http://2014.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=250&target=Kariny888&year=&month=2014.igem.org - User contributions [en]2024-03-29T15:04:20ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/File:Bio-X_Logo.pngFile:Bio-X Logo.png2015-07-28T12:25:44Z<p>Kariny888: uploaded a new version of &quot;File:Bio-X Logo.png&quot;</p>
<hr />
<div></div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/ProjectTeam:SJTU-BioX-Shanghai/Project2015-07-08T09:20:58Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
<br />
.header_logo{ background-image:url("/wiki/images/7/7c/SJTU14_project.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;<br />
height:300px;<br />
}<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
@media screen and (max-width: 45em) {<br />
.projtile {<br />
width:100%;<br />
height:200px;<br />
}<br />
}<br />
@media screen and (max-width: 30em) {<br />
.projtile {<br />
width:100%;<br />
height:200px;<br />
}<br />
}<br />
</style><br />
<div class="jiao" ><br />
<br />
<br />
<div class="projtile_only"><br />
<center><h2>Enzymes, in the name of crown, get closer!</h2></center> </div><br />
<div class="projtile_img"><center><img weight="666.67px" height="400px" src="https://static.igem.org/mediawiki/2014/f/ff/SJTU14_Overview.png"></img></center><br />
<p>This year, our project intends to achieve protein polymerization with the help of TAL effector (Tale Transcription Activator–like Effector), a DNA-binding protein, which can recognize a specific nucleotide sequence. With circular DNA(plasmid) as the connection medium, expressed proteins in the host can form a complex selectively, so that a variety of enzyme combinations can be used to complete different tasks. Compared to traditional methods, the advantages of the project lie in selective polymerization of proteins and the ability to mediate polymerization between more proteins..</p></div><br />
<div class="projtile"><br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_Connect" title="Connect"><br />
<center><h2>Connection</h2></center><br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/96/SJTU14_connect_small.png"></img></center></a><br />
<p>Want to know more about how to build the crown?<br/><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension">Click here~</a></p><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part2_Extension" title="Maximize"><br />
<center><h2>Polymerization</h2></center><br/><br />
<center><img src="/wiki/images/5/51/SJTU14_Application_small.png"></img></center></a><br />
<p>What makes this little crown a real useful tool?<br/><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension">Click here~</a></p><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" title="Gear Box"><br />
<center><h2>TAL Improvement</h2></center><br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_TAL_small.png"></img></a></center><br />
<p>We work for the better using of TAL!<br/><a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement">Click here~</a></p><br />
</div><br />
<br />
<br />
</div><br />
<div style="clear:both;"></div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="content"><br />
<br />
<article class="post__article"><br />
<br />
<br />
</article><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/ProjectTeam:SJTU-BioX-Shanghai/Project2015-07-08T09:20:18Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
<br />
.header_logo{ background-image:url("/wiki/images/7/7c/SJTU14_project.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;<br />
height:300px;<br />
}<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
@media screen and (max-width: 45em) {<br />
.projtile {<br />
width:100%;<br />
height:200px;<br />
}<br />
}<br />
@media screen and (max-width: 30em) {<br />
.projtile {<br />
width:100%;<br />
height:200px;<br />
}<br />
}<br />
</style><br />
<div class="jiao" ><br />
<br />
<br />
<div class="projtile_only"><br />
<center><h2>Enzymes, in the name of crown, get closer!</h2></center> </div><br />
<div class="projtile_img"><center><img weight="666.67px" height="400px" src="https://static.igem.org/mediawiki/2014/f/ff/SJTU14_Overview.png"></img></center><br />
<p>This year, our project intends to achieve protein polymerization with the help of TAL effector (Tale Transcription Activator–like Effector), a DNA-binding protein, which can recognize a specific nucleotide sequence. With circular DNA(plasmid) as the connection medium, expressed proteins in the host can form a complex selectively, so that a variety of enzyme combinations can be used to complete different tasks. Compared to traditional methods, the advantages of the project lie in selective polymerization of proteins and the ability to mediate polymerization between more proteins..</p></div><br />
<div class="projtile"><br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_Connect" title="Connect"><br />
<center><h2>Connection</h2></center><br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/96/SJTU14_connect_small.png"></img></center></a><br />
<p>Want to know more about how to build the crown?<br/><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension">Click here~</a></p><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part2_Extension" title="Maximize"><br />
<center><h2>Polymerization</h2></center><br/><br />
<center><img src="/wiki/images/5/51/SJTU14_Application_small.png"></img></center></a><br />
<p>What makes this little crown a real useful tool?<br/><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension">Click here~</a></p><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" title="Gear Box"><br />
<center><h2>TAL Improvement</h2></center><br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_TAL_small.png"></img></a></center><br />
<p>We work for the better using of TAL!<br/><a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement">Click here~</a></p><br />
</div><br />
<br />
<br />
</div><br />
<div style="clear:both;"></div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="content"><br />
<br />
<article class="post__article"><br />
<br />
<br />
</article><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/ProjectTeam:SJTU-BioX-Shanghai/Project2015-07-08T09:19:24Z<p>Kariny888: </p>
<hr />
<div>v<br />
<html><br />
<style type="text/css"><br />
<br />
.header_logo{ background-image:url("/wiki/images/7/7c/SJTU14_project.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;<br />
height:300px;<br />
}<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
@media screen and (max-width: 45em) {<br />
.projtile {<br />
width:100%;<br />
height:200px;<br />
}<br />
}<br />
@media screen and (max-width: 30em) {<br />
.projtile {<br />
width:100%;<br />
height:200px;<br />
}<br />
}<br />
</style><br />
<div class="jiao" ><br />
<br />
<br />
<div class="projtile_only"><br />
<center><h2>Enzymes, in the name of crown, get closer!</h2></center> </div><br />
<div class="projtile_img"><center><img weight="666.67px" height="400px" src="https://static.igem.org/mediawiki/2014/f/ff/SJTU14_Overview.png"></img></center><br />
<p>This year, our project intends to achieve protein polymerization with the help of TAL effector (Tale Transcription Activator–like Effector), a DNA-binding protein, which can recognize a specific nucleotide sequence. With circular DNA(plasmid) as the connection medium, expressed proteins in the host can form a complex selectively, so that a variety of enzyme combinations can be used to complete different tasks. Compared to traditional methods, the advantages of the project lie in selective polymerization of proteins and the ability to mediate polymerization between more proteins..</p></div><br />
<div class="projtile"><br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_Connect" title="Connect"><br />
<center><h2>Connection</h2></center><br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/96/SJTU14_connect_small.png"></img></center></a><br />
<p>Want to know more about how to build the crown?<br/><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension">Click here~</a></p><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part2_Extension" title="Maximize"><br />
<center><h2>Polymerization</h2></center><br/><br />
<center><img src="/wiki/images/5/51/SJTU14_Application_small.png"></img></center></a><br />
<p>What makes this little crown a real useful tool?<br/><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension">Click here~</a></p><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" title="Gear Box"><br />
<center><h2>TAL Improvement</h2></center><br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_TAL_small.png"></img></a></center><br />
<p>We work for the better using of TAL!<br/><a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement">Click here~</a></p><br />
</div><br />
<br />
<br />
</div><br />
<div style="clear:both;"></div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="content"><br />
<br />
<article class="post__article"><br />
<br />
<br />
</article><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/ProjectTeam:SJTU-BioX-Shanghai/Project2015-07-08T09:18:50Z<p>Kariny888: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
