http://2014.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=StefanReinhold&year=&month=2014.igem.org - User contributions [en]2024-03-29T11:51:51ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/Team:Aachen/Notebook/Wetlab/OctoberTeam:Aachen/Notebook/Wetlab/October2014-10-17T22:09:15Z<p>StefanReinhold: /* 3rd */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= October =<br />
== 1st ==<br />
* Prepartations for sensor-chip production the following day (2014-10-02) was done accoringly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 18:30 we prepared over-night cultures from K1319042, B0015 and K131026 by inoculating 250&nbsp;ml Erlenmeyer flasks each containing 50&nbsp;ml LB medium . The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
== 2nd ==<br />
<br />
* At 8:30, we did a plasmid prep of dublicate samples of K1319011 clone #1 and #6. We measured the DNA yield, and the higher concentrated sample of clone #1 and #6, respectively, were sent in for sequencing.<br />
* made precultures and a master plate of 6 colonies of K3139008 in psB1C3 in NEB10β cells that had been plated at 5:30 this morning.<br />
<br />
* Production of sensor-chips was done accordingly to [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Briefly:<br />
** At 10:00 we prepared 150&nbsp;ml 1.5%&nbsp;(w/v) LB+agarose solution. The LB+agarose solution was autoclaved and subsequently tempered to 45°C. Precultures (50&nbsp;ml each) of K1319042, B0015 and K131026 were spun down at 3000&nbsp;g for 10&nbsp;min at 21°C and re-suspended in 1&nbsp;ml pretempered (21°C) LB medium. The re-suspended cultures were mixed with 50&nbsp;ml LB+agarose and poured onto three sensor-chip-templates (one template per culture). Sensor chips were cut out from the template and incubated at 37°C for 1&nbsp;h.<br />
** K1319042 and B0015 were induced with 0.2&nbsp;µl IPTG (100&nbsp;mM) subsequently to incubation and K131026 was induced with 0.2&nbsp;µl homoserinlacton stock solution (500&nbsp;µg/ml) 30 minutes after induction of the K1319042 and B0015. The induced sensor-chips were read out every 30 minutes for 180 minutes in total. An additional readout was conducted 285 minutes post induction. The readout was done at 450&nbsp;nm and 480&nbsp;nm wavelength. <br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_10_2014_B0015_serie.png|title=Sensor Chips with B0015 in NEB in LB (480&nbsp;nm): first try with final device|subtitle=Sensor chips with B0015 in NEB in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 100&nbsp;mM IPTG B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
* Gibson assembly of K1319008<br />
** template Backbone: I746909, Insert: K1319004<br />
** transformation in ''E.coli'' NEB10β and BL21<br />
<br />
* PCRs for Gibson assembly of K1319010 and K1319015<br />
** template Backbone: I20260 for K1319010 and K1319015<br />
** template Insert: K1319000 for K1319010 and K1319015 (but different primer)<br />
<br />
* made precultures of K1319013 and K1319014 in pSB3K3<br />
<br />
* K1319011 in pSB1C3 prepped for sequencing<br />
<br />
* Gibson assembly of K1319017 (PCRs, Gibson assembly, restriction with DnpI, transformation into NEB10β)<br />
** template Backbone: B0015<br />
** template Insert 1: LasI synthesized gene<br />
** template Insert 2: K660004<br />
<br />
==3rd==<br />
<br />
* made master plates of K1319008 in NEB10β and BL21 and precultures<br />
<br />
* check PCR for K1319008 to validate the Gibson assembly check for potential I746909 residues<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_K1319008_insert_colonyPCR.png|title=Check PCR K1319008|subtitle=K1319008 was checked with the Primers K1319008_Check_R and I746909_Check_R (both with G00100 Alternative as froward primer) for presence of K1319008 or I746909. All tested clones were positive for K1319008 and negative for I746909.|width=800px}}<br />
</center><br />
<br />
* did a plasmid prep and made cryo stocks of K1319008 in NEB (clones #1, #2, #3) and BL21 (clones #1, #2)<br />
<br />
* plasmid prep of K1319013 and K1319014 in pSB3K3<br />
<br />
* Gibson assembly for K1319010 and transformation into NEB10β<br />
<br />
* made cryo stocks of K1319011 clone #6<br />
<br />
* restriction of K1319012, k1319013 and K1319014 with EcoRI and PstI. Restriction of linearized plasmid backbone pSB1C3 with EcoRI and PstI. Ligation of K1319012, K1319013 and K1319014 into pSB1C3. Transformation into NEB10β. <br />
<br />
* Gibson assembly of K1319015 and transformation into NEB10β<br />
<br />
* colony PCR of K1319017<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_colony_PCR_K1319017.png|title=colony PCR K1319017|subtitle=K1319017 was checked with a colony PCR for the right insert length. Clones #2 and #4 were correct and used forthwith.|width=800px}}<br />
</center><br />
<br />
* did plasmid prep and cryo of clones #2 and #4 of K1319017<br />
<br />
* new plasmid backbone of pSB1C3 was made using the [http://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones Standard Protocol].<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and K1319013 into BL21 (two plasmids in one cell).<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and k1319014 into BL21 (two plasmids in one cell).<br />
<br />
* OD measurements of three biological triplicates from ''E. coli'' BW21 113, ''P. putida'' and ''S. cerevisiae''. Measurement as an analytic triplicate in the spectrophotometer (absorbance and transmission) and our own OD/F Device.<br />
<br />
* Gibson assembly of K1319021 <br />
** template Backbone: K1319008<br />
** template Insert: LasI gene synthesis<br />
<br />
* At 19:00 we measured OD (our OD-device), absorption (spectrophotometer) and transmission (spectrophotometer) for 19 diltuions in the range of 2.5-100% from yeast (''Saccharomyces cerevisiae'') and ''P. putida'' liquid cultures. Measurements were conducted in biological as well as technical triplicates. Aim of this experiment was the comparison of our OD-device to commonly used devices in terms of OD determination.<br />
<br />
* Prepartations for sensor-chip production the following day (2014-10-04) were done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 22:00 we prepared over-night cultures from B0015, K1319017 and K131026 by inoculating 250&nbsp;mL Erlenmeyer flasks each containing 50&nbsp;mL LB medium for sensor-chip manufacturing the next day. The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
* Our BioBrick K1319021 enables expression of the TEV protease inducible by the autoinducers of ''Pseumomonas aeruginosa''. In order to construct this BioBrick, a Gibson assembly of K1319008 (IPTG-inducible expression of TEV protease) and the synthezised composite HSL-promotor J23101.B0032.C0079.B0015.J64010.B0034 activated by the respective autoinducers (HomoSerineLactones) was perfomed. Prior to this, we used two PCRs to linearize pSB1C3-K1319008, serving as backbone for Gibson assembly, and cutting out J23101.B0032.C0079.B0015.J64010.B0034 as well as adding adequate overlapping sequences.<br />
<br />
<center><br />
{| class="wikitable"<br />
| <div style="text-align: center;">'''PCRs'''</div> || colspan="2" | <div style="text-align: center;">'''K1319008'''</div> || colspan="2"| <div style="text-align: center;">'''HSL-Promotor'''</div> ||<br />
|-<br />
! step !! time [mm:ss] !! temperature [°C] !! time [mm:ss] !! temperature [°C] !! <br />
|-<br />
| Initial denaturation || 05:00 || 98 || 05:00 || 98 ||<br />
|-<br />
| '''Denaturation''' || '''00:30''' || '''98''' || '''00:30''' || '''98''' || rowspan="3" | '''30 cycles'''<br />
|-<br />
| '''Annealing''' || '''00:30''' || '''55''' || '''00:30''' || '''51''' <br />
|-<br />
| '''Elongation''' || '''01:35''' || '''72''' || '''00:37''' || '''72'''<br />
|-<br />
| Final elongation || 05:00 || 72 || 05:00 || 72 ||<br />
|}<br />
</center><br />
<br />
==4th ==<br />
<br />
* colony PCR of K1319015 and Check PCR of K1319010<br />
** K1319010: clone #1 was positive<br />
** K1319015: in all clones the inserts were too short. <br />
<br />
* new digestion of Gibson master mix of K1319015 with DnpI<br />
<br />
* transformation of new Gibson master mix into NEB 10β<br />
<br />
* restriction of K1319010, K1319012, K1319013 and K1319014 (all in pSB3K3) with EcoRI and PstI, cutting of pSB1C3 with EcoRI and PstI, and then ligation.<br />
<br />
* made master plates and precultures of the transformations of K1319008 in BL21, K1319013 + K1319008 in BL21 and K1319014 + K1319008 in BL21<br />
<br />
* colony PCR of the master plates with the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008<br />
<br />
* sent the first BioBricks to the iGEM headquarters:<br />
** K1319000: RFC25 version of E0030<br />
** K1319001: REACh1 (Quencher)<br />
** K1319002: REACh2 (Quencher)<br />
** K1319003: Galectin 3<br />
** K1319004: TEV protease<br />
** K1319008: IPTG inducible expression of TEV protease<br />
** K1319011: J23101.B0032.K1319001.B0015<br />
** K1319017: HSL inducible expression of iLOV<br />
** K1319020: B0034.K1319009.B0015 in pSBX1A3<br />
** K1319042: IPTG inducible expression of iLOV<br />
<br />
* shake flask experiments with K1319008 (clone #1), K1319013 + K1319008 (clone #2) and K1319014 + K1319008 (clone #2) in LB (2 flasks each); inoculation with 50&nbsp;µL preculture and inducing with iPTG at OD of 1.5.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 13:30 we prepared sensor chips from pre-cultures of B0015, K1319017 and K131026.<br />
** Subsequently to 1&nbsp;h icubation at 37°C B0015, K1319017 and K131026 were induced with 0.2&nbsp;µL homoserinlacton stock solution (500&nbsp;µg/ml). The induced sensor-chips were read out every 30 minutes for 240 minutes in total. Readout was conducted at 450&nbsp;nm and 480&nbsp;nm wavelength. An additional readout was conducted after 12 hours.<br />
<br />
* At 17:00 we prepared 4 liquid cultures from the K1319010_pSB3K3 master plate (clone#1) in 5&nbsp;mL LB-medium, each. The liquid cultures were prepared in order to create cryo stocks from K1319010-pSB3K3. Kanamycin was added to the liquid cultures as antibiotic at an concentration of 1&nbsp;µL/mL.<br />
<br />
* At 18:00 we prepared a master plate (LB+C) and corresonding liquid cultures from 6 clones of ''E.coli'' NEB10B k1319021-psB1C3. Liquid cultures and master plate were incubated at 37°C.<br />
<br />
* At 23:30 we prepared liquid cultures from K1319015-pSB3K3 clones #7, #8 and #9 in 5&nbsp;mL LB-medium. Kanamycin was used as antibiotic and the cultures were incubated at 37°C. Purpose of the cultures was cryo stock preparation and plasmid prep.<br />
<br />
==5th ==<br />
<br />
* At 11:45 we prepared cryo stocks from NEB K1319010-pSB3k3 #1, K1319015-pSB3K3 #7, K1319015-pSB3K3 #8 and K1319015-pSB3K3 #9 by mixing 750&nbsp;µl lquid culture with 750&nbsp;µl 50%&nbsp;(v/v) Glycerol-solution in 2&nbsp;ml eppis.<br />
**Plasmid prep was also done for the cultures mentioned above.<br />
<br />
* At 12:00 we prepared liquid cultures from K139010-pSB3K3, K139011-pSB3K3, K139012-pSB3K3, K139013-pSB3K3, K139014-pSB3K3, K139015-pSB3K3 in 5&nbsp;ml LB-medium each. Kanamycin was used as antibiotic. Purpose for the cultures was the characterization of constituitive expression and an additional plasmid prep of K139013-pSB3K3 and K139014-pSB3K3.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 13:00 we prepared sensor chips from shake flask pre-cultures of BL21 pSB1C3-K1319008+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015.<br />
**Subsequently to 1&nbsp;h incubation at 37°C, BL21 pSB1C3-K131900+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015 were induced with 0.2&nbsp;µL IPTG. The induced sensor-chips were read out every 30&nbsp;minutes for 360&nbsp;minutes in total. K1319013 was induced earlier and thus measurements were taken for 450&nbsp;min in total. Readout was conducted at 480&nbsp;nm wavelength. An additional readout was conducted next day at 11:00.<br />
<br />
* At 15:30 we prepared liquid cultures for the characterization of ITPG inducible expression:<br />
** I746909 in pSB1C3<br />
** I20260 in pSB3K3<br />
** K731520 in pSB1C3<br />
** K1319008 in pSB1C3<br />
** K1319013 in pSB3K3<br />
** K1319014 in pSB3K3<br />
** B0015 in pSB1C3<br />
** K1319013 in pSB3K3 + K1319008 in pSB1C3<br />
** B0015 in pSB1C3<br />
** K1319014 in pSB3K3 + K1319008 in pSB1C3<br />
<br />
* prepared a colony PCR from K1319014-pSB1C3 clones #3, #4, #5 and#6. H20 and K1319014-pSB3K3 were used as controls.<br />
<br />
* At 22:20 we prepared 1&nbsp;L LB+C plates (2.5&nbsp;g NaCl, 10&nbsp;g Agar, 2.5&nbsp;g yeast extract and 5&nbsp;g Trypton). N-Z-amine (peptone from casein) was used instead of tryptone, because the tryptone stock was depleted.<br />
<br />
* prepped multiple cultures K1319013 in pSB3K3 and K1319014 in pSB3K3. Now we have sufficient amount of both plasmids.<br />
<br />
* Plates were made for the following constructs:<br />
<br />
<center><br />
{| class="wikitable"<br />
! part in vector !! strain !! resistance<br />
|-<br />
| K1319008 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319010 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319011 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319012 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319013 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319014 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319015 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319017 in pSB1C3 || NEB10β || C<br />
|-<br />
| K1319042 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319008 in pSB1C3 + K1319013 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| K1319008 in pSB1C3 + K1319014 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| I746909 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K731520 in pSB1C3 || DH5α || C<br />
|-<br />
| I20260 in pSB3K3 || NEB10β || K<br />
|-<br />
| B0015 in pSB1C3 || NEB10β || C<br />
|}<br />
</center><br />
<br />
* To determine whether the conducted Gibson assembly of K1319021 and subsequent transformation into ''E. coli'' NEB 10β were successful, a colony PCR on these cells was performed. Primers binding to each of the templates used for Gibson assembly were used: LasI_Insert_F binding in J23101.B0032.C0079.B0015.J64010.B0034 and K1319004_Check_R binding in pSB1C3-K1319008. Bands at 1341&nbsp;bp would indicate the successful construction and transformation of K1319021. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-05_Check_PCR_on_K1319021.png|title=Check PCR on K1319021|subtitle=(Homoserinlactone-inducible expression of the TEV protease)|width=800px}}<br />
</center><br />
<br />
Since Bands >2000&nbsp;bp were observed, another PCR was performed by using primers binding upstream and downstream of the insert in pSB1C3: G00100_alternative and G00101_alternative. Here, bands with a length of 2210&nbsp;bp would verify the correct length of K1319021.<br />
<br />
==6th ==<br />
<br />
* made a SDS page of K1319010-15 and J23101.E0240<br />
<br />
* made a master plate at 15:30 containing two clones of K1319015 plate from yesterday.<br />
<br />
* At 22:00 we inocculated two 500&nbsp;ml flasks containing 50 ml&nbsp;LB-medium with 1&nbsp;ml pre-culture of K1319017, which had been prepared from a master-plate earlier this day. Chloramphinicol was used as antibiotic. The flasks were incubated at 37°C. One culture (50&nbsp;ml) was induced with 25&nbsp;µg homoserinlacton after an OD of 0.6 was reached and the induced culture as well as the control were used for fluorescence characterization. Fluorescene and OD were monitored once per hour. The OD of the induced culture stagnated at ~0.7 while the non induced culture grew further.<br />
<br />
== 7th ==<br />
<br />
* Two conducted colony PCRs confirmed that our double plasmid systems of K1319008 and K13190013/14 contain nothing but the desired BioBricks, which were used as positive controls. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-07_colonyPCR_on_characterization_constructs.png|title=colony PCR cells harboring the double plasmid system pSB3K3-K1319008 pSB1C3-K1319013/14|subtitle=(IPTG-inducible expression of the TEV protease and constitutive expression of our GFP-Quencher-Constructs)|width=800px}}<br />
</center><br />
<br />
*Characterisation of the biobrick K1319008 together with the biobricks K1319014 and K1319013.<br />
<br />
*Therefore the following biobricks were cultivated in biological triplicates:<br />
<br />
<center><br />
{|class="wikitable"<br />
!biobrick !! strain !! plasmid !! induced with iPTG<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || no<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || yes<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K731520 || BL21 || pSB1C3 || no<br />
|- <br />
|K731520 || BL21 || pSB1C3 || yes<br />
|-<br />
|I746909 || BL21 || pSB1C3 || no<br />
|-<br />
|I746909 || BL21 || pSB1C3 || yes<br />
|-<br />
|B0015 || NEB 10 Beta || pSB1C3 || no<br />
|-<br />
|I20260 || BL21 || pSB3K3 || no<br />
|-<br />
|}<br />
</center><br />
<br />
* overnight culture of K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 for chip production ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]).<br />
<br />
== 8th ==<br />
* We prepared sensor-chips with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and B0015 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Images were made every 30 min with our own device.<br />
* made precultures with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and K731520. <br />
* cutting K1319013, K1319014 ans a pSB1A3 vector backbone with EcoRI and SpeI and K1319008 with XbaI and PstI<br />
* Ligation of K1319013/K1319014 with K1319008 and then ligation into pSB1A3<br />
*Transformation of the ligation product into BL21<br />
<br />
== 9th ==<br />
* SOC medium was added to the transformation before the heat shock had occurred by mistake.<br />
* At 02:00 the precultures for the characterization experiment were transferred to 250&nbsp;ml shake flasks (3&nbsp;ml culture + 10&nbsp;ml LB+antibiotics).<br />
* new transformation of the ligation product was conducted into BL21 and DH5α<br />
* At 23:00 a 500&nbsp;ml flask containing 50&nbsp;ml LB-medium was inocculated from a K131026 BL21 cryo stock for sensor-chip manufacturing the following day.<br />
<br />
== 10th ==<br />
* made master plates of the new transformation of the ligation product and overnight cultures<br />
* made chips with K131026 in BL21. Images were taken automaticly every 5 min with our own device<br />
<br />
* For sensor-chip manufacturing the following day, we inocculated 500&nbsp;ml flasks containing 50&nbsp;ml LB-medium with NEB10β K1319017.pSB1C3 clone #2 and with BL21 K1319042.pSB1C3 clone 2# accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Inoccultion was done at 21:35.<br />
*In preparation for an additional main charcterization experiment we inocculated 200 ml flasks or 300 ml flasks as available containing 25 ml LB-medium with seven of our own constructs listd below. Inoccuaation was done at 22:00.<br />
**K1319010<br />
**K1319011<br />
**B0015<br />
**I20260<br />
**K1319015<br />
**K1319014<br />
**K1319012<br />
**k1319013<br />
<br />
==11th==<br />
<br />
*At 21:00 we inocculted two 500 ml flasks containing 50 ml LB-medium with BL21 K1319042.pSB1C3 (from plate) and DH5α K1319026.pSB1C3 (from cryo), respectively. Chloramphenicol was used as antibiotik. Both cultures were required for chip manufacturing the next day ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]). The chips´ fluorescence was meant to be measured with a plate reader starting ~11:00 the next day. The chips were meant to be measured in parallel.<br />
<br />
*At 20:30 eight cultures listed below were plated out for additional characterization experiments on monday.<br />
