle= This is a test subtitle<br />
|<br />
container-style=background-color:white;<br />
|<br />
titles=<br />
|<br />
abstract=<br />
|<br />
content=<br />
<div class="col-lg-12"><br />
{{:Team:Heidelberg/pages/Public_Relations}}<br />
</div><br />
|<br />
white-logo=true<br />
|<br />
red=<br />
}}</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/ProjectTeam:Heidelberg/Project2014-10-18T00:31:14Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/MainTemplate|unresponsive=}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstrapcss}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstraptheme}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/overrides}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/jquery}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/bootstrapjs}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/wikipage}}<br />
<html><br />
<style type="text/css"><br />
#myContainer {<br />
padding:0;<br />
background-color: black;<br />
background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg);<br />
background-repeat: no-repeat;<br />
background-size: 100% auto;<br />
}<br />
<br />
#light:hover {<br />
color: #FF7E25;<br />
}<br />
<br />
.main {<br />
margin-top: 25px;<br />
}<br />
<br />
.middle {<br />
font-size: 3em;<br />
}<br />
<br />
.large {<br />
font-size: 5em;<br />
font-weight: bold;<br />
}<br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icon-scale:hover {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icon-scale {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.ringbox{<br />
/*<br />
width: 750px;<br />
height: 600px;<br />
background-image:url('/wiki/images/d/dc/Ring_Project.png');<br />
background-size: 550px;<br />
background-repeat: no-repeat;<br />
*/<br />
position: absolute;<br />
top:260px;<br />
left:140px;<br />
height:640px;<br />
z-index:3;<br />
}<br />
<br />
.abstract-special {<br />
color: white;<br />
}<br />
<br />
.abstract-special span {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
display: block;<br />
}<br />
<br />
.abstract-special img {<br />
height: 15px;<br />
}<br />
<br />
.toolbox-icon {<br />
height: 90px;<br />
position: absolute;<br />
right:-43px;<br />
bottom:-45px;<br />
}<br />
<br />
#ring-background {<br />
width: 450px;<br />
height: auto;<br />
opacity:0.8;<br />
}<br />
<br />
.block{<br />
display:block;<br />
text-decoration:none;<br />
color: white;<br />
}<br />
<br />
.block:hover{<br />
text-decoration: none;<br />
}<br />
<br />
.box {<br />
background-color: rgba(81,81,81,0.7);<br />
padding: 15px;<br />
position:relative;<br />
}<br />
<br />
.box:hover {<br />
border:solid 2px #DE4230;<br />
padding: 13px;<br />
}<br />
<br />
<br />
.descr-box {<br />
width: 250px;<br />
height: 100px;<br />
position: absolute;<br />
}<br />
<br />
.descr-box h3 {<br />
margin-top: 10px;<br />
margin-bottom: 0;<br />
text-align: left;<br />
}<br />
<br />
.descr-box h3 span {<br />
font-size: 0.8em;<br />
}<br />
<br />
.descr-box div {<br />
border-right: solid white 2px;<br />
border-top: solid white 2px;<br />
padding-right:43px;<br />
}<br />
<br />
.descr-box span {<br />
display: block;<br />
}<br />
<br />
#circ-box {<br />
right: 160px;<br />
top: -120px;<br />
}<br />
<br />
#circ-box img {<br />
bottom: -130px;<br />
height: 120px;<br />
right: -57px;<br />
}<br />
<br />
#circ-box div {<br />
height: 114px;<br />
}<br />
<br />
#oligo-box {<br />
left: -100px;<br />
top: -10px;<br />
width: 200px;<br />
}<br />
<br />
#onoff-box {<br />
left: -105px;<br />
top: 120px;<br />
width: 150px;<br />
}<br />
<br />
#fusion-box {<br />
left: -100px;<br />
top: 330px;<br />
width: 190px;<br />
}<br />
<br />
#fusion-box img {<br />
top: -16px;<br />
}<br />
<br />
#fusion-box div {<br />
border-right: none;<br />
}<br />
<br />
#purification-box {<br />
left: 20px;<br />
top: 445px;<br />
width: 200px;<br />
}<br />
<br />
#purification-box img {<br />
top: -70px;<br />
}<br />
<br />
#purification-box div {<br />
border-top: none;<br />
border-bottom: solid white 2px;<br />
}<br />
<br />
#abstract-content {<br />
display:none;<br />
}<br />
<br />
.graphicalAbstract {<br />
background-image:url('/wiki/images/f/fa/Heidelberg_Project_Background.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
position:relative;<br />
z-index: 1;<br />
height:900px;<br />
}<br />
<br />
#redOverlay {<br />
position:absolute;<br />
width:100%;<br />
height:100%;<br />
left:0;<br />
top:0;<br />
display:none;<br />
background-image:url('/wiki/images/5/51/Heidelberg_project_red_overlay.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
z-index:2;<br />
}<br />
<br />
#lightning {<br />
z-index: 3;<br />
position:absolute;<br />
top: 610px;<br />
left: 460px;<br />
color:white;<br />
}<br />
<br />
<br />
#screened {<br />
z-index: 3;<br />
position:absolute;<br />
left: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#calibrated {<br />
z-index: 3;<br />
position:absolute;<br />
right: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#dnmt1-img {<br />
position: absolute;<br />
height: 155px;<br />
right: 15px;<br />
z-index:4;<br />
}<br />
<br />
a:hover #dnmt1-img {<br />
right: 13px;<br />
}<br />
<br />
#dnmt1-box {<br />
right: 40px;<br />
top: 340px;<br />
position: absolute;<br />
}<br />
<br />
#xylanase-box {<br />
width:250px;<br />
top: 556px;<br />
right:40px;<br />
position:absolute;<br />
}<br />
<br />
#xylanase-img {<br />
height: 140px;<br />
position: absolute;<br />
right: 15px;<br />
}<br />
<br />
a:hover #xylanase-img {<br />
right: 13px;<br />
}<br />
<br />
#toolbox-text{<br />
position: absolute;<br />
top: 145px;<br />
right: -135px;<br />
font-size: 5em;<br />
line-height: 70px;<br />
font-weight: bold;<br />
}<br />
<br />
#linker-links {<br />
position: absolute;<br />
width: 405px;<br />
right: 60px;<br />
top: 35px;<br />
height: 300px;<br />
}<br />
<br />
#toolbox {<br />
position:absolute;<br />
right: 50px;<br />
bottom: 190px;<br />
}<br />
<br />
#toolbox:hover > span {<br />
color: white;<br />
}<br />
<br />
.container {<br />
width: 1170px;<br />
}<br />
<br />
.scheisslinkbleibweiss {<br />
color: white;<br />
}<br />
<br />
.scheisslinkbleibweiss:hover {<br />
color: white;<br />
}<br />
<br />
div.margin-top { margin-top: 100px; }<br />
<br />
img.medal {<br />
height:200px;<br />
margin-top: 40px;<br />
text-align: center;<br />
}<br />
<br />
.center {<br />
text-align:center;<br />
}<br />
<br />
.linie {<br />
margin:20px 40px;<br />
border: solid 1px black;<br />
}<br />
<br />
.vcenter-table{<br />
display: table;<br />
}<br />
<br />
.vcenter-cell {<br />
display: table-cell;<br />
vertical-align: middle;<br />
float: none;<br />
}<br />
<br />
</style><br />
<div id="myContainer" class="container"><br />
</html><br />
{{:Team:Heidelberg/Templates/BootstrapNav|<br />
red=|<br />
white=true|<br />
red-logo=true|<br />
white-logo=|<br />
header-bg=|<br />
header-img=|<br />
title=<br />
}}<br />
<html><br />
<div class="container main" style="color: white;"><br />
<div id="abstract-dropdown" class="row abstract-special dark-grey"><br />
<div class="col-lg-offset-1 col-lg-11"><br />
<h4><img id="dropdownImg" src="/wiki/images/7/70/Heidelberg_Abstract-dropdown.png"/>&nbsp;Project overview</h4><br />
</div><br />
<!--<div class="col-lg-9"><br />
<span>Click to read the project overview</span><br />
</div>--><br />
<div id="abstract-content" class="col-lg-12" ><br />
<p>Proteins are the functional basis of all biological processes and being able to control and improve their functions through design and engineering is one of the fundamental goals of synthetic biology. While conventional proteins subsist as chains of amino acids with defined beginning and end, nature has found a curious way of enhancing a protein capabilities: circularization.<br />
In head to tail circularized peptides the terminal amino acids are joined together just like in the rest of the chain, forming a circular structure. Such peptides have been discovered in all kingdoms of life during the past years and they are unified by an extreme stability towards high temperatures, proteases and changes in pH.</p><br />
<br />
<p>Given these attractive features of circular proteins, methods to circularize otherwise linear proteins have been devised, one of which is based on autocatalytic protein domains called inteins. <br />
We have applied the principle of circular peptides to synthetic biology by introducing a BioBrick-based, standardised method for circularizing any protein using inteins.</p><br />
<br />
<p>Synthetically connecting a protein&apos;s termini without disrupting its 3D structure and function is, however, a delicate task which has so far been accomplished only for relatively small proteins whose ends lie close to each other. We therefore saw the need for a comprehensive software that predicts the process of circularization. With CRAUT we have brought into existence a powerful open-source software to predict an optimal linker to support circularization of a protein preserving its 3D structure and function.<br /><br />
Due to our lack of calculating power we deployed this software on the distributed computing platform BOINC in an initiative we call iGEM@home.</p><br />
<br />
<p>Based on our software predictions, we constructed linkers to circularize the 871 a.a. long methyltransferase Dnmt1 and provide data suggesting that circular DNMT1 is more functional than its linear counterpart at high temperatures. Our results have strong implications for developing an innovative PCR-based technique that could revolutionize epigenetic studies and cancer research by maintaining the methylation pattern of the DNA template during amplification.</p><br />
<br />
<p>Eventually, inteins can be used to post-translationally modify any protein in a multitude of ways going far beyond circularization. We therefore created a BioBrick-based intein toolbox to allow for easy and standardised protein manipulation. We think that our toolbox will be invaluable to many systems biology projects aimed at dissecting or re-engineering the function of cellular networks.</p><br />
</div><br />
</div><br />
<div class="graphicalAbstract"><br />
<div id="redOverlay"></div><br />
<div style="z-index:3;position:relative; height:100%;"><br />
<div id="linker-links"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome" class="block box" id="calibrated"><br />
<img style="height:60px;display: inline-block;" src="/wiki/images/e/ea/Heidelberg_Project_Computer.png"><br />
<span style="position: relative;top: 10px;display: inline-block;"><br />
calibrated<br><br />
<span class="red-text">in silico</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Linker_Screening" class="block box" id="screened"><br />
<span style="position: relative;top:10px;display: inline-block;"><br />
screened <span class="red-text">in vitro</span><br><br />
with lysozyme</span><br />
<img style="height:60px; display:inline-block;" src="/wiki/images/d/df/Heidelberg_Lysozyme.png" /><br />
</a><br />
<a href="/Team:Heidelberg/Software/Linker_Software" class="block box" style="bottom:0; left:-20px; position:absolute;width:170px;"><br />
<img src="/wiki/images/4/42/Craut_small.png" alt="..." style="width:100%;"/><br />
<span class="red-text" >circularize</span> it<br><br />
with calculated linkers<br />
</a><br />
</div><br />
<div class="ringbox"><br />
<img src="/wiki/images/0/0d/Heidelberg_Firering_red.png" id="ring-background" /><br />
<div id="circ-box" class="descr-box"><br />
<a href="/Team:Heidelberg/Toolbox/Circularization"><br />
<img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" id="circ-icon" class="toolbox-icon toolbox-icon-scale"/><br />
</a><br />
<h3>CIRCULARIZATION</h3><br />
<div><span>Create a linker with our crowd computing software and make your protein heat stable</span></div><br />
</div><br />
<div id="oligo-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><img src="/wiki/images/4/40/Oligomerization.png" id="oligo-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>OLIGOMERIZATION</h3><div><span>Fuse multiple Proteins or Domains using Inteins</span></div><br />
</div><br />
<div id="fusion-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" id="fusion-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>FUSION</h3><div><span>Fuse two Proteins or Domains together using Inteins</span></div><br />
</div><br />
<div id="onoff-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" id="onoff-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>ON/OFF</h3><div><span>Activate or deactivate Proteins using Inteins</span></div></div><br />
<div id="purification-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" id="purification-icon" class="toolbox-icon toolbox-icon-scale"/></a><div><h3>PURIFICATION</h3></div><span>Placeholder</span></div><br />
<div id="toolbox-text"><br />
the intein<br><br />
<span><a class="scheisslinkbleibweiss" href="/Team:Heidelberg/Project/Toolbox">toolbox</a><span><br />
</div><br />
</div><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Induction" class="block" id="lightning"><br />
<img class="toolbox-icon-scale" style="height:110px;display: inline-block;" src="/wiki/images/8/83/Heidelberg_Project_Lightning.png"><span style="position: relative;top: 20px;display: inline-block;">&nbsp;inducible via<br><br />
<span style="font-weight:bold;position: relative;left: -18px;" class="red-text">light induction</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/PCR_2.0" class="block box" style="width:250px;" id="dnmt1-box"><br />
<img id="dnmt1-img" src="/wiki/images/a/a6/Heidelberg_Project_Dnmt1.png"><br />
<span style="position:relative; z-index:5;" class="block"><br />
<span style="font-size:1.5em;"><br />
<span class="red-text">Heat-stable</span><br> circular <br><span style="font-weight:bold;">DNA-<br/>Methyltransferase</span><br />
</span><br><br />
<span style="font-weight:bold;font-size: 2.5em; text-align:right;line-height: 35px;"><br />
<span class="red-text">PCR 2.0</span><br />
</span><br />
</span><br />
</a><br />
<a href="/Team:Heidelberg/Toolbox_Guide" class="block" id="toolbox"><br />
<span style="position:relative; display: inline-block;height:110px; width:110px; vertical-align: middle;"><br />
<img style="height:100%; position:absolute; top:0; left:0;" id="toolbox-img" src="/wiki/images/2/24/Heidelberg_Project_Toolbox_guide.png" /><br />
<img style="height:100%; position:absolute; top:0; left:0; display:none;" id="toolbox-img-hover" src="/wiki/images/4/4c/Heidelberg_Toolbox_guide_highlighted.png" /><br />
</span><br />
<span style="position: relative;top: 20px;display: inline-block; vertical-align:middle;"><br />
<span style="font-weight:bold;" class="red-text">modify your protein</span><br/><br />
using the toolbox guide<br />
</span><br />
</a><br />
<div class="clearfix"></div><br />
</div><br />
</div><br />
</div><br />
<div class="container" id="Achievements"><br />
<ul class="nav nav-tabs" role="tablist"><br />