.header_logo{ background-image:url("/wiki/images/7/7c/SJTU14_project.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;<br />
height:300px;<br />
}<br />
<br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
@media screen and (max-width: 45em) {<br />
.projtile {<br />
width:100%;<br />
height:200px;<br />
}<br />
}<br />
@media screen and (max-width: 30em) {<br />
.projtile {<br />
width:100%;<br />
height:200px;<br />
}<br />
}<br />
</style><br />
<div class="jiao" ><br />
<br />
<br />
<div class="projtile_only"><br />
<center><h2>Enzymes, in the name of crown, get closer!</h2></center> </div><br />
<div class="projtile_img"><center><img weight="666.67px" height="400px" src="https://static.igem.org/mediawiki/2014/f/ff/SJTU14_Overview.png"></img></center><br />
<p>This year, our project intends to achieve protein polymerization with the help of TAL effector (Tale Transcription Activator–like Effector), a DNA-binding protein, which can recognize a specific nucleotide sequence. With circular DNA(plasmid) as the connection medium, expressed proteins in the host can form a complex selectively, so that a variety of enzyme combinations can be used to complete different tasks. Compared to traditional methods, the advantages of the project lie in selective polymerization of proteins and the ability to mediate polymerization between more proteins..</p></div><br />
<div class="projtile"><br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part1_Connect" title="Connect"><br />
<center><h2>Connection</h2></center><br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/96/SJTU14_connect_small.png"></img></center></a><br />
<p>Want to know more about how to build the crown?<br/><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension">Click here~</a></p><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part2_Extension" title="Maximize"><br />
<center><h2>Polymerization</h2></center><br/><br />
<center><img src="/wiki/images/5/51/SJTU14_Application_small.png"></img></center></a><br />
<p>What makes this little crown a real useful tool?<br/><a href="/Team:SJTU-BioX-Shanghai/Part2_Extension">Click here~</a></p><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" title="Gear Box"><br />
<center><h2>TAL Improvement</h2></center><br/><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/f9/SJTU14_TAL_small.png"></img></a></center><br />
<p>We work for the better using of TAL!<br/><a href="/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement">Click here~</a></p><br />
</div><br />
<br />
<br />
</div><br />
<div style="clear:both;"></div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<div class="content"><br />
<br />
<article class="post__article"><br />
<br />
<br />
</article><br />
</div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/Front_HeaderTemplate:Team:SJTU-BioX-Shanghai/Front Header2015-07-06T06:26:26Z<p>Kariny888: Undo revision 406696 by Kariny888 (talk)</p>
<hr />
<div><html><br />
<style type="text/css"><br />
.header_logo {<br />
width: 100%;<br />
min-width: 100%;<br />
background-color: #f2ce3a;<br />
height:80%;<br />
text-align:center;<br />
position:relative;<br />
border-top-width:15px;<br />
border-color: #f2ce3a;<br />
border-top-width:1px;<br />
}<br />
.header_link {<br />
position:absolute;<br />
right:0px;<br />
top:0px;}<br />
div.header_img{margin-right:auto;<br />
margin-left:auto;}<br />
.header_link img {<br />
float:right;<br />
}<br />
.header_link .igem_img{position:absolute;top:5px;right:0px;height:50px;}<br />
@media screen and (max-width: 55.6875em) {<br />
<br />
.header_link .igem_img{height:30px;}<br />
.header_link .home_img{top:35px;height:30px;}<br />
@media screen and (max-height: 25.25em) and (max-width: 44.3125em) {<br />
<br />
<br />
.header_link .igem_img{height:20px;}<br />
.header_link .home_img{top:25px;height:20px;}<br />
}<br />
</style><br />
<div class="header_logo" id="header_logo"><br />
<div class="header_img"><br />
<img width=540px height=500px src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_front_logo.png"></img></div><br />
<div class="header_link"><br />
<a href="https://2014.igem.org/Main_Page"><img class="igem_img" border="0" src="https://static.igem.org/mediawiki/2014/a/a8/SJTU14_igemlink.png" /></a><br />
</div><br />
</div><br />
</html></div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/Front_HeaderTemplate:Team:SJTU-BioX-Shanghai/Front Header2015-07-06T06:25:38Z<p>Kariny888: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
.header_logo {<br />
width: 100%;<br />
min-width: 100%;<br />
background-color: #A60000;<br />
height:80%;<br />
text-align:center;<br />
position:relative;<br />
border-top-width:15px;<br />
border-color: #f2ce3a;<br />
border-top-width:1px;<br />
}<br />
.header_link {<br />
position:absolute;<br />
right:0px;<br />
top:0px;}<br />
div.header_img{margin-right:auto;<br />
margin-left:auto;}<br />
.header_link img {<br />
float:right;<br />
}<br />
.header_link .igem_img{position:absolute;top:5px;right:0px;height:50px;}<br />
@media screen and (max-width: 55.6875em) {<br />
<br />
.header_link .igem_img{height:30px;}<br />
.header_link .home_img{top:35px;height:30px;}<br />
@media screen and (max-height: 25.25em) and (max-width: 44.3125em) {<br />
<br />
<br />
.header_link .igem_img{height:20px;}<br />
.header_link .home_img{top:25px;height:20px;}<br />
}<br />
</style><br />
<div class="header_logo" id="header_logo"><br />
<div class="header_img"><br />
<img width=540px height=500px src="https://static.igem.org/mediawiki/2014/f/f3/SJTU14_front_logo.png"></img></div><br />
<div class="header_link"><br />
<a href="https://2014.igem.org/Main_Page"><img class="igem_img" border="0" src="https://static.igem.org/mediawiki/2014/a/a8/SJTU14_igemlink.png" /></a><br />
</div><br />
</div><br />
</html></div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/previewTemplate:Team:SJTU-BioX-Shanghai/preview2014-10-17T22:35:24Z<p>Kariny888: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
.jiao{ margin:0 auto;<br />
width:96%;<br />
font-family:OpenSans, 'Trebuchet MS', Helvetica, sans-serif;<br />
<br />
}<br />
.projtile {<br />
float:left;<br />
background:#fbf4de;<br />
overflow:hidden;<br />
margin-bottom:15px;<br />
}<br />
.projtile_only {<br />
<br />
background:#fbf4de;<br />
overflow:hidden;<br />
margin:15px auto;<br />
padding:15px 0px;<br />
width:96%; <br />
font-size:1.5em;<br />
font-weight: normal;<br />
line-height:1.2;<br />
}<br />
.projtile_only h2{<br />
font-size:2.5em;<br />
font-weight:bolder;<br />
color:#2d3e58;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
}<br />
<br />
.projtile h2 {<br />
padding-bottom:10px;<br />
padding-top:10px;<br />
font-size:25px;<br />
font-weight:bolder;<br />
color:#2d3e58;<br />
<br />
}<br />
.jiao p{<br />
font-family:'Trebuchet MS', Helvetica, sans-serif;<br />
font-weight:lighter;<br />
text-align: justify;<br />
text-indent: 3em;<br />
word-spacing: 0.2em;<br />
font-size:17px;<br />
padding:2%;<br />
<br />
}<br />
.jiao .projtile img{float:none;}<br />
.jiao .projtile p {<br />
padding:10%;<br />
text-indent:0;<br />
}<br />
.projtile_img{background-color:#FFF;<br />
margin-bottom:10px;}<br />
@media screen and (max-width: 45em) {<br />
.projtile {<br />
width:100%<br />
}}<br />
@media screen and (max-width: 30em) {<br />
.projtile {<br />
width:100%<br />
}}<br />
<br />
</style><br />
</html></div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/previewTemplate:Team:SJTU-BioX-Shanghai/preview2014-10-17T22:31:06Z<p>Kariny888: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
.jiao{ margin:0 auto;<br />
width:96%;<br />
font-family:OpenSans, 'Trebuchet MS', Helvetica, sans-serif;<br />
<br />
}<br />
.projtile {<br />
float:left;<br />
background:#fbf4de;<br />
overflow:hidden;<br />
margin-bottom:15px;<br />
}<br />
.projtile_only {<br />
<br />
background:#fbf4de;<br />
overflow:hidden;<br />
margin:15px auto;<br />
padding:15px 0px;<br />
width:96%; <br />
font-size:1.5em;<br />
font-weight: normal;<br />
line-height:1.2;<br />
}<br />
.projtile_only h2{<br />
font-size:2.5em;<br />
font-weight:bolder;<br />
color:#2d3e58;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
}<br />
<br />
.projtile h2 {<br />
padding-bottom:10px;<br />
padding-top:10px;<br />
font-size:25px;<br />
font-weight:bolder;<br />
color:#2d3e58;<br />
<br />
}<br />
.jiao p{<br />
font-family:'Trebuchet MS', Helvetica, sans-serif;<br />
font-weight:lighter;<br />
text-align: justify;<br />
text-indent: 3em;<br />
word-spacing: 0.2em;<br />
font-size:17px;<br />
padding:2%;<br />
<br />
}<br />
.jiao .projtile img{float:none;}<br />
.jiao .projtile p {<br />
padding:10%;<br />
text-indent:0;<br />
}<br />
.projtile_img{background-color:#FFF;<br />
margin-bottom:10px;<br />
box-shadow: 0 0 5px #2b3770;}<br />
@media screen and (max-width: 45em) {<br />
.projtile {<br />
width:100%<br />
}}<br />
@media screen and (max-width: 30em) {<br />
.projtile {<br />
width:100%<br />
}}<br />
<br />
</style><br />
</html></div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/previewTemplate:Team:SJTU-BioX-Shanghai/preview2014-10-17T22:29:56Z<p>Kariny888: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