**B0015 in pSB1C3<br />
**I20260 in pSB3K3<br />
**K731520 pSB1C3 #2<br />
**I746909 in pSB1C3<br />
**K1319042 i pSB1C3 #2<br />
**K1319008 in pSB1C3 #1<br />
**K1319008/13 in pSB1C3/3K3 #1<br />
**K1319008/14 in pSB1C3/3K3 #2<br />
<br />
==12th==<br />
<br />
*At 9:00 sensor-chips were prepared from precultures of BL21 K1319042.pSB1C3 and DH5α K1319026pSB1C.pSB1C3 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. The cultures were induced at ~11:00 and fluorescence was measured using a plate-reader. K1319026 was additionally measured in our device for its fluorescence.<br />
* Media with different antibiotics for the experiment for collaboration with Heidelberg were prepared. Also media for Robolektor were made.<br />
* Cultures of I13507 in seven vectors listed below were solued in 0,9% NaCl for the OD measurment. Then all cultures and an additional positive control were inoculated in 96-wellsplate with resulted OD of 0,648. The cultures were required for calibration of the plate-reader used for fluorescence measurement, which was part of the Heidelberg chracaterization project. Inocculation was done at ~19:15.<br />
**pSBX1A3<br />
**pSBX4A5<br />
**pSBX1C3<br />
**pSBX4C5<br />
**pSBX1K3<br />
**pSBX4K5<br />
**pSBX1T3<br />
<br />
*At 22:15 a 300 ml flask containing 30 ml LB-medium was inocculated with I746909.pSB1C3. The culture was required for calibration of the robolector (Jülich FHZ). Cloramphenicol was used as antibiotic.<br />
<br />
==13th==<br />
* overnight culture of K131026 in BL21 for chips<br />
<br />
==14th==<br />
* made chips of K131026 in BL21 in LB. Images were taken nearly every 5 or 2&nbsp;min with our own device. Chips were induced with 2&nbsp;µl of ''Pseudomonas aeruginosa'' liquid culture or 500&nbsp;µg/ml HSL<br />
* overnight cultures of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 in BL21 for chips<br />
<br />
== 15th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 (BL21) in LB. Images were taken every 2&nbsp;min with our own device and every 4&nbsp;min in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
* made overnight cultures of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 for chips<br />
<br />
== 16th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 in LB. Images were taken every 2&nbsp;min with our own device from K731520 and I746909 and every 4&nbsp;min from all strains in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/OctoberTeam:Aachen/Notebook/Wetlab/October2014-10-17T22:08:07Z<p>StefanReinhold: /* 3rd */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= October =<br />
== 1st ==<br />
* Prepartations for sensor-chip production the following day (2014-10-02) was done accoringly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 18:30 we prepared over-night cultures from K1319042, B0015 and K131026 by inoculating 250&nbsp;ml Erlenmeyer flasks each containing 50&nbsp;ml LB medium . The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
== 2nd ==<br />
<br />
* At 8:30, we did a plasmid prep of dublicate samples of K1319011 clone #1 and #6. We measured the DNA yield, and the higher concentrated sample of clone #1 and #6, respectively, were sent in for sequencing.<br />
* made precultures and a master plate of 6 colonies of K3139008 in psB1C3 in NEB10β cells that had been plated at 5:30 this morning.<br />
<br />
* Production of sensor-chips was done accordingly to [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Briefly:<br />
** At 10:00 we prepared 150&nbsp;ml 1.5%&nbsp;(w/v) LB+agarose solution. The LB+agarose solution was autoclaved and subsequently tempered to 45°C. Precultures (50&nbsp;ml each) of K1319042, B0015 and K131026 were spun down at 3000&nbsp;g for 10&nbsp;min at 21°C and re-suspended in 1&nbsp;ml pretempered (21°C) LB medium. The re-suspended cultures were mixed with 50&nbsp;ml LB+agarose and poured onto three sensor-chip-templates (one template per culture). Sensor chips were cut out from the template and incubated at 37°C for 1&nbsp;h.<br />
** K1319042 and B0015 were induced with 0.2&nbsp;µl IPTG (100&nbsp;mM) subsequently to incubation and K131026 was induced with 0.2&nbsp;µl homoserinlacton stock solution (500&nbsp;µg/ml) 30 minutes after induction of the K1319042 and B0015. The induced sensor-chips were read out every 30 minutes for 180 minutes in total. An additional readout was conducted 285 minutes post induction. The readout was done at 450&nbsp;nm and 480&nbsp;nm wavelength. <br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_10_2014_B0015_serie.png|title=Sensor Chips with B0015 in NEB in LB (480&nbsp;nm): first try with final device|subtitle=Sensor chips with B0015 in NEB in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 100&nbsp;mM IPTG B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
* Gibson assembly of K1319008<br />
** template Backbone: I746909, Insert: K1319004<br />
** transformation in ''E.coli'' NEB10β and BL21<br />
<br />
* PCRs for Gibson assembly of K1319010 and K1319015<br />
** template Backbone: I20260 for K1319010 and K1319015<br />
** template Insert: K1319000 for K1319010 and K1319015 (but different primer)<br />
<br />
* made precultures of K1319013 and K1319014 in pSB3K3<br />
<br />
* K1319011 in pSB1C3 prepped for sequencing<br />
<br />
* Gibson assembly of K1319017 (PCRs, Gibson assembly, restriction with DnpI, transformation into NEB10β)<br />
** template Backbone: B0015<br />
** template Insert 1: LasI synthesized gene<br />
** template Insert 2: K660004<br />
<br />
==3rd==<br />
<br />
* made master plates of K1319008 in NEB10β and BL21 and precultures<br />
<br />
* check PCR for K1319008 to validate the Gibson assembly check for potential I746909 residues<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_K1319008_insert_colonyPCR.png|title=Check PCR K1319008|subtitle=K1319008 was checked with the Primers K1319008_Check_R and I746909_Check_R (both with G00100 Alternative as froward primer) for presence of K1319008 or I746909. All tested clones were positive for K1319008 and negative for I746909.|width=800px}}<br />
</center><br />
<br />
* did a plasmid prep and made cryo stocks of K1319008 in NEB (clones #1, #2, #3) and BL21 (clones #1, #2)<br />
<br />
* plasmid prep of K1319013 and K1319014 in pSB3K3<br />
<br />
* Gibson assembly for K1319010 and transformation into NEB10β<br />
<br />
* made cryo stocks of K1319011 clone #6<br />
<br />
* restriction of K1319012, k1319013 and K1319014 with EcoRI and PstI. Restriction of linearized plasmid backbone pSB1C3 with EcoRI and PstI. Ligation of K1319012, K1319013 and K1319014 into pSB1C3. Transformation into NEB10β. <br />
<br />
* Gibson assembly of K1319015 and transformation into NEB10β<br />
<br />
* colony PCR of K1319017<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_colony_PCR_K1319017.png|title=colony PCR K1319017|subtitle=K1319017 was checked with a colony PCR for the right insert length. Clones #2 and #4 were correct and used forthwith.|width=800px}}<br />
</center><br />
<br />
* did plasmid prep and cryo of clones #2 and #4 of K1319017<br />
<br />
* new plasmid backbone of pSB1C3 was made using the [http://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones].<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and K1319013 into BL21 (two plasmids in one cell).<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and k1319014 into BL21 (two plasmids in one cell).<br />
<br />
* OD measurements of three biological triplicates from ''E. coli'' BW21 113, ''P. putida'' and ''S. cerevisiae''. Measurement as an analytic triplicate in the spectrophotometer (absorbance and transmission) and our own OD/F Device.<br />
<br />
* Gibson assembly of K1319021 <br />
** template Backbone: K1319008<br />
** template Insert: LasI gene synthesis<br />
<br />
* At 19:00 we measured OD (our OD-device), absorption (spectrophotometer) and transmission (spectrophotometer) for 19 diltuions in the range of 2.5-100% from yeast (''Saccharomyces cerevisiae'') and ''P. putida'' liquid cultures. Measurements were conducted in biological as well as technical triplicates. Aim of this experiment was the comparison of our OD-device to commonly used devices in terms of OD determination.<br />
<br />
* Prepartations for sensor-chip production the following day (2014-10-04) were done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 22:00 we prepared over-night cultures from B0015, K1319017 and K131026 by inoculating 250&nbsp;mL Erlenmeyer flasks each containing 50&nbsp;mL LB medium for sensor-chip manufacturing the next day. The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
* Our BioBrick K1319021 enables expression of the TEV protease inducible by the autoinducers of ''Pseumomonas aeruginosa''. In order to construct this BioBrick, a Gibson assembly of K1319008 (IPTG-inducible expression of TEV protease) and the synthezised composite HSL-promotor J23101.B0032.C0079.B0015.J64010.B0034 activated by the respective autoinducers (HomoSerineLactones) was perfomed. Prior to this, we used two PCRs to linearize pSB1C3-K1319008, serving as backbone for Gibson assembly, and cutting out J23101.B0032.C0079.B0015.J64010.B0034 as well as adding adequate overlapping sequences.<br />
<br />
<center><br />
{| class="wikitable"<br />
| <div style="text-align: center;">'''PCRs'''</div> || colspan="2" | <div style="text-align: center;">'''K1319008'''</div> || colspan="2"| <div style="text-align: center;">'''HSL-Promotor'''</div> ||<br />
|-<br />
! step !! time [mm:ss] !! temperature [°C] !! time [mm:ss] !! temperature [°C] !! <br />
|-<br />
| Initial denaturation || 05:00 || 98 || 05:00 || 98 ||<br />
|-<br />
| '''Denaturation''' || '''00:30''' || '''98''' || '''00:30''' || '''98''' || rowspan="3" | '''30 cycles'''<br />
|-<br />
| '''Annealing''' || '''00:30''' || '''55''' || '''00:30''' || '''51''' <br />
|-<br />
| '''Elongation''' || '''01:35''' || '''72''' || '''00:37''' || '''72'''<br />
|-<br />
| Final elongation || 05:00 || 72 || 05:00 || 72 ||<br />
|}<br />
</center><br />
<br />
==4th ==<br />
<br />
* colony PCR of K1319015 and Check PCR of K1319010<br />
** K1319010: clone #1 was positive<br />
** K1319015: in all clones the inserts were too short. <br />
<br />
* new digestion of Gibson master mix of K1319015 with DnpI<br />
<br />
* transformation of new Gibson master mix into NEB 10β<br />
<br />
* restriction of K1319010, K1319012, K1319013 and K1319014 (all in pSB3K3) with EcoRI and PstI, cutting of pSB1C3 with EcoRI and PstI, and then ligation.<br />
<br />
* made master plates and precultures of the transformations of K1319008 in BL21, K1319013 + K1319008 in BL21 and K1319014 + K1319008 in BL21<br />
<br />
* colony PCR of the master plates with the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008<br />
<br />
* sent the first BioBricks to the iGEM headquarters:<br />
** K1319000: RFC25 version of E0030<br />
** K1319001: REACh1 (Quencher)<br />
** K1319002: REACh2 (Quencher)<br />
** K1319003: Galectin 3<br />
** K1319004: TEV protease<br />
** K1319008: IPTG inducible expression of TEV protease<br />
** K1319011: J23101.B0032.K1319001.B0015<br />
** K1319017: HSL inducible expression of iLOV<br />
** K1319020: B0034.K1319009.B0015 in pSBX1A3<br />
** K1319042: IPTG inducible expression of iLOV<br />
<br />
* shake flask experiments with K1319008 (clone #1), K1319013 + K1319008 (clone #2) and K1319014 + K1319008 (clone #2) in LB (2 flasks each); inoculation with 50&nbsp;µL preculture and inducing with iPTG at OD of 1.5.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 13:30 we prepared sensor chips from pre-cultures of B0015, K1319017 and K131026.<br />
** Subsequently to 1&nbsp;h icubation at 37°C B0015, K1319017 and K131026 were induced with 0.2&nbsp;µL homoserinlacton stock solution (500&nbsp;µg/ml). The induced sensor-chips were read out every 30 minutes for 240 minutes in total. Readout was conducted at 450&nbsp;nm and 480&nbsp;nm wavelength. An additional readout was conducted after 12 hours.<br />
<br />
* At 17:00 we prepared 4 liquid cultures from the K1319010_pSB3K3 master plate (clone#1) in 5&nbsp;mL LB-medium, each. The liquid cultures were prepared in order to create cryo stocks from K1319010-pSB3K3. Kanamycin was added to the liquid cultures as antibiotic at an concentration of 1&nbsp;µL/mL.<br />
<br />
* At 18:00 we prepared a master plate (LB+C) and corresonding liquid cultures from 6 clones of ''E.coli'' NEB10B k1319021-psB1C3. Liquid cultures and master plate were incubated at 37°C.<br />
<br />
* At 23:30 we prepared liquid cultures from K1319015-pSB3K3 clones #7, #8 and #9 in 5&nbsp;mL LB-medium. Kanamycin was used as antibiotic and the cultures were incubated at 37°C. Purpose of the cultures was cryo stock preparation and plasmid prep.<br />
<br />
==5th ==<br />
<br />
* At 11:45 we prepared cryo stocks from NEB K1319010-pSB3k3 #1, K1319015-pSB3K3 #7, K1319015-pSB3K3 #8 and K1319015-pSB3K3 #9 by mixing 750&nbsp;µl lquid culture with 750&nbsp;µl 50%&nbsp;(v/v) Glycerol-solution in 2&nbsp;ml eppis.<br />
**Plasmid prep was also done for the cultures mentioned above.<br />
<br />
* At 12:00 we prepared liquid cultures from K139010-pSB3K3, K139011-pSB3K3, K139012-pSB3K3, K139013-pSB3K3, K139014-pSB3K3, K139015-pSB3K3 in 5&nbsp;ml LB-medium each. Kanamycin was used as antibiotic. Purpose for the cultures was the characterization of constituitive expression and an additional plasmid prep of K139013-pSB3K3 and K139014-pSB3K3.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 13:00 we prepared sensor chips from shake flask pre-cultures of BL21 pSB1C3-K1319008+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015.<br />
**Subsequently to 1&nbsp;h incubation at 37°C, BL21 pSB1C3-K131900+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015 were induced with 0.2&nbsp;µL IPTG. The induced sensor-chips were read out every 30&nbsp;minutes for 360&nbsp;minutes in total. K1319013 was induced earlier and thus measurements were taken for 450&nbsp;min in total. Readout was conducted at 480&nbsp;nm wavelength. An additional readout was conducted next day at 11:00.<br />
<br />
* At 15:30 we prepared liquid cultures for the characterization of ITPG inducible expression:<br />
** I746909 in pSB1C3<br />
** I20260 in pSB3K3<br />
** K731520 in pSB1C3<br />
** K1319008 in pSB1C3<br />
** K1319013 in pSB3K3<br />
** K1319014 in pSB3K3<br />
** B0015 in pSB1C3<br />
** K1319013 in pSB3K3 + K1319008 in pSB1C3<br />
** B0015 in pSB1C3<br />
** K1319014 in pSB3K3 + K1319008 in pSB1C3<br />
<br />
* prepared a colony PCR from K1319014-pSB1C3 clones #3, #4, #5 and#6. H20 and K1319014-pSB3K3 were used as controls.<br />
<br />
* At 22:20 we prepared 1&nbsp;L LB+C plates (2.5&nbsp;g NaCl, 10&nbsp;g Agar, 2.5&nbsp;g yeast extract and 5&nbsp;g Trypton). N-Z-amine (peptone from casein) was used instead of tryptone, because the tryptone stock was depleted.<br />
<br />
* prepped multiple cultures K1319013 in pSB3K3 and K1319014 in pSB3K3. Now we have sufficient amount of both plasmids.<br />
<br />
* Plates were made for the following constructs:<br />
<br />
<center><br />
{| class="wikitable"<br />
! part in vector !! strain !! resistance<br />
|-<br />
| K1319008 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319010 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319011 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319012 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319013 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319014 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319015 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319017 in pSB1C3 || NEB10β || C<br />
|-<br />
| K1319042 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319008 in pSB1C3 + K1319013 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| K1319008 in pSB1C3 + K1319014 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| I746909 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K731520 in pSB1C3 || DH5α || C<br />
|-<br />
| I20260 in pSB3K3 || NEB10β || K<br />
|-<br />
| B0015 in pSB1C3 || NEB10β || C<br />
|}<br />
</center><br />
<br />
* To determine whether the conducted Gibson assembly of K1319021 and subsequent transformation into ''E. coli'' NEB 10β were successful, a colony PCR on these cells was performed. Primers binding to each of the templates used for Gibson assembly were used: LasI_Insert_F binding in J23101.B0032.C0079.B0015.J64010.B0034 and K1319004_Check_R binding in pSB1C3-K1319008. Bands at 1341&nbsp;bp would indicate the successful construction and transformation of K1319021. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-05_Check_PCR_on_K1319021.png|title=Check PCR on K1319021|subtitle=(Homoserinlactone-inducible expression of the TEV protease)|width=800px}}<br />
</center><br />
<br />
Since Bands >2000&nbsp;bp were observed, another PCR was performed by using primers binding upstream and downstream of the insert in pSB1C3: G00100_alternative and G00101_alternative. Here, bands with a length of 2210&nbsp;bp would verify the correct length of K1319021.<br />
<br />
==6th ==<br />
<br />
* made a SDS page of K1319010-15 and J23101.E0240<br />
<br />
* made a master plate at 15:30 containing two clones of K1319015 plate from yesterday.<br />
<br />
* At 22:00 we inocculated two 500&nbsp;ml flasks containing 50 ml&nbsp;LB-medium with 1&nbsp;ml pre-culture of K1319017, which had been prepared from a master-plate earlier this day. Chloramphinicol was used as antibiotic. The flasks were incubated at 37°C. One culture (50&nbsp;ml) was induced with 25&nbsp;µg homoserinlacton after an OD of 0.6 was reached and the induced culture as well as the control were used for fluorescence characterization. Fluorescene and OD were monitored once per hour. The OD of the induced culture stagnated at ~0.7 while the non induced culture grew further.<br />
<br />
== 7th ==<br />
<br />
* Two conducted colony PCRs confirmed that our double plasmid systems of K1319008 and K13190013/14 contain nothing but the desired BioBricks, which were used as positive controls. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-07_colonyPCR_on_characterization_constructs.png|title=colony PCR cells harboring the double plasmid system pSB3K3-K1319008 pSB1C3-K1319013/14|subtitle=(IPTG-inducible expression of the TEV protease and constitutive expression of our GFP-Quencher-Constructs)|width=800px}}<br />
</center><br />
<br />
*Characterisation of the biobrick K1319008 together with the biobricks K1319014 and K1319013.<br />
<br />
*Therefore the following biobricks were cultivated in biological triplicates:<br />
<br />
<center><br />
{|class="wikitable"<br />
!biobrick !! strain !! plasmid !! induced with iPTG<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || no<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || yes<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K731520 || BL21 || pSB1C3 || no<br />
|- <br />
|K731520 || BL21 || pSB1C3 || yes<br />
|-<br />
|I746909 || BL21 || pSB1C3 || no<br />
|-<br />
|I746909 || BL21 || pSB1C3 || yes<br />
|-<br />
|B0015 || NEB 10 Beta || pSB1C3 || no<br />
|-<br />
|I20260 || BL21 || pSB3K3 || no<br />
|-<br />
|}<br />
</center><br />
<br />
* overnight culture of K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 for chip production ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]).<br />
<br />
== 8th ==<br />
* We prepared sensor-chips with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and B0015 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Images were made every 30 min with our own device.<br />
* made precultures with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and K731520. <br />
* cutting K1319013, K1319014 ans a pSB1A3 vector backbone with EcoRI and SpeI and K1319008 with XbaI and PstI<br />
* Ligation of K1319013/K1319014 with K1319008 and then ligation into pSB1A3<br />
*Transformation of the ligation product into BL21<br />
<br />
== 9th ==<br />