<li class="active" style="font-size:30px"><a href="#Achievements-tab" role="tab" data-toggle="tab"><img src="https://static.igem.org/mediawiki/2014/2/22/Heidelberg_Achievements_red.png" height="50px" alt="Button"> Achievements</a></li><br />
<li style="font-size:30px"><a href="#Medal_Criteria-tab" role="tab" data-toggle="tab"> <img src="https://static.igem.org/mediawiki/2014/3/3f/Heidelberg_Gold_red.png" height="50px" alt="Button"> Medal Criteria</a></li><br />
</ul><br />
<div class="tab-content"><br />
<div class="tab-pane fade in active" style="background-color:white; color:black;" id="Achievements-tab"><br />
<br />
<div class="row" style="margin-top: 20px; background-color:white"><br />
</div><br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Achievements_3.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establishing protein circularization as a NEW BIOENGINEERING TOOL in synthetic biology.</p> <br />
<p style="margin-left:50px; font-size:20px">Contributing to iGEM with a new foundational advance!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/Achievement_1.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Providing a NEW COMPREHENSIVE TOOLBOX based on inteins for modifying proteins post-translationally.</p> <br />
<p style="margin-left:50px; font-size:20px">Sending 67 Biobricks to Registry of Biological parts!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Achievement_2.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Development of a NEW STANDARD to make the use of inteins easy and modular.</p> <br />
<p style="margin-left:50px; font-size:20px">Establishment of a new <a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC">RFC</a>!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/1b/Achievements_toolbox.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Showing that the toolbox WORKS: proteins are circularized and split fluorescent proteins are reconstituted.</p> <br />
<p style="margin-left:50px; font-size:20px">Making Gels, Western Blots, Fluorescence-based Assays and Mass spectrometry to prove it! </p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/2/26/Achievements_4.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating circular DNMT1 and showing that it is ACTIVE.</p> <br />
<p style="margin-left:50px; font-size:20px">For the first time achieving the circularization of a large protein!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/5/5a/Achievements_craut.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Developing a NEW SOFTWARE to calculate customized linkers to circularize proteins.</p> <br />
<p style="margin-left:50px; font-size:20px">Making CRAUT open-source for the scientific community.</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/e/e5/Heidelberg_Frontpage_igemathome.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establish a distributed computing platform called <a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome">iGEM@home</a>.</p> <br />
<p style="margin-left:50px; font-size:20px">Using this platform as an entirely new way to reach out to the world with synthetic biology concepts!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
</div><br />
</div><br />
<div class="linie"></div><br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/Achievements_md.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating a NEW SOFTWARE to display the notebook on the wiki.</p> <br />
<p style="margin-left:50px; font-size:20px">Distributing MidNightDOC to the iGEM community to help future teams organize their protocols!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="tab-pane fade" style="color:white;" id="Medal_Criteria-tab"><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin-top: 20px"><br />
</div><br />
<div class="row vcenter-table"> <br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/6/63/Heidelberg_Bronze.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Bronze</h1><br />
<br><br />
<ul><br />
<li>Please find a comprehensive compilation of <a href="https://2014.igem.org/Team:Heidelberg/Team/Sponsoring">sponsors</a>, partners and scientific contributors on our <a href="https://2014.igem.org/Team:Heidelberg/Team/Attributions">acknowledgements page</a>. </li><br />
<br/><br />
<li>We also encourage you to take notice of the projects “Photo-intein” and “Mito-intein” by <a href="https://2014.igem.org/Team:Queens_Canada/Project">iGEM team Queens from Canada</a> that may supply you with complementary information and tools for the use of inteins in synthetic biology!</li><br />
<br/><br />
<li>A list of links to more than 60 parts in the registry submitted by our team (being or not being part of the new intein toolbox) can be found <a href="https://2014.igem.org/Team:Heidelberg/Parts#allParts">here</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/b/bf/Heidelberg_Silver.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Silver</h1><br />
<br><br />
<ul><br />
<li>We experimentally validated that our biobricks <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, <a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100 </a>and <a href="http://parts.igem.org/Part:BBa_K1362101">BBa_K1362101</a> work as expected. For more information on the <a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">parts</a> please visit the corresponding main pages in the parts registry or explore their involvement in our subprojects.</li><br />
<br/><br />
<li>Religious perceptions of synthetic biology have been part of several surveys during the past ten years of iGEM and Human Practices projects. Since religious groups cover the majority of worlds population, deliver moral values and wield power at the same time, we decided to dedicate a whole event on the topic of religion, philosophy and ethics regarding synthetic biology. Please find an <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/Ethics">evaluation of our event</a> on the corresponding Human Practices pages. <!--In order to reassure ourselves about the acceptability of our project and synthetic biology in general, we also used this opportunity to build up on the work of the iGEM Team Heidelberg 2013 and conducted a survey that addresses basic questions regarding the public reflection of our work.--><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/0/0a/Heidelberg_Gold.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Gold</h1><br />
<ul><br />
<li>We improved the function of the <b>already existing</b> biobrick part <a href="http://parts.igem.org/Part:BBa_K117505">BBa_K1175005 </a>by optimizing and resubmitting the corresponding sequence of B. subtilis xylanase to the registry (Part:<a href="http://parts.igem.org/Part:BBa_K1362020"> BBa_K1362020</a>). In addition, we submitted a new part for expression of <a href="http://parts.igem.org/Part:BBa_K1362022">circularized xylanase </a>(BBa_K1362022) that might be used in future applications with need for refined enzyme stability.</li><br />
<br/><br />
<li>Despite the fact that we focused on building a set of powerful soft- and wetware tools to help future iGEM-teams developing and realizing projects in synthetic biology, we are happy to announce that we were also able to help out several team during the course of our project, aspecially with sending <a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones"> our expression vectors</a>. Read more abou in in our <a href="https://2014.igem.org/Team:Heidelberg/Team/Collaborations">Collaborations</a>.</li><br />
<br/><br />
<li>In the style of of the new iGEM community labs track that involves science amateurs “beyond the accolades of scientific publishing and economic reward”, we sought for a new way to involve laymen in actual science and build a strong community of well informed supporters and communicators of synthetic biology at the same time. Now we proudly present the crowd sourcing and communication platform <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
</div><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
if(window.location.hash) {<br />
var hash = window.location.hash.substring(1); //Puts hash in variable, and removes the # character<br />
if(hash == "Abstract")<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
$('#abstract-dropdown').click(function() {<br />
if($('#abstract-content').css("display") == 'none'){<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
else{<br />
$('#abstract-content').slideUp(400, function() {$('#dropdownImg').attr("src", "/wiki/images/7/70/Heidelberg_Abstract-dropdown.png");});<br />
}<br />
});<br />
<br />
$('#linker-links').mouseenter(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeIn();<br />
});<br />
<br />
$('#linker-links').mouseleave(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeOut();<br />
});<br />
<br />
$('.descr-box span').css("opacity", 0);<br />
$('.descr-box h3, .descr-box > a')<br />
.mouseenter(function(){<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent()<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 1}, 800);<br />
})<br />
.mouseleave(function() {<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent();<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 0}, 800);<br />
});<br />
<br />
$('#toolbox')<br />
.mouseover(function() {<br />
$('#toolbox-img-hover').fadeIn();<br />
})<br />
.mouseleave(function() {<br />
$('#toolbox-img-hover').fadeOut();<br />
});<br />
<br />
$('#myTab a').click(function (e) {<br />
e.preventDefault()<br />
$(this).tab('show')<br />
})<br />
<br />
});<br />
</script><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/ProjectTeam:Heidelberg/Project2014-10-18T00:28:46Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/MainTemplate|unresponsive=}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstrapcss}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstraptheme}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/overrides}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/jquery}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/bootstrapjs}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/wikipage}}<br />
<html><br />
<style type="text/css"><br />
#myContainer {<br />
padding:0;<br />
background-color: black;<br />
background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg);<br />
background-repeat: no-repeat;<br />
background-size: 100% auto;<br />
}<br />
<br />
#light:hover {<br />
color: #FF7E25;<br />
}<br />
<br />
.main {<br />
margin-top: 25px;<br />
}<br />
<br />
.middle {<br />
font-size: 3em;<br />
}<br />
<br />
.large {<br />
font-size: 5em;<br />
font-weight: bold;<br />
}<br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icon-scale:hover {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icon-scale {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.ringbox{<br />
/*<br />
width: 750px;<br />
height: 600px;<br />
background-image:url('/wiki/images/d/dc/Ring_Project.png');<br />
background-size: 550px;<br />
background-repeat: no-repeat;<br />
*/<br />
position: absolute;<br />
top:260px;<br />
left:140px;<br />
height:640px;<br />
z-index:3;<br />
}<br />
<br />
.abstract-special {<br />
color: white;<br />
}<br />
<br />
.abstract-special span {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
display: block;<br />
}<br />
<br />
.abstract-special img {<br />
height: 15px;<br />
}<br />
<br />
.toolbox-icon {<br />
height: 90px;<br />
position: absolute;<br />
right:-43px;<br />
bottom:-45px;<br />
}<br />
<br />
#ring-background {<br />
width: 450px;<br />
height: auto;<br />
opacity:0.8;<br />
}<br />
<br />
.block{<br />
display:block;<br />
text-decoration:none;<br />
color: white;<br />
}<br />
<br />
.block:hover{<br />
text-decoration: none;<br />
}<br />
<br />
.box {<br />
background-color: rgba(81,81,81,0.7);<br />
padding: 15px;<br />
position:relative;<br />
}<br />
<br />
.box:hover {<br />
border:solid 2px #DE4230;<br />
padding: 13px;<br />
}<br />
<br />
<br />
.descr-box {<br />
width: 250px;<br />
height: 100px;<br />
position: absolute;<br />
}<br />
<br />
.descr-box h3 {<br />
margin-top: 10px;<br />
margin-bottom: 0;<br />
text-align: left;<br />
}<br />
<br />
.descr-box h3 span {<br />
font-size: 0.8em;<br />
}<br />
<br />
.descr-box div {<br />
border-right: solid white 2px;<br />
border-top: solid white 2px;<br />
padding-right:43px;<br />
}<br />
<br />
.descr-box span {<br />
display: block;<br />
}<br />
<br />
#circ-box {<br />
right: 160px;<br />
top: -120px;<br />
}<br />
<br />
#circ-box img {<br />
bottom: -130px;<br />
height: 120px;<br />
right: -57px;<br />
}<br />
<br />
#circ-box div {<br />
height: 114px;<br />
}<br />
<br />
#oligo-box {<br />
left: -100px;<br />
top: -10px;<br />
width: 200px;<br />
}<br />
<br />
#onoff-box {<br />
left: -105px;<br />
top: 120px;<br />
width: 150px;<br />
}<br />
<br />
#fusion-box {<br />
left: -100px;<br />
top: 330px;<br />
width: 190px;<br />
}<br />
<br />
#fusion-box img {<br />
top: -16px;<br />
}<br />
<br />
#fusion-box div {<br />
border-right: none;<br />
}<br />
<br />
#purification-box {<br />
left: 20px;<br />
top: 445px;<br />
width: 200px;<br />
}<br />
<br />
#purification-box img {<br />
top: -70px;<br />
}<br />
<br />
#purification-box div {<br />
border-top: none;<br />
border-bottom: solid white 2px;<br />
}<br />
<br />
#abstract-content {<br />
display:none;<br />
}<br />
<br />
.graphicalAbstract {<br />
background-image:url('/wiki/images/f/fa/Heidelberg_Project_Background.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
position:relative;<br />
z-index: 1;<br />
height:900px;<br />
}<br />
<br />
#redOverlay {<br />
position:absolute;<br />
width:100%;<br />
height:100%;<br />
left:0;<br />
top:0;<br />
display:none;<br />
background-image:url('/wiki/images/5/51/Heidelberg_project_red_overlay.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
z-index:2;<br />
}<br />
<br />
#lightning {<br />
z-index: 3;<br />
position:absolute;<br />
top: 610px;<br />
left: 460px;<br />
color:white;<br />
}<br />
<br />
<br />
#screened {<br />
z-index: 3;<br />
position:absolute;<br />
left: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#calibrated {<br />
z-index: 3;<br />
position:absolute;<br />
right: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#dnmt1-img {<br />
position: absolute;<br />
height: 155px;<br />
right: 15px;<br />
z-index:4;<br />
}<br />
<br />
a:hover #dnmt1-img {<br />
right: 13px;<br />
}<br />
<br />
#dnmt1-box {<br />
right: 40px;<br />
top: 340px;<br />
position: absolute;<br />
}<br />
<br />
#xylanase-box {<br />
width:250px;<br />
top: 556px;<br />
right:40px;<br />
position:absolute;<br />
}<br />
<br />
#xylanase-img {<br />
height: 140px;<br />
position: absolute;<br />
right: 15px;<br />
}<br />
<br />
a:hover #xylanase-img {<br />
right: 13px;<br />
}<br />
<br />
#toolbox-text{<br />
position: absolute;<br />
top: 145px;<br />
right: -135px;<br />
font-size: 5em;<br />
line-height: 70px;<br />
font-weight: bold;<br />
}<br />
<br />
#linker-links {<br />
position: absolute;<br />
width: 405px;<br />
right: 60px;<br />
top: 35px;<br />