.jiao{ margin:0 auto;<br />
width:96%;<br />
font-family:OpenSans, 'Trebuchet MS', Helvetica, sans-serif;<br />
<br />
}<br />
.projtile {<br />
float:left;<br />
background:#fbf4de;<br />
overflow:hidden;<br />
margin-bottom:15px;<br />
}<br />
.projtile_only {<br />
<br />
background:#fbf4de;<br />
overflow:hidden;<br />
margin:15px auto;<br />
padding:15px 0px;<br />
width:96%; <br />
font-size:1.5em;<br />
font-weight: normal;<br />
line-height:1.2;<br />
}<br />
.projtile_only h2{<br />
font-size:2.5em;<br />
font-weight:bolder;<br />
color:#2d3e58;<br />
font-family: Rancho,Impact, Charcoal, sans-serif;<br />
}<br />
<br />
.projtile h2 {<br />
padding-bottom:10px;<br />
padding-top:10px;<br />
font-size:25px;<br />
font-weight:bolder;<br />
color:#2d3e58;<br />
<br />
}<br />
.jiao p{<br />
font-family:'Trebuchet MS', Helvetica, sans-serif;<br />
font-weight:lighter;<br />
text-align: justify;<br />
text-indent: 3em;<br />
word-spacing: 0.2em;<br />
font-size:17px;<br />
padding:2%;<br />
<br />
}<br />
.jiao .projtile img{float:none;box-shadow: 0 0 5px #2b3770;}<br />
.jiao .projtile p {<br />
padding:10%;<br />
text-indent:0;<br />
}<br />
.projtile_img{background-color:#FFF;<br />
margin-bottom:10px;}<br />
@media screen and (max-width: 45em) {<br />
.projtile {<br />
width:100%<br />
}}<br />
@media screen and (max-width: 30em) {<br />
.projtile {<br />
width:100%<br />
}}<br />
<br />
</style><br />
</html></div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotesTeam:SJTU-BioX-Shanghai/daynotes2014-10-17T22:27:23Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/Header}}<br />
{{Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<br />
<html><br />
<head><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:400italic,200|Ultra' rel='stylesheet' type='text/css'><br />
<br />
<style type="text/css"><br />
<br />
#sidenav_container{<br />
float: left;<br />
width: 15%;<br />
margin-top: 100px;<br />
}<br />
.sidenav{<br />
width: 100%;<br />
border: 1px #ddd solid;<br />
text-align: center;<br />
font-size:1.5em;<br />
}<br />
.sidenav:first-of-type{<br />
border-top-left-radius: 5px;<br />
border-top-right-radius: 5px;<br />
border-bottom-right-radius: 0px;<br />
border-bottom-right-radius: 0px;<br />
}<br />
.sidenav:last-of-type{<br />
border-top-left-radius: 0px;<br />
border-top-right-radius: 0px;<br />
border-bottom-right-radius: 5px;<br />
border-bottom-right-radius: 5px;<br />
}<br />
.sidenav-fixed{<br />
position: fixed;<br />
left: 0;<br />
top: 100px;<br />
width: 100%;<br />
margin-top: 0;<br />
font-size: 2em;<br />
}<br />
.sidenav .heading{<br />
background-color: #fbf4de;<br />
color: #68afbc;<br />
border: 1px #edecec solid;<br />
font-size: 1.5em;<br />
padding: 8px 0px;<br />
}<br />
.sidenav .content{<br />
background-color: #ffffff;<br />
<br />
padding: 8px 0px;<br />
display: none;<br />
<br />
}<br />
.post__article h2{<br />
padding-top: 80px;<br />
padding-bottom: 15px;<br />
}<br />
a:visited {<br />
color:#2d3e58;<br />
}<br />
a{ color:#2d3e58;}<br />
</style><br />
</head><br />
<body><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/2/20/SJTU14_DAY-NOTES.png");}<br />
</style><br />
<div id="sidenav_container" style="font-family: Rancho,Impact, Charcoal, sans-serif; font-size: 1.1em; letter-spacing: 1.5px;"><br />
<div class="sidenav"><br />
<div class="heading"><br />
Week Notes<br />
</div><br />
<div class="content"><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#July">July</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#August">August</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#September">September</a></p><br />
</div><br />
<br />
</div><br />
<div class="sidenav"><br />
<div class="heading"><br />
Protocol<br />
</div><br />
<div class="content"><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Molecule">Molecule</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Cell">Cell</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Protein">Protein</a></p><br />
</div><br />
</div><br />
<br />
</div><br />
<div style="padding-left: 15%; background-color: #fff;"><br />
<div class="content"><br />
<article class="post__article"><br />
<h3 id="July">July Week 1: Plasmid Amplification</h3><br><br />
<p>We chose pRSFDuet-1, pACYCDuet-1 and pCDFDuet-1 as expression vectors and pBluescript II KS(+) as the connector. These plasmids were amplified for further construction.<p><br />
<img src="https://static.igem.org/mediawiki/2014/0/07/SJTU14-notebook-week1.jpg"width=50% height=50%><br />
<br />
<h3 id ="JulyWeek2" >July Week 2: Plan Making</h3><br><br />
<p>We intended to construct the gene of our fusion protein, ssDsbA-mRFP-HL-Lgt-FL-TAL-His Tag, using overlap PCR, enzyme digestion and ligation. After careful consideration, we decided to connect ssDsbA-mRFP-HL-Lgt as one part of this fusion protein and FL-TAL-His Tag for another, so that they could be connected together.<p><br />
<br />
<h3 id ="JulyWeek3" >July Week 3: Construction of Part 1</h3><br><br />
<p> We constructed the first part, ssDsbA-mRFP-HL-Lgt with overlap PCR and ligated it into the pBluescript II KS(+). Then we obtained more plasmids through transformation, colony picking and plasmid extraction. After that, we verified them with digestion identification and sequencing. Sequencing results showed accurate construction.<p><br />
<img src="https://static.igem.org/mediawiki/2014/8/82/SJTU14-July_week3.jpg"width=50% height=50%><br />
<p><img src="https://static.igem.org/mediawiki/2014/8/83/SJTU14-July_week4.jpg"width=50% height=50%><br />
<br />
<h3 id ="JulyWeek4" >July Week 4: TAL Connection</h3><br><br />
<p> In order to construct the second part, we had to obtain the TAL we needed using bioparts from 2012 Freiburg iGEM team. But unfortunately, we didn't get any positive result.<p><br />
<img src="https://static.igem.org/mediawiki/2014/3/32/SJTU14-week4-1.jpg"width=10% height=10%><br />
<img src="https://static.igem.org/mediawiki/2014/a/a3/SJTU14-week4-2.jpg"width=25% height=25%><br />
<br />
<h3 id="August">August Week 1-2: PCR Optimization</h3><br><br />
<p>Because of the negative results, we decided to adjust some PCR parameters, including the annealing temperature, template concentration and cycle number. Test the conditions for the PCR. <br />
Connected TAL, transform, colony picking plasmid extraction and digestion identification. Find with our electrophoresis band. Expression vectors and connector plasmid are confirmed by sequencing.<p><br />
<img src="https://static.igem.org/mediawiki/2014/f/fb/SJTU14-August_week1~2-1.jpg"width=25% height=25%><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/SJTU14-August_week1~2-2.jpg"width=35% height=35%><br />
<br />
<h3 id ="AugustWeek3" >August Week3:</h3><br><br />
<p>There are some problems about Freiburg’s parts. We can’t connect TAL in the right order. <br />
So we design some new primers for PCR that can produce the right sequence.<p><br />
<br />
<h3 id ="AugustWeek4" >August Week4</h3><br><br />
<p>Design a few new ports for the fusion protein. <br />
Sequencing results showed accurate construction. Observe the FP using LSCM to confirm the fusion protein can locate on the membrane.<p> <br />
<br />
<h3 id="September" >September Week1</h3><br><br />
<p>Try co-transformation: Prsf pacyc pBluescript . <br />
Find the conditions of protein expression. <br />
Find the way to construct the TAL.<br />
Start to synthesis the TAL gene <p> <br />
<br />
<h3 id ="SeptemberWeek2" >September Week2</h3><br><br />
<p>Find the enzymes for the application. <br />
Find the way to detect the substrate in these pathways. <br />
Connector plasmid modification.<p> <br />
<p>Start to design the primers used in the vector remoulding.<br />
<br />
<h3 id ="SeptemberWeek3" >September Week3</h3><br><br />
<p>The synthesized TAL gene sequence from a gene company received; continue to construct the part with our new ports.<p> <br />
<p>remould the PSK vector in order to achieve our aims.<br />
<br />
<h3 id ="SeptemberWeek4" >September Week4</h3><br><br />
<p>Express the TAL gene;Do the test for prokaryotic expression.Express the constructed gene and get the final results.<p> <br />
<br />
</article><br />
</div><br />
</div><br />
<br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/jquery-1.11.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('.sidenav > .heading').click(function(event){<br />
var target = $(event.target);<br />
var content = target.next()[0];<br />
var visible = $('.sidenav > .content:visible')[0];<br />
if(visible != content){<br />
$(visible).fadeOut(5);<br />
$(content).fadeIn(600);<br />
}<br />
});<br />
$(window).scroll(function(){<br />
//var top = document.getElementById('sidenav_container').getBoundingClientRect().top;<br />
<br />
if($('#wrap').hasClass('sticky')){<br />
console.log('123');<br />
$('#sidenav_container').addClass('sidenav-fixed');<br />
} else {<br />
console.log('12345');<br />
$('#sidenav_container').removeClass('sidenav-fixed');<br />
}<br />
});<br />
});<br />
</script><br />
</body><br />
<br />
</body><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotesTeam:SJTU-BioX-Shanghai/daynotes2014-10-17T22:26:21Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/Header}}<br />