* SOC medium was added to the transformation before the heat shock had occurred by mistake.<br />
* At 02:00 the precultures for the characterization experiment were transferred to 250&nbsp;ml shake flasks (3&nbsp;ml culture + 10&nbsp;ml LB+antibiotics).<br />
* new transformation of the ligation product was conducted into BL21 and DH5α<br />
* At 23:00 a 500&nbsp;ml flask containing 50&nbsp;ml LB-medium was inocculated from a K131026 BL21 cryo stock for sensor-chip manufacturing the following day.<br />
<br />
== 10th ==<br />
* made master plates of the new transformation of the ligation product and overnight cultures<br />
* made chips with K131026 in BL21. Images were taken automaticly every 5 min with our own device<br />
<br />
* For sensor-chip manufacturing the following day, we inocculated 500&nbsp;ml flasks containing 50&nbsp;ml LB-medium with NEB10β K1319017.pSB1C3 clone #2 and with BL21 K1319042.pSB1C3 clone 2# accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Inoccultion was done at 21:35.<br />
*In preparation for an additional main charcterization experiment we inocculated 200 ml flasks or 300 ml flasks as available containing 25 ml LB-medium with seven of our own constructs listd below. Inoccuaation was done at 22:00.<br />
**K1319010<br />
**K1319011<br />
**B0015<br />
**I20260<br />
**K1319015<br />
**K1319014<br />
**K1319012<br />
**k1319013<br />
<br />
==11th==<br />
<br />
*At 21:00 we inocculted two 500 ml flasks containing 50 ml LB-medium with BL21 K1319042.pSB1C3 (from plate) and DH5α K1319026.pSB1C3 (from cryo), respectively. Chloramphenicol was used as antibiotik. Both cultures were required for chip manufacturing the next day ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]). The chips´ fluorescence was meant to be measured with a plate reader starting ~11:00 the next day. The chips were meant to be measured in parallel.<br />
<br />
*At 20:30 eight cultures listed below were plated out for additional characterization experiments on monday.<br />
**B0015 in pSB1C3<br />
**I20260 in pSB3K3<br />
**K731520 pSB1C3 #2<br />
**I746909 in pSB1C3<br />
**K1319042 i pSB1C3 #2<br />
**K1319008 in pSB1C3 #1<br />
**K1319008/13 in pSB1C3/3K3 #1<br />
**K1319008/14 in pSB1C3/3K3 #2<br />
<br />
==12th==<br />
<br />
*At 9:00 sensor-chips were prepared from precultures of BL21 K1319042.pSB1C3 and DH5α K1319026pSB1C.pSB1C3 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. The cultures were induced at ~11:00 and fluorescence was measured using a plate-reader. K1319026 was additionally measured in our device for its fluorescence.<br />
* Media with different antibiotics for the experiment for collaboration with Heidelberg were prepared. Also media for Robolektor were made.<br />
* Cultures of I13507 in seven vectors listed below were solued in 0,9% NaCl for the OD measurment. Then all cultures and an additional positive control were inoculated in 96-wellsplate with resulted OD of 0,648. The cultures were required for calibration of the plate-reader used for fluorescence measurement, which was part of the Heidelberg chracaterization project. Inocculation was done at ~19:15.<br />
**pSBX1A3<br />
**pSBX4A5<br />
**pSBX1C3<br />
**pSBX4C5<br />
**pSBX1K3<br />
**pSBX4K5<br />
**pSBX1T3<br />
<br />
*At 22:15 a 300 ml flask containing 30 ml LB-medium was inocculated with I746909.pSB1C3. The culture was required for calibration of the robolector (Jülich FHZ). Cloramphenicol was used as antibiotic.<br />
<br />
==13th==<br />
* overnight culture of K131026 in BL21 for chips<br />
<br />
==14th==<br />
* made chips of K131026 in BL21 in LB. Images were taken nearly every 5 or 2&nbsp;min with our own device. Chips were induced with 2&nbsp;µl of ''Pseudomonas aeruginosa'' liquid culture or 500&nbsp;µg/ml HSL<br />
* overnight cultures of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 in BL21 for chips<br />
<br />
== 15th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 (BL21) in LB. Images were taken every 2&nbsp;min with our own device and every 4&nbsp;min in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
* made overnight cultures of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 for chips<br />
<br />
== 16th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 in LB. Images were taken every 2&nbsp;min with our own device from K731520 and I746909 and every 4&nbsp;min from all strains in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/ODFTeam:Aachen/Notebook/Engineering/ODF2014-10-17T22:00:13Z<p>StefanReinhold: /* Technical Components */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
{{Team:Aachen/Stylesheet}}<br />
= OD/F Device =<br />
<br />
On this page we present the technical details of our OD/F Device. You can skip to specific chapters by clicking on the panels below:<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#dev" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br><br />
<b>General Considerations</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#od" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>OD Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/04/Aachen_Cuvette_button_v1_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#f" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>F Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
= General Considerations =<br />
<span class="anchor" id="dev"></span><br />
<br />
Building the OD/F Device has been an interesting task. While this device has been developed mainly by the IT division of our team, we got an immense support from the biologists suffering from color-blindness, yet eager to help selecting the best color filters for the LEDs.<br />
<br />
The measuring principle and guidelines for this project have already been presented in the [https://2014.igem.org/Team:Aachen/OD/F_device project] section.<br />
Here, details about selecting filters, code and a construction manual are presented.<br />
<br />
=== Cuvette Holder ===<br />
The essential part of this device is the '''cuvette holder'''. In short, we had to overcome a dilemma created by the need for an optimal height for the sensor:<br />
* A too low sensor position bears problems with sedimentation as well as light diffraction from the bottom of the cuvette.<br />
* The sensor has to be as close as possible to the bottom so that enough light shines through for the fluorescence measurement.<br />
<br />
As a compromise, we place the sensor at a height of 0.75&nbsp;cm. It is comparable to one of the standard heights (0.2&nbsp;cm, 0.8&nbsp;cm, 1.2&nbsp;cm) of OD meters. It is important to note that our device works with filling volumens of just 1&nbsp;mL, which in fact comes close to reality in the lab.<br />
<br />
The final cuvette holder design is rendered from a [https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=raw stl-file] shown below:<br />
<br />
<html><br />
<center> <br />
<iframe src="https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=render<br />
" width=500px height=500px frameBorder="0"></iframe><br />
<br/><br />
<b>Cuvette Holder devloped for our OD/F Device.</b><br />
</center><br />
</html><br />
<br />
=== Light Filters ===<br />
'''Finding the right and optimal filters is a tough challenge'''.<br />
The main goal throughout our project has been to choose easily available parts which are also inexpensive. Thus choosing Schott glasses as filters could not be considered. Alternatively, filters used for illumination of theaters were found to be an ideal solution.<br />
<br />
We tested serveral filters and the optimal configuration of filters used is listed below.<br />
<br />
{| class="wikitable"<br />
! Mode<br />
! Fluorescence Protein<br />
! Filter Name<br />
! Filter<br />
! Peak Excitation<br />
! Peak Emission<br />
|-<br />
| Fluorescence<br />
| [http://parts.igem.org/Part:BBa_E0040 GFPmut3b]<br />
| [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green]<br />
| [[File:Aachen_Filter_736.png|200px]]<br />
| 501nm<br />
| 511nm<br />
|-<br />
| Optical Density<br />
| --<br />
| [http://leefilters.com/lighting/colour-details.html#019 Fire]<br />
| [[File:Aachen_Filter_019.png|200px]]<br />
| 600nm<br />
| 600nm<br />
|}<br />
<br />
The fluorescence protein [http://parts.igem.org/Part:BBa_E0040 GFPmut3b] has a peak excitation at 501&nbsp;nm and a peak emission at 511&nbsp;nm - too close together for our low-cost filters to block the excitation light but transmit the emitted light. Thus, we chose to excite at around 485&nbsp;nm reduce false positive results below 500&nbsp;nm. However, no adequate filter for these settings could be found.<br />
Eventually, using the dark greenish [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green] filter only little amounts of light shorter than 500&nbsp;nm gets through, reducing any bias from excitation illumination significantly. Unfortunately, the transmission rate of this filter is quite bad, 20% only, for the target emission wavelength of 511&nbsp;nm.<br />
<br />
== Linearity of the Hardware Light Sensor ==<br />
<span class="anchor" id="lin"></span><br />
It is crucial that the selected hardware is mapping reality into the digital world of our $\mu$-Controller.<br />
In order to sense reality our setup uses a light to frequency sensor, [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf TSL235R-LF].<br />
The light to frequency sensor resembles the most to a photo transistor and thus is less sensible to temperature than a light dependant resistor.<br />
Additionally counting a frequency using interrupts seems to be easier and more accurate than using the analog to digital converter.<br />
<br />
Using a dilution series of purified [https://2011.igem.org/Team:Glasgow/LOV2 iLOV] we could determine the characteristic curve for the light sensor. Finally we can conclude that the sensor is linear as expected and shown in the [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf datasheet].<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Linearity iFG.PNG|title=Linearity of TSL235R-LF sensor|subtitle=Dilution series of GFP expressing ''E. coli'' showing linearity between fluorescence count and dilution. The linearity of the chosen sensor can be determined.|width=700px}}<br />
<br />
We are measuring optical density using our in-house developed cuvette holder.<br />
Particularly for optical density measurement, the amount of light shining through the sample is crucial.<br />
If there is too few light, there will be not enough light registered at the sensor, and the resolution of the measurement shrinks. This should be prevented.<br />
The chosen light to frequency sensor is reported to be very sensitive on the amount of light shining on it.<br />
There are reports of the sensor breaking when put into [https://www.sparkfun.com/products/9768 sunlight on a nice day], and not being sensitive at both high light or low light [http://kesslerarduino.wordpress.com/author/kevinmkessler/page/2/ conditions].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
[[File:Aachen_Cuvette_button_v1_ipo.png|right|150px]]<br />
<br />
= Evaluation of the Optical Density Measurement =<br />
<span class="anchor" id="od"></span><br />
<br />
=== From Transmittance to True Optical Density ===<br />
At very low levels, uncorrected photometric determinations of cell densities show a decreasing proportionaility to actual cell density.<br />
<br />
This can also be observed using our device.<br />
<br />
In general, photometric determination of bacterial concentrations depends primarily on light scattering, rather than light absorption. Therefore, often not absorption is measured, but transmittance. For this, the relationship between optical density (OD) and transmitted light $\frac{I_0}{I}$ exists as:<br />
<br />
$$ OD = \frac{I_0}{I} = \kappa \cdot c$$<br />
<br />
where $I_0$ is the intensity of incoming light and $I$ the amount of the light passing through.<br />
<br />
However, this equation is linear only in a certain range.<br />
While one can tackle this non-linearity by using dilutions of the culture, correcting the error systematically is another way to overcome this limitation.<br />
<br />
For our OD device we needed to correlate the transmittance measured by our sensor to an optical density anyway.<br />
Our team members from the deterministic sciences emphasized on the correction method, which was conducted according to Lawrence and Maier (2006):<br />
<br />
* The relative density ($RD$) of each sample in a dilution series is calculated using $\frac{min(dilution)}{dilution}$.<br />
* The uncorrected optical density is derived from the transmission T [%]: $OD = 2 - \log T$<br />
* Finally, the unit optical density is calculated as $\frac{OD}{TD}$.<br />
* The average of the stable unit optical densities is used to calculate the true optical density $ OD_{unit} \cdot RD $.<br />
This way, the correlation between transmission and true optical density can be computed.<br />
The derived function allows the conversion from transmission to optical density on our device and therefore calibrates our device.<br />
<br />
<br />
In our experiments, we find in accordance to Lawrence and Maier that the correction majorly depends on the technical equipment used, especially the LED, sensor and cuvettes.<br />
While this at first sight looks disappointing, it is also expected:<br />
Transmittance is the fraction of light not absorbed by some medium relative to the cell-free and clear medium.<br />
However, the transmittance is not only dependent on the amount of cells in the way of the light's beam, but also how much light shines through the cuvette in which fashion, and in which fraction is received by the sensor in which angles.<br />
<br />
Using the above formula we performed this experiment for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae'' and asked team [https://2014.igem.org/Team:Aachen/Collaborations/Freiburg Freiburg] to perform the same experiment using mamallian cells.<br />
<br />
=== Experiments ===<br />
<br />
We performed several experiments during the development of the device.<br />
Finally, we can relate the measured transmittance to the true Optical Density (true OD), and further, we can relate the true OD to the true OD of the photospectrometer in our lab.<br />
By doing so, we can calibrate our device to meaningful values.<br />
<br />
We have done this according to the previous section for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae''.<br />
<br />
The final function for calculating the OD from the transmission calculated by our device can be calculated as<br />
<br />
$$ OD(T) = f(T) \circ g(device) $$<br />
<br />
where $f$ transforms transforms transmittance $T$ to true optical density for our device, and $g$ transforms true optical density of our device into the true optical density of the photospectrometer. This way our device is calibrated according to the photospectrometer.<br />
<br />
==== ''Pseudomonas putida'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida iFG.PNG|title=True Optical Density to Transmittance plot for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
==== ''Saccharomyces cerevisiae'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer iFG.PNG|title=True Optical Density to Transmittance plot for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
From these plots, it can be seen that our device delivers robust and reproducible results for both procaryotes and eucaryotes.<br />
Also the function from transmittance to true OD follows a clear pattern, making its calculation possible on a low-end device like a microcontroller.<br />
<br />
It is interesting to observer that function $g$, mapping the true OD of our device to the true OD of the photospectrometer, are close together for both ''P. putida'' and ''S. cerivisae'', as seen by the regression coefficient.<br />
In fact, 3.416 and 3.461 are such close together, that the minor deviation could be just measuring inaccuracy.<br />
Therefore, we fix the regression coefficient for converting true OD of our device to true OD of the photospectrometer to an average of 3.432 .<br />
<br />
Additionally the function $f$ for mapping transmittance to true OD for our device is similar for all cell types, as seen in the following figure. Therefore the exponential regression curve for all cell types specifies this function.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_ODallstrains1.png|title=Transmission of different cell types at OD-values from 0.001-1|subtitle=The transmittance data of NIH&nbsp;3T3 cells (mouse fibroblasts) align with the transmittance of ''P.&nbsp;putida'' and ''S.&nbsp;cerevisiae'' strains, even though the measured optical densities are lower by 1-2 orders of magnitude.|width=800px}}<br />
</center><br />
Finally, we have empirically determined our $OD(T)$ function by finding $f$ and $g$, such that we can convert true OD to the optical density of the photospectrometer.<br />
<br />
By this evaluation, we have shown that our self-build OD/F Device can compete with commercial systems.<br />
It is easy to calibrate by just calculating the true optical density.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_17-10-14_Glowing_cuvette-ipo.png|right|150px]]<br />
<br />
= Evaluation of the Fluorescence Measurement =<br />
<span class="anchor" id="f"></span><br />
<br />
For the evaluation of the fluorescence measurement, we performed a dilution series of a constitutively GFPmut3b expressing ''E. coli''.<br />
<br />
The below figure shows the absolute measurements for both the platereader and our OD/F Device. The abrupt jump at 50% concentration can be explained by a second dilution step and is prevalent in both devices.<br />
It can be seen that the platereader show a much higher difference between the GFP and non-GFP cell culture at a higher standard deviation.<br />
Another interesting metric is the difference between the GFP and non-GFP, which can be seen as the normalized fluorescence measure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachn 15-10-14 F platereader ODF iFG.PNG|title=Fluorescence Measurement comparison OD/F Device and Platereader (absolute values)|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F Device shows no significant linearity.|width=700px}}<br />
</center><br />
<br />
If one compares the results there, as in the below figure with normalized fluorescence values, interesting observations can be made.<br />
First, both platereader and OD/F Device show very similar results.<br />
The regression curves differ only in a linear factor.<br />
Most interestingly the general fit of the OD/F Device to a linear function seems to be better than the platereader.<br />
Overall the linearity which has been observed earlier (in testing the general setup) could be verified.<br />
Therefore our do-it-yourself OD/F Device can be used to determine fluorescence.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 F platereader ODF2 iFG.PNG|title=Fluorescence Measurement comparison OD/F Device and platereader using normalized fluorescence values|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F Device shows no significant. A non-GFP expressing ''E. coli'' dilution has been used to normalize the GFP dilution series. A linear correlation can be seen.|width=700px}}<br />
</center><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How to Build Your Own Device =<br />
<span class="anchor" id="diy"></span><br />
== Technical Components ==<br />
<br />
While the casing and the cuvette holder are custom made, most of the parts are pre-made and can be readily bought. The previous section lists all needed parts.<br />
To get all these parts for creating your own OD/F Device is easy using the internet. Thus all '''potential customers have a market access''' to the used components. <br />
<br />