height: 300px;<br />
}<br />
<br />
#toolbox {<br />
position:absolute;<br />
right: 50px;<br />
bottom: 190px;<br />
}<br />
<br />
#toolbox:hover > span {<br />
color: white;<br />
}<br />
<br />
.container {<br />
width: 1170px;<br />
}<br />
<br />
.scheisslinkbleibweiss {<br />
color: white;<br />
}<br />
<br />
.scheisslinkbleibweiss:hover {<br />
color: white;<br />
}<br />
<br />
div.margin-top { margin-top: 100px; }<br />
<br />
img.medal {<br />
height:200px;<br />
margin-top: 40px;<br />
text-align: center;<br />
}<br />
<br />
.center {<br />
text-align:center;<br />
}<br />
<br />
.linie {<br />
margin:20px 40px;<br />
border: solid 1px black;<br />
}<br />
<br />
.vcenter-table{<br />
display: table;<br />
}<br />
<br />
.vcenter-cell {<br />
display: table-cell;<br />
vertical-align: middle;<br />
float: none;<br />
}<br />
<br />
</style><br />
<div id="myContainer" class="container"><br />
</html><br />
{{:Team:Heidelberg/Templates/BootstrapNav|<br />
red=|<br />
white=true|<br />
red-logo=true|<br />
white-logo=|<br />
header-bg=|<br />
header-img=|<br />
title=<br />
}}<br />
<html><br />
<div class="container main" style="color: white;"><br />
<div id="abstract-dropdown" class="row abstract-special darkgray"><br />
<div class="col-lg-offset-1 col-lg-11"><br />
<h4><img id="dropdownImg" src="https://static.igem.org/mediawiki/2014/0/05/Heidelberg_Dreieck-black.png"/>&nbsp;Project overview</h4><br />
</div><br />
<!--<div class="col-lg-9"><br />
<span>Click to read the project overview</span><br />
</div>--><br />
<div id="abstract-content" class="col-lg-12" ><br />
<p>Proteins are the functional basis of all biological processes and being able to control and improve their functions through design and engineering is one of the fundamental goals of synthetic biology. While conventional proteins subsist as chains of amino acids with defined beginning and end, nature has found a curious way of enhancing a protein capabilities: circularization.<br />
In head to tail circularized peptides the terminal amino acids are joined together just like in the rest of the chain, forming a circular structure. Such peptides have been discovered in all kingdoms of life during the past years and they are unified by an extreme stability towards high temperatures, proteases and changes in pH.</p><br />
<br />
<p>Given these attractive features of circular proteins, methods to circularize otherwise linear proteins have been devised, one of which is based on autocatalytic protein domains called inteins. <br />
We have applied the principle of circular peptides to synthetic biology by introducing a BioBrick-based, standardised method for circularizing any protein using inteins.</p><br />
<br />
<p>Synthetically connecting a protein&apos;s termini without disrupting its 3D structure and function is, however, a delicate task which has so far been accomplished only for relatively small proteins whose ends lie close to each other. We therefore saw the need for a comprehensive software that predicts the process of circularization. With CRAUT we have brought into existence a powerful open-source software to predict an optimal linker to support circularization of a protein preserving its 3D structure and function.<br /><br />
Due to our lack of calculating power we deployed this software on the distributed computing platform BOINC in an initiative we call iGEM@home.</p><br />
<br />
<p>Based on our software predictions, we constructed linkers to circularize the 871 a.a. long methyltransferase Dnmt1 and provide data suggesting that circular DNMT1 is more functional than its linear counterpart at high temperatures. Our results have strong implications for developing an innovative PCR-based technique that could revolutionize epigenetic studies and cancer research by maintaining the methylation pattern of the DNA template during amplification.</p><br />
<br />
<p>Eventually, inteins can be used to post-translationally modify any protein in a multitude of ways going far beyond circularization. We therefore created a BioBrick-based intein toolbox to allow for easy and standardised protein manipulation. We think that our toolbox will be invaluable to many systems biology projects aimed at dissecting or re-engineering the function of cellular networks.</p><br />
</div><br />
</div><br />
<div class="graphicalAbstract"><br />
<div id="redOverlay"></div><br />
<div style="z-index:3;position:relative; height:100%;"><br />
<div id="linker-links"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome" class="block box" id="calibrated"><br />
<img style="height:60px;display: inline-block;" src="/wiki/images/e/ea/Heidelberg_Project_Computer.png"><br />
<span style="position: relative;top: 10px;display: inline-block;"><br />
calibrated<br><br />
<span class="red-text">in silico</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Linker_Screening" class="block box" id="screened"><br />
<span style="position: relative;top:10px;display: inline-block;"><br />
screened <span class="red-text">in vitro</span><br><br />
with lysozyme</span><br />
<img style="height:60px; display:inline-block;" src="/wiki/images/d/df/Heidelberg_Lysozyme.png" /><br />
</a><br />
<a href="/Team:Heidelberg/Software/Linker_Software" class="block box" style="bottom:0; left:-20px; position:absolute;width:170px;"><br />
<img src="/wiki/images/4/42/Craut_small.png" alt="..." style="width:100%;"/><br />
<span class="red-text" >circularize</span> it<br><br />
with calculated linkers<br />
</a><br />
</div><br />
<div class="ringbox"><br />
<img src="/wiki/images/0/0d/Heidelberg_Firering_red.png" id="ring-background" /><br />
<div id="circ-box" class="descr-box"><br />
<a href="/Team:Heidelberg/Toolbox/Circularization"><br />
<img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" id="circ-icon" class="toolbox-icon toolbox-icon-scale"/><br />
</a><br />
<h3>CIRCULARIZATION</h3><br />
<div><span>Create a linker with our crowd computing software and make your protein heat stable</span></div><br />
</div><br />
<div id="oligo-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><img src="/wiki/images/4/40/Oligomerization.png" id="oligo-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>OLIGOMERIZATION</h3><div><span>Fuse multiple Proteins or Domains using Inteins</span></div><br />
</div><br />
<div id="fusion-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" id="fusion-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>FUSION</h3><div><span>Fuse two Proteins or Domains together using Inteins</span></div><br />
</div><br />
<div id="onoff-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" id="onoff-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>ON/OFF</h3><div><span>Activate or deactivate Proteins using Inteins</span></div></div><br />
<div id="purification-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" id="purification-icon" class="toolbox-icon toolbox-icon-scale"/></a><div><h3>PURIFICATION</h3></div><span>Placeholder</span></div><br />
<div id="toolbox-text"><br />
the intein<br><br />
<span><a class="scheisslinkbleibweiss" href="/Team:Heidelberg/Project/Toolbox">toolbox</a><span><br />
</div><br />
</div><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Induction" class="block" id="lightning"><br />
<img class="toolbox-icon-scale" style="height:110px;display: inline-block;" src="/wiki/images/8/83/Heidelberg_Project_Lightning.png"><span style="position: relative;top: 20px;display: inline-block;">&nbsp;inducible via<br><br />
<span style="font-weight:bold;position: relative;left: -18px;" class="red-text">light induction</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/PCR_2.0" class="block box" style="width:250px;" id="dnmt1-box"><br />
<img id="dnmt1-img" src="/wiki/images/a/a6/Heidelberg_Project_Dnmt1.png"><br />
<span style="position:relative; z-index:5;" class="block"><br />
<span style="font-size:1.5em;"><br />
<span class="red-text">Heat-stable</span><br> circular <br><span style="font-weight:bold;">DNA-<br/>Methyltransferase</span><br />
</span><br><br />
<span style="font-weight:bold;font-size: 2.5em; text-align:right;line-height: 35px;"><br />
<span class="red-text">PCR 2.0</span><br />
</span><br />
</span><br />
</a><br />
<a href="/Team:Heidelberg/Toolbox_Guide" class="block" id="toolbox"><br />
<span style="position:relative; display: inline-block;height:110px; width:110px; vertical-align: middle;"><br />
<img style="height:100%; position:absolute; top:0; left:0;" id="toolbox-img" src="/wiki/images/2/24/Heidelberg_Project_Toolbox_guide.png" /><br />
<img style="height:100%; position:absolute; top:0; left:0; display:none;" id="toolbox-img-hover" src="/wiki/images/4/4c/Heidelberg_Toolbox_guide_highlighted.png" /><br />
</span><br />
<span style="position: relative;top: 20px;display: inline-block; vertical-align:middle;"><br />
<span style="font-weight:bold;" class="red-text">modify your protein</span><br/><br />
using the toolbox guide<br />
</span><br />
</a><br />
<div class="clearfix"></div><br />
</div><br />
</div><br />
</div><br />
<div class="container" id="Achievements"><br />
<ul class="nav nav-tabs" role="tablist"><br />
<li class="active" style="font-size:30px"><a href="#Achievements-tab" role="tab" data-toggle="tab"><img src="https://static.igem.org/mediawiki/2014/2/22/Heidelberg_Achievements_red.png" height="50px" alt="Button"> Achievements</a></li><br />
<li style="font-size:30px"><a href="#Medal_Criteria-tab" role="tab" data-toggle="tab"> <img src="https://static.igem.org/mediawiki/2014/3/3f/Heidelberg_Gold_red.png" height="50px" alt="Button"> Medal Criteria</a></li><br />
</ul><br />
<div class="tab-content"><br />
<div class="tab-pane fade in active" style="background-color:white; color:black;" id="Achievements-tab"><br />
<br />
<div class="row" style="margin-top: 20px; background-color:white"><br />
</div><br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Achievements_3.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establishing protein circularization as a NEW BIOENGINEERING TOOL in synthetic biology.</p> <br />
<p style="margin-left:50px; font-size:20px">Contributing to iGEM with a new foundational advance!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/Achievement_1.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Providing a NEW COMPREHENSIVE TOOLBOX based on inteins for modifying proteins post-translationally.</p> <br />
<p style="margin-left:50px; font-size:20px">Sending 67 Biobricks to Registry of Biological parts!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Achievement_2.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Development of a NEW STANDARD to make the use of inteins easy and modular.</p> <br />
<p style="margin-left:50px; font-size:20px">Establishment of a new <a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC">RFC</a>!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/1b/Achievements_toolbox.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Showing that the toolbox WORKS: proteins are circularized and split fluorescent proteins are reconstituted.</p> <br />
<p style="margin-left:50px; font-size:20px">Making Gels, Western Blots, Fluorescence-based Assays and Mass spectrometry to prove it! </p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/2/26/Achievements_4.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating circular DNMT1 and showing that it is ACTIVE.</p> <br />
<p style="margin-left:50px; font-size:20px">For the first time achieving the circularization of a large protein!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/5/5a/Achievements_craut.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Developing a NEW SOFTWARE to calculate customized linkers to circularize proteins.</p> <br />
<p style="margin-left:50px; font-size:20px">Making CRAUT open-source for the scientific community.</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/e/e5/Heidelberg_Frontpage_igemathome.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establish a distributed computing platform called <a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome">iGEM@home</a>.</p> <br />
<p style="margin-left:50px; font-size:20px">Using this platform as an entirely new way to reach out to the world with synthetic biology concepts!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
</div><br />
</div><br />
<div class="linie"></div><br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/Achievements_md.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating a NEW SOFTWARE to display the notebook on the wiki.</p> <br />
<p style="margin-left:50px; font-size:20px">Distributing MidNightDOC to the iGEM community to help future teams organize their protocols!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="tab-pane fade" style="color:white;" id="Medal_Criteria-tab"><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin-top: 20px"><br />
</div><br />
<div class="row vcenter-table"> <br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/6/63/Heidelberg_Bronze.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Bronze</h1><br />
<br><br />
<ul><br />
<li>Please find a comprehensive compilation of <a href="https://2014.igem.org/Team:Heidelberg/Team/Sponsoring">sponsors</a>, partners and scientific contributors on our <a href="https://2014.igem.org/Team:Heidelberg/Team/Attributions">acknowledgements page</a>. </li><br />
<br/><br />
<li>We also encourage you to take notice of the projects “Photo-intein” and “Mito-intein” by <a href="https://2014.igem.org/Team:Queens_Canada/Project">iGEM team Queens from Canada</a> that may supply you with complementary information and tools for the use of inteins in synthetic biology!</li><br />
<br/><br />
<li>A list of links to more than 60 parts in the registry submitted by our team (being or not being part of the new intein toolbox) can be found <a href="https://2014.igem.org/Team:Heidelberg/Parts#allParts">here</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/b/bf/Heidelberg_Silver.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Silver</h1><br />
<br><br />
<ul><br />
<li>We experimentally validated that our biobricks <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, <a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100 </a>and <a href="http://parts.igem.org/Part:BBa_K1362101">BBa_K1362101</a> work as expected. For more information on the <a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">parts</a> please visit the corresponding main pages in the parts registry or explore their involvement in our subprojects.</li><br />
<br/><br />