{{Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<br />
<html><br />
<head><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:400italic,200|Ultra' rel='stylesheet' type='text/css'><br />
<br />
<style type="text/css"><br />
.content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
#sidenav_container{<br />
float: left;<br />
width: 15%;<br />
margin-top: 100px;<br />
}<br />
.sidenav{<br />
width: 100%;<br />
border: 1px #ddd solid;<br />
text-align: center;<br />
font-size:1.5em;<br />
}<br />
.sidenav:first-of-type{<br />
border-top-left-radius: 5px;<br />
border-top-right-radius: 5px;<br />
border-bottom-right-radius: 0px;<br />
border-bottom-right-radius: 0px;<br />
}<br />
.sidenav:last-of-type{<br />
border-top-left-radius: 0px;<br />
border-top-right-radius: 0px;<br />
border-bottom-right-radius: 5px;<br />
border-bottom-right-radius: 5px;<br />
}<br />
.sidenav-fixed{<br />
position: fixed;<br />
left: 0;<br />
top: 100px;<br />
width: 100%;<br />
margin-top: 0;<br />
font-size: 2em;<br />
}<br />
.sidenav .heading{<br />
background-color: #fbf4de;<br />
color: #68afbc;<br />
border: 1px #edecec solid;<br />
font-size: 1.5em;<br />
padding: 8px 0px;<br />
}<br />
.sidenav .content{<br />
background-color: #ffffff;<br />
<br />
padding: 8px 0px;<br />
display: none;<br />
<br />
}<br />
.post__article h2{<br />
padding-top: 80px;<br />
padding-bottom: 15px;<br />
}<br />
a:visited {<br />
color:#2d3e58;<br />
}<br />
a{ color:#2d3e58;}<br />
</style><br />
</head><br />
<body><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/2/20/SJTU14_DAY-NOTES.png");}<br />
</style><br />
<div id="sidenav_container" style="font-family: Rancho,Impact, Charcoal, sans-serif; font-size: 1.1em; letter-spacing: 1.5px;"><br />
<div class="sidenav"><br />
<div class="heading"><br />
Week Notes<br />
</div><br />
<div class="content"><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#July">July</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#August">August</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#September">September</a></p><br />
</div><br />
<br />
</div><br />
<div class="sidenav"><br />
<div class="heading"><br />
Protocol<br />
</div><br />
<div class="content"><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Molecule">Molecule</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Cell">Cell</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Protein">Protein</a></p><br />
</div><br />
</div><br />
<br />
</div><br />
<div style="padding-left: 15%; background-color: #fff;"><br />
<div class="content"><br />
<article class="post__article"><br />
<h3 id="July">July Week 1: Plasmid Amplification</h3><br><br />
<p>We chose pRSFDuet-1, pACYCDuet-1 and pCDFDuet-1 as expression vectors and pBluescript II KS(+) as the connector. These plasmids were amplified for further construction.<p><br />
<img src="https://static.igem.org/mediawiki/2014/0/07/SJTU14-notebook-week1.jpg"width=50% height=50%><br />
<br />
<h3 id ="JulyWeek2" >July Week 2: Plan Making</h3><br><br />
<p>We intended to construct the gene of our fusion protein, ssDsbA-mRFP-HL-Lgt-FL-TAL-His Tag, using overlap PCR, enzyme digestion and ligation. After careful consideration, we decided to connect ssDsbA-mRFP-HL-Lgt as one part of this fusion protein and FL-TAL-His Tag for another, so that they could be connected together.<p><br />
<br />
<h3 id ="JulyWeek3" >July Week 3: Construction of Part 1</h3><br><br />
<p> We constructed the first part, ssDsbA-mRFP-HL-Lgt with overlap PCR and ligated it into the pBluescript II KS(+). Then we obtained more plasmids through transformation, colony picking and plasmid extraction. After that, we verified them with digestion identification and sequencing. Sequencing results showed accurate construction.<p><br />
<img src="https://static.igem.org/mediawiki/2014/8/82/SJTU14-July_week3.jpg"width=50% height=50%><br />
<p><img src="https://static.igem.org/mediawiki/2014/8/83/SJTU14-July_week4.jpg"width=50% height=50%><br />
<br />
<h3 id ="JulyWeek4" >July Week 4: TAL Connection</h3><br><br />
<p> In order to construct the second part, we had to obtain the TAL we needed using bioparts from 2012 Freiburg iGEM team. But unfortunately, we didn't get any positive result.<p><br />
<img src="https://static.igem.org/mediawiki/2014/3/32/SJTU14-week4-1.jpg"width=10% height=10%><br />
<img src="https://static.igem.org/mediawiki/2014/a/a3/SJTU14-week4-2.jpg"width=25% height=25%><br />
<br />
<h3 id="August">August Week 1-2: PCR Optimization</h3><br><br />
<p>Because of the negative results, we decided to adjust some PCR parameters, including the annealing temperature, template concentration and cycle number. Test the conditions for the PCR. <br />
Connected TAL, transform, colony picking plasmid extraction and digestion identification. Find with our electrophoresis band. Expression vectors and connector plasmid are confirmed by sequencing.<p><br />
<img src="https://static.igem.org/mediawiki/2014/f/fb/SJTU14-August_week1~2-1.jpg"width=25% height=25%><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/SJTU14-August_week1~2-2.jpg"width=35% height=35%><br />
<br />
<h3 id ="AugustWeek3" >August Week3:</h3><br><br />
<p>There are some problems about Freiburg’s parts. We can’t connect TAL in the right order. <br />
So we design some new primers for PCR that can produce the right sequence.<p><br />
<br />
<h3 id ="AugustWeek4" >August Week4</h3><br><br />
<p>Design a few new ports for the fusion protein. <br />
Sequencing results showed accurate construction. Observe the FP using LSCM to confirm the fusion protein can locate on the membrane.<p> <br />
<br />
<h3 id="September" >September Week1</h3><br><br />
<p>Try co-transformation: Prsf pacyc pBluescript . <br />
Find the conditions of protein expression. <br />
Find the way to construct the TAL.<br />
Start to synthesis the TAL gene <p> <br />
<br />
<h3 id ="SeptemberWeek2" >September Week2</h3><br><br />
<p>Find the enzymes for the application. <br />
Find the way to detect the substrate in these pathways. <br />
Connector plasmid modification.<p> <br />
<p>Start to design the primers used in the vector remoulding.<br />
<br />
<h3 id ="SeptemberWeek3" >September Week3</h3><br><br />
<p>The synthesized TAL gene sequence from a gene company received; continue to construct the part with our new ports.<p> <br />
<p>remould the PSK vector in order to achieve our aims.<br />
<br />
<h3 id ="SeptemberWeek4" >September Week4</h3><br><br />
<p>Express the TAL gene;Do the test for prokaryotic expression.Express the constructed gene and get the final results.<p> <br />
<br />
</article><br />
</div><br />
</div><br />
<br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/jquery-1.11.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('.sidenav > .heading').click(function(event){<br />
var target = $(event.target);<br />
var content = target.next()[0];<br />
var visible = $('.sidenav > .content:visible')[0];<br />
if(visible != content){<br />
$(visible).fadeOut(5);<br />
$(content).fadeIn(600);<br />
}<br />
});<br />
$(window).scroll(function(){<br />
//var top = document.getElementById('sidenav_container').getBoundingClientRect().top;<br />
<br />
if($('#wrap').hasClass('sticky')){<br />
console.log('123');<br />
$('#sidenav_container').addClass('sidenav-fixed');<br />
} else {<br />
console.log('12345');<br />
$('#sidenav_container').removeClass('sidenav-fixed');<br />
}<br />
});<br />
});<br />
</script><br />
</body><br />
<br />
</body><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotesTeam:SJTU-BioX-Shanghai/daynotes2014-10-17T22:25:53Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/Header}}<br />
{{Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<br />
<html><br />
<head><br />
<link href='http://fonts.googleapis.com/css?family=Rancho|Open+Sans:400italic,200|Ultra' rel='stylesheet' type='text/css'><br />
<br />
<style type="text/css"><br />
#content<br />
{<br />
background-image: url('https://static.igem.org/mediawiki/2014/2/2d/SJTU14_Background.png');<br />
background-repeat: repeat;<br />
}<br />
#sidenav_container{<br />
float: left;<br />
width: 15%;<br />
margin-top: 100px;<br />
}<br />
.sidenav{<br />
width: 100%;<br />
border: 1px #ddd solid;<br />
text-align: center;<br />
font-size:1.5em;<br />
}<br />
.sidenav:first-of-type{<br />
border-top-left-radius: 5px;<br />
border-top-right-radius: 5px;<br />
border-bottom-right-radius: 0px;<br />
border-bottom-right-radius: 0px;<br />
}<br />
.sidenav:last-of-type{<br />
border-top-left-radius: 0px;<br />
border-top-right-radius: 0px;<br />
border-bottom-right-radius: 5px;<br />
border-bottom-right-radius: 5px;<br />
}<br />
.sidenav-fixed{<br />
position: fixed;<br />
left: 0;<br />
top: 100px;<br />
width: 100%;<br />
margin-top: 0;<br />
font-size: 2em;<br />
}<br />
.sidenav .heading{<br />
background-color: #fbf4de;<br />
color: #68afbc;<br />
border: 1px #edecec solid;<br />
font-size: 1.5em;<br />
padding: 8px 0px;<br />
}<br />
.sidenav .content{<br />
background-color: #ffffff;<br />
<br />
padding: 8px 0px;<br />
display: none;<br />
<br />
}<br />
.post__article h2{<br />