Please find our custom parts for download below. Despite being custom parts, these are quite inenxpensive - so feel free to give our OD/F Device a test! For printing the 3D model of our cuvette holder and laser cutting our case, we want to express many thanks to [http://hci.rwth-aachen.de/fablab Fablab Aachen].<span class="anchor" id="ref2"></span><br />
<br />
* cuvette holder [https://2014.igem.org/Template:Team:Aachen/cuvette.stl?action=raw STL file]<br />
* casing single device [https://2014.igem.org/File:Aachen_ODF_device_casing.svg.zip SVG file]<br />
* lid combined device [https://2014.igem.org/File:Aachen_Odf_device_combined_lid.svg.zip SVG file]<br />
* Arduino Code for single device [https://2014.igem.org/Template:Team:Aachen/arduino_single.ino?action=raw Sketchbook (.ino)]<br />
* Arduino Code for combined device [https://2014.igem.org/Template:Team:Aachen/arduino_combined.ino?action=raw Sketchbook (.ino)]<br />
<br />
You will need a special [http://www.exp-tech.de/images/product_images/description%20images/YWRobot/1602/LiquidCrystal_I2C1602V2.rar library] for the display, which can not be uploaded for legal reasons.<br />
<br />
<br />
<center><br />
'''All needed components their quantities and prices for creating your own OD/F Device'''<br />
{| class="wikitable"<br />
! align="center" |'''OD/F Device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs [€] !! Costs [$] !! Final [€] !! Final [$] <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]||9.17||11.65||9.17||11.65 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/ams/TSL235R-LF/?qs=14HO7rLZPQsjmBHaoYCzkA%3D%3D TSL 235R]||2.47||3.14||2.47||3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356 Display 16x2]||2.58||3.28||2.58||3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]||1.57||1.99||1.57||1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]||2.90||3.69||2.90||3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]||1.57||2.00||1.57||2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]||0.09||0.11||1.80||2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]||1.98||2.51||1.98||2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893 power supply]||2.20||2.80||2.20||2.80<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)||7.98||10.14||7.98||10.14<br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913 Prototype Universal Printed Circuit Board]||2.27||2.88||2.27||2.88<br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191#.VEGRF2d_tGg Male Headers]||2.14||2.72||2.14||2.72<br />
|- style="border-top: 2px solid #808080;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600&nbsp;nm]||0.94||1.19||0.94||1.19<br />
|-<br />
! -!!Total OD!!-!!-!! 46.01 !! 58.45 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
! -!!Total F!!-!!-!! 46.06 !! 58.52 <br />
|- style="border-top: 2px solid #808080;;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]||0.94||1.19||0.94||1.19 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
! -!!Total OD/F!!-!!-!! 53.44 !! 67.89 <br />
|-<br />
|}<br />
</center><br />
<br />
For more detailed economical information about the OD/F project visit our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
== Breadboards ==<br />
<br />
=== Optical Density ===<br />
<br />
{{Team:Aachen/Figure|Aachen ODdevice Steckplatine.png|align=center|title=Breadboard of our OD device|subtitle=To build your own OD device, connect the parts as shown in this diagram.|width=900px}}<br />
<br />
If you want to build our OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#019 Fire 019]<br />
* LED: [http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== 600 nm] Dialight 550-2505F<br />
<br />
=== Fluorescence ===<br />
<br />
{{Team:Aachen/Figure|Aachen_Fdevice_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
If you want to build the OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#736 Twickenham Green 736]<br />
* LED: [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html 480 nm] NSPBR70BSS LED<br />
<br />
=== Combined Device ===<br />
Even though evaluation of the measurements have been performed in two separate device, it is fairly well possible to put everything into one casing.<br />
All you need to do is choosing another lid, and connect a second light to frequency sensor to your Arduino.<br />
Right at the bottom we present you the differences in wiring things up.<br />
Building the combined device is straight forward and very similar to the single device. You will need a slightly larger connector, a different lid for your case, and some more cables. The corresponding fritzing-layout is presented below.<br />
<br />
{{Team:Aachen/Figure|Aachen_ODF_combined_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
<br />
== Construction Steps ==<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_ODF_9.JPG|300px]] || First we want to assemble the casing. Once you have all the cut parts, you can start to assemble them. For cutting, we really recommend using a laser cutter.<br />
|-<br />
| [[File:Aachen_ODF_8.JPG|300px]] || Attach the cuvette-holder holders such that the cuvette holder is placed directly under the opening hole.<br />
|-<br />
| [[File:Aachen_ODF_4.JPG|300px]] || Next build the lid of the device. At this stage you can already mount the button. We recommend to glue any parts.<br />
|-<br />
| [[File:Aachen_ODF_3.JPG|300px]] || Your lid finally should look like this.<br />
|-<br />
| [[File:Aachen_ODF_11.JPG|150px]][[File:Aachen_ODF_10.JPG|150px]] || Next we want to assemble the cuvette holders. On the side with the square hole attach the light-to-frequency sensor with glue. For the OD case place the orange LED opposite, or for fluorescence, the LED in the hole in the bottom. Make sure to close any remaining open hole! Please attach a piece of filter foil (approx. $7 \times 7 mm^2$) from the inside in front of the light to frequency converter. Forceps is highly recommended.<br />
|-<br />
| [[File:Aachen_ODF_12.JPG|300px]] || Your final assembly should then look like this. Now place the correct filter into the cuvette holder, directly in front of the sensor. Make sure that the filter does not degrade due to the glue!<br />
|-<br />
| [[File:Aachen_ODF_14.JPG|300px]] || As the case can be used for both, fluorescence and OD measurement, we use a combined plug. Just three header rows (7 pins, 9pins for combined) and connect them as we did.<br />
|-<br />
| [[File:Aachen_ODF_1.JPG|300px]] || Now we're doing the wiring. Connect the Arduino 5V and GND such that you have one 5V and one GND line on your breadboard.<br />
|-<br />
| [[File:Aachen_ODF_2.JPG|300px]] || Then connect the button to 5V on the one side, and to GND via a resistor on the other side. Connect this side also to port __ on your Arduino. This will sense the blank. Next connect the display to the Arduino and our connector. See the Fritzing diagram at the bottom for a detailed information.<br />
|-<br />
| [[File:Aachen_ODF_13.JPG|300px]] || Now put everything into the case and ...<br />
|-<br />
| [[File:Aachen_ODF_6.JPG|300px]] || ... also place the cuvette holder into the device. Attach the display to the device lid and close the casing.<br />
|-<br />
| [[File:Aachen_ODF_7.JPG|300px]] || Congratulations! You have finished constructing your own OD/F Device!<br />
|-<br />
| [[File:Aachen_zwei_Kuevetten.jpg|300px]] || ... or even the combined device!<br />
|}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
Lawrence, J. V., & Maier, S. (1977). Correction for the inherent error in optical density readings. Applied and Environmental Microbiology, 33(2), 482–484. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=170707&tool=pmcentrez&rendertype=abstract.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/PolicyPractices/EconomicsTeam:Aachen/PolicyPractices/Economics2014-10-17T21:59:33Z<p>StefanReinhold: /* OD/F Device */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
[[File:Aachen_open_access.png|right|300px]]<br />
<br />
= Economical View =<br />
The economical considerations regarding our project were carried out according to the motto: <br />
<br />
'''Make the world a better place - Open access for scientific progress'''<br />
<br />
In the center of every economic analysis are the customers and their needs and desires. Every commercial company is interested in satisfying and dealing with all customer needs for better sales figures, in order to maintain regular clientele. Both measures aim for '''higher financial profits'''. On the global seller’s market of technical laboratory equipment there is a permanent competition between the existing providers. On the one hand, this competition depends on the mentioned financial profits and, on the other hand, on the following factors: technical improvement followed by price wars. Due to globalization products from the Asian market are increasingly competing with the American and European market resulting in intensitief price wars. On the Asian market personnel and production costs are much less and thus the same product can be sold with higher profits. Some of these products are less expensive but are often of lower quality, too. However, for a company it is important to chose a good '''price-performance ratio''' because this factor always catch customers and influence their purchase decision. <br />
<center><br />
{{Team:Aachen/FigureFloat|TeamAachen DiagrammThermoScientific.png|title=Costs and operating expenses for companies producing technical laboratory equipment|subtitle=(Thermo Fisher Scientific, 2013)|width=600px}}<br />
</center><br />
Take a look at cost calculations for technical laboratory equipment including development, production, transport, warehousing and sale. Usually, you will find that in this branche there are really low costs for research and development, restruction and amorthilisation. In contrast, general expenses and costs for administartion, revenues, and sales are high. Lastly, financial profit is a big cost point cause businesses have to be self-financing. In general, these factors are making '''technical equipment for labs really expensive''', and therefore unaffordable for low-budget instutions. <br />
<br />
One of the world's biggest producers of laboratory products is [http://www.thermofisher.com/en/home.html Thermo Fisher Scientific]. They also offer photometers and other equipment. The image on the left side shows all costs and operating expenses listed in the [http://ir.thermofisher.com/investors/financial-information/annual-reports/default.aspx Annual Report 2013] from Thermo Fisher Scientific.<br />
<br />
<br />
We follow a strategy to circumvent unnecessary costs for customers by realizing a '''social vision'''. In accordance with the '''principle of open source''' including both open hardware and open software, information where to get the necessary components, quantities, step-by-step technical construction manuals and circuit diagrams are '''published online for free'''. Potential customers can follow our provided instructions and acquire information from our [https://2014.igem.org/Team:Aachen/Notebook/Engineering Engineering page]. Therefore, our profit is not of financial nature but is instead based on recognition and on motivating other iGEM teams and companies to '''spread the idea of open hardware''', too. In accordance with the motto "Do It Yourself!" (DIY) we offer low-budget versions through reducing costs at as many points as possible, except for the basic costs for material. Customers with a little technical dexterity, motivation to try something new and who are keen to experiment can follow our step-by-step construction manual to create their own custom-made devices. <br />
<center><br />
{{Team:Aachen/Figure|Aachen Social Vision.png|title=Social vision as economical strategy for creating access to low-budget technical equipment.|width=800px}}<br />
</center><br />
To make our product more user-friendly, we '''considered offering device kits'''. When offering kits customers do not have to order a lot of separate device parts from different suppliers. However, this introduces the disadvantage of a '''loss of flexibility'''. Yet it is very important to have the '''opportunity to modify''' the devices, for example, by choosing alternative parts or including add-ons, because research requiring novel techniques advances quickly in the natural sciences. With our concept, improvements and adjustments are thus immediately realizable.<br />
<br />
Lastly, we want to mention that our vision is limited because it is incompatible with capitalism which rules the global market. Generally, companies are profit oriented and follow a different economical strategy than our iGEM team. As '''non-profit concept''', our idea is therefore limited to a group of customers with lower budgets. <br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== ''WatsOn'' ==<br />
<span class="anchor" id="economicswatson"></span><br />
<br />
The measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] for our [https://2014.igem.org/Team:Aachen/Project/2D_Biosensor 2D biosensor] has been designed according to our social vision. So far, we have not found comparable devices on the market. Here, we definitely take a pioneer role. Following our DIY concept, you can create your own ''WatsOn'' for '''just $310''' using the given [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn construction manual]. All components for putting a ''WatsOn'' together are easily available all over the world using the following links.<br />
<center><br />
'''All needed components, their quantities and prices for creating your own ''WatsOn'''''<br />
{| class="wikitable sortable"<br />
! align="center" |'''''WatsOn'''''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|- class="unsortable"<br />
!Quantity !! Component !! Costs [€]!! Costs [$]!! Final [€]!! Final [$]<br />
|-<br />
| 1|| [http://www.prolighting.de/Zubehoer/Farbfilter/Lee-Filter_HT/Lee-Filters_Musterheft_Designer_Edition_i174_3965_0.htm filter slides] (medium yellow 010, sally green 505)||1.57||2.00||1.57||2.00<br />
|-<br />
| 1|| [http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600 arduino UNO R3]||9.17||11.65||9.17||11.65<br />
|-<br />
| 1|| [http://www.dx.com/p/arduino-2-channel-relay-shield-module-red-144140 2-channel relay shield]||2.72||3.46||2.72||3.46<br />
|-<br />
| 40||jumper-wire cable||2.35||2.99||2.35||2.99<br />
|-<br />
| 1|| [http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191 40er male header (10-Piece Pack)]||2.14||2.72||2.14||2.72<br />
|-<br />
| 1|| [http://www.dx.com/p/jtron-2-54mm-40-pin-single-row-seat-single-row-female-header-black-10-pcs-278953 40er female header (10-Piece Pack)]||2.05||2.60||2.05||2.60<br />
|-<br />
| 1|| [http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-brown-5-piece-pack-130926 circuit board]||2.35||2.99||2.35||2.99<br />
|-<br />
| 1|| [http://www.newark.com/pro-signal/rp006/audio-video-cable-hdmi-1m-black/dp/96T7446 HDMI cable]||1.47||1.87||1.47||1.87<br />
|-<br />
| 1|| [http://www.dx.com/p/hd-053-high-speed-usb-2-0-7-port-hub-black-174817 7 port USB hub]||5.28||6.71||5.28||6.71<br />
|-<br />
| 1||[http://www.dx.com/p/dx-original-ultra-mini-usb-2-0-802-11n-b-g-150mbps-wi-fi-wlan-wireless-network-adapter-black-252716 USB WiFi stick]||4.21||5.35||4.21||5.35<br />
|-<br />
| 1||USB mouse and keyboard||9.84||12.50||9.84||12.50<br />
|-<br />
| 1|| [http://corporate.evonik.com/en/products/pages/default.aspx case acrylic glass XT 6mm~0.5<sup>2</sup>]||39.88||50.65||39.88||50.65<br />
|-<br />
| 1||spray paint for acrylic glass||5.15||6.54||5.15||6.54<br />
|-<br />
| 1|| [http://www.newark.com/raspberry-pi/raspberry-modb-512m/raspberry-pi-model-b-board/dp/68X0155 Raspberry Pi model B board]||27.56||35.00||27.56||35.00<br />
|-<br />
| 1||[http://www.newark.com/raspberry-pi/rpi-camera-board/add-on-brd-camera-module-raspberry/dp/69W0689 Raspberry Pi camera module]||19.69||25.00||19.69||25.00<br />
|-<br />
| 1||[http://www.pollin.de/shop/dt/NzUwOTc4OTk-/ 7” display]||39.35||49.97||39.35||49.97<br />
|-<br />
| 1||[http://www.dx.com/p/diy8-x-seven-segment-displays-module-for-arduino-595-driver-250813 8-segment display]||3.04||3.86||3.04||3.86<br />
|-11.81<br />
| 2|| [http://www.dx.com/p/arduino-dht11-digital-temperature-humidity-sensor-138531 digital temperature sensor DHT-22]||5.91||7.50||11.82||15.00<br />
|-<br />
| 1 ||aluminum block 100x100x15&nbsp;mm||11.20||14.23||11.20||14.23<br />
|-<br />
| 1|| [http://www.dx.com/p/tec1-12706-semiconductor-thermoelectric-cooler-peltier-white-157283 Peltier heater 12V 60W]||3.54||4.49||3.54||4.49<br />
|-<br />
| 1||power supply||25.90||32.89||25.90||32.89<br />
|-<br />
| 6|| [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html superflux LED 480&nbsp;nm]||0.99||1.26||5.94||7.54<br />
|-<br />
| 16||LED 450&nbsp;nm||0.37||0.47||5.94||7.54<br />
|-<br />
| 2|| Resistor 40&nbsp;Ohm||0.12||0.15||0.24||0.30<br />
|-<br />
| 4|| Resistor 100&nbsp;Ohm||0.12||0.15||0.48||0.60<br />
|-<br />
| 1||cupboard button||0.98||1.24||0.98||1.24<br />
|- class="sortbottom" style="background:#cfe2f4; border-top:2px #808080 solid; font-weight:bold"<br />
| -||Total||-||-||243.88||309.70<br />
|}<br />
</center><br />
<br />
Such low prices in combination with the DIY concept opens a grand new customer market and lets our device '''compete with commercially available products'''. Especially in developing counties our ''WatsOn'' could help improve health infrastructure since high cost are eliminated as an obstacle. The low material costs and the high technical flexibility turn ''WatsOn'' into an adequate device for developing countries, community labs and the biohacking scene. Particularly for developing countries, such a low-budget device poses a '''good alternative to regular devices''' for detecting pathogens and other bacteria. With our device, we create access to modern technology and working methods for everybody.<br />
<center><br />
{{Team:Aachen/Figure|Aachen_Team_WatsOn_3.png|title=''WatsOn's'' self-made concept makes it available for low budged institutions|width=800px}}<br />
</center><br />
For ''WatsOn'', we offer both the construction manual and the image processing software ''Measurarty''. Since we do not offer everything in one kit, it is possible for the user to modify the device and software according to personal needs such as '''adjusting the range od detectable microorganisms'''. By engineering the ''Cellocks'' detection of other pathogens is theoretically possible. However, please always mind the respective [https://2014.igem.org/Team:Aachen/Safety safety aspects] when dealing with GMOs and human pathogens. Moverover, it is possible to detect not just the fluorescence of GFP and iLOV. Just by changing the filters and/or LEDs, the device can be modified such that the fluorescence '''other regularly used reporter proteins like YFP, CFP or RFP can be detected'''. <br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== OD/F Device ==<br />
<span class="anchor" id="economicsodf"></span><br />
<br />
One of our greater visions we share with the synthetic biology community is that everyone interested in biological work should have access to basic laboratory equipment. With our OD/F Device, we '''offer a low-cost solution for community labs, biohackers and high schools'''. <br />
<br />
<center><br />
{{Team:Aachen/FigureFloat|Netdiagramm_ODF_Device.png|title= Advantages and disadvantes of our OD/F Device compared to commercially available devices|subtitle=We compared the devices in portability, affordability, reliability, user-friendliness, capabilities, precision and accuracy.|width=400px}}<br />
</center><br />
<br />
For an economic analysis, we deal with F Device and the OD Device separately. The reason for this is the bad comparability to commercial devices. Latter do not combine the measurument of fluorescence and OD while being in the same product class of small, portable devices. With our OD/F Device, we offer a '''solution to combine both measurement methods in one mobile device'''. With the instructions provided by us it possible to either build an OD Device or an F Device or an OD/F Device. We are offering a high degree of flexibility by enabling the user to modify our device according to own ideas and wishes. <br />