<li>Religious perceptions of synthetic biology have been part of several surveys during the past ten years of iGEM and Human Practices projects. Since religious groups cover the majority of worlds population, deliver moral values and wield power at the same time, we decided to dedicate a whole event on the topic of religion, philosophy and ethics regarding synthetic biology. Please find an <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/Ethics">evaluation of our event</a> on the corresponding Human Practices pages. <!--In order to reassure ourselves about the acceptability of our project and synthetic biology in general, we also used this opportunity to build up on the work of the iGEM Team Heidelberg 2013 and conducted a survey that addresses basic questions regarding the public reflection of our work.--><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/0/0a/Heidelberg_Gold.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Gold</h1><br />
<ul><br />
<li>We improved the function of the <b>already existing</b> biobrick part <a href="http://parts.igem.org/Part:BBa_K117505">BBa_K1175005 </a>by optimizing and resubmitting the corresponding sequence of B. subtilis xylanase to the registry (Part:<a href="http://parts.igem.org/Part:BBa_K1362020"> BBa_K1362020</a>). In addition, we submitted a new part for expression of <a href="http://parts.igem.org/Part:BBa_K1362022">circularized xylanase </a>(BBa_K1362022) that might be used in future applications with need for refined enzyme stability.</li><br />
<br/><br />
<li>Despite the fact that we focused on building a set of powerful soft- and wetware tools to help future iGEM-teams developing and realizing projects in synthetic biology, we are happy to announce that we were also able to help out several team during the course of our project, aspecially with sending <a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones"> our expression vectors</a>. Read more abou in in our <a href="https://2014.igem.org/Team:Heidelberg/Team/Collaborations">Collaborations</a>.</li><br />
<br/><br />
<li>In the style of of the new iGEM community labs track that involves science amateurs “beyond the accolades of scientific publishing and economic reward”, we sought for a new way to involve laymen in actual science and build a strong community of well informed supporters and communicators of synthetic biology at the same time. Now we proudly present the crowd sourcing and communication platform <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
</div><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
if(window.location.hash) {<br />
var hash = window.location.hash.substring(1); //Puts hash in variable, and removes the # character<br />
if(hash == "Abstract")<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
$('#abstract-dropdown').click(function() {<br />
if($('#abstract-content').css("display") == 'none'){<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
else{<br />
$('#abstract-content').slideUp(400, function() {$('#dropdownImg').attr("src", "/wiki/images/7/70/Heidelberg_Abstract-dropdown.png");});<br />
}<br />
});<br />
<br />
$('#linker-links').mouseenter(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeIn();<br />
});<br />
<br />
$('#linker-links').mouseleave(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeOut();<br />
});<br />
<br />
$('.descr-box span').css("opacity", 0);<br />
$('.descr-box h3, .descr-box > a')<br />
.mouseenter(function(){<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent()<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 1}, 800);<br />
})<br />
.mouseleave(function() {<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent();<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 0}, 800);<br />
});<br />
<br />
$('#toolbox')<br />
.mouseover(function() {<br />
$('#toolbox-img-hover').fadeIn();<br />
})<br />
.mouseleave(function() {<br />
$('#toolbox-img-hover').fadeOut();<br />
});<br />
<br />
$('#myTab a').click(function (e) {<br />
e.preventDefault()<br />
$(this).tab('show')<br />
})<br />
<br />
});<br />
</script><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/ProjectTeam:Heidelberg/Project2014-10-18T00:28:26Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/MainTemplate|unresponsive=}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstrapcss}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstraptheme}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/overrides}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/jquery}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/bootstrapjs}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/wikipage}}<br />
<html><br />
<style type="text/css"><br />
#myContainer {<br />
padding:0;<br />
background-color: black;<br />
background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg);<br />
background-repeat: no-repeat;<br />
background-size: 100% auto;<br />
}<br />
<br />
#light:hover {<br />
color: #FF7E25;<br />
}<br />
<br />
.main {<br />
margin-top: 25px;<br />
}<br />
<br />
.middle {<br />
font-size: 3em;<br />
}<br />
<br />
.large {<br />
font-size: 5em;<br />
font-weight: bold;<br />
}<br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icon-scale:hover {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icon-scale {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.ringbox{<br />
/*<br />
width: 750px;<br />
height: 600px;<br />
background-image:url('/wiki/images/d/dc/Ring_Project.png');<br />
background-size: 550px;<br />
background-repeat: no-repeat;<br />
*/<br />
position: absolute;<br />
top:260px;<br />
left:140px;<br />
height:640px;<br />
z-index:3;<br />
}<br />
<br />
.abstract-special {<br />
color: white;<br />
}<br />
<br />
.abstract-special span {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
display: block;<br />
}<br />
<br />
.abstract-special img {<br />
height: 15px;<br />
}<br />
<br />
.toolbox-icon {<br />
height: 90px;<br />
position: absolute;<br />
right:-43px;<br />
bottom:-45px;<br />
}<br />
<br />
#ring-background {<br />
width: 450px;<br />
height: auto;<br />
opacity:0.8;<br />
}<br />
<br />
.block{<br />
display:block;<br />
text-decoration:none;<br />
color: white;<br />
}<br />
<br />
.block:hover{<br />
text-decoration: none;<br />
}<br />
<br />
.box {<br />
background-color: rgba(81,81,81,0.7);<br />
padding: 15px;<br />
position:relative;<br />
}<br />
<br />
.box:hover {<br />
border:solid 2px #DE4230;<br />
padding: 13px;<br />
}<br />
<br />
<br />
.descr-box {<br />
width: 250px;<br />
height: 100px;<br />
position: absolute;<br />
}<br />
<br />
.descr-box h3 {<br />
margin-top: 10px;<br />
margin-bottom: 0;<br />
text-align: left;<br />
}<br />
<br />
.descr-box h3 span {<br />
font-size: 0.8em;<br />
}<br />
<br />
.descr-box div {<br />
border-right: solid white 2px;<br />
border-top: solid white 2px;<br />
padding-right:43px;<br />
}<br />
<br />
.descr-box span {<br />
display: block;<br />
}<br />
<br />
#circ-box {<br />
right: 160px;<br />
top: -120px;<br />
}<br />
<br />
#circ-box img {<br />
bottom: -130px;<br />
height: 120px;<br />
right: -57px;<br />
}<br />
<br />
#circ-box div {<br />
height: 114px;<br />
}<br />
<br />
#oligo-box {<br />
left: -100px;<br />
top: -10px;<br />
width: 200px;<br />
}<br />
<br />
#onoff-box {<br />
left: -105px;<br />
top: 120px;<br />
width: 150px;<br />
}<br />
<br />
#fusion-box {<br />
left: -100px;<br />
top: 330px;<br />
width: 190px;<br />
}<br />
<br />
#fusion-box img {<br />
top: -16px;<br />
}<br />
<br />
#fusion-box div {<br />
border-right: none;<br />
}<br />
<br />
#purification-box {<br />
left: 20px;<br />
top: 445px;<br />
width: 200px;<br />
}<br />
<br />
#purification-box img {<br />
top: -70px;<br />
}<br />
<br />
#purification-box div {<br />
border-top: none;<br />
border-bottom: solid white 2px;<br />
}<br />
<br />
#abstract-content {<br />
display:none;<br />
}<br />
<br />
.graphicalAbstract {<br />
background-image:url('/wiki/images/f/fa/Heidelberg_Project_Background.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
position:relative;<br />
z-index: 1;<br />
height:900px;<br />
}<br />
<br />
#redOverlay {<br />
position:absolute;<br />
width:100%;<br />
height:100%;<br />
left:0;<br />
top:0;<br />
display:none;<br />
background-image:url('/wiki/images/5/51/Heidelberg_project_red_overlay.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
z-index:2;<br />
}<br />
<br />
#lightning {<br />
z-index: 3;<br />
position:absolute;<br />
top: 610px;<br />
left: 460px;<br />
color:white;<br />
}<br />
<br />
<br />
#screened {<br />
z-index: 3;<br />
position:absolute;<br />
left: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#calibrated {<br />
z-index: 3;<br />
position:absolute;<br />
right: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#dnmt1-img {<br />
position: absolute;<br />
height: 155px;<br />
right: 15px;<br />
z-index:4;<br />
}<br />
<br />
a:hover #dnmt1-img {<br />
right: 13px;<br />
}<br />
<br />
#dnmt1-box {<br />
right: 40px;<br />
top: 340px;<br />
position: absolute;<br />
}<br />
<br />
#xylanase-box {<br />
width:250px;<br />
top: 556px;<br />
right:40px;<br />
position:absolute;<br />
}<br />
<br />
#xylanase-img {<br />
height: 140px;<br />
position: absolute;<br />
right: 15px;<br />
}<br />
<br />
a:hover #xylanase-img {<br />
right: 13px;<br />
}<br />
<br />
#toolbox-text{<br />
position: absolute;<br />
top: 145px;<br />
right: -135px;<br />
font-size: 5em;<br />
line-height: 70px;<br />
font-weight: bold;<br />
}<br />
<br />
#linker-links {<br />
position: absolute;<br />
width: 405px;<br />
right: 60px;<br />
top: 35px;<br />
height: 300px;<br />
}<br />
<br />
#toolbox {<br />
position:absolute;<br />
right: 50px;<br />
bottom: 190px;<br />
}<br />
<br />
#toolbox:hover > span {<br />
color: white;<br />
}<br />
<br />
.container {<br />
width: 1170px;<br />
}<br />
<br />
.scheisslinkbleibweiss {<br />
color: white;<br />
}<br />
<br />
.scheisslinkbleibweiss:hover {<br />
color: white;<br />
}<br />
<br />
div.margin-top { margin-top: 100px; }<br />
<br />
img.medal {<br />
height:200px;<br />
margin-top: 40px;<br />
text-align: center;<br />
}<br />
<br />
.center {<br />
text-align:center;<br />
}<br />
<br />
.linie {<br />
margin:20px 40px;<br />
border: solid 1px black;<br />
}<br />
<br />
.vcenter-table{<br />
display: table;<br />
}<br />
<br />
.vcenter-cell {<br />
display: table-cell;<br />
vertical-align: middle;<br />
float: none;<br />
}<br />
<br />
</style><br />
<div id="myContainer" class="container"><br />
</html><br />
{{:Team:Heidelberg/Templates/BootstrapNav|<br />
red=|<br />
white=true|<br />
red-logo=true|<br />
white-logo=|<br />
header-bg=|<br />
header-img=|<br />
title=<br />
}}<br />
<html><br />
<div class="container main" style="color: white;"><br />
<div id="abstract-dropdown" class="row abstract-special red"><br />
<div class="col-lg-offset-1 col-lg-11"><br />
<h4><img id="dropdownImg" src="https://static.igem.org/mediawiki/2014/0/05/Heidelberg_Dreieck-black.png"/>&nbsp;Project overview</h4><br />
</div><br />
<!--<div class="col-lg-9"><br />
<span>Click to read the project overview</span><br />
</div>--><br />
<div id="abstract-content" class="col-lg-12" ><br />
<p>Proteins are the functional basis of all biological processes and being able to control and improve their functions through design and engineering is one of the fundamental goals of synthetic biology. While conventional proteins subsist as chains of amino acids with defined beginning and end, nature has found a curious way of enhancing a protein capabilities: circularization.<br />
In head to tail circularized peptides the terminal amino acids are joined together just like in the rest of the chain, forming a circular structure. Such peptides have been discovered in all kingdoms of life during the past years and they are unified by an extreme stability towards high temperatures, proteases and changes in pH.</p><br />
<br />
<p>Given these attractive features of circular proteins, methods to circularize otherwise linear proteins have been devised, one of which is based on autocatalytic protein domains called inteins. <br />
We have applied the principle of circular peptides to synthetic biology by introducing a BioBrick-based, standardised method for circularizing any protein using inteins.</p><br />
<br />
<p>Synthetically connecting a protein&apos;s termini without disrupting its 3D structure and function is, however, a delicate task which has so far been accomplished only for relatively small proteins whose ends lie close to each other. We therefore saw the need for a comprehensive software that predicts the process of circularization. With CRAUT we have brought into existence a powerful open-source software to predict an optimal linker to support circularization of a protein preserving its 3D structure and function.<br /><br />
Due to our lack of calculating power we deployed this software on the distributed computing platform BOINC in an initiative we call iGEM@home.</p><br />
<br />
<p>Based on our software predictions, we constructed linkers to circularize the 871 a.a. long methyltransferase Dnmt1 and provide data suggesting that circular DNMT1 is more functional than its linear counterpart at high temperatures. Our results have strong implications for developing an innovative PCR-based technique that could revolutionize epigenetic studies and cancer research by maintaining the methylation pattern of the DNA template during amplification.</p><br />
<br />
<p>Eventually, inteins can be used to post-translationally modify any protein in a multitude of ways going far beyond circularization. We therefore created a BioBrick-based intein toolbox to allow for easy and standardised protein manipulation. We think that our toolbox will be invaluable to many systems biology projects aimed at dissecting or re-engineering the function of cellular networks.</p><br />
</div><br />
</div><br />
<div class="graphicalAbstract"><br />
<div id="redOverlay"></div><br />
<div style="z-index:3;position:relative; height:100%;"><br />
<div id="linker-links"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome" class="block box" id="calibrated"><br />
<img style="height:60px;display: inline-block;" src="/wiki/images/e/ea/Heidelberg_Project_Computer.png"><br />
<span style="position: relative;top: 10px;display: inline-block;"><br />
calibrated<br><br />
<span class="red-text">in silico</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Linker_Screening" class="block box" id="screened"><br />
<span style="position: relative;top:10px;display: inline-block;"><br />
screened <span class="red-text">in vitro</span><br><br />
with lysozyme</span><br />
<img style="height:60px; display:inline-block;" src="/wiki/images/d/df/Heidelberg_Lysozyme.png" /><br />
</a><br />
<a href="/Team:Heidelberg/Software/Linker_Software" class="block box" style="bottom:0; left:-20px; position:absolute;width:170px;"><br />
<img src="/wiki/images/4/42/Craut_small.png" alt="..." style="width:100%;"/><br />
<span class="red-text" >circularize</span> it<br><br />
with calculated linkers<br />
</a><br />
</div><br />
<div class="ringbox"><br />
<img src="/wiki/images/0/0d/Heidelberg_Firering_red.png" id="ring-background" /><br />
<div id="circ-box" class="descr-box"><br />
<a href="/Team:Heidelberg/Toolbox/Circularization"><br />
<img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" id="circ-icon" class="toolbox-icon toolbox-icon-scale"/><br />