padding-top: 80px;<br />
padding-bottom: 15px;<br />
}<br />
a:visited {<br />
color:#2d3e58;<br />
}<br />
a{ color:#2d3e58;}<br />
</style><br />
</head><br />
<body><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/2/20/SJTU14_DAY-NOTES.png");}<br />
</style><br />
<div id="sidenav_container" style="font-family: Rancho,Impact, Charcoal, sans-serif; font-size: 1.1em; letter-spacing: 1.5px;"><br />
<div class="sidenav"><br />
<div class="heading"><br />
Week Notes<br />
</div><br />
<div class="content"><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#July">July</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#August">August</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/daynotes#September">September</a></p><br />
</div><br />
<br />
</div><br />
<div class="sidenav"><br />
<div class="heading"><br />
Protocol<br />
</div><br />
<div class="content"><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Molecule">Molecule</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Cell">Cell</a></p><br />
<p><a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Protocol#Protein">Protein</a></p><br />
</div><br />
</div><br />
<br />
</div><br />
<div style="padding-left: 15%; background-color: #fff;"><br />
<div class="content"><br />
<article class="post__article"><br />
<h3 id="July">July Week 1: Plasmid Amplification</h3><br><br />
<p>We chose pRSFDuet-1, pACYCDuet-1 and pCDFDuet-1 as expression vectors and pBluescript II KS(+) as the connector. These plasmids were amplified for further construction.<p><br />
<img src="https://static.igem.org/mediawiki/2014/0/07/SJTU14-notebook-week1.jpg"width=50% height=50%><br />
<br />
<h3 id ="JulyWeek2" >July Week 2: Plan Making</h3><br><br />
<p>We intended to construct the gene of our fusion protein, ssDsbA-mRFP-HL-Lgt-FL-TAL-His Tag, using overlap PCR, enzyme digestion and ligation. After careful consideration, we decided to connect ssDsbA-mRFP-HL-Lgt as one part of this fusion protein and FL-TAL-His Tag for another, so that they could be connected together.<p><br />
<br />
<h3 id ="JulyWeek3" >July Week 3: Construction of Part 1</h3><br><br />
<p> We constructed the first part, ssDsbA-mRFP-HL-Lgt with overlap PCR and ligated it into the pBluescript II KS(+). Then we obtained more plasmids through transformation, colony picking and plasmid extraction. After that, we verified them with digestion identification and sequencing. Sequencing results showed accurate construction.<p><br />
<img src="https://static.igem.org/mediawiki/2014/8/82/SJTU14-July_week3.jpg"width=50% height=50%><br />
<p><img src="https://static.igem.org/mediawiki/2014/8/83/SJTU14-July_week4.jpg"width=50% height=50%><br />
<br />
<h3 id ="JulyWeek4" >July Week 4: TAL Connection</h3><br><br />
<p> In order to construct the second part, we had to obtain the TAL we needed using bioparts from 2012 Freiburg iGEM team. But unfortunately, we didn't get any positive result.<p><br />
<img src="https://static.igem.org/mediawiki/2014/3/32/SJTU14-week4-1.jpg"width=10% height=10%><br />
<img src="https://static.igem.org/mediawiki/2014/a/a3/SJTU14-week4-2.jpg"width=25% height=25%><br />
<br />
<h3 id="August">August Week 1-2: PCR Optimization</h3><br><br />
<p>Because of the negative results, we decided to adjust some PCR parameters, including the annealing temperature, template concentration and cycle number. Test the conditions for the PCR. <br />
Connected TAL, transform, colony picking plasmid extraction and digestion identification. Find with our electrophoresis band. Expression vectors and connector plasmid are confirmed by sequencing.<p><br />
<img src="https://static.igem.org/mediawiki/2014/f/fb/SJTU14-August_week1~2-1.jpg"width=25% height=25%><br />
<img src="https://static.igem.org/mediawiki/2014/1/11/SJTU14-August_week1~2-2.jpg"width=35% height=35%><br />
<br />
<h3 id ="AugustWeek3" >August Week3:</h3><br><br />
<p>There are some problems about Freiburg’s parts. We can’t connect TAL in the right order. <br />
So we design some new primers for PCR that can produce the right sequence.<p><br />
<br />
<h3 id ="AugustWeek4" >August Week4</h3><br><br />
<p>Design a few new ports for the fusion protein. <br />
Sequencing results showed accurate construction. Observe the FP using LSCM to confirm the fusion protein can locate on the membrane.<p> <br />
<br />
<h3 id="September" >September Week1</h3><br><br />
<p>Try co-transformation: Prsf pacyc pBluescript . <br />
Find the conditions of protein expression. <br />
Find the way to construct the TAL.<br />
Start to synthesis the TAL gene <p> <br />
<br />
<h3 id ="SeptemberWeek2" >September Week2</h3><br><br />
<p>Find the enzymes for the application. <br />
Find the way to detect the substrate in these pathways. <br />
Connector plasmid modification.<p> <br />
<p>Start to design the primers used in the vector remoulding.<br />
<br />
<h3 id ="SeptemberWeek3" >September Week3</h3><br><br />
<p>The synthesized TAL gene sequence from a gene company received; continue to construct the part with our new ports.<p> <br />
<p>remould the PSK vector in order to achieve our aims.<br />
<br />
<h3 id ="SeptemberWeek4" >September Week4</h3><br><br />
<p>Express the TAL gene;Do the test for prokaryotic expression.Express the constructed gene and get the final results.<p> <br />
<br />
</article><br />
</div><br />
</div><br />
<br />
<script type="text/javascript" src="https://2014.igem.org/Team:SJTU-BioX-Shanghai/jquery-1.11.1.min.js?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$('.sidenav > .heading').click(function(event){<br />
var target = $(event.target);<br />
var content = target.next()[0];<br />
var visible = $('.sidenav > .content:visible')[0];<br />
if(visible != content){<br />
$(visible).fadeOut(5);<br />
$(content).fadeIn(600);<br />
}<br />
});<br />
$(window).scroll(function(){<br />
//var top = document.getElementById('sidenav_container').getBoundingClientRect().top;<br />
<br />
if($('#wrap').hasClass('sticky')){<br />
console.log('123');<br />
$('#sidenav_container').addClass('sidenav-fixed');<br />
} else {<br />
console.log('12345');<br />
$('#sidenav_container').removeClass('sidenav-fixed');<br />
}<br />
});<br />
});<br />
</script><br />
</body><br />
<br />
</body><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T22:02:45Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<h2>Thanks for all the effort</h2><br />
<p>We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<img style="float:right;width:200px;" src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology.<img style="width:300px;" src="/wiki/images/c/cf/SJTU14_life-ing.jpg"></img> During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article></div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T22:01:49Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<img style="float:right;width:200px;" src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology.<img style="width:300px;" src="/wiki/images/c/cf/SJTU14_life-ing.jpg"></img> During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article></div><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T22:01:27Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<div class="content"><br />
<article class="post__article"><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<img style="float:right;width:200px;" src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology.<img style="width:300px;" src="/wiki/images/c/cf/SJTU14_life-ing.jpg"></img> During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article></div><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T22:00:20Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<img style="float:right;width:200px;" src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology.<img style="width:300px;" src="/wiki/images/c/cf/SJTU14_life-ing.jpg"></img> During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:59:57Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<img style="float:right;width:200px;" src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology.<img style="width:300px;" src="/wiki/images/c/cf/SJTU14_life-ing.jpg"></img> During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:57:27Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<img style="float:right;width:200px;" src="/wiki/images/c/cf/SJTU14_life-ing.jpg"></img><p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology.<img style="width:300px;" src="/wiki/images/c/cf/SJTU14_life-ing.jpg"></img> During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:57:01Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<img style="float:right;width:200px;" src="/wiki/images/c/cf/SJTU14_life-ing.jpg"></img><p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology.<img src=style="width:300px;" "/wiki/images/c/cf/SJTU14_life-ing.jpg"></img> During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:56:28Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<img style="float:right;width:200px;" src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology.<img src=style="width:300px;" "/wiki/images/c/cf/SJTU14_life-ing.jpg"></img> During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/File:SJTU14_life-ing.jpgFile:SJTU14 life-ing.jpg2014-10-17T21:55:44Z<p>Kariny888: </p>