<br />
Both portability and low cost are two out of several factors that we heavily place importance on. Commercially obtainable spectrophotometers like [http://www.opticsplanet.com/unico-model-s-1205-spectrophotometer-5-nm-bandpass.html UNICO S-1205], for example, cost $1.250 or more, and can measure optical density only. On top of that, they are heavy, hardly portable and therefore not easy to handle. However, they are able to work with a broader range of wavelengths and show higher accuracy and precision. For measuring fluorescence, devices such as [http://www.moleculardevices.com/systems/microplate-readers/fluorescent-readers/gemini-xps plate readers] are available. Yet comparing a commercial device with our F Device is really difficult because we could not find one that is both portable and able to measure at 480&nbsp;nm.<br />
<br />
To compare our device to another commercially availalbe system we chose the OD-meter [http://www.laboratory-equipment.com/laboratory-equipment/cell-density-meter.php CO 8000]. This device measures the OD at 600&nbsp;nm, too, but costs almost $920. Our [https://2014.igem.org/Team:Aachen/OD/F_device OD/F Device] can measure OD as well as fluorescence for less than [https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy $60] as shown in the chart on the left. The '''cost savings''' here are round about '''$850''', money that could definetly be invested into other research projects or equipment instead. Nonetheless, one weakness of our device is the low reliability compared to commercial devices. This is due to use of low cost materials. Prices are given in both Euro and US-Dollar for better accountability and easy conversion.<br />
<br />
<center><br />
'''All needed components their quantities and prices for creating your own OD/F device'''<br />
{| class="wikitable"<br />
! align="center" |'''OD/F device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs [€] !! Costs [$] !! Final [€] !! Final [$] <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]||9.17||11.65||9.17||11.65 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/ams/TSL235R-LF/?qs=14HO7rLZPQsjmBHaoYCzkA%3D%3D TSL 235R]||2.47||3.14||2.47||3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356 Display 16x2]||2.58||3.28||2.58||3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]||1.57||1.99||1.57||1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]||2.90||3.69||2.90||3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]||1.57||2.00||1.57||2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]||0.09||0.11||1.80||2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]||1.98||2.51||1.98||2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893 power supply]||2.20||2.80||2.20||2.80<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)||7.98||10.14||7.98||10.14<br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913 Prototype Universal Printed Circuit Board]||2.27||2.88||2.27||2.88<br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191#.VEGRF2d_tGg Male Headers]||2.14||2.72||2.14||2.72<br />
|- style="border-top: 2px solid #808080;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600&nbsp;nm]||0.94||1.19||0.94||1.19<br />
|-<br />
! -!!Total OD!!-!!-!! 46.01 !! 58.45 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
! -!!Total F!!-!!-!! 46.06 !! 58.52 <br />
|- style="border-top: 2px solid #808080;;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]||0.94||1.19||0.94||1.19 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
! -!!Total OD/F!!-!!-!! 53.44 !! 67.89 <br />
|-<br />
|}<br />
</center><br />
<br />
To build your own OD/F Device, all you have to do is order the required parts listed above, invest some time and have a little technical dexterity. This DIY aspect could also have a positive learning effect, for example, for students in schools, universities and other educational institutions. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Team_Aachen_OD F device.png|title= Possible application of our OD/F device|width=800px}}<br />
</center><br />
<br />
In our cooperations with the [https://2014.igem.org/Team:Aachen/Collaborations/Kaiser-Karls-Gymnasium Kaiser-Karls-Gymnasium] and with [https://2014.igem.org/Team:Aachen/Collaborations/Neanderlab NEAnderLab], one of our target groups '''already gathered first experience''' using our OD/F Device. This proves that our device is suitable for school everday life. When working with the schools, we got a lot of positive feedback from the instructors as well as the students.<br />
<br />
In summary, in our OD/F Device, we see a piece of equipment to measure OD and fluorescence, two quantities regularly used in biology, that is open source and perfectly fit for low-budget instutions such as schools, universities, community labs and the biohacking scene.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
==References==<br />
<br />
Annual report. (2013). Thermo Fisher Scientific. Available at http://ir.thermofisher.com/investors/financial-information/annual-reports/default.aspx.<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Project/FRET_ReporterTeam:Aachen/Project/FRET Reporter2014-10-17T21:46:21Z<p>StefanReinhold: /* Characterization of GFP-REACh1 and GFP-REACh2 fusion proteins in combination with an IPTG-inducible TEV Protease */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
=The modified REACh Construct=<br />
<br />
On this page, we present our biosensor on the molecular level. Explore the different parts of our genetic device:<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid" style="width:inherit;"><br />
<!-- Overview --><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#fluorescence" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">A Faster Answer</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0b/Aachen_14-10-13_GFP_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#fret" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">The FRET System</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/5/54/Aachen_14-10-13_FRET_Arrows_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#darkquencher" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">REACh Quenchers</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/65/Aachen_14-10-13_REACh_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#gfp-reach" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">The Fusion Protein</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/0/02/Aachen_14-10-13_Fusion_Protein_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
</ul><br />
</center><br />
</html><br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid" style="width:516px;"><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#tevprotease" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">TEV Protease</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/dc/Aachen_14-10-13_TEV_Protease_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#reachachievements" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Achieve-<br/>ments</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#reachoutlook" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Outlook</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_GFP_iNB.png|150px|right]]<br />
<br />
= A Fluorescence Answer Faster than Expression =<br />
<span class="anchor" id="fluorescence"></span><br />
<br />
Biosensors often work with a system that comprises a reported gene under the control of a promoter directly induced by the chemical that the sensor is supposed to detect. In the case of our 2D biosensor for ''Pseudomonas&nbsp;aeruginosa'', the expression of our reporter gene, GFP, would be directly induced by the activity of the bacterium's quorum sensing molecules. However, transcription, translation, folding and post-translational modifications take their time. Since our goal is to detect the pathogen as fast as possible, we wanted to use a system that gives a fluorescent answer faster than just expressing the fluorescent protein.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_Traditional_biosensor.png|align=center|title=Schematic model of a traditional biosensor|subtitle=In this model, the expression of GFP is directly controlled by a promoter whose activator binds to a molecule secreted by the pathogen.|width=500px}}<br />
</center><br />
<br />
As an alternative to the traditional approach, we '''constitutively express our reporter gene in a quenched form'''. in the GFP-REACh fusion protein fluorescence is suppressed. Our biosensor gives a response when homoserine lactones of ''P.&nbsp;aeruginosa'' are taken up by our sensor cells where the '''autoinducer activates the expression of the TEV protease''' by binding to the LasI promoter in front of the protease gene.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_REACh_approach.png|align=center|title=Schematic model of our novel biosensor|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elicit a fluorescence response.|width=900px}}<br />
</center><br />
<br />
Advantages of the novel biosensor:<br />
<br />
* When ''P.&nbsp;aeruginosa'' is detected by our cells, the reporter protein has already been expressed and only waits to be cleaved off the REACh quencher. The cleavage reaction catalyzed by the TEV protease is a faster process than expression and correct folding of GFP. This way we hope for '''an earlier response''' by our sensor cells.<br />
<br />
* While a certain concentration of homoserine lactone will produce the same number of gene read-outs, one TEV protease can cleave many GFP-REACh constructs. Through the cleavage step, we introduce an '''amplification step''' into our system. With the TEV protease, we will be able to produce '''a much stronger signal''' in a short time interval.<br />
<br />
In order to comfirm our hypothesis we built a [https://2014.igem.org/Team:Aachen/Project/Model model] of the biosensor showing our system to respond faster than a conventional biosensor.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_FRET_Arrows_iNB.png|150px|right]]<br />
<br />
=The FRET (Förster Resonance Energy Transfer) System=<br />
<span class="anchor" id="fret"></span><br />
<br />
Förster resonance energy transfer (FRET), sometimes also called fluorescence resonance energy transfer, is a physical process of energy transfer. In FRET, the energy of a donor chromophore, whose electrons are in an excited state, is passed to a second chromophore, the acceptor. The '''energy is transferred without radiation''' and is therefore not exchanged via emission and absorption of photons. The acceptor then releases the energy received from the donor, for example, as light of a longer wavelength. <br />
<br />
In biochemistry and cell biology, fluorescent dyes, which interact via FRET, are applied as "optical nano metering rules", because the intensity of the transfer is dependent on the spacing between donor and acceptor, and can be observed over distances of up to 10&nbsp;nm. This way, protein-protein interactions and conformational changes of a variety of tagged biomolecules can be observed. For an efficient FRET to occur, there must be a substantial overlap between the donor fluorescence emission spectrum and the acceptor fluorescence excitation (or absorption) spectrum ([http://www.nature.com/nprot/journal/v8/n2/full/nprot.2012.147.html Broussard et al., 2013]), as described in the figure below.<br />
<br />
{{Team:Aachen/Figure|Aachen_14-10-07_Jablonski_Diagram_and_Absorption_Spectra_iNB.png|align=center|title=FRET betweeen donor and acceptor|subtitle=On the left: Jablonski diagram showing the transfer of energy between donor and acceptor; on the right: For successful FRET, the emission spectrum of of the donor has to overlap with the absorption spectrum of the acceptor.|width=900px}}<br />
<br />
However, '''fluorescence is not an essential requirement for FRET'''. This type of energy transfer can also be observed between donors that are capable of other forms of radiation, such as phosphorescence, bioluminescence or chemiluminescence, and fit acceptors. Acceptor chromophores do not necessarily emit the energy in form of light, and can lead to quenching instead. Thus, this kind of acceptors are also referred to as '''dark quenchers'''. In our project, we use a FRET system with a dark quencher, namely our '''REACh construct'''.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_REACh_iNB.png|150px|right]]<br />
<br />
=REACh Proteins - Dark Quenchers of GFP=<br />
<span class="anchor" id="darkquencher"></span><br />
<br />
<center><br />
{{Team:Aachen/FigureFloat|Aachen_K1319000.gif|align=center|title=Homology model of REACh.|subtitle=This homology model was created with SWISS-MODEL. We used Chimera to prepare and export a scene that was then rendered into an animation with POV-Ray.|width=256px}}<br />
</center><br />
<br />
In 2006, [http://www.pnas.org/content/103/11/4089.full Ganesan et al.] were the first to present a previously undescribed FRET acceptor, a non-fluorescent yellow fluorescent protein (YFP) mutant called '''REACh (for Resonance Energy-Accepting Chromoprotein)'''. YFP can be used as a FRET acceptor in combination with GFP as the donor in FRET microscopy and miscellaneous assays in molecular biology. The ideal FRET couple should possess a large spectral overlap between donor emission and acceptor absorption - as illustrated in previous section - but have separated emission spectra to allow their selective imaging.<br />
<br />
To optimize the spectral overlap of this FRET pair, the group obtained '''a genetically modified YFP acceptor'''. Mutations of amino acid residues that stabilize the excited state of the chromophore in enhanced YFP (EYFP) resulted in a non-fluorescent chromoprotein. Two mutations, H148V and Y145W, reduced the fluorescence emission by 82 and 98%, respectively. Ganesan et al. chose the Y145W mutant and the Y145W/H148V double mutant as FRET acceptors, and named them REACh1 and REACh2, respectively. '''Both REACh1 and REACh2 act as dark quenchers of GFP'''.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Fusion_Protein_iNB.png|150px|right]]<br />
<br />
=Producing a GFP-REACh Fusion Protein=<br />
<span class="anchor" id="gfp-reach"></span><br />
<br />
In our project, we reproduced the REACh1 and REACh2 proteins by subjecting an RFC-25 compatible version of the BioBrick [http://parts.igem.org/Part:BBa_E0030 E0030] (EYFP) to a '''QuikChange mutation''', creating the BioBricks [http://parts.igem.org/Part:BBa_K1319001 K1319001] and [http://parts.igem.org/Part:BBa_K1319002 K1319002]. Subsequently, we fused each REACh protein with '''GFP (mut3b)''' which is available as BioBrick [http://parts.igem.org/Part:BBa_E0040 E0040]. The protein complex was linked via a '''protease cleavage site''', [http://parts.igem.org/Part:BBa_K1319016 K1319016]. As constitutive promoter we use [http://parts.igem.org/Part:BBa_J23101 J232101]. When GFP is connected to either REACh quencher, GFP will absorb light but the energy will be transferred to REACh via FRET and is then emitted in the form of heat; the fluorescence is quenched. Our cells also constitutively express the '''[http://parts.igem.org/Part:BBa_C0179 LasR] activator'''. Together with the HSL molecules from ''P. aeruginosa'', LasR binds to the '''[http://parts.igem.org/Part:BBa_J64010 LasI] promoter''' that controls the expression of the TEV protease, which we make available as [http://parts.igem.org/Part:BBa_K1319004 K1319004]. When the fusion protein is cleaved by the TEV protease, REACh will be separated from GFP. The latter will then be able to absorb and emit light as usual.<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen_14-10-08_REACh_approach_with_BioBricks_iNB.png|title= Composition of our biosensor|subtitle=For our biosensor, we use a mix of already available and self-constructed BioBricks.|width=900px}}<br />
<br />
The resulting fusion proteins were labelled as [http://parts.igem.org/Part:BBa_K1319013 K1319013] (GFP fused with REACh1) and [http://parts.igem.org/Part:BBa_K1319014 K1319014] (GFP fused with REACh 2) and the linker between the proteins is labelled as [http://parts.igem.org/Part:BBa_K1319016 K1319016].<br />
<br />
Since we did not have enough time to built the complete system we tested our system with an IPTG inducible TEV protease ([http://parts.igem.org/Part:BBa_K1319008 K1319008]). In this way we were able to establish a proof of concept of our reporter system including proper expression of the TEV protease as well as functionality of our GFP-REACh construct.<br />
<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 14-10-17 IPTG REACh iFG.png|title= Composition of our biosensor for IPTG|subtitle=To test the funtionality of our sensor concept, we expressed the TEV protease with a T7 promoter.|width=900px}}<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_TEV_Protease_iNB.png|150px|right]]<br />
<br />
=Cutting the Fusion Protein with the TEV Protease=<br />
<span class="anchor" id="tevprotease"></span><br />
<br />
To cut the GFP-REACh fusion protein off, we chose '''Tobacco Etch Virus (TEV) protease''', a highly sequence-specific cysteine protease, that is frequently used for the controlled cleavage of fusion proteins ''in vitro'' and ''in vivo''. The native protease also contains an internal self-cleavage site. This site is slowly cleaved to inactivate the enzyme. The physiological reason for the self-cleavage is unknown, however, undesired for our use. Therefore, our team uses a variant of the native TEV protease containing the mutation S219V which results in an alteration of the cleavage site so that self-inactivation is diminished.<br />
<br />
{{Team:Aachen/Figure|Aachen_TEV_Protease_Model.png|title=TEV protease with a bound peptide|subtitle=This picture shows the TEV protease with a peptide chain bound in the binding pocket ready to be cleaved. The bound peptide chain has the recognition sequence inside the binding pocket. It was rendered with POV-Ray.|width=800px}}<br />
<br />
Though quite popular in molecular biology, the TEV protease is not avaiable as a BioBrick yet. Hence, the Aachen team introduces a protease with anti-self cleavage mutation S219V and codon optimized for ''E. coli'' [http://parts.igem.org/Part:BBa_K1319004 '''to the Parts Registry this year.''']<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
== Achievements ==<br />
<span class="anchor" id="reachachievements"></span> <br />
<br />
===Characterization of GFP-REACh1 and GFP-REACh2 fusion proteins in combination with an IPTG-inducible TEV Protease===<br />
<br />
The characterization of the TEV protease and the REACh1 and REACh2 dark quenchers was performed by introducing both simultaneously into ''E.&nbsp;coli'' Bl21 (DE3). The resulting double plasmid cells therefore contained [http://parts.igem.org/Part:BBa_K1319013 K1319013] (GFP-REACh1 fusion protein) or [http://parts.igem.org/Part:BBa_K1319014 K1319014] (GFP-REACh2 fusion protein) and [http://parts.igem.org/Part:BBa_K1319008 K1319008] (IPTG-inducible TEV protease). K1319013 and K1319014 were located on a pSB3K3 plasmid backbone and K1319008 on a pSB1C3 backbone, two standard iGEM plasmids with different oris allowing simultaneous use in one cell. <br />
<br />
[http://parts.igem.org/Part:BBa_I20260 I20260] was used as a positive control because I20260 contains the same promoter ([http://parts.igem.org/Part:BBa_J23101 J23101]), the same RBS ([http://parts.igem.org/Part:BBa_B0032 B0032]) and the same version of GFP ([http://parts.igem.org/Part:BBa_E0040 E0040]) and is located on the same plasmid backbone pSB3K3. Therefore, it is expected that when all fusion proteins are successfully cut by the TEV protease, the fluorescence level of the double plasmid constructs reaches the same level as the positive control of I20260. As a negative control [http://parts.igem.org/Part:BBa_B0015 B0015] was used, a coding sequence of a terminator which should not show any sign of fluorescence.<br />