</a><br />
<h3>CIRCULARIZATION</h3><br />
<div><span>Create a linker with our crowd computing software and make your protein heat stable</span></div><br />
</div><br />
<div id="oligo-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><img src="/wiki/images/4/40/Oligomerization.png" id="oligo-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>OLIGOMERIZATION</h3><div><span>Fuse multiple Proteins or Domains using Inteins</span></div><br />
</div><br />
<div id="fusion-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" id="fusion-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>FUSION</h3><div><span>Fuse two Proteins or Domains together using Inteins</span></div><br />
</div><br />
<div id="onoff-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" id="onoff-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>ON/OFF</h3><div><span>Activate or deactivate Proteins using Inteins</span></div></div><br />
<div id="purification-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" id="purification-icon" class="toolbox-icon toolbox-icon-scale"/></a><div><h3>PURIFICATION</h3></div><span>Placeholder</span></div><br />
<div id="toolbox-text"><br />
the intein<br><br />
<span><a class="scheisslinkbleibweiss" href="/Team:Heidelberg/Project/Toolbox">toolbox</a><span><br />
</div><br />
</div><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Induction" class="block" id="lightning"><br />
<img class="toolbox-icon-scale" style="height:110px;display: inline-block;" src="/wiki/images/8/83/Heidelberg_Project_Lightning.png"><span style="position: relative;top: 20px;display: inline-block;">&nbsp;inducible via<br><br />
<span style="font-weight:bold;position: relative;left: -18px;" class="red-text">light induction</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/PCR_2.0" class="block box" style="width:250px;" id="dnmt1-box"><br />
<img id="dnmt1-img" src="/wiki/images/a/a6/Heidelberg_Project_Dnmt1.png"><br />
<span style="position:relative; z-index:5;" class="block"><br />
<span style="font-size:1.5em;"><br />
<span class="red-text">Heat-stable</span><br> circular <br><span style="font-weight:bold;">DNA-<br/>Methyltransferase</span><br />
</span><br><br />
<span style="font-weight:bold;font-size: 2.5em; text-align:right;line-height: 35px;"><br />
<span class="red-text">PCR 2.0</span><br />
</span><br />
</span><br />
</a><br />
<a href="/Team:Heidelberg/Toolbox_Guide" class="block" id="toolbox"><br />
<span style="position:relative; display: inline-block;height:110px; width:110px; vertical-align: middle;"><br />
<img style="height:100%; position:absolute; top:0; left:0;" id="toolbox-img" src="/wiki/images/2/24/Heidelberg_Project_Toolbox_guide.png" /><br />
<img style="height:100%; position:absolute; top:0; left:0; display:none;" id="toolbox-img-hover" src="/wiki/images/4/4c/Heidelberg_Toolbox_guide_highlighted.png" /><br />
</span><br />
<span style="position: relative;top: 20px;display: inline-block; vertical-align:middle;"><br />
<span style="font-weight:bold;" class="red-text">modify your protein</span><br/><br />
using the toolbox guide<br />
</span><br />
</a><br />
<div class="clearfix"></div><br />
</div><br />
</div><br />
</div><br />
<div class="container" id="Achievements"><br />
<ul class="nav nav-tabs" role="tablist"><br />
<li class="active" style="font-size:30px"><a href="#Achievements-tab" role="tab" data-toggle="tab"><img src="https://static.igem.org/mediawiki/2014/2/22/Heidelberg_Achievements_red.png" height="50px" alt="Button"> Achievements</a></li><br />
<li style="font-size:30px"><a href="#Medal_Criteria-tab" role="tab" data-toggle="tab"> <img src="https://static.igem.org/mediawiki/2014/3/3f/Heidelberg_Gold_red.png" height="50px" alt="Button"> Medal Criteria</a></li><br />
</ul><br />
<div class="tab-content"><br />
<div class="tab-pane fade in active" style="background-color:white; color:black;" id="Achievements-tab"><br />
<br />
<div class="row" style="margin-top: 20px; background-color:white"><br />
</div><br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Achievements_3.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establishing protein circularization as a NEW BIOENGINEERING TOOL in synthetic biology.</p> <br />
<p style="margin-left:50px; font-size:20px">Contributing to iGEM with a new foundational advance!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/Achievement_1.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Providing a NEW COMPREHENSIVE TOOLBOX based on inteins for modifying proteins post-translationally.</p> <br />
<p style="margin-left:50px; font-size:20px">Sending 67 Biobricks to Registry of Biological parts!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Achievement_2.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Development of a NEW STANDARD to make the use of inteins easy and modular.</p> <br />
<p style="margin-left:50px; font-size:20px">Establishment of a new <a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC">RFC</a>!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/1b/Achievements_toolbox.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Showing that the toolbox WORKS: proteins are circularized and split fluorescent proteins are reconstituted.</p> <br />
<p style="margin-left:50px; font-size:20px">Making Gels, Western Blots, Fluorescence-based Assays and Mass spectrometry to prove it! </p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/2/26/Achievements_4.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating circular DNMT1 and showing that it is ACTIVE.</p> <br />
<p style="margin-left:50px; font-size:20px">For the first time achieving the circularization of a large protein!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/5/5a/Achievements_craut.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Developing a NEW SOFTWARE to calculate customized linkers to circularize proteins.</p> <br />
<p style="margin-left:50px; font-size:20px">Making CRAUT open-source for the scientific community.</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/e/e5/Heidelberg_Frontpage_igemathome.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establish a distributed computing platform called <a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome">iGEM@home</a>.</p> <br />
<p style="margin-left:50px; font-size:20px">Using this platform as an entirely new way to reach out to the world with synthetic biology concepts!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
</div><br />
</div><br />
<div class="linie"></div><br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/Achievements_md.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating a NEW SOFTWARE to display the notebook on the wiki.</p> <br />
<p style="margin-left:50px; font-size:20px">Distributing MidNightDOC to the iGEM community to help future teams organize their protocols!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="tab-pane fade" style="color:white;" id="Medal_Criteria-tab"><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin-top: 20px"><br />
</div><br />
<div class="row vcenter-table"> <br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/6/63/Heidelberg_Bronze.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Bronze</h1><br />
<br><br />
<ul><br />
<li>Please find a comprehensive compilation of <a href="https://2014.igem.org/Team:Heidelberg/Team/Sponsoring">sponsors</a>, partners and scientific contributors on our <a href="https://2014.igem.org/Team:Heidelberg/Team/Attributions">acknowledgements page</a>. </li><br />
<br/><br />
<li>We also encourage you to take notice of the projects “Photo-intein” and “Mito-intein” by <a href="https://2014.igem.org/Team:Queens_Canada/Project">iGEM team Queens from Canada</a> that may supply you with complementary information and tools for the use of inteins in synthetic biology!</li><br />
<br/><br />
<li>A list of links to more than 60 parts in the registry submitted by our team (being or not being part of the new intein toolbox) can be found <a href="https://2014.igem.org/Team:Heidelberg/Parts#allParts">here</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/b/bf/Heidelberg_Silver.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Silver</h1><br />
<br><br />
<ul><br />
<li>We experimentally validated that our biobricks <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, <a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100 </a>and <a href="http://parts.igem.org/Part:BBa_K1362101">BBa_K1362101</a> work as expected. For more information on the <a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">parts</a> please visit the corresponding main pages in the parts registry or explore their involvement in our subprojects.</li><br />
<br/><br />
<li>Religious perceptions of synthetic biology have been part of several surveys during the past ten years of iGEM and Human Practices projects. Since religious groups cover the majority of worlds population, deliver moral values and wield power at the same time, we decided to dedicate a whole event on the topic of religion, philosophy and ethics regarding synthetic biology. Please find an <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/Ethics">evaluation of our event</a> on the corresponding Human Practices pages. <!--In order to reassure ourselves about the acceptability of our project and synthetic biology in general, we also used this opportunity to build up on the work of the iGEM Team Heidelberg 2013 and conducted a survey that addresses basic questions regarding the public reflection of our work.--><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/0/0a/Heidelberg_Gold.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Gold</h1><br />
<ul><br />
<li>We improved the function of the <b>already existing</b> biobrick part <a href="http://parts.igem.org/Part:BBa_K117505">BBa_K1175005 </a>by optimizing and resubmitting the corresponding sequence of B. subtilis xylanase to the registry (Part:<a href="http://parts.igem.org/Part:BBa_K1362020"> BBa_K1362020</a>). In addition, we submitted a new part for expression of <a href="http://parts.igem.org/Part:BBa_K1362022">circularized xylanase </a>(BBa_K1362022) that might be used in future applications with need for refined enzyme stability.</li><br />
<br/><br />
<li>Despite the fact that we focused on building a set of powerful soft- and wetware tools to help future iGEM-teams developing and realizing projects in synthetic biology, we are happy to announce that we were also able to help out several team during the course of our project, aspecially with sending <a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones"> our expression vectors</a>. Read more abou in in our <a href="https://2014.igem.org/Team:Heidelberg/Team/Collaborations">Collaborations</a>.</li><br />
<br/><br />
<li>In the style of of the new iGEM community labs track that involves science amateurs “beyond the accolades of scientific publishing and economic reward”, we sought for a new way to involve laymen in actual science and build a strong community of well informed supporters and communicators of synthetic biology at the same time. Now we proudly present the crowd sourcing and communication platform <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
</div><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
if(window.location.hash) {<br />
var hash = window.location.hash.substring(1); //Puts hash in variable, and removes the # character<br />
if(hash == "Abstract")<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
$('#abstract-dropdown').click(function() {<br />
if($('#abstract-content').css("display") == 'none'){<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
else{<br />
$('#abstract-content').slideUp(400, function() {$('#dropdownImg').attr("src", "/wiki/images/7/70/Heidelberg_Abstract-dropdown.png");});<br />
}<br />
});<br />
<br />
$('#linker-links').mouseenter(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeIn();<br />
});<br />
<br />
$('#linker-links').mouseleave(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeOut();<br />
});<br />
<br />
$('.descr-box span').css("opacity", 0);<br />
$('.descr-box h3, .descr-box > a')<br />
.mouseenter(function(){<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent()<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 1}, 800);<br />
})<br />
.mouseleave(function() {<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent();<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 0}, 800);<br />
});<br />
<br />
$('#toolbox')<br />
.mouseover(function() {<br />
$('#toolbox-img-hover').fadeIn();<br />
})<br />
.mouseleave(function() {<br />
$('#toolbox-img-hover').fadeOut();<br />
});<br />
<br />
$('#myTab a').click(function (e) {<br />
e.preventDefault()<br />
$(this).tab('show')<br />
})<br />
<br />
});<br />
</script><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/ProjectTeam:Heidelberg/Project2014-10-18T00:27:54Z<p>Bunnech: </p>
<hr />
<div>{{:Team:Heidelberg/Templates/MainTemplate|unresponsive=}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstrapcss}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/bootstraptheme}}<br />
{{:Team:Heidelberg/Templates/IncludeCSS|:Team:Heidelberg/css/overrides}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/jquery}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/bootstrapjs}}<br />
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/wikipage}}<br />
<html><br />
<style type="text/css"><br />
#myContainer {<br />
padding:0;<br />
background-color: black;<br />
background-image: url(/wiki/images/6/6a/Heidelberg_epic_background.jpg);<br />
background-repeat: no-repeat;<br />
background-size: 100% auto;<br />
}<br />
<br />
#light:hover {<br />
color: #FF7E25;<br />
}<br />
<br />
.main {<br />
margin-top: 25px;<br />
}<br />
<br />
.middle {<br />
font-size: 3em;<br />
}<br />
<br />
.large {<br />
font-size: 5em;<br />
font-weight: bold;<br />
}<br />
<br />
/* Enlarge Icons on hover */<br />
.toolbox-icon-scale:hover {<br />
transform: scale(1.15);<br />
-webkit-transform: scale(1.15);<br />
-moz-transform: scale(1.15);<br />
-o-transform: scale(1.15);<br />
-ms-transform: scale(1.15);<br />
}<br />
<br />
.toolbox-icon-scale {<br />
transition:transform 0.15s ease;<br />
-webkit-transition:-webkit-transform 0.15s ease;<br />
-moz-transition:-moz-transform 0.15s ease;<br />
-o-transition:-o-transform 0.15s ease;<br />
}<br />
<br />
.ringbox{<br />
/*<br />
width: 750px;<br />
height: 600px;<br />
background-image:url('/wiki/images/d/dc/Ring_Project.png');<br />
background-size: 550px;<br />
background-repeat: no-repeat;<br />
*/<br />
position: absolute;<br />
top:260px;<br />
left:140px;<br />
height:640px;<br />
z-index:3;<br />
}<br />
<br />
.abstract-special {<br />
color: white;<br />
}<br />
<br />
.abstract-special span {<br />
margin-top: 10px;<br />
margin-bottom: 10px;<br />
display: block;<br />
}<br />
<br />
.abstract-special img {<br />
height: 15px;<br />
}<br />
<br />
.toolbox-icon {<br />