<hr />
<div></div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:54:39Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university.<img style="float:right;width:200px;" src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img> Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><img src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:54:23Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university.<img style="float:right;weight:200px;" src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img> Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><img src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:54:03Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university.<img style="float:right;weight:300px;" src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img> Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><img src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:52:41Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university.<img src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img> Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><img src="/wiki/images/1/18/SJTU14_sjtu-ing.jpg"></img><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/File:SJTU14_sjtu-ing.jpgFile:SJTU14 sjtu-ing.jpg2014-10-17T21:51:44Z<p>Kariny888: </p>
<hr />
<div></div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:51:02Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. <img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img>Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:50:33Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:10px;}<br />
</style><br />
<article><br />
<img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img><p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:50:20Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:5px;}<br />
</style><br />
<article><br />
<img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img><p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:50:08Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;<br />
margin:2px;}<br />
</style><br />
<article><br />
<img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img><p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:49:45Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
article img{ float:left;}<br />
</style><br />
<article><br />
<img src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img><p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:48:28Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
</style><br />
<article><br />
<img float=left src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img><p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/AttributionsTeam:SJTU-BioX-Shanghai/Attributions2014-10-17T21:48:09Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
<html><br />
<style type="text/css"><br />
.header_logo{ background-image:url("/wiki/images/3/37/SJTU14_ATTRIBUTIONS.png");}<br />
</style><br />
<article><br />
<img float="left" src="/wiki/images/5/51/SJTU14_bio-x-ing.png"></img><p><br />
We sincerely thank for all the help given by the research institute of Bio-X. During the whole preparation procedure of the igem competition, Bio-X offered us a great support in all aspects. Thanks to their providing of experimental funds and drugs. Thanks to our supervisor Gang Ma, the professor of Bio-X who supported us with a good experimental condition. Thanks to our instructor Yushu Wang, who spent a lot of time and energy on us, we fought together dealing with all of the hard problems. Without their help and encouragement, we can not held up to the end. And we also give thanks to all other teachers and fellow students who supported us in either experiment or brainstorming in Bio-X. Our whole project is mostly based on their understanding and help!<br />
</p><br />
<p>We sincerely thank for all the help given by Sbanghai Jiao Tong University. Thanks for the substantial support given by our university. Our university gives us logistics support for our whole project.</p><br />
<p>We sincerely thank for all the help given by School of Life Sciences and Biotechnology. During the whole experimentation, School of Life Science and Biotechnology provided us with experimental funds, laboratory and experimental apparatus. We also thank for all the professors who helped us dealing with difficulties in SLSB.</p><br />
<br></br><br />
<p><strong>Binhan Hao</strong> Primarily in charge of wet lab. Designed Enzyme USB when we need insert target enzyme into our part. Moreover, the most valuable work is that he found out the sticky ends problem with 2012 Freiburg’ project and wrote down a article about the problem.</p><br />
<p><strong>Renhe Luo</strong> Responsible for almost everything in wet lab.</p><br />
<p><strong>Ziyang Tan</strong> Remould the vectors of pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy. Assist in constructing the main part.</p><br />
<p><strong>Yangyang Li</strong> Mainly in charge of enzyme polymerization verification and help with TAL construction as well.</p><br />
<p><strong>Xiangdong Bu</strong> Take part in project designing, do some experiments in wet lab and do a few jobs in dry lab.</p><br />
<p><strong>Qiao Zhou</strong> Responsible for TAL ligation ,protein expression and inverse PCR</p><br />
<p><strong>Ming Chen</strong> Took part in the wet lab part of our project and sometimes helped with the dry lab.</p><br />
<p><strong>Yaojin Sun</strong> Responsible for modeling parts.</p><br />
<p><strong>Mingzhao Chen</strong> Responsible for modeling parts.</p><br />
<p><strong>Yitian Yao</strong> Responsible for modeling parts.</p><br />
<p><strong>Kang Ren</strong> Construct the structure of testing and functional reformed plasmids, insert TAL effectors and test the Crown system.</p><br />
<p><strong>Xuemin Pan</strong> Joined in other team members to do the plasmid construction and was responsible for the purification of target protein.</p><br />
<p><strong>Yue Shen</strong> Took part in the design of our project.</p><br />
<p><strong>Karin Yaragi,Xingyu Wang,Jiannan Ye,PeiYu Liu,Yaan Ge,Yan Jiang, Jianye Shi</strong> Responsible for Human Practice and webpage making.</p><br />
<br />
<br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
<br/><br />
</article><br />
<style type="text/css"><br />
article<br />
{<br />
margin: 3% 15%;<br />
}<br />
article p<br />
{<br />
font-family: 'Open Sans', sans-serif;<br />
text-align: justify;<br />
text-indent: 2.5em;<br />
line-height: 1.7em;<br />
font-weight: 400;<br />
font-size: 120%;<br />
}<br />
</style><br />
</html><br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/File:SJTU14_bio-x-ing.pngFile:SJTU14 bio-x-ing.png2014-10-17T21:47:16Z<p>Kariny888: </p>
<hr />
<div></div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:44:04Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
#groupparts table{visibility:visible;}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div></html><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<html><div class="content"><article class="post__article"><br />
<br />
<h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><a name="#dianweidian2"></a><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fb/4plasmid.png" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<br><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453901" target="_blank">(BBa_K1453901)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453001" target="_blank">(BBa_K1453001)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<p><br />
This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7e/3409.png" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<p><br />
This part is based on the BBa_1453006 and BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
</p><br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:43:15Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
#groupparts table{visibility:visible;}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div></html><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<html><div class="content"><article class="post__article"><br />
<br />
<h2>Basic Parts</h2><br />
<a name="#dianweidian2"></a><h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fb/4plasmid.png" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<p><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453901" target="_blank">(BBa_K1453901)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453001" target="_blank">(BBa_K1453001)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<p><br />
This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7e/3409.png" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<p><br />
This part is based on the BBa_1453006 and BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
</p><br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:42:48Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
#groupparts table{visibility:visible;}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div></html><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<html><div class="content"><article class="post__article"><br />
<br />