<br />
To characterize our REACh1/2 constructs in combination with the TEV protease a growth experiment was conducted. Both of the double plasmid constructs, a constitutive expression of GFP (I20260) as positive control and B0015 as negative control were compared. For each expression IPTG-induced and uninduced cultures were grown in parallel. All measurements were done in a biological triplicate. <br />
<br />
To better evaluate the fluorescence, the observed Optical desity (OD) was taken into account in order to achieve a fluorescence measurement independent of the amount of cells present. This way, the measurement represents the amount of fluorescence per cell only. <br />
<br />
{{Team:Aachen/Figure|Aachen 16-10-14 Graph2iFG.PNG|title=Comparison of K1319013 + K1319008, K1319014 + K1319008, I20260 (positive control) and B0015 (negative control)|subtitle=Both double plasmid construct exhibit a clear fluorescence signal when induced.|width=900px}}<br />
<br />
The negative control B0015 did not exhibit any significant fluorescence. The positive control I20260 showed a steady level of fluorescence as expected due to the constitutive expression of GFP. As expected, the production is also independent of addition of IPTG therefore the triplicates have been merged together.<br />
<br />
Both double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008 did not exhibit a strong fluorescence before induction with IPTG. In the uninduced state, the fluorescence stays low and does not increase over time. It is significantly weaker than the fluorescence reached by the induced constructs or the positive control but was higher than the negative control. The higher base level of fluorescence in the not induced constructs is due to the imperfect quenching and the leakiness of the IPTG inducible promoter. <br />
<br />
The induced double plasmid constructs exhibited a fast rise in fluorescence after induction. '''The signal strenght increased ~ 10-fold over the uninduced constructs.''' K1319014 + K1319008 reached the the same level of fluorescence as I20260, indicating a complete cleavage of the fusion proteins by the TEV protease. K1319013 + K1319008 did not reach a level of fluorescence as high as K1319013 + K1319008, however, the nearly 10-fold increase in fluorescence after induction is a clear indicator for the TEV protease cutting the fusion protein K1319013. The weaker fluorescence signal is probably due to a lower expression level of K1319013 in the cells compared to the expression level of K1319014. <br />
<br />
The fluorescence results of K1319014 + K1319008 was used to fit our [https://2014.igem.org/Team:Aachen/Project/Model model] to experimental data.<br />
<br />
====Summary====<br />
<br />
The double plasmid systems of K1319013 + K1319008 and K1319014 + K1319008 demonstrate the quenching ability of the REACh1 and REACh2 proteins as well as the funcionality of the TEV protease.<br />
The increase in fluorescence after induction with IPTG is based on a functional expression of the TEV protease which proceeds to cut the linker of the fusion protein already produced destroying the FRET system between GFP and its quencher and resulting in a strong fluorescence signal. Combined, this characterization is a '''validation of the functionality of the REACh1 protein ([http://parts.igem.org/Part:BBa_K1319001 K1319001]), the REACh2 protein ([http://parts.igem.org/Part:BBa_K1319002 K1319002]) and the TEV protease ([http://parts.igem.org/Part:BBa_K1319004 K1319004])'''.<br />
<br />
===Determining the Quenching ability of REACh 1 and REACh 2===<br />
<br />
In order to further evaluate the quenching ability of the REACh 1 and REACh 2 constructs in the fusion proteins produced by K1319013 and K1319014, they were expressed alone without an IPTG inducible TEV protease. This eliminated the effect of a potential leakiness of the non induced promoter to reliably assess the quenching ability of the REACh 1 and REACh 2 proteins. <br />
<br />
{{Team:Aachen/Figure|Aachen_K1319001_and_K1319002.PNG|title=Comparison of K1319013 and K1319014 with I20260 and B0015|subtitle=K1319013 and K1319014 show a severely reduced fluorescence compared to the positive control I20260.|width=900px}}<br />
<br />
In the previous experiment it was established that the fusion proteins K1319013 and K1319014 are expressed funtionally. K1319014 reached the same level of fluorescence as the positive control after being cut by the TEV protease. Therefore the reduced fluorescence in this experiment is completely attributable to the quenching of REACh 1. The quenching reduces the fluorescence of GFP by a factor ~ 25 which means a '''quenching efficiency of ~ 96%!'''. <br />
<br />
K139013 was not able to reach the same fluorescence level as the positive control in the previous experiment. Therefore a worse rate of functional expression of K1319013 compared to K1319014 is assumed. incorporating this, the difference in fluorescence between induced and not induced is still a factor of ~ 30 resulting in a '''quenching efficiency of ~ 97%'''.<br />
<br />
====Summary ====<br />
<br />
The fusion proteins of GFP combined with REACh 1 and REACh 2 are not only fully functional but exhibit a great quenching efficiency of ~ 97% for REACh 1 and ~ 96% for REACh 2.Even though REACh 1s quenching ability seems to be slighty superior, the expression level of the K1319014 fusion protein including REACh 2 is nearly twice as high as the fusion protein K1319013 containing REACh 1 and therefore shows a stronger fluorescence. Ganesan et al. (2006) reported a reduction on emission of GFP of 82% for REACh 1 and 98% for REACh 2 but with a different Linker between the proteins and on a different vector backbone.<br />
<br />
===Comparing fluorescence kinetics of the GFP-REACh fusion proteins with a Standard lacI-inducible GFP Expression===<br />
<br />
To assess the kinetics of the fusion proteins K1319013 (GFP-REACh1) and K1319014 (GFP-REACh2), the double plasmid systems K1319013 + K1319008 and K1319014 + K1319008 were compared to a standard expression of GFP under the control of a lacI promoter in [http://parts.igem.org/Part:BBa_K731520 K731520], a BioBrick made by the iGEM Team TRENTO in 2012. This tested the hypothesis of achieving a faster fluorescence response with the GFP-REACh fusion proteins compared to a standard expression.<br />
<br />
K731520 and the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008 were cultivated in ''E. coli'' BL21(DE3), and fluorescence and OD was measured.The fluorescence was adjusted for the OD to show a relative fluorescence on a per cell basis. The difference between the induced and uninduced state, the fluorescence quotient, serves as a better indicator for a system used as a sensor because the difference between an ''on'' and ''off'' state is more important for a clear and unmistakable signal than the overall fluorescence. Hence, the OD-adjusted fluorescence quotient for both double plasmid constructs and K731520 was obtained and plotted in the following graph.<br />
<br />
{{Team:Aachen/Figure|Aachen_16-10-14_GraphQuotient_iFG.PNG|Comparison of K1319013 + K1319008, K1319014 + K1319008 and K731520|subtitle=Fluorescence was normalized by dividing by the optical density. The fluorescence of induced cells was additionally divided by the fluorescence of uninduced cells to obtain the fluorescence quotient.|width=700px}}<br />
<br />
The graph clearly shows the faster response of the cut GFP-REACh fusion protein compared to a standard GFP expression. Both fluorescence signals of the double plasmid constructs achieve a higher difference in fluorescence signal between induced and uninduced state as well as at a faster rate. This proves the hypothesis made earlier about the kinetics of the GFP-REACh fusion protein combined with the TEV protease.<br />
<br />
====Summary====<br />
<br />
The kinetics of the fusion protein combined with the TEV protease exhibits the exact characteristics as predicted. The response is clearly faster than normal expression by accumulating a reservoir of fusion proteins which are not fluorescing due to the dark quencher attached to them. This reservoir is then activated by the induction of the TEV protease expression. Production of the protease results in the cleavage of the fusion protein, releasing GFP from the dark quencher and disturbing the interaction between the FRET pair. This results in the observed faster fluorescence reaction due to the amplificating effect of the TEV protease in which every one TEV protease can account for many fluorescence proteins being activated.<br />
<br />
===Characterizing the GFP-REACh Constructs in Sensor Chips===<br />
To further characterize the REACh construct, they were introduced into the sensor cells which were then induced with 2&nbsp;µL IPTG with a concentration of 100&nbsp;mM. Subsequently, we took fluorescence measurement read-outs (GFP, excitation 496&nbsp;±&nbsp;9&nbsp;nm, emission&nbsp;516&nbsp;±&nbsp;9&nbsp;nm) roughly every 10&nbsp;min in the plate reader. The results were plotted in the heatmap shown here. <br />
<center><br />
<div class="figure" style="float:{{{align|center}}}; margin: 0px 10px 10px 40px; border:{{{border|0px solid #aaa}}};width:{{{width|500px}}};padding:10px 10px 0px 0px;"><br />
{|<br />
|<html> <img src="https://static.igem.org/mediawiki/2014/6/6d/Aachen_K1319014%2B8_and_K1319013%2B8_pixelig_minus_bg.gif" width="500px"></html><br />
|-<br />
|'''{{{title|K1319014 + K1319008 and K1319013 + K1319008 uninduced (top) and induced (bottom) in sensor cells }}}'''<br />{{{subtitle|The induced double plasmid systems K1319013 + K1319008 and K1319014&nbsp;+&nbsp;K1319008 exhibit a clear fluorescence response in our sensor cells which in response to induction with 2 µl IPTG. }}}<br />
|}<br />
</div><br />
</center><br />
<br />
The heatmap shows an increase of fluorescence from blue (no fluorescence) to red (high fluorescence). It is clearly visible that the induced chips are exhibiting a significantly higher fluorescence than the uninduced chips. This shows that the constructs also work as intended in the sensor chips: The TEV protease cuts the linker so that the fusion protein is separated into GFP and a dark quencher, disabling the quenching. GFP has a clear fluorescence emission after the fusion protein has been successfully cut into two pieces by the TEV protease.<br />
<br />
===Comparing the kinetic of the double plasmid systems K1319013 + K1319008 and K1319014 + K1319008 with standard GFP expression===<br />
<br />
<center><br />
<div class="figure" style="float:{{{align|center}}}; margin: 0px 10px 10px 40px; border:{{{border|0px solid #aaa}}};width:{{{width|480px}}};padding:10px 10px 0px 0px;"><br />
{|<br />
|<html> <img src="https://static.igem.org/mediawiki/2014/1/1a/Aachen_K13%2B8%2CK14%2B8%2CK731_slower_reduced.gif" width="480px"></html><br />
|-<br />
|'''{{{title|K1319013 + K1319008, K1319014 + K1319008 and K731520 in an uninduced (top) and induced (bottom) chip}}}'''<br />{{{subtitle|Comparing the factor of fluorescence adjusted for OD between induced (bottom) and not induced (top) sensor chips of the constructs K1319013 + K1319008, K1319014 + K1319008 and K731520.}}}<br />
|}<br />
</div><br />
</center><br />
<br />
The analysis of the different [https://2014.igem.org/Team:Aachen/Project/2D_Biosensor sensor chips] with the three different construct K1319013 + K1319008, K1319014 + K1319008 and K731520 demonstrates the same fluorescence response kinetic as in the shake flask experiments. The double plasmid systems exhibits a faster and stronger fluorescence response compared to a standard GFP expression in K731520. The build up pool of fusion proteins allows for a faster, stronger fluorescence response when the induced TEV protease cleaves the fusion proteins and releases GFP from its dark quencher. <br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="reachoutlook"></span><br />
<br />
The system of the GFP-REACh fusion proteins with an inducible TEV protease has been established and shows the desired results of being faster than standard expression. The next step will be to devise aan expression of the TEV protease inducible by HSL instead of IPTG and then to incorporate both the HSL inducible TEV protease and the fusion protein onto one plasmid backbone. This would also allow us to choose a high copy plasmid for both inserts, instead of a high copy plasmid for the TEV protease and a low to mid copy plasmid for the fusion protein which should yield an overall higher fluorescence readout.<br />
<br />
Afterwards the combined construct will be characterizes the same way as the double plasmid system and other options regarding different fluorescence proteins with different quenchers will be considered to be able to have multiple fluorescence responses readable at the same time while still being faster than normal expression. <br />
<br />
Also finding and testing different promoters which can be used to express the TEV protease is planned to be able to detect not only ''Pseudomonas aeruginosa'' but also other pathogens. Also the technology will be expanded to other relevant molecules in general so that the faster fluorescence can be benefitial to more research areas.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
= References =<br />
* Sundar Ganesan, Simon M. Ameer-Beg, Tony T. C. Ng, Borivoj Vojnovic and Fred S. Wouters. "A dark yellow fluorescent protein (YFP)-based Resonance Energy-Accepting Chromoprotein (REACh) for Förster resonance energy transfer with GFP" Proceedings of the National Academy of Science of the United States of America | March 14,2006 | vol. 103 | no. 11 | 4089 - 4094<br />
<br />
* Broussard, Joshua A, Benjamin Rappaz, Donna J Webb, and Claire M Brown. "Fluorescence resonance energy transfer microscopy as demonstrated by measuring the activation of the serine/threonine kinase Akt." Nature protocols 8.2 (2013): 265-281. doi:10.1038/nprot.2012.147. <br />
<br />
* Broussard, J. A., Rappaz, B., Webb, D. J., & Brown, C. M. (2013). Fluorescence resonance energy transfer microscopy as demonstrated by measuring the activation of the serine/threonine kinase Akt. Nature protocols, 8(2), 265-281. doi: 10.1073/pnas.0509922103 <br />
<br />
'''SWISS-MODEL'''<br />
* Arnold, K., Bordoli, L., Kopp, J., & Schwede, T. (2005). The SWISS-MODEL Workspace: A Web-based Environment For Protein Structure Homology Modelling. Bioinformatics, 22(2), 195-201.<br />
<br />
* Biasini, M., Bienert, S., Schwede, T., Waterhouse, A., Arnold, K., Studer, G., et al. (2014). Nucleic Acids Research. SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information. doi: 10.1093/nar/gku340.<br />
<br />
* Guex, N., Peitsch, M. C., & Schwede, T. (2009). Automated comparative protein structure modeling with SWISS-MODEL and Swiss-PdbViewer: A historical perspective. Electrophoresis, 30(S1), S162-S173.<br />
<br />
* Kiefer, F., Arnold, K., Kunzli, M., Bordoli, L., & Schwede, T. (2009). The SWISS-MODEL Repository and associated resources. Nucleic Acids Research, 37(Database), D387-D392.<br />
<br />
'''UCSF Chimera'''<br />
* Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C., et al. (2004). UCSF Chimera?A visualization system for exploratory research and analysis. Journal of Computational Chemistry, 25(13), 1605-1612. PubMed PMID: 15264254.<br />
<br />
'''POV-Ray'''<br />
* Persistence of Vision Pty. Ltd. (2004) Persistence of Vision Raytracer (Version 3.7) [Computer software]. Retrieved from http://www.povray.org/download/<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Project/FRET_ReporterTeam:Aachen/Project/FRET Reporter2014-10-17T21:45:07Z<p>StefanReinhold: /* Producing a GFP-REACh Fusion Protein */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
=The modified REACh Construct=<br />
<br />
On this page, we present our biosensor on the molecular level. Explore the different parts of our genetic device:<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid" style="width:inherit;"><br />
<!-- Overview --><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#fluorescence" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">A Faster Answer</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0b/Aachen_14-10-13_GFP_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#fret" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">The FRET System</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/5/54/Aachen_14-10-13_FRET_Arrows_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#darkquencher" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">REACh Quenchers</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/65/Aachen_14-10-13_REACh_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#gfp-reach" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">The Fusion Protein</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/0/02/Aachen_14-10-13_Fusion_Protein_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
</ul><br />
</center><br />
</html><br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid" style="width:516px;"><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#tevprotease" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">TEV Protease</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/dc/Aachen_14-10-13_TEV_Protease_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#reachachievements" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Achieve-<br/>ments</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/FRET_Reporter#reachoutlook" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Outlook</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_GFP_iNB.png|150px|right]]<br />
<br />
= A Fluorescence Answer Faster than Expression =<br />
<span class="anchor" id="fluorescence"></span><br />
<br />
Biosensors often work with a system that comprises a reported gene under the control of a promoter directly induced by the chemical that the sensor is supposed to detect. In the case of our 2D biosensor for ''Pseudomonas&nbsp;aeruginosa'', the expression of our reporter gene, GFP, would be directly induced by the activity of the bacterium's quorum sensing molecules. However, transcription, translation, folding and post-translational modifications take their time. Since our goal is to detect the pathogen as fast as possible, we wanted to use a system that gives a fluorescent answer faster than just expressing the fluorescent protein.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_Traditional_biosensor.png|align=center|title=Schematic model of a traditional biosensor|subtitle=In this model, the expression of GFP is directly controlled by a promoter whose activator binds to a molecule secreted by the pathogen.|width=500px}}<br />
</center><br />
<br />
As an alternative to the traditional approach, we '''constitutively express our reporter gene in a quenched form'''. in the GFP-REACh fusion protein fluorescence is suppressed. Our biosensor gives a response when homoserine lactones of ''P.&nbsp;aeruginosa'' are taken up by our sensor cells where the '''autoinducer activates the expression of the TEV protease''' by binding to the LasI promoter in front of the protease gene.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_REACh_approach.png|align=center|title=Schematic model of our novel biosensor|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elicit a fluorescence response.|width=900px}}<br />
</center><br />
<br />
Advantages of the novel biosensor:<br />
<br />