height: 90px;<br />
position: absolute;<br />
right:-43px;<br />
bottom:-45px;<br />
}<br />
<br />
#ring-background {<br />
width: 450px;<br />
height: auto;<br />
opacity:0.8;<br />
}<br />
<br />
.block{<br />
display:block;<br />
text-decoration:none;<br />
color: white;<br />
}<br />
<br />
.block:hover{<br />
text-decoration: none;<br />
}<br />
<br />
.box {<br />
background-color: rgba(81,81,81,0.7);<br />
padding: 15px;<br />
position:relative;<br />
}<br />
<br />
.box:hover {<br />
border:solid 2px #DE4230;<br />
padding: 13px;<br />
}<br />
<br />
<br />
.descr-box {<br />
width: 250px;<br />
height: 100px;<br />
position: absolute;<br />
}<br />
<br />
.descr-box h3 {<br />
margin-top: 10px;<br />
margin-bottom: 0;<br />
text-align: left;<br />
}<br />
<br />
.descr-box h3 span {<br />
font-size: 0.8em;<br />
}<br />
<br />
.descr-box div {<br />
border-right: solid white 2px;<br />
border-top: solid white 2px;<br />
padding-right:43px;<br />
}<br />
<br />
.descr-box span {<br />
display: block;<br />
}<br />
<br />
#circ-box {<br />
right: 160px;<br />
top: -120px;<br />
}<br />
<br />
#circ-box img {<br />
bottom: -130px;<br />
height: 120px;<br />
right: -57px;<br />
}<br />
<br />
#circ-box div {<br />
height: 114px;<br />
}<br />
<br />
#oligo-box {<br />
left: -100px;<br />
top: -10px;<br />
width: 200px;<br />
}<br />
<br />
#onoff-box {<br />
left: -105px;<br />
top: 120px;<br />
width: 150px;<br />
}<br />
<br />
#fusion-box {<br />
left: -100px;<br />
top: 330px;<br />
width: 190px;<br />
}<br />
<br />
#fusion-box img {<br />
top: -16px;<br />
}<br />
<br />
#fusion-box div {<br />
border-right: none;<br />
}<br />
<br />
#purification-box {<br />
left: 20px;<br />
top: 445px;<br />
width: 200px;<br />
}<br />
<br />
#purification-box img {<br />
top: -70px;<br />
}<br />
<br />
#purification-box div {<br />
border-top: none;<br />
border-bottom: solid white 2px;<br />
}<br />
<br />
#abstract-content {<br />
display:none;<br />
}<br />
<br />
.graphicalAbstract {<br />
background-image:url('/wiki/images/f/fa/Heidelberg_Project_Background.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
position:relative;<br />
z-index: 1;<br />
height:900px;<br />
}<br />
<br />
#redOverlay {<br />
position:absolute;<br />
width:100%;<br />
height:100%;<br />
left:0;<br />
top:0;<br />
display:none;<br />
background-image:url('/wiki/images/5/51/Heidelberg_project_red_overlay.png');<br />
background-size: 100% auto;<br />
background-repeat: no-repeat;<br />
z-index:2;<br />
}<br />
<br />
#lightning {<br />
z-index: 3;<br />
position:absolute;<br />
top: 610px;<br />
left: 460px;<br />
color:white;<br />
}<br />
<br />
<br />
#screened {<br />
z-index: 3;<br />
position:absolute;<br />
left: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#calibrated {<br />
z-index: 3;<br />
position:absolute;<br />
right: 0;<br />
top: 0;<br />
color: white;<br />
}<br />
<br />
#dnmt1-img {<br />
position: absolute;<br />
height: 155px;<br />
right: 15px;<br />
z-index:4;<br />
}<br />
<br />
a:hover #dnmt1-img {<br />
right: 13px;<br />
}<br />
<br />
#dnmt1-box {<br />
right: 40px;<br />
top: 340px;<br />
position: absolute;<br />
}<br />
<br />
#xylanase-box {<br />
width:250px;<br />
top: 556px;<br />
right:40px;<br />
position:absolute;<br />
}<br />
<br />
#xylanase-img {<br />
height: 140px;<br />
position: absolute;<br />
right: 15px;<br />
}<br />
<br />
a:hover #xylanase-img {<br />
right: 13px;<br />
}<br />
<br />
#toolbox-text{<br />
position: absolute;<br />
top: 145px;<br />
right: -135px;<br />
font-size: 5em;<br />
line-height: 70px;<br />
font-weight: bold;<br />
}<br />
<br />
#linker-links {<br />
position: absolute;<br />
width: 405px;<br />
right: 60px;<br />
top: 35px;<br />
height: 300px;<br />
}<br />
<br />
#toolbox {<br />
position:absolute;<br />
right: 50px;<br />
bottom: 190px;<br />
}<br />
<br />
#toolbox:hover > span {<br />
color: white;<br />
}<br />
<br />
.container {<br />
width: 1170px;<br />
}<br />
<br />
.scheisslinkbleibweiss {<br />
color: white;<br />
}<br />
<br />
.scheisslinkbleibweiss:hover {<br />
color: white;<br />
}<br />
<br />
div.margin-top { margin-top: 100px; }<br />
<br />
img.medal {<br />
height:200px;<br />
margin-top: 40px;<br />
text-align: center;<br />
}<br />
<br />
.center {<br />
text-align:center;<br />
}<br />
<br />
.linie {<br />
margin:20px 40px;<br />
border: solid 1px black;<br />
}<br />
<br />
.vcenter-table{<br />
display: table;<br />
}<br />
<br />
.vcenter-cell {<br />
display: table-cell;<br />
vertical-align: middle;<br />
float: none;<br />
}<br />
<br />
</style><br />
<div id="myContainer" class="container"><br />
</html><br />
{{:Team:Heidelberg/Templates/BootstrapNav|<br />
red=|<br />
white=true|<br />
red-logo=true|<br />
white-logo=|<br />
header-bg=|<br />
header-img=|<br />
title=<br />
}}<br />
<html><br />
<div class="container main" style="color: white;"><br />
<div id="abstract-dropdown" class="row abstract-special #DE2430"><br />
<div class="col-lg-offset-1 col-lg-11"><br />
<h4><img id="dropdownImg" src="https://static.igem.org/mediawiki/2014/0/05/Heidelberg_Dreieck-black.png"/>&nbsp;Project overview</h4><br />
</div><br />
<!--<div class="col-lg-9"><br />
<span>Click to read the project overview</span><br />
</div>--><br />
<div id="abstract-content" class="col-lg-12" ><br />
<p>Proteins are the functional basis of all biological processes and being able to control and improve their functions through design and engineering is one of the fundamental goals of synthetic biology. While conventional proteins subsist as chains of amino acids with defined beginning and end, nature has found a curious way of enhancing a protein capabilities: circularization.<br />
In head to tail circularized peptides the terminal amino acids are joined together just like in the rest of the chain, forming a circular structure. Such peptides have been discovered in all kingdoms of life during the past years and they are unified by an extreme stability towards high temperatures, proteases and changes in pH.</p><br />
<br />
<p>Given these attractive features of circular proteins, methods to circularize otherwise linear proteins have been devised, one of which is based on autocatalytic protein domains called inteins. <br />
We have applied the principle of circular peptides to synthetic biology by introducing a BioBrick-based, standardised method for circularizing any protein using inteins.</p><br />
<br />
<p>Synthetically connecting a protein&apos;s termini without disrupting its 3D structure and function is, however, a delicate task which has so far been accomplished only for relatively small proteins whose ends lie close to each other. We therefore saw the need for a comprehensive software that predicts the process of circularization. With CRAUT we have brought into existence a powerful open-source software to predict an optimal linker to support circularization of a protein preserving its 3D structure and function.<br /><br />
Due to our lack of calculating power we deployed this software on the distributed computing platform BOINC in an initiative we call iGEM@home.</p><br />
<br />
<p>Based on our software predictions, we constructed linkers to circularize the 871 a.a. long methyltransferase Dnmt1 and provide data suggesting that circular DNMT1 is more functional than its linear counterpart at high temperatures. Our results have strong implications for developing an innovative PCR-based technique that could revolutionize epigenetic studies and cancer research by maintaining the methylation pattern of the DNA template during amplification.</p><br />
<br />
<p>Eventually, inteins can be used to post-translationally modify any protein in a multitude of ways going far beyond circularization. We therefore created a BioBrick-based intein toolbox to allow for easy and standardised protein manipulation. We think that our toolbox will be invaluable to many systems biology projects aimed at dissecting or re-engineering the function of cellular networks.</p><br />
</div><br />
</div><br />
<div class="graphicalAbstract"><br />
<div id="redOverlay"></div><br />
<div style="z-index:3;position:relative; height:100%;"><br />
<div id="linker-links"><br />
<a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome" class="block box" id="calibrated"><br />
<img style="height:60px;display: inline-block;" src="/wiki/images/e/ea/Heidelberg_Project_Computer.png"><br />
<span style="position: relative;top: 10px;display: inline-block;"><br />
calibrated<br><br />
<span class="red-text">in silico</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/Linker_Screening" class="block box" id="screened"><br />
<span style="position: relative;top:10px;display: inline-block;"><br />
screened <span class="red-text">in vitro</span><br><br />
with lysozyme</span><br />
<img style="height:60px; display:inline-block;" src="/wiki/images/d/df/Heidelberg_Lysozyme.png" /><br />
</a><br />
<a href="/Team:Heidelberg/Software/Linker_Software" class="block box" style="bottom:0; left:-20px; position:absolute;width:170px;"><br />
<img src="/wiki/images/4/42/Craut_small.png" alt="..." style="width:100%;"/><br />
<span class="red-text" >circularize</span> it<br><br />
with calculated linkers<br />
</a><br />
</div><br />
<div class="ringbox"><br />
<img src="/wiki/images/0/0d/Heidelberg_Firering_red.png" id="ring-background" /><br />
<div id="circ-box" class="descr-box"><br />
<a href="/Team:Heidelberg/Toolbox/Circularization"><br />
<img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" id="circ-icon" class="toolbox-icon toolbox-icon-scale"/><br />
</a><br />
<h3>CIRCULARIZATION</h3><br />
<div><span>Create a linker with our crowd computing software and make your protein heat stable</span></div><br />
</div><br />
<div id="oligo-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Oligomerization"><img src="/wiki/images/4/40/Oligomerization.png" id="oligo-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>OLIGOMERIZATION</h3><div><span>Fuse multiple Proteins or Domains using Inteins</span></div><br />
</div><br />
<div id="fusion-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Fusion_and_Tagging"><img src="/wiki/images/8/87/Heidelberg_Toolbox_Fusion.png" id="fusion-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>FUSION</h3><div><span>Fuse two Proteins or Domains together using Inteins</span></div><br />
</div><br />
<div id="onoff-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#On_Off"><img src="/wiki/images/c/c2/Heidelberg_Toolbox_On-Off.png" id="onoff-icon" class="toolbox-icon toolbox-icon-scale"/></a><h3>ON/OFF</h3><div><span>Activate or deactivate Proteins using Inteins</span></div></div><br />
<div id="purification-box" class="descr-box"><a href="https://2014.igem.org/Team:Heidelberg/Project/Toolbox#Purification"><img src="/wiki/images/0/04/Heidelberg_Toolbox_Purification.png" id="purification-icon" class="toolbox-icon toolbox-icon-scale"/></a><div><h3>PURIFICATION</h3></div><span>Placeholder</span></div><br />
<div id="toolbox-text"><br />
the intein<br><br />
<span><a class="scheisslinkbleibweiss" href="/Team:Heidelberg/Project/Toolbox">toolbox</a><span><br />
</div><br />
</div><br />
<a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Induction" class="block" id="lightning"><br />
<img class="toolbox-icon-scale" style="height:110px;display: inline-block;" src="/wiki/images/8/83/Heidelberg_Project_Lightning.png"><span style="position: relative;top: 20px;display: inline-block;">&nbsp;inducible via<br><br />
<span style="font-weight:bold;position: relative;left: -18px;" class="red-text">light induction</span></span><br />
</a><br />
<a href="https://2014.igem.org/Team:Heidelberg/Project/PCR_2.0" class="block box" style="width:250px;" id="dnmt1-box"><br />
<img id="dnmt1-img" src="/wiki/images/a/a6/Heidelberg_Project_Dnmt1.png"><br />
<span style="position:relative; z-index:5;" class="block"><br />
<span style="font-size:1.5em;"><br />
<span class="red-text">Heat-stable</span><br> circular <br><span style="font-weight:bold;">DNA-<br/>Methyltransferase</span><br />
</span><br><br />
<span style="font-weight:bold;font-size: 2.5em; text-align:right;line-height: 35px;"><br />
<span class="red-text">PCR 2.0</span><br />
</span><br />
</span><br />
</a><br />
<a href="/Team:Heidelberg/Toolbox_Guide" class="block" id="toolbox"><br />
<span style="position:relative; display: inline-block;height:110px; width:110px; vertical-align: middle;"><br />
<img style="height:100%; position:absolute; top:0; left:0;" id="toolbox-img" src="/wiki/images/2/24/Heidelberg_Project_Toolbox_guide.png" /><br />
<img style="height:100%; position:absolute; top:0; left:0; display:none;" id="toolbox-img-hover" src="/wiki/images/4/4c/Heidelberg_Toolbox_guide_highlighted.png" /><br />
</span><br />
<span style="position: relative;top: 20px;display: inline-block; vertical-align:middle;"><br />
<span style="font-weight:bold;" class="red-text">modify your protein</span><br/><br />
using the toolbox guide<br />
</span><br />
</a><br />
<div class="clearfix"></div><br />
</div><br />
</div><br />
</div><br />
<div class="container" id="Achievements"><br />
<ul class="nav nav-tabs" role="tablist"><br />
<li class="active" style="font-size:30px"><a href="#Achievements-tab" role="tab" data-toggle="tab"><img src="https://static.igem.org/mediawiki/2014/2/22/Heidelberg_Achievements_red.png" height="50px" alt="Button"> Achievements</a></li><br />
<li style="font-size:30px"><a href="#Medal_Criteria-tab" role="tab" data-toggle="tab"> <img src="https://static.igem.org/mediawiki/2014/3/3f/Heidelberg_Gold_red.png" height="50px" alt="Button"> Medal Criteria</a></li><br />
</ul><br />
<div class="tab-content"><br />
<div class="tab-pane fade in active" style="background-color:white; color:black;" id="Achievements-tab"><br />
<br />
<div class="row" style="margin-top: 20px; background-color:white"><br />
</div><br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Achievements_3.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establishing protein circularization as a NEW BIOENGINEERING TOOL in synthetic biology.</p> <br />
<p style="margin-left:50px; font-size:20px">Contributing to iGEM with a new foundational advance!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/Achievement_1.png" class="img-responsive" style="margin-left:15px;"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Providing a NEW COMPREHENSIVE TOOLBOX based on inteins for modifying proteins post-translationally.</p> <br />
<p style="margin-left:50px; font-size:20px">Sending 67 Biobricks to Registry of Biological parts!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/f/f9/Achievement_2.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Development of a NEW STANDARD to make the use of inteins easy and modular.</p> <br />