<a name="#dianweidian2"></a><h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fb/4plasmid.png" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<p><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453901" target="_blank">(BBa_K1453901)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453001" target="_blank">(BBa_K1453001)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<p><br />
This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7e/3409.png" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<p><br />
This part is based on the BBa_1453006 and BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
</p><br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/footerTemplate:Team:SJTU-BioX-Shanghai/footer2014-10-17T21:31:13Z<p>Kariny888: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/clear}}<br />
<html><br />
<style type="text/css"><br />
.footer {<br />
width: 100%;<br />
height: 200px;<br />
background-color: #2d3e58;<br />
font-family: "OpenSans",'Trebuchet MS', Helvetica, sans-serif;<br />
font-weight: 100;<br />
font-size:1.4em;<br />
}<br />
<br />
.footer .footer-content {<br />
margin-top: 2%;<br />
float: left;<br />
margin-left: 5%;<br />
color: #f2ce3a;<br />
}<br />
<br />
.footer-link{<br />
width: 100%;<br />
background-color: #1b2232;<br />
}<br />
.footer-logo{<br />
float:right;}<br />
.logo_img{padding:15px;<br />
height:70px;}<br />
#footer-box {<br />
font-family: "OpenSans","Bauhaus 93","Arial Black", Gadget, sans-serif;<br />
font-weight: 100;<br />
/*width: 90%;*/<br />
margin: 0 auto;<br />
}<br />
@media screen and (max-width: 72em) {<br />
.footer {<br />
height:400px;<br />
}}<br />
@media screen and (max-width: 46em) {<br />
.footer {<br />
height:600px;<br />
}<br />
}<br />
</style><br />
<div class="footer"><br />
<div class="footer-content"><br />
<p>Bio-X Institutes</p><br />
<p>Shanghai Jiao Tong University</p><br />
<p>800, Dongchuan Road 200240, Shanghai, China</p><br />
<p>sunyaojin2011@foxmail.com</p><br />
</div><br />
<div class="footer-logo"><br />
<a href="http://www.sjtu.edu.cn/"><img class="logo_img" border="0" src="/wiki/images/2/29/SJTU_Logo.png" /></a><br />
<a href="http://www.bio-x.cn/"><img class="logo_img" border="0" src="/wiki/images/1/13/Bio-X_Logo.png" /></a><br />
<a href="http://life.sjtu.edu.cn/"><img class="logo_img" border="0" src="/wiki/images/c/cd/Life-logo.png" /></a><br/><br />
<a href="http://www.merck.de/de/index.html"><img class="logo_img" border="0" src="/wiki/images/b/b7/Merck_Logo.png" /></a><br />
<a href="http://www.genewiz.com/"><img class="logo_img" border="0" src="/wiki/images/f/fb/Genewiz_Logo.png" /></a><br />
<a href="http://www.sjtu.edu.cn/"><img class="logo_img" border="0" src="/wiki/images/4/4f/SJTU14_iGEM_foundation_logo.png" /></a></div><br />
</div><br />
<br />
</html></div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/footerTemplate:Team:SJTU-BioX-Shanghai/footer2014-10-17T21:29:35Z<p>Kariny888: </p>
<hr />
<div>{{Template:Team:SJTU-BioX-Shanghai/clear}}<br />
<html><br />
<style type="text/css"><br />
.footer {<br />
width: 100%;<br />
height: 200px;<br />
background-color: #2d3e58;<br />
font-family: "OpenSans",'Trebuchet MS', Helvetica, sans-serif;<br />
font-weight: 100;<br />
font-size:1.4em;<br />
}<br />
<br />
.footer .footer-content {<br />
margin-top: 2%;<br />
float: left;<br />
margin-left: 5%;<br />
color: #f2ce3a;<br />
}<br />
<br />
.footer-link{<br />
width: 100%;<br />
background-color: #1b2232;<br />
}<br />
.footer-logo{<br />
float:right;}<br />
.logo_img{padding:15px;<br />
height:70px;}<br />
#footer-box {<br />
font-family: "OpenSans","Bauhaus 93","Arial Black", Gadget, sans-serif;<br />
font-weight: 100;<br />
/*width: 90%;*/<br />
margin: 0 auto;<br />
}<br />
@media screen and (max-width: 72em) {<br />
.footer {<br />
height:400px;<br />
}}<br />
@media screen and (max-width: 46em) {<br />
.footer {<br />
height:600px;<br />
}<br />
}<br />
</style><br />
<div class="footer"><br />
<div class="footer-content"><br />
<p>Bio-X Institutes</p><br />
<p>Shanghai Jiao Tong University</p><br />
<p>800, Dongchuan Road 200240, Shanghai, China</p><br />
<p>1774058348@qq.com</p><br />
<p>13601976967</p><br />
</div><br />
<div class="footer-logo"><br />
<a href="http://www.sjtu.edu.cn/"><img class="logo_img" border="0" src="/wiki/images/2/29/SJTU_Logo.png" /></a><br />
<a href="http://www.bio-x.cn/"><img class="logo_img" border="0" src="/wiki/images/1/13/Bio-X_Logo.png" /></a><br />
<a href="http://life.sjtu.edu.cn/"><img class="logo_img" border="0" src="/wiki/images/c/cd/Life-logo.png" /></a><br/><br />
<a href="http://www.merck.de/de/index.html"><img class="logo_img" border="0" src="/wiki/images/b/b7/Merck_Logo.png" /></a><br />
<a href="http://www.genewiz.com/"><img class="logo_img" border="0" src="/wiki/images/f/fb/Genewiz_Logo.png" /></a><br />
<a href="http://www.sjtu.edu.cn/"><img class="logo_img" border="0" src="/wiki/images/4/4f/SJTU14_iGEM_foundation_logo.png" /></a></div><br />
</div><br />
<br />
</html></div>Kariny888http://2014.igem.org/File:SJTU14_iGEM_foundation_logo.pngFile:SJTU14 iGEM foundation logo.png2014-10-17T21:28:34Z<p>Kariny888: </p>
<hr />
<div></div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:21:20Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
#groupparts table{visibility:visible;}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div></html><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<html><div class="content"><article class="post__article"><br />
<br />
<h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/SJTU14_Diagram_of_four_types_of_connector.jpg" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<p><br />
<br><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<br><br />
<p><br />
This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:20:27Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
#groupparts table{visibility:visible;}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<div class="content"><article class="post__article"><br />
<br />
<h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/SJTU14_Diagram_of_four_types_of_connector.jpg" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<p><br />
<br><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<br><br />
<p><br />
This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:19:26Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
#groupparts table{visibility:visible;}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div></div></html><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
#groupparts table{visibility:visible;}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><div class="content"><article class="post__article"><br />
<br />
<h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/SJTU14_Diagram_of_four_types_of_connector.jpg" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<p><br />
<br><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<br><br />
<p><br />
This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:17:54Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
#groupparts table{visibility:visible;}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div></div></html><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<html><div class="content"><article class="post__article"><br />
<br />
<h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/SJTU14_Diagram_of_four_types_of_connector.jpg" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<p><br />
<br><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is used in our application test free in the cytoplasm.<br />
</p><br />
<br><br />
<p><br />
This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:16:43Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
#groupparts table{visibility:visible;}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<article class="post__article"><br />
<br />
<h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/SJTU14_Diagram_of_four_types_of_connector.jpg" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<p><br />
<br><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is used in our application test free in the cytoplasm.<br />
<br><br />
This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:15:14Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;}<br />
table{visibility:visible;}<br />
#groupparts {}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<article class="post__article"><br />
<br />
<h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/SJTU14_Diagram_of_four_types_of_connector.jpg" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<p><br />
<br><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Team:SJTU-BioX-Shanghai/PartsTeam:SJTU-BioX-Shanghai/Parts2014-10-17T21:14:40Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
<html><br />
<style type="text/css"><br />
#groupparts {<br />
width: 100%;<br />
text-align: center; margin-left: auto; margin-right: auto;<br />
background:#FFF;<br />
visibility:visible;<br />
<br />
}<br />
#groupparts {}<br />
.header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}<br />
.projtile {<br />
margin-right:1.167%;<br />
margin-left:1.167%;<br />
width:31%;}<br />
<br />
#passage{<br />
width:100%;}<br />