* When ''P.&nbsp;aeruginosa'' is detected by our cells, the reporter protein has already been expressed and only waits to be cleaved off the REACh quencher. The cleavage reaction catalyzed by the TEV protease is a faster process than expression and correct folding of GFP. This way we hope for '''an earlier response''' by our sensor cells.<br />
<br />
* While a certain concentration of homoserine lactone will produce the same number of gene read-outs, one TEV protease can cleave many GFP-REACh constructs. Through the cleavage step, we introduce an '''amplification step''' into our system. With the TEV protease, we will be able to produce '''a much stronger signal''' in a short time interval.<br />
<br />
In order to comfirm our hypothesis we built a [https://2014.igem.org/Team:Aachen/Project/Model model] of the biosensor showing our system to respond faster than a conventional biosensor.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_FRET_Arrows_iNB.png|150px|right]]<br />
<br />
=The FRET (Förster Resonance Energy Transfer) System=<br />
<span class="anchor" id="fret"></span><br />
<br />
Förster resonance energy transfer (FRET), sometimes also called fluorescence resonance energy transfer, is a physical process of energy transfer. In FRET, the energy of a donor chromophore, whose electrons are in an excited state, is passed to a second chromophore, the acceptor. The '''energy is transferred without radiation''' and is therefore not exchanged via emission and absorption of photons. The acceptor then releases the energy received from the donor, for example, as light of a longer wavelength. <br />
<br />
In biochemistry and cell biology, fluorescent dyes, which interact via FRET, are applied as "optical nano metering rules", because the intensity of the transfer is dependent on the spacing between donor and acceptor, and can be observed over distances of up to 10&nbsp;nm. This way, protein-protein interactions and conformational changes of a variety of tagged biomolecules can be observed. For an efficient FRET to occur, there must be a substantial overlap between the donor fluorescence emission spectrum and the acceptor fluorescence excitation (or absorption) spectrum ([http://www.nature.com/nprot/journal/v8/n2/full/nprot.2012.147.html Broussard et al., 2013]), as described in the figure below.<br />
<br />
{{Team:Aachen/Figure|Aachen_14-10-07_Jablonski_Diagram_and_Absorption_Spectra_iNB.png|align=center|title=FRET betweeen donor and acceptor|subtitle=On the left: Jablonski diagram showing the transfer of energy between donor and acceptor; on the right: For successful FRET, the emission spectrum of of the donor has to overlap with the absorption spectrum of the acceptor.|width=900px}}<br />
<br />
However, '''fluorescence is not an essential requirement for FRET'''. This type of energy transfer can also be observed between donors that are capable of other forms of radiation, such as phosphorescence, bioluminescence or chemiluminescence, and fit acceptors. Acceptor chromophores do not necessarily emit the energy in form of light, and can lead to quenching instead. Thus, this kind of acceptors are also referred to as '''dark quenchers'''. In our project, we use a FRET system with a dark quencher, namely our '''REACh construct'''.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_REACh_iNB.png|150px|right]]<br />
<br />
=REACh Proteins - Dark Quenchers of GFP=<br />
<span class="anchor" id="darkquencher"></span><br />
<br />
<center><br />
{{Team:Aachen/FigureFloat|Aachen_K1319000.gif|align=center|title=Homology model of REACh.|subtitle=This homology model was created with SWISS-MODEL. We used Chimera to prepare and export a scene that was then rendered into an animation with POV-Ray.|width=256px}}<br />
</center><br />
<br />
In 2006, [http://www.pnas.org/content/103/11/4089.full Ganesan et al.] were the first to present a previously undescribed FRET acceptor, a non-fluorescent yellow fluorescent protein (YFP) mutant called '''REACh (for Resonance Energy-Accepting Chromoprotein)'''. YFP can be used as a FRET acceptor in combination with GFP as the donor in FRET microscopy and miscellaneous assays in molecular biology. The ideal FRET couple should possess a large spectral overlap between donor emission and acceptor absorption - as illustrated in previous section - but have separated emission spectra to allow their selective imaging.<br />
<br />
To optimize the spectral overlap of this FRET pair, the group obtained '''a genetically modified YFP acceptor'''. Mutations of amino acid residues that stabilize the excited state of the chromophore in enhanced YFP (EYFP) resulted in a non-fluorescent chromoprotein. Two mutations, H148V and Y145W, reduced the fluorescence emission by 82 and 98%, respectively. Ganesan et al. chose the Y145W mutant and the Y145W/H148V double mutant as FRET acceptors, and named them REACh1 and REACh2, respectively. '''Both REACh1 and REACh2 act as dark quenchers of GFP'''.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Fusion_Protein_iNB.png|150px|right]]<br />
<br />
=Producing a GFP-REACh Fusion Protein=<br />
<span class="anchor" id="gfp-reach"></span><br />
<br />
In our project, we reproduced the REACh1 and REACh2 proteins by subjecting an RFC-25 compatible version of the BioBrick [http://parts.igem.org/Part:BBa_E0030 E0030] (EYFP) to a '''QuikChange mutation''', creating the BioBricks [http://parts.igem.org/Part:BBa_K1319001 K1319001] and [http://parts.igem.org/Part:BBa_K1319002 K1319002]. Subsequently, we fused each REACh protein with '''GFP (mut3b)''' which is available as BioBrick [http://parts.igem.org/Part:BBa_E0040 E0040]. The protein complex was linked via a '''protease cleavage site''', [http://parts.igem.org/Part:BBa_K1319016 K1319016]. As constitutive promoter we use [http://parts.igem.org/Part:BBa_J23101 J232101]. When GFP is connected to either REACh quencher, GFP will absorb light but the energy will be transferred to REACh via FRET and is then emitted in the form of heat; the fluorescence is quenched. Our cells also constitutively express the '''[http://parts.igem.org/Part:BBa_C0179 LasR] activator'''. Together with the HSL molecules from ''P. aeruginosa'', LasR binds to the '''[http://parts.igem.org/Part:BBa_J64010 LasI] promoter''' that controls the expression of the TEV protease, which we make available as [http://parts.igem.org/Part:BBa_K1319004 K1319004]. When the fusion protein is cleaved by the TEV protease, REACh will be separated from GFP. The latter will then be able to absorb and emit light as usual.<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen_14-10-08_REACh_approach_with_BioBricks_iNB.png|title= Composition of our biosensor|subtitle=For our biosensor, we use a mix of already available and self-constructed BioBricks.|width=900px}}<br />
<br />
The resulting fusion proteins were labelled as [http://parts.igem.org/Part:BBa_K1319013 K1319013] (GFP fused with REACh1) and [http://parts.igem.org/Part:BBa_K1319014 K1319014] (GFP fused with REACh 2) and the linker between the proteins is labelled as [http://parts.igem.org/Part:BBa_K1319016 K1319016].<br />
<br />
Since we did not have enough time to built the complete system we tested our system with an IPTG inducible TEV protease ([http://parts.igem.org/Part:BBa_K1319008 K1319008]). In this way we were able to establish a proof of concept of our reporter system including proper expression of the TEV protease as well as functionality of our GFP-REACh construct.<br />
<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 14-10-17 IPTG REACh iFG.png|title= Composition of our biosensor for IPTG|subtitle=To test the funtionality of our sensor concept, we expressed the TEV protease with a T7 promoter.|width=900px}}<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_TEV_Protease_iNB.png|150px|right]]<br />
<br />
=Cutting the Fusion Protein with the TEV Protease=<br />
<span class="anchor" id="tevprotease"></span><br />
<br />
To cut the GFP-REACh fusion protein off, we chose '''Tobacco Etch Virus (TEV) protease''', a highly sequence-specific cysteine protease, that is frequently used for the controlled cleavage of fusion proteins ''in vitro'' and ''in vivo''. The native protease also contains an internal self-cleavage site. This site is slowly cleaved to inactivate the enzyme. The physiological reason for the self-cleavage is unknown, however, undesired for our use. Therefore, our team uses a variant of the native TEV protease containing the mutation S219V which results in an alteration of the cleavage site so that self-inactivation is diminished.<br />
<br />
{{Team:Aachen/Figure|Aachen_TEV_Protease_Model.png|title=TEV protease with a bound peptide|subtitle=This picture shows the TEV protease with a peptide chain bound in the binding pocket ready to be cleaved. The bound peptide chain has the recognition sequence inside the binding pocket. It was rendered with POV-Ray.|width=800px}}<br />
<br />
Though quite popular in molecular biology, the TEV protease is not avaiable as a BioBrick yet. Hence, the Aachen team introduces a protease with anti-self cleavage mutation S219V and codon optimized for ''E. coli'' [http://parts.igem.org/Part:BBa_K1319004 '''to the Parts Registry this year.''']<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
== Achievements ==<br />
<span class="anchor" id="reachachievements"></span> <br />
<br />
===Characterization of GFP-REACh1 and GFP-REACh2 fusion proteins in combination with an IPTG-inducible TEV Protease===<br />
<br />
The characterization of the TEV protease and the REACh1 and REACh2 dark quenchers was performed by introducing both simultaneously into ''E.&nbsp;coli'' Bl21 (DE3). The resulting double plasmid cells therefore contained [http://parts.igem.org/Part:BBa_K1319013 K1319013] (GFP-REACh1 fusion protein) or [http://parts.igem.org/Part:BBa_K1319014 K1319014] (GFP-REACh2 fusion protein) and [http://parts.igem.org/Part:BBa_K1319008 K1319008] (IPTG-inducible TEV protease). K1319013 and K1319014 were located on a pSB3K3 plasmid backbone and K1319008 on a pSB1C3 backbone, two standard iGEM plasmids with different oris allowing simultaneous use in one cell. <br />
<br />
[http://parts.igem.org/Part:BBa_I20260 I20260] was used as a positive control because I20260 contains the same promoter ([http://parts.igem.org/Part:BBa_J23101 J23101]), the same RBS ([http://parts.igem.org/Part:BBa_B0032 B0032]) and the same version of GFP ([http://parts.igem.org/Part:BBa_E0040 E0040]) and is located on the same plasmid backbone pSB3K3. Therefore, it is expected that when all fusion proteins are successfully cut by the TEV protease, the fluorescence level of the double plasmid constructs reaches the same level as the positive control of I20260. As a negative control[http://parts.igem.org/Part:BBa_B0015 B0015] was used, a coding sequence of a terminator which should not show any sign of fluorescence.<br />
<br />
To characterize our REACh1/2 constructs in combination with the TEV protease a growth experiment was conducted. Both of the double plasmid constructs, a constitutive expression of GFP (I20260) as positive control and B0015 as negative control were compared. For each expression IPTG-induced and uninduced cultures were grown in parallel. All measurements were done in a biological triplicate. <br />
<br />
To better evaluate the fluorescence, the observed Optical desity (OD) was taken into account in order to achieve a fluorescence measurement independent of the amount of cells present. This way, the measurement represents the amount of fluorescence per cell only. <br />
<br />
{{Team:Aachen/Figure|Aachen 16-10-14 Graph2iFG.PNG|title=Comparison of K1319013 + K1319008, K1319014 + K1319008, I20260 (positive control) and B0015 (negative control)|subtitle=Both double plasmid construct exhibit a clear fluorescence signal when induced.|width=900px}}<br />
<br />
The negative control B0015 did not exhibit any significant fluorescence. The positive control I20260 showed a steady level of fluorescence as expected due to the constitutive expression of GFP. As expected, the production is also independent of addition of IPTG therefore the triplicates have been merged together.<br />
<br />
Both double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008 did not exhibit a strong fluorescence before induction with IPTG. In the uninduced state, the fluorescence stays low and does not increase over time. It is significantly weaker than the fluorescence reached by the induced constructs or the positive control but was higher than the negative control. The higher base level of fluorescence in the not induced constructs is due to the imperfect quenching and the leakiness of the IPTG inducible promoter. <br />
<br />
The induced double plasmid constructs exhibited a fast rise in fluorescence after induction. '''The signal strenght increased ~ 10-fold over the uninduced constructs.''' K1319014 + K1319008 reached the the same level of fluorescence as I20260, indicating a complete cleavage of the fusion proteins by the TEV protease. K1319013 + K1319008 did not reach a level of fluorescence as high as K1319013 + K1319008, however, the nearly 10-fold increase in fluorescence after induction is a clear indicator for the TEV protease cutting the fusion protein K1319013. The weaker fluorescence signal is probably due to a lower expression level of K1319013 in the cells compared to the expression level of K1319014. <br />
<br />
The fluorescence results of K1319014 + K1319008 was used to fit our [https://2014.igem.org/Team:Aachen/Project/Model model] to experimental data.<br />
<br />
====Summary====<br />
<br />
The double plasmid systems of K1319013 + K1319008 and K1319014 + K1319008 demonstrate the quenching ability of the REACh1 and REACh2 proteins as well as the funcionality of the TEV protease.<br />
The increase in fluorescence after induction with IPTG is based on a functional expression of the TEV protease which proceeds to cut the linker of the fusion protein already produced destroying the FRET system between GFP and its quencher and resulting in a strong fluorescence signal. Combined, this characterization is a '''validation of the functionality of the REACh1 protein ([http://parts.igem.org/Part:BBa_K1319001 K1319001]), the REACh2 protein ([http://parts.igem.org/Part:BBa_K1319002 K1319002]) and the TEV protease ([http://parts.igem.org/Part:BBa_K1319004 K1319004])'''.<br />
<br />
===Determining the Quenching ability of REACh 1 and REACh 2===<br />
<br />
In order to further evaluate the quenching ability of the REACh 1 and REACh 2 constructs in the fusion proteins produced by K1319013 and K1319014, they were expressed alone without an IPTG inducible TEV protease. This eliminated the effect of a potential leakiness of the non induced promoter to reliably assess the quenching ability of the REACh 1 and REACh 2 proteins. <br />
<br />
{{Team:Aachen/Figure|Aachen_K1319001_and_K1319002.PNG|title=Comparison of K1319013 and K1319014 with I20260 and B0015|subtitle=K1319013 and K1319014 show a severely reduced fluorescence compared to the positive control I20260.|width=900px}}<br />
<br />
In the previous experiment it was established that the fusion proteins K1319013 and K1319014 are expressed funtionally. K1319014 reached the same level of fluorescence as the positive control after being cut by the TEV protease. Therefore the reduced fluorescence in this experiment is completely attributable to the quenching of REACh 1. The quenching reduces the fluorescence of GFP by a factor ~ 25 which means a '''quenching efficiency of ~ 96%!'''. <br />
<br />
K139013 was not able to reach the same fluorescence level as the positive control in the previous experiment. Therefore a worse rate of functional expression of K1319013 compared to K1319014 is assumed. incorporating this, the difference in fluorescence between induced and not induced is still a factor of ~ 30 resulting in a '''quenching efficiency of ~ 97%'''.<br />
<br />
====Summary ====<br />
<br />
The fusion proteins of GFP combined with REACh 1 and REACh 2 are not only fully functional but exhibit a great quenching efficiency of ~ 97% for REACh 1 and ~ 96% for REACh 2.Even though REACh 1s quenching ability seems to be slighty superior, the expression level of the K1319014 fusion protein including REACh 2 is nearly twice as high as the fusion protein K1319013 containing REACh 1 and therefore shows a stronger fluorescence. Ganesan et al. (2006) reported a reduction on emission of GFP of 82% for REACh 1 and 98% for REACh 2 but with a different Linker between the proteins and on a different vector backbone.<br />
<br />
===Comparing fluorescence kinetics of the GFP-REACh fusion proteins with a Standard lacI-inducible GFP Expression===<br />
<br />
To assess the kinetics of the fusion proteins K1319013 (GFP-REACh1) and K1319014 (GFP-REACh2), the double plasmid systems K1319013 + K1319008 and K1319014 + K1319008 were compared to a standard expression of GFP under the control of a lacI promoter in [http://parts.igem.org/Part:BBa_K731520 K731520], a BioBrick made by the iGEM Team TRENTO in 2012. This tested the hypothesis of achieving a faster fluorescence response with the GFP-REACh fusion proteins compared to a standard expression.<br />
<br />
K731520 and the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008 were cultivated in ''E. coli'' BL21(DE3), and fluorescence and OD was measured.The fluorescence was adjusted for the OD to show a relative fluorescence on a per cell basis. The difference between the induced and uninduced state, the fluorescence quotient, serves as a better indicator for a system used as a sensor because the difference between an ''on'' and ''off'' state is more important for a clear and unmistakable signal than the overall fluorescence. Hence, the OD-adjusted fluorescence quotient for both double plasmid constructs and K731520 was obtained and plotted in the following graph.<br />
<br />
{{Team:Aachen/Figure|Aachen_16-10-14_GraphQuotient_iFG.PNG|Comparison of K1319013 + K1319008, K1319014 + K1319008 and K731520|subtitle=Fluorescence was normalized by dividing by the optical density. The fluorescence of induced cells was additionally divided by the fluorescence of uninduced cells to obtain the fluorescence quotient.|width=700px}}<br />
<br />
The graph clearly shows the faster response of the cut GFP-REACh fusion protein compared to a standard GFP expression. Both fluorescence signals of the double plasmid constructs achieve a higher difference in fluorescence signal between induced and uninduced state as well as at a faster rate. This proves the hypothesis made earlier about the kinetics of the GFP-REACh fusion protein combined with the TEV protease.<br />
<br />
====Summary====<br />
<br />
The kinetics of the fusion protein combined with the TEV protease exhibits the exact characteristics as predicted. The response is clearly faster than normal expression by accumulating a reservoir of fusion proteins which are not fluorescing due to the dark quencher attached to them. This reservoir is then activated by the induction of the TEV protease expression. Production of the protease results in the cleavage of the fusion protein, releasing GFP from the dark quencher and disturbing the interaction between the FRET pair. This results in the observed faster fluorescence reaction due to the amplificating effect of the TEV protease in which every one TEV protease can account for many fluorescence proteins being activated.<br />
<br />
===Characterizing the GFP-REACh Constructs in Sensor Chips===<br />
To further characterize the REACh construct, they were introduced into the sensor cells which were then induced with 2&nbsp;µL IPTG with a concentration of 100&nbsp;mM. Subsequently, we took fluorescence measurement read-outs (GFP, excitation 496&nbsp;±&nbsp;9&nbsp;nm, emission&nbsp;516&nbsp;±&nbsp;9&nbsp;nm) roughly every 10&nbsp;min in the plate reader. The results were plotted in the heatmap shown here. <br />