<p style="margin-left:50px; font-size:20px">Establishment of a new <a href="https://2014.igem.org/Team:Heidelberg/Parts/RFC">RFC</a>!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/1b/Achievements_toolbox.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Showing that the toolbox WORKS: proteins are circularized and split fluorescent proteins are reconstituted.</p> <br />
<p style="margin-left:50px; font-size:20px">Making Gels, Western Blots, Fluorescence-based Assays and Mass spectrometry to prove it! </p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/2/26/Achievements_4.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating circular DNMT1 and showing that it is ACTIVE.</p> <br />
<p style="margin-left:50px; font-size:20px">For the first time achieving the circularization of a large protein!</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/5/5a/Achievements_craut.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Developing a NEW SOFTWARE to calculate customized linkers to circularize proteins.</p> <br />
<p style="margin-left:50px; font-size:20px">Making CRAUT open-source for the scientific community.</p><br />
</div><br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
<div class="linie"></div><br />
<br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/e/e5/Heidelberg_Frontpage_igemathome.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Establish a distributed computing platform called <a href="https://2014.igem.org/Team:Heidelberg/Software/igemathome">iGEM@home</a>.</p> <br />
<p style="margin-left:50px; font-size:20px">Using this platform as an entirely new way to reach out to the world with synthetic biology concepts!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
</div><br />
</div><br />
<div class="linie"></div><br />
<div class="row vcenter-table" style="margin:0;"><br />
<div class="col-md-3 col-xs-12 vcenter-cell"><br />
<img src="https://static.igem.org/mediawiki/2014/1/18/Achievements_md.png" class="img-responsive" style="margin-left:15px;"> <br />
</div><br />
<br />
<div class="col-md-9 col-xs-12 vcenter-cell"><br />
<div class="col-xs-9"><br />
<p style="font-weight:light; font-size:25px">Creating a NEW SOFTWARE to display the notebook on the wiki.</p> <br />
<p style="margin-left:50px; font-size:20px">Distributing MidNightDOC to the iGEM community to help future teams organize their protocols!</p><br />
</div><br />
<br />
<br />
<div class="col-xs-3"><br />
<img src="/wiki/images/7/7d/Check_new.png" style="height:100px; margin-right:15px;"><br />
</div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div class="tab-pane fade" style="color:white;" id="Medal_Criteria-tab"><br />
<br />
<div class="col-md-12 col-sm-12 col-xs-12" style="margin-top: 20px"><br />
</div><br />
<div class="row vcenter-table"> <br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/6/63/Heidelberg_Bronze.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Bronze</h1><br />
<br><br />
<ul><br />
<li>Please find a comprehensive compilation of <a href="https://2014.igem.org/Team:Heidelberg/Team/Sponsoring">sponsors</a>, partners and scientific contributors on our <a href="https://2014.igem.org/Team:Heidelberg/Team/Attributions">acknowledgements page</a>. </li><br />
<br/><br />
<li>We also encourage you to take notice of the projects “Photo-intein” and “Mito-intein” by <a href="https://2014.igem.org/Team:Queens_Canada/Project">iGEM team Queens from Canada</a> that may supply you with complementary information and tools for the use of inteins in synthetic biology!</li><br />
<br/><br />
<li>A list of links to more than 60 parts in the registry submitted by our team (being or not being part of the new intein toolbox) can be found <a href="https://2014.igem.org/Team:Heidelberg/Parts#allParts">here</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/b/bf/Heidelberg_Silver.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Silver</h1><br />
<br><br />
<ul><br />
<li>We experimentally validated that our biobricks <a href="http://parts.igem.org/Part:BBa_K1362000">BBa_K1362000</a>, <a href="http://parts.igem.org/Part:BBa_K1362100">BBa_K1362100 </a>and <a href="http://parts.igem.org/Part:BBa_K1362101">BBa_K1362101</a> work as expected. For more information on the <a href="https://2014.igem.org/Team:Heidelberg/Parts#Favorite Parts">parts</a> please visit the corresponding main pages in the parts registry or explore their involvement in our subprojects.</li><br />
<br/><br />
<li>Religious perceptions of synthetic biology have been part of several surveys during the past ten years of iGEM and Human Practices projects. Since religious groups cover the majority of worlds population, deliver moral values and wield power at the same time, we decided to dedicate a whole event on the topic of religion, philosophy and ethics regarding synthetic biology. Please find an <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/Ethics">evaluation of our event</a> on the corresponding Human Practices pages. <!--In order to reassure ourselves about the acceptability of our project and synthetic biology in general, we also used this opportunity to build up on the work of the iGEM Team Heidelberg 2013 and conducted a survey that addresses basic questions regarding the public reflection of our work.--><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<br />
<div class="row vcenter-table"><br />
<div class="col-md-3 center col-xs-12"><br />
<img class="medal" src="https://static.igem.org/mediawiki/2014/0/0a/Heidelberg_Gold.png"><br />
</div><br />
<br />
<div class="col-md-9 col-xs-12"><br />
<h1>Gold</h1><br />
<ul><br />
<li>We improved the function of the <b>already existing</b> biobrick part <a href="http://parts.igem.org/Part:BBa_K117505">BBa_K1175005 </a>by optimizing and resubmitting the corresponding sequence of B. subtilis xylanase to the registry (Part:<a href="http://parts.igem.org/Part:BBa_K1362020"> BBa_K1362020</a>). In addition, we submitted a new part for expression of <a href="http://parts.igem.org/Part:BBa_K1362022">circularized xylanase </a>(BBa_K1362022) that might be used in future applications with need for refined enzyme stability.</li><br />
<br/><br />
<li>Despite the fact that we focused on building a set of powerful soft- and wetware tools to help future iGEM-teams developing and realizing projects in synthetic biology, we are happy to announce that we were also able to help out several team during the course of our project, aspecially with sending <a href="https://2014.igem.org/Team:Heidelberg/Parts#Backbones"> our expression vectors</a>. Read more abou in in our <a href="https://2014.igem.org/Team:Heidelberg/Team/Collaborations">Collaborations</a>.</li><br />
<br/><br />
<li>In the style of of the new iGEM community labs track that involves science amateurs “beyond the accolades of scientific publishing and economic reward”, we sought for a new way to involve laymen in actual science and build a strong community of well informed supporters and communicators of synthetic biology at the same time. Now we proudly present the crowd sourcing and communication platform <a href="https://2014.igem.org/Team:Heidelberg/Human_Practice/igemathome">iGEM@home</a>.</li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<br />
</div><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
if(window.location.hash) {<br />
var hash = window.location.hash.substring(1); //Puts hash in variable, and removes the # character<br />
if(hash == "Abstract")<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
$('#abstract-dropdown').click(function() {<br />
if($('#abstract-content').css("display") == 'none'){<br />
$('#abstract-content').slideDown(400, function() {$('#dropdownImg').attr("src", "/wiki/images/f/f2/Heidelberg-Abstract-dropup.png");});<br />
}<br />
else{<br />
$('#abstract-content').slideUp(400, function() {$('#dropdownImg').attr("src", "/wiki/images/7/70/Heidelberg_Abstract-dropdown.png");});<br />
}<br />
});<br />
<br />
$('#linker-links').mouseenter(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeIn();<br />
});<br />
<br />
$('#linker-links').mouseleave(function(){<br />
$('#redOverlay').stop(true);<br />
$('#redOverlay').fadeOut();<br />
});<br />
<br />
$('.descr-box span').css("opacity", 0);<br />
$('.descr-box h3, .descr-box > a')<br />
.mouseenter(function(){<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent()<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 1}, 800);<br />
})<br />
.mouseleave(function() {<br />
var $element;<br />
if($(this).siblings().length == 0)<br />
// we're inside the warpping div, break out first<br />
$element = $(this).parent().parent();<br />
else<br />
$element = $(this).parent();<br />
<br />
$element.find('span').stop(true).animate({opacity: 0}, 800);<br />
});<br />
<br />
$('#toolbox')<br />
.mouseover(function() {<br />
$('#toolbox-img-hover').fadeIn();<br />
})<br />
.mouseleave(function() {<br />
$('#toolbox-img-hover').fadeOut();<br />
});<br />
<br />
$('#myTab a').click(function (e) {<br />
e.preventDefault()<br />
$(this).tab('show')<br />
})<br />
<br />
});<br />
</script><br />
</html></div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/backgroundTeam:Heidelberg/pages/background2014-10-18T00:21:24Z<p>Bunnech: /* References */</p>
<hr />
<div><br/><br />
In the variety of proteins that exist, inteins are clearly among the most mysterious.<br />
They behave in such a peculiarly way that scientists are still puzzle about their initial role in the host organisms and are even more astonished when discovering their endless seeming abilities.<br />
<br />
Inteins are integrated as extraneous polypeptide sequences into ordinary proteins. They do not contribute to the original protein function but perform an autocatalytic splicing reaction after protein translation. Analog to intron splicing on RNA level, this posttranslational modification was named protein splicing. Consequentially the protein segments were called inteins, derived from “internal protein sequence”, and the flanking protein chains exteins, “external protein sequences”. Inteins excise themselves out of the host protein while reconnecting the remaining N and C exteins via a new peptide bond. Despite this immense invasion the original protein regains its normal structure and function after splicing [[#References|[1]]]. <br />
<br />
<div><br />
{{:Team:Heidelberg/templates/image-half|<br />
align=right|<br />
caption=Figure 1) Trans-splicing mechanism reaction by split inteins. |<br />
descr=The N-Intein is fused to the C’ terminal end of the N-extein. Complementary, C-Intein is located at the N’ end of the C-extein. After assembly of the two intein fragments, a splicing reaction takes place, where the intein removes itself from the precursor protein and simultaneously ligates the exteins via a peptide bond.|<br />
file=InteinSplicingReaction.png}}<br />
</div><br />
<br />
==History==<br />
<br />
Inteins were discovered in 1990 when dissimilarities between the mature protein sequence of the yeast vacuolar ATPase (Vma1) and its corresponding mRNA were investigated. Surprisingly the mature protein had a lower molecular weight than expected from the encoding sequence, indicating the loss of one part of the protein after translation. <br />
Indeed, a region of 454 amino acids was found to be translated and subsequently removed from the Vma1 protein [[#References|[2]]] [[#References|[3]]]. Since then, over 600 different inteins have been reported in all three domains of life as well as in viruses [[#References|[4]]]. <br />
<br />
Dependent on the organism they belong to, the intein’s name consists out of the genus and species abbreviation followed by the host gene [[#References|[5]]]. For example, the "golden standard" split-intein, NpuDnaE has derived from the DNA polymerase III (DnaE) in <i>Nostoc punctiforme</i> PCC73102 (<i>Npu</i>).<br />
<br />
==Evolution: Inteins as parasitic genes==<br />
Despite many years of research the initial role of inteins in their host organism remains still unclear.<br />
Many natural inteins contain a homing endonuclease (HEN) domain, an enzyme that cleaves DNA and introduces new sequences at homing sites via homologous recombination or reverse transcription. This characteristic led to the perception of the intein as selfish DNA sequence - a gene generating copies of itself without an advantage for the host organism [[#References|[6]]]. This allows horizontal gene transfer of inteins. [[#References|[7]]]. Data showing that 27% of the intein's host proteins are related to DNA metabolism and involved in DNA replication or repair is further supporting the "selfish gene" hypothesis. This ensures expression of the inteins and the HEN domain during DNA replication, where they can take advantage of the DNA replication and repair system for introducing changes in the DNA [[#References|[8]]].<br />
<br />
However recent work on conditional protein splicing has shown sensitivity of some inteins to redox state, temperature and small molecules (reviewed in [[#References|[9]]], [[#References|[10]]]). <br />
This might be a sign for inteins having a role in post-translational protein regulation upon environmental signals. Inserted close to the catalytic core of an protein the intein deactivates the protein function until the splicing reaction has taken place. Evolutionary said, selfish inteins might have adapted due to positive selection pressure to provide a beneficial mechanism for the host cell, thereby becoming selfless [[#References|[8]]].<br />
<br />
==Structure and Classification==<br />
<br />
The structure of inteins contains several conserved motifs. The splicing domains are located at the N and C terminal ends. Before splicing takes place the intein rearranges itself from its initial linear structure into to a horseshoe like structure where the termini are brought in close proximity making up the catalytic core [[#References|[14]]]. <br />
Inteins are divided into three groups: bifunctional (large) inteins, mini inteins and split inteins.<br />
<br />
Large inteins carry both a splicing domain and an endonuclease (HEN) domain whereas mini inteins lack the HEN domain [[#References|[11]]]. <br />
The most promising inteins for biotechnology are split inteins, which are basically mini-inteins, just divided in two fragments and expressed separately connected different proteins. After translation, they assemble with high affinity to become catalytic active and perform a splicing reaction. Split enzymes occure naturally [[#References|[12]]] but can also be engineered artificially [[#References|[13]]]. <br />
<br />
In our project we focused on split inteins, as they present a powerful tool to insert posttranslational modifications, offering a plethora of applications in biotechnology. We have characterized the most promising inteins in our [[Team:Heidelberg/Parts#Intein_Library|Intein Library]].<br />
<br />
==A detailed description of the trans-splicing reaction==<br />
<br />
In contrast to the mini and large inteins that mediate cis-splicing reactions, split inteins are responsible for trans-splicing and fusion of protein parts. The trans-splicing reaction can be divided into the following steps:<br />