#passage p{<br />
padding:4%;}<br />
<br />
<br />
<br />
#subtitleyjn2{<br />
margin-left:40%;}<br />
<br />
</style><br />
<br />
<br />
<div class="content"><br />
<br />
<div class="jiao" ><br />
<br />
<div class="projtile_only"><br />
<center><h2>Parts</h2></br></center><br />
<center><br />
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br><br />
<br />
&nbsp;&nbsp;&nbsp;Those BioBricks could be divided into four groups.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.</br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;3.BioBricks in application is our complete part. </br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.</br><br />
<br />
</p><br />
</center><br />
<br />
</div><br />
<br />
<div class="projtile" id="dingweidian2"><br />
<a href="#dingweidian2" title="Basic Parts"><br />
<center><h2>Basic Parts</h2></center></a><br />
</div><br />
<br />
<div class="projtile"><br />
<a href="#dianweidian9" title="USB"><br />
<center> <h2>USB</h2></center></a><br />
</div><br />
<br />
<br />
<div class="projtile"><br />
<a href="#dianweidian10" title="New TAL"><br />
<center><h2>New TAL</h2></center></a><br />
</div><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<div style="clear:both;"></div><br />
<article class="post__article"><br />
<br />
<h2>Basic Parts</h2><br />
<h3>Review previous parts</h3><br />
<p><br />
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.<br><br />
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)<br />
</p><br />
<p><br />
mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.<br><br />
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (<a href="http://parts.igem.org/Part:BBa_E1010" target="_blank">BBa_E1010</a>, Antiquity )<br />
<h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br><br />
<p><br />
This is a TALE protein with a flexible linker 3 before it. <br><br />
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br><br />
<br />
</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>Connector</h3><br />
<p><br />
We have four types of connector.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/SJTU14_Diagram_of_four_types_of_connector.jpg" width= 800px></img></center><br />
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center><br />
</br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br><br />
<p><br />
<br><br />
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br><br />
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br><br />
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br><br />
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br><br />
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br><br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br><br />
<p><br />
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br><br />
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br><br />
<br><br />
<h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center><br />
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.<br />
<br><br />
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.<br />
<br><br />
</p><br />
<br />
<br />
<br />
<br />
<br><br />
<h2>USB</h2><br />
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p><br />
<h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3><br />
<center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center><br />
<br />
</br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br><br />
<p><br />
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.<br />
</p><br />
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3><br />
<br />
<br><br />
<p><br />
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center><br />
<center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br><br />
<p><br />
<br />
The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site. </p><p><br />
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p><br />
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p><br />
<br />
<br><br />
<br />
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. <br />
<p><br />
When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453401 and BBa_K1453006.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br><br />
<p><br />
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h2>Application</h2><br />
<p><br />
We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong><br />
<br><br />
We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end.<br />
<br><br />
</p><br />
<br />
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center><br />
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br><br />
<p><br />
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3><br />
<br />
<center><img src="" width=400px></img></center><br />
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br><br />
<p><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3><br />
<br />
<center><img src="" width=400px></img></br><p id="dianweidian10"></p></center><br />
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br><br />
<p ><br />
<br />
<br><br />
</p><br />
<br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<h2>New TAL</h2><br />
<p><br />
We design seven new sticky ends which get the least score when judging the similarity.<br><br />
If you want to know how we design these ends, please go to see our <br />
<a href="https://2014.igem.org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" >project-Part3 TAL improve</a>.<br><br />
</p><br />
<p><br />
<br><br />
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a><br />
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br><br />
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br><br />
</p><br />
<p ><br />
<b>PART-left:</b><br><br />
…CTGACCCCGGAGACG<br />
</p><br />
<p><br />
<b>PART1(150bp):</b><br><br />
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG<br />
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT<br />
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p><br />
<p><br />
<b>PART2(219bp):</b><br><br />
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG<br />
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA<br />
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG<br />
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p><br />
<p><br />
<b>PART3(262bp):</b><br><br />
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG<br />
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT<br />
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC<br />
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA<br />
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center><br />
<p><br />
<br />
<b>PART4(224bp):</b><br><br />
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT<br />
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG<br />
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA<br />
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br><br />
GACG<br />
</p><br />
<p><br />
<b>PART5(194bp):</b><br><br />
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC<br />
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC<br />
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br><br />
TCGGCGGCAAACAGGCACTCGATGAGACG<br />
</p><br />
<p><br />
<b>PART6(249bp):</b><br><br />
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC<br />
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT<br />
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG<br />
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br><br />
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p><br />
<p><br />
<br />
<b>PART-right:</b><br><br />
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br><br />
<br />
<br />
<p><br />
The recognition sequence of the TALE protein:<br />
<center><font size="5" color="red">TCGATATCAAGC</font></center></p><br />
<div class="default" id="default"><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><br />
</div><br />
</article><br />
</div><br />
<br />
</html><br />
<br />
{{Team:SJTU-BioX-Shanghai/footer}}</div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/partsTemplate:Team:SJTU-BioX-Shanghai/parts2014-10-17T21:13:49Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><style="text/css"><br />
table{visibility:visible;}<br />
</style></html><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts></div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/partsTemplate:Team:SJTU-BioX-Shanghai/parts2014-10-17T21:13:21Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><style="text/css"><br />
div#groupparts table{visibility:visible;height:0;}<br />
</style></html><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts></div>Kariny888http://2014.igem.org/Template:Team:SJTU-BioX-Shanghai/partsTemplate:Team:SJTU-BioX-Shanghai/parts2014-10-17T21:13:00Z<p>Kariny888: </p>
<hr />
<div>{{Team:SJTU-BioX-Shanghai/clear}}<br />
{{Template:Team:SJTU-BioX-Shanghai/Header}}<br />
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}<br />
{{Template:Team:SJTU-BioX-Shanghai/article}}<br />
{{Template:Team:SJTU-BioX-Shanghai/preview}}<br />
<html><style="text/css">div#groupparts table{visibility:visible;height:0;}<style><br />
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts></html></div>Kariny888