<br />
# N-Intein and C-Intein first assemble together to form a dimer like structure with a newly formed catalytic core next to the exteins.<br />
# The tertiary structure of the intein, once correctly formed, facilitates an ''N&rarr;O/S'' acyl rearrangement at its N-terminal serine or cysteine residue. The result is an ester or thioester bond, respectively between the side-chain and the peptide backbone of the N-extein.<br />
# The two exteins are then linked by trans(thio)esterification involving the N-terminal serine or cysteine residue of the C-extein. The C-terminus of the N-extein is now covalently bound to the N-terminal side-chain of the C-extein, while its backbone still retains its normal peptide bond to the intein.<br />
# The C-terminal asparagine of the intein undergoes self-cyclisation to form a succinimidyl moiety. The peptide bond between the intein and the extein is thereby broken, resolving the branched intermediate.<br />
# In a final reaction, an ''O/S&rarr;N'' acyl shift results in the two exteins now being linked by an amide bond, indistinguishable from a ribosome-assembled fusion protein.<br />
(as reviewed in [[#References|[15]]]) <br />
<br />
{{:Team:Heidelberg/templates/image-full|<br />
align=right|<br />
caption=Figure 2) Trans-splicing mechanism reaction by split inteins. |<br />
descr=Picture taken from [[#References|[16]]]|<br />
file=Trans_splicing_OCreaction}}<br />
<br />
For intein efficiency not only the structure of the intein domain itself is important but also the nature of the flanking extein residues, as they are heavily involved in the splicing reaction. It has been shown, that the first residue has to be a nucleophilic amino acid, preferable Cysteine, Serine or Threonine. Effectiveness of the intein can be mold by changing the these amino acids [[#References|[17]]].<br />
<br />
==Use of inteins in molecular biology and biotechnology==<br />
<br />
Due to their distinct characteristics intein are a powerful tool for molecular biology and biotechnology. Performing an autocatalytic reaction, the inteins are neither dependent on their host protein nor on any other additional substrate. This makes it them broadly applicable for in vivo and in vitro applications. [[#References|[16]]].<br />
<br />
Inteins have been used for protein purification, achieving a higher yield of protein due to more specific targeting. The production of semi-synthetic proteins and the attachment of synthetic groups is of huge interest for recombinant proteins. [[#References|[16]]]. Split Intein-mediated Circular Ligation Of Peptides a ProteinS (SICLOPPS) is a method to produce circular peptides of eight amino acids length, which could be potent therapeutic drugs [[#References|[18]]]. Inteins, fused to split fluorescent proteins as reporter and to the protein of investigation have been used to detect protein-protein interactions in vivo (reviewed in [[#References|[10]]]).<br />
Nevertheless most of this applications are performed in vitro and do not exploit the full potential of inteins as regulatory element for post-translational modification. The iGEM Team Heidelberg employs this excellent mechanism of protein splicing to specifically change whole amino-acid sequences and thereby regulate proteins via (dis-) assembly, protein cleavage or circularization of enzymes in vivo. All this and much more was embedded into our versatile intein toolbox. With this universal toolkit we provide a foundational advance for protein control - introducing the full potential of post-translational modification and therefore a new dimension of genetic engineering to Synthetic Biology. There is much more to [[Team:Heidelberg/Project|explore]]!<br />
<br />
=References=<br />
<br />
[1] Perler FB, Davis EO, Dean GE, Gimble FS, Jack WE, et al. (1994) Protein splicing elements: inteins and exteins–a definition of terms and recommended nomenclature. Nucleic Acids Res 22: 1125–1127<br />
<br />
[2] Kane P.M., et al. Protein Splicing Converts the Yeast TEPI Gene Product to the 69-kD Subunit of the Vacuolar. 13253, (1990)<br />
<br />
[3] Hirata, R. et al. Molecular structure of a gene, VMA1, encoding the catalytic subunit of H(+)-translocating adenosine triphosphatase from vacuolar membranes of Saccharomyces cerevisiae. J. Biol. Chem. 265 , 6726–6733 (1990)<br />
<br />
[4] Perler, F. B. InBase : the Intein Database. 30, 383–384 (2002)<br />
<br />
[5] Perler, F. B. et al. Protein splicing elements : inteins and exteins — a definition of terms and recommended nomenclature. 22, 1125–1127 (1994)<br />
<br />
[6] Barzel, A., Naor, A., Privman, E., Kupiec, M. & Gophna, U. Homing endonucleases residing within inteins: evolutionary puzzles awaiting genetic solutions. Biochem. Soc. Trans. 39, 169–73 (2011)<br />
<br />
[7] Pietrokovski, S. Intein spread and extinction in evolution. Trends Genet. 17, 465-472 (2001)<br />
<br />
[8] Novikova, O., Topilina, N. & Belfort, M. Enigmatic distribution, evolution and function of inteins. J. Biol. Chem. (2014)<br />
<br />
[9] Shah, N. H., and Muir, T. W. Inteins: nature's gift to protein chemists. Chem. Sci. 5, 446- 461 (2014) <br />
<br />
[10] Topilina, N. I. & Mills, K. V. Recent advances in in vivo applications of intein-mediated protein splicing. Mob. DNA 5, 5 (2014)<br />
<br />
[11] Eryilmaz, E., Shah, N., Muir, T. & Cowburn, D. Structural and Dynamical Features of Inteins and Implications on Protein Splicing. J. Biol. Chem. (2014)<br />
<br />
[12] Carvajal-Vallejos, P., Pallissé, R., Mootz, H. D. & Schmidt, S. R. Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources. J. Biol. Chem. 287, 28686–96 (2012) <br />
<br />
[13] Lin, Y. et al. Protein trans-splicing of multiple atypical split inteins engineered from natural inteins. PLoS One 8, e59516 (2013). <br />
<br />
[14] Eryilmaz, E., Shah, N., Muir, T. & Cowburn, D. Structural and Dynamical Features of Inteins and Implications on Protein Splicing. J. Biol. Chem. (2014)<br />
<br />
[15] Mills, K. V, Johnson, M. a & Perler, F. B. Protein Splicing: How Inteins Escape from Precursor Proteins. J. Biol. Chem. (2014)<br />
<br />
[16] Mootz, H. D. Split inteins as versatile tools for protein semisynthesis. Chembiochem 10, 2579–89 (2009).<br />
<br />
[17] Amitai, G., Callahan, B. P., Stanger, M. J., Belfort, G. & Belfort, M. Modulation of intein activity by its neighboring extein substrates. Proc. Natl. Acad. Sci. U. S. A. 106, 11005–10 (2009).<br />
<br />
[18] Tavassoli, A. & Benkovic, S. J. Split-intein mediated circular ligation used in the synthesis of cyclic peptide libraries in E. coli. Nat. Protoc. 2, 1126–1133 (2007).</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T00:19:42Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="/wiki/images/6/68/Freiburg_Cellculture2.JPG" target="_blank"><img src="/wiki/images/6/68/Freiburg_Cellculture2.JPG" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/d/d1/Heidelberg_orig_Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/8/88/Heidelberg_orig_Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}}<br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.</div>Bunnechhttp://2014.igem.org/Team:Heidelberg/pages/CollaborationsTeam:Heidelberg/pages/Collaborations2014-10-18T00:18:20Z<p>Bunnech: </p>
<hr />
<div><br/><br />
<br />
Besides spending a whole summer in the lab and developing an own project, iGEM is about meeting new people, people with the same interests, the same motivation, the same dedication. Collaborations between team ensure the exchange of ideas, therefore helping the field of Synthetic Biology to be interdisciplinary and creative - the best conditions to give rise to revolutionary projects. We are very happy to met some of the team members from Freiburg, Aachen, Tuebingen, Marburg and London. <br />
<br />
=iGEM Team Aachen=<br />
<br />
<br />
Michael from the iGEM team Aachen visited us in Heidelberg. Their team worked on the development of a real-time pathogen detection technique for what they have build their own fluorescence measurement camera. We provided our expression vectors to the iGEM team Aachen, which they used to express their part [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1319003 E1010-K1319003], the human galectin-3 protein fused to mRFP. Nicely seen in Figure 1 and 2 the the intensity of the red color is significantly higher for the induced sample with [http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362091 pSBX1A30] compared to the uninduced ones. To ensure the right molecular mass of the fusion protein, a SDS gel was run as well (Figure 3).<br />
<br />
<div><br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=3) SDS-PAGE of K1319020 expression| file=AachenCo3.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=2) Expression of Galectin-3| file=AachenCo2.png}}<br />
{{:Team:Heidelberg/templates/image-quarter| align=right|descr=|<br />
caption=1) Expression of Galectin-3| file=AachenCo1.jpg}}<br />
</div><br />
<br />
More information about their project can be found on Aachens [https://2014.igem.org/Team:Aachen/Project/Gal3 Galectin-3 site].<br />
<br />
In exchange they offered to characterise these expression vectors with their own designed analyser by measuring the amount of produced fluorescent proteins. Unfortunately, transporting <i>E.colis</i> to another city wasn't as easy as expected, not all Bacteria were able to grow afterwards and we could only obtain sufficient data from pSBX4C5. <br />
<br />
<br/><br />
<br />
=iGEM Team Tuebingen=<br />
The project of iGEM Team Tuebingen is about blood types and the difficulties that arises during blood donation of the wrong blood type. They aim to develop an easy system to convert blood types A, B, AB to the rares but also most applicable blood type 0. They have applied the method of intein targeting, a method which can also be found in our intein toolbox, to the N-Acetyl-Galactosaminidase protein. More about their project can be read in the very nice [http://igem14-heidelberg.tumblr.com/post/98138990630/igem-team-tubingen article] they have wrote for our tumblr blog or on their own [[Team:Tuebingen|wiki]].<br />
<br />
In this collaboration, Tuebingen conducted a mass spectrometry analysis of our Lambda lysozyme to proof circularization. The data still has to be evaluated, but we will have them ready until the jamboree. There is a high demand for our expression vectors. Tuebingen had problems with expressing their constructs, therefore we send them some of our plasmids pSBX1K30 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362093 BBa_K1362093]) and pSBX4K50 ([http://parts.igem.org/wiki/index.php?title=Part:BBa_K1362097 BBa_K1362097]), as they showed to work really nicely even with big proteins like the [[Team:Heidelberg/Project/PCR2.0|Dnmt1]] with 105kDa.<br />
<br />
<br/><br />
<br />
=iGEM Team Freiburg=<br />
<br />
<br />
{{#tag:html|<br />
<style type="text/css"><br />
.carousel-indicators li {<br />
border: #000 1px solid;<br />
}<br />
</style><br />
<style type="text/css"><br />
div.margin-top { margin-top: 25px; }<br />
</style><br />
<div class="col-lg-8 col-md-8 col-sm-12 col-xs-12 col-lg-offset-2 col-md-offset-2" style="margin-top: 25px; margin-bottom: 25px;"><br />
<div style="border: #DE4230 5px solid" id="carousel-screensaver" class="carousel slide" data-ride="carousel"><br />
<!-- Indicators --><br />
<ol class="carousel-indicators"><br />
<li data-target="#carousel-screensaver" data-slide-to="0"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="1"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="2"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="3"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="4"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="5"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="6" class="active"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="7"></li><br />
<li data-target="#carousel-screensaver" data-slide-to="8"></li><br />
</ol><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<a class="img-enlarge " href="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/c/c9/Heidelberg_orig_Freiburgvonoben2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/2/20/Heidelberg_orig_Freiburg_presentation2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/c/c6/Heidelberg_orig_Freiburg_Inductionbox2.jpg" target="_blank"><img src="" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="/wiki/images/6/68/Freiburg_Cellculture2.JPG" target="_blank"><img src="/wiki/images/6/68/Freiburg_Cellculture2.JPG" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="Freiburg_Cellculture2.jpg" target="_blank"><img src="Freiburg_Cellculture2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2014/7/7c/Heidelberg_orig_Freiburg_discussion2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
<div class="item"><br />
<a class="img-enlarge" href="Freiburg_Teamfoto2.jpg" target="_blank"><img src="Freiburg_Teamfoto2.jpg" class="img-responsive" alt="Image"></a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#carousel-screensaver" role="button" data-slide="prev"><br />
<span class="glyphicon glyphicon-chevron-left"></span><br />
</a><br />
<a class="right carousel-control" href="#carousel-screensaver" role="button" data-slide="next"><br />
<span class="glyphicon glyphicon-chevron-right"></span><br />
</a><br />
</div><br />
</div><br />
</div><br />
}}<br />
<br />
Three of our team members, Anna, Caro, and Charlotte visited the iGEM team Freiburg. We met the team right after a big team meeting, therefore we were able to hear their latest project developments. We spend the evening talking about experiences in the lab and about iGEM. It was relieving to hear that they faced similar difficulties in the lab. <br />
The morning after we presented our project to the iGEM team Freiburg. Freiburg was very interested in our program iGEM@home as we offered them to promote their own human practice projects. You can also find an [http://igem14-heidelberg.tumblr.com/post/99936805780/optogenetics-the-lock-and-key-for-daily-life article] about optogenetics on our tumblr blog.<br />
Both our teams are working with light inducible systems, manly the LOV domain. Although working in different organisms, the constructs were compatible, therefore we could interchange protocols for induction and preliminary results. Furthermore we gazed at their professional light induction box - we can definitely improved ours. <br />
<br />
After cooperation with the iGEM Team Freiburg for two years in a row we are hoping to keep Freiburg as a reliable partner in the next years as well.<br />
<br />
<br/><br />
<br />
=iGEM Team Marburg=<br />
<br />
<br />
The screensaver of [[Team:Heidelberg/Human_Practice/igemathome|iGEM@home]] is a great possibility to spread news and information about Synthetic Biology around the world. Lately, even other iGEM team have used this new option and filled our screensaver with slides about their own project. Marburg was able to promote their quiz app about Synthetic Biology.</div>Bunnech