<center><br />
<div class="figure" style="float:{{{align|center}}}; margin: 0px 10px 10px 40px; border:{{{border|0px solid #aaa}}};width:{{{width|500px}}};padding:10px 10px 0px 0px;"><br />
{|<br />
|<html> <img src="https://static.igem.org/mediawiki/2014/6/6d/Aachen_K1319014%2B8_and_K1319013%2B8_pixelig_minus_bg.gif" width="500px"></html><br />
|-<br />
|'''{{{title|K1319014 + K1319008 and K1319013 + K1319008 uninduced (top) and induced (bottom) in sensor cells }}}'''<br />{{{subtitle|The induced double plasmid systems K1319013 + K1319008 and K1319014&nbsp;+&nbsp;K1319008 exhibit a clear fluorescence response in our sensor cells which in response to induction with 2 µl IPTG. }}}<br />
|}<br />
</div><br />
</center><br />
<br />
The heatmap shows an increase of fluorescence from blue (no fluorescence) to red (high fluorescence). It is clearly visible that the induced chips are exhibiting a significantly higher fluorescence than the uninduced chips. This shows that the constructs also work as intended in the sensor chips: The TEV protease cuts the linker so that the fusion protein is separated into GFP and a dark quencher, disabling the quenching. GFP has a clear fluorescence emission after the fusion protein has been successfully cut into two pieces by the TEV protease.<br />
<br />
===Comparing the kinetic of the double plasmid systems K1319013 + K1319008 and K1319014 + K1319008 with standard GFP expression===<br />
<br />
<center><br />
<div class="figure" style="float:{{{align|center}}}; margin: 0px 10px 10px 40px; border:{{{border|0px solid #aaa}}};width:{{{width|480px}}};padding:10px 10px 0px 0px;"><br />
{|<br />
|<html> <img src="https://static.igem.org/mediawiki/2014/1/1a/Aachen_K13%2B8%2CK14%2B8%2CK731_slower_reduced.gif" width="480px"></html><br />
|-<br />
|'''{{{title|K1319013 + K1319008, K1319014 + K1319008 and K731520 in an uninduced (top) and induced (bottom) chip}}}'''<br />{{{subtitle|Comparing the factor of fluorescence adjusted for OD between induced (bottom) and not induced (top) sensor chips of the constructs K1319013 + K1319008, K1319014 + K1319008 and K731520.}}}<br />
|}<br />
</div><br />
</center><br />
<br />
The analysis of the different [https://2014.igem.org/Team:Aachen/Project/2D_Biosensor sensor chips] with the three different construct K1319013 + K1319008, K1319014 + K1319008 and K731520 demonstrates the same fluorescence response kinetic as in the shake flask experiments. The double plasmid systems exhibits a faster and stronger fluorescence response compared to a standard GFP expression in K731520. The build up pool of fusion proteins allows for a faster, stronger fluorescence response when the induced TEV protease cleaves the fusion proteins and releases GFP from its dark quencher. <br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="reachoutlook"></span><br />
<br />
The system of the GFP-REACh fusion proteins with an inducible TEV protease has been established and shows the desired results of being faster than standard expression. The next step will be to devise aan expression of the TEV protease inducible by HSL instead of IPTG and then to incorporate both the HSL inducible TEV protease and the fusion protein onto one plasmid backbone. This would also allow us to choose a high copy plasmid for both inserts, instead of a high copy plasmid for the TEV protease and a low to mid copy plasmid for the fusion protein which should yield an overall higher fluorescence readout.<br />
<br />
Afterwards the combined construct will be characterizes the same way as the double plasmid system and other options regarding different fluorescence proteins with different quenchers will be considered to be able to have multiple fluorescence responses readable at the same time while still being faster than normal expression. <br />
<br />
Also finding and testing different promoters which can be used to express the TEV protease is planned to be able to detect not only ''Pseudomonas aeruginosa'' but also other pathogens. Also the technology will be expanded to other relevant molecules in general so that the faster fluorescence can be benefitial to more research areas.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
= References =<br />
* Sundar Ganesan, Simon M. Ameer-Beg, Tony T. C. Ng, Borivoj Vojnovic and Fred S. Wouters. "A dark yellow fluorescent protein (YFP)-based Resonance Energy-Accepting Chromoprotein (REACh) for Förster resonance energy transfer with GFP" Proceedings of the National Academy of Science of the United States of America | March 14,2006 | vol. 103 | no. 11 | 4089 - 4094<br />
<br />
* Broussard, Joshua A, Benjamin Rappaz, Donna J Webb, and Claire M Brown. "Fluorescence resonance energy transfer microscopy as demonstrated by measuring the activation of the serine/threonine kinase Akt." Nature protocols 8.2 (2013): 265-281. doi:10.1038/nprot.2012.147. <br />
<br />
* Broussard, J. A., Rappaz, B., Webb, D. J., & Brown, C. M. (2013). Fluorescence resonance energy transfer microscopy as demonstrated by measuring the activation of the serine/threonine kinase Akt. Nature protocols, 8(2), 265-281. doi: 10.1073/pnas.0509922103 <br />
<br />
'''SWISS-MODEL'''<br />
* Arnold, K., Bordoli, L., Kopp, J., & Schwede, T. (2005). The SWISS-MODEL Workspace: A Web-based Environment For Protein Structure Homology Modelling. Bioinformatics, 22(2), 195-201.<br />
<br />
* Biasini, M., Bienert, S., Schwede, T., Waterhouse, A., Arnold, K., Studer, G., et al. (2014). Nucleic Acids Research. SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information. doi: 10.1093/nar/gku340.<br />
<br />
* Guex, N., Peitsch, M. C., & Schwede, T. (2009). Automated comparative protein structure modeling with SWISS-MODEL and Swiss-PdbViewer: A historical perspective. Electrophoresis, 30(S1), S162-S173.<br />
<br />
* Kiefer, F., Arnold, K., Kunzli, M., Bordoli, L., & Schwede, T. (2009). The SWISS-MODEL Repository and associated resources. Nucleic Acids Research, 37(Database), D387-D392.<br />
<br />
'''UCSF Chimera'''<br />
* Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C., et al. (2004). UCSF Chimera?A visualization system for exploratory research and analysis. Journal of Computational Chemistry, 25(13), 1605-1612. PubMed PMID: 15264254.<br />
<br />
'''POV-Ray'''<br />
* Persistence of Vision Pty. Ltd. (2004) Persistence of Vision Raytracer (Version 3.7) [Computer software]. Retrieved from http://www.povray.org/download/<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/File:Team_Aachen_Teamfoto.pngFile:Team Aachen Teamfoto.png2014-10-17T21:38:22Z<p>StefanReinhold: uploaded a new version of &quot;File:Team Aachen Teamfoto.png&quot;</p>
<hr />
<div>Picture for landing page</div>StefanReinholdhttp://2014.igem.org/File:Team_Aachen_Teamfoto.pngFile:Team Aachen Teamfoto.png2014-10-17T21:32:45Z<p>StefanReinhold: uploaded a new version of &quot;File:Team Aachen Teamfoto.png&quot;</p>
<hr />
<div>Picture for landing page</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Software/MeasurartyTeam:Aachen/Notebook/Software/Measurarty2014-10-17T21:30:53Z<p>StefanReinhold: /* Source Code */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Aachen/Scripts/highlight.pack.default.css?action=raw&ctype=text/css"><br />
<script src="https://2014.igem.org/Team:Aachen/Scripts/highlight.pack.js?action=raw&ctype=text/javascript"></script><br />
<script>hljs.initHighlightingOnLoad();</script><br />
</html><br />
<br />
= ''Measurarty'' =<br />
<br />
''Measurarty'' is the evil player in the game of ''Cellock Holmes'' and ''WatsOn''.<br />
''Measurarty'' is the pathogen detection logic behind our project.<br />
Using our ''Measurarty'' algorithm, we want to automatically detect pathogens from the chip photos delivered by WatsOn, without human interaction.<br />
Besides reducing the risk of human errors, this makes our device usable by almost everyone.<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<!-- Overview --><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#intro" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Intro</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1b/Aachen_Measurarty_Intro_button.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#SRM" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">SRM!</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_Puzzels_button.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#segment" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Segment!</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/e/e1/Aachen_SEgment_button.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#classification" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Classify!</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/f/f9/Aachen_Classify_button.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#measurartyachievements" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Achieve-<br/>ments</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_Measurarty_Intro_button.png|right|150px]]<br />
<br />
== ''Measurarty'' - An Introduction ==<br />
<span class="anchor" id="intro"></span><br />
<br />
Our [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsonsoftware device control software] is able to take images of incubated chips inside WatsOn. Yet, that does not bring the user closer to the answer of the question:<br />
<br />
<center>'''What's on the chip?'''</center><br />
<br />
In fact, answering this question seems trivial for a human: Just check whether a colony grown has grown on the chip and you're done. This task is even easier with our chip system, because these show fluorescence wherever a pathogen has been detected.<br />
<br />
But is this an easy task for a computer? Actually not. The task of automatic detection is tried by several disciplines in computer science, from pattern recognition over machine learning to by medical imaging chairs.<br />
<br />
Here, we would like to present a pipeline for this task that makes use of '''easy segmentation and classification algorithms'''.<br />
First, ''Measurarty'' segments the target image using '''Statistical Region Merging (SRM)''' in order to find regions of similar properties. After this step, we can segment the picture using '''histogram thresholding''' in [http://en.wikipedia.org/wiki/HSL_and_HSV HSV color space] to find candidate regions for pathogens.<br />
Finally, a classification algorithm can detect the pathogen on our chips.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_Puzzels_button.png|right|150px]]<br />
<br />
== Statistical Region Merging (SRM) ==<br />
<span class="anchor" id="SRM"></span><br />
<br />
Before briefly introducing Statistical Region Merging (SRM), we would like to explain why we need this step, and why this algorithm is an ideal choice.<br />
<br />
Compared to other clustering algorithms, SRM is quite leight weight, yet delivers ''deterministic'' results and is not dependent on a certain seed (like ''k''-means, for example).<br />
<br />
On the other hand, it can create as many refinements as one wants and is thus flexible enough for the our purposes. Finally there's already been knowledge about this algorithm in the group.<br />
<br />
Statistical Region Merging (SRM) (Nook and Nielson, 2004) is a clustering technique also used directly for image segmentation.<br />
A region $R$ is a set of pixels and the cardinality $\lvert R \rvert$ determines how many pixels are in one region.<br />
Starting with a sorted set of connected regions (w. r. t. some distance function $f$), two regions $R$ and $R'$ are merged if the qualification criteria $\vert \overline{R'}-\overline{R} \vert \leq \sqrt{b^2(R)+b^2(R')}$ with $b(R) = g \cdot \sqrt{\frac{\ln \frac{\mathcal{R}_{\lvert R \rvert}}{\delta}}{2Q\lvert R \rvert}}$ is fulfilled.<br />
Therefore, $\mathcal{R}_{\lvert R \rvert}$ is the set of regions with $\lvert R \rvert$ pixels.<br />
Typically $Q$ is chosen as $Q \in \lbrack 256, 1\rbrack$ and $\delta = \frac{1}{\lvert I \rvert^2}$.<br />
<br />
The $Q$ parameter mainly influences the merging process. For an example, see the figure ''SRM Regions'' below. The lower the chosen value for $Q$, more coarse the regions become. Using a union-find structure, the segmentation does not need to be recalculated for each $Q$ level. For the step from $q$ to $\frac{q}{2}$, just the qualification criteria needs to be applied to the regions from the $q$ result. A MATLAB implementation is also available (Boltz, 2009).<br />
<br />
{{Team:Aachen/FigureDual|Aachen_srm_regions_3.PNG|Aachen_srm_regions_2.PNG|title1=SRM regions in random colors|title2=SRM regions (average color)|subtitle1=Different regions from an SRM run starting at $Q=256$ (top left) and going to $Q=1$ (bottom right). Each region is assigned a random color.|subtitle2=Different regions from an SRM run starting at $Q=256$ (top left) and going to $Q=1$ (bottom right). Each region is assigned the average color of that region.|width=425px}} <br />
<br />
=== SRM Clustering ===<br />
<br />
In our project, we used Statistical Region Merging for clustering. In contrast to other algorithms, such as ''k-means'', this approach is highly deterministic.<br />
For our purposes we only have one SRM run for $Q=256$.<br />
<br />
In MATLAB, we use the previously mentioned code from MATLAB Fileexchange (Boltz, 2009).<br />
For our Qt-based GUI we implemented the SRM method ourselves.<br />
<br />
The SRM clustering reduces the amount of different colors in the image and hence eases the recognition of parts belonging together.<br />
<br />
<html><br />
<div class="codediv"><br />
<pre><code class="matlab"><br />
Qlevel = 256;<br />
[maps,images]=singlesrm(double(image),Qlevel);<br />
</code></pre><br />
</div><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_SEgment_button.png|right|150px]]<br />
<br />
== Segmentation ==<br />
<span class="anchor" id="segment"></span><br />
<br />
In the segmentation stage all background regions are removed. This task is quite crucial. If one removes too few, the final stage of finding pathogens might get irritated.<br />
On the other hand, if one removes too many regions, positive hits might get removed early before detection. This surely must be avoided.<br />
<br />
We opted for a simple thresholding step because it showed that while being easy, it is an effective weapon against the uniform background. In fact, the good image quality we wanted to reach with our device allows now less sophisticated methods.<br />
Also the less computational intensive the steps are, the better they might even run directly on the Raspberry Pi in our device!<br />
<br />
The HSV thresholding is performed on each component seperately. For more information on the HSV color space we refer to [http://en.wikipedia.org/wiki/HSL_and_HSV Wikipedia]. The first component is the hue which we select to be inbetween $0.462$ and $0.520$ to select any blue-greenish color. We will not see bright green due to the filter selection in our device.<br />
The saturation value must be high, between $0.99$ and $1.0$.<br />
Moreover, the value component of the HSV image has to lie between $0.25$ and $0.32$, which assumes a relatively dark color.<br />
<br />
Indeed, these values are not problem specific, but specific for each setup and therefore have to be determined empirically.<br />
<br />
The remainder of this stage creates a mask of pixels that fulfill the conditions.<br />
<br />
* image of masked bit<br />
<br />
<html><br />
<div class="codediv"><br />
<pre><code class="matlab"><br />
% Auto-generated by colorThresholder app on 15-Oct-2014<br />
%-------------------------------------------------------<br />
function [maskedRGBImage] = createMask(srmimg)<br />
RGB = srmimg;<br />
<br />
% Convert RGB image to chosen color space<br />
I = rgb2hsv(RGB);<br />
<br />
% Define thresholds for channel 1 based on histogram settings<br />
channel1Min = 0.462;<br />
channel1Max = 0.520;<br />
<br />
% Define thresholds for channel 2 based on histogram settings<br />
channel2Min = 0.99;<br />
channel2Max = 1.000;<br />
<br />
% Define thresholds for channel 3 based on histogram settings<br />
channel3Min = 0.25;<br />
channel3Max = 0.32;<br />
<br />
% Create mask based on chosen histogram thresholds<br />
BW = (I(:,:,1) >= channel1Min ) & (I(:,:,1) <= channel1Max) & ...<br />
(I(:,:,2) >= channel2Min ) & (I(:,:,2) <= channel2Max) & ...<br />
(I(:,:,3) >= channel3Min ) & (I(:,:,3) <= channel3Max);<br />
<br />
% Initialize output masked image based on input image.<br />
maskedRGBImage = RGB;<br />
<br />
% Set background pixels where BW is false to zero.<br />
maskedRGBImage(repmat(~BW,[1 1 3])) = 0;<br />
<br />
end<br />
</code></pre><br />
</div><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_Classify_button.png|right|150px]]<br />
<br />
== Classification ==<br />
<span class="anchor" id="classification"></span><br />
<br />
=== Smoothness Index ===<br />
<br />
For position prediction in virtual environments, jitter or noise in the output signal is not wanted though often present.<br />
Since discovering smooth areas is a similar problem to jitter detection, a simple method for determining jitter can be used to measure non-jitter, smoothness (Joppich, Rausch and Kuhlen, 2013).<br />
It is assumed that jitter-free areas of a position signal do not differ in velocity.<br />
<br />
Smooth areas do not differ in intensity, and therefore only low changes in velocity (intensity change) can be recorded.<br />
For the reduction of noise, this operation is performed on the smoothed input image.<br />
Then the smoothness $s$ of a pixel $p$ in its k-neighbourhood $\mathcal{N}_k$ can be determined as:<br />
\begin{equation}<br />
s(p) = \sum\limits_{p' \in \mathcal{N}_k} \nabla(p') / \arg\max\limits_{p} s(p)<br />
\end{equation}<br />
<br />
Using thresholding, $TS_l \leq s(p) \leq TS_u \wedge TI_l \leq I \leq TI_u$, different areas, such as background or pathogen, can be selected.<br />
<br />
For the empirical choice of thresholds, it can be argued that these are tailored to the specific case.<br />
While this surely is true to a certain extent, the here presented method has been successfully tested on images from a completely different domain, and no changes to the thresholds have been made to make it work.<br />
A proper theoretical evaluation is emphasized, however, is probably not the aim of the iGEM competition.<br />
<br />
Finally, selecting for the red region, this delivers the location of possible pathogens.<br />
Since the size of the agar chips is variable but fixed a quantitative analysis can be performed by counting pixels for instance.<br />
<br />
=== Empirical Evaluation ===<br />
<br />
Using our MATLAB code we found the lower threshold for the smoothness index to be $TS_l = 0.85$ and the upper threshold $TS_u = \infty$.<br />
Similarly, for $TI_l = 235$ and $TI_u = \infty$.<br />
<br />
Using these settings, we can find a response already in images taken after 42&nbsp;minutes.<br />
<br />
Ideally, one would rate the quality of the image segmentation using some ground truth, such as manual delineations. This still has to be done for our method.<br />
However, from visual observations, our method is showing promising results.<br />
<br />
* image of smoothness index<br />
<br />
=== Automatic Classification ===<br />
<br />
<br />
<html><br />
<div class="codediv"><br />
<pre><code class="matlab"><br />
function [mask, seg] = automaticseeds(im)<br />
<br />
imc = im;<br />
<br />
%% to grayscale and filtering<br />
Z = double(rgb2gray(im));<br />
Z = 255 * Z / max(max(Z));<br />
<br />
filtertype = 'disk';<br />
Z = filter2(fspecial(filtertype), Z);<br />
Z = filter2(fspecial(filtertype), filter2(fspecial(filtertype), Z));<br />
Z = 255 * Z / max(max(Z)); <br />
<br />
%% calculating similarity score/smoothness index<br />
k=4;<br />
sSI = similarity(Z,k);<br />
sSI = sSI / max(max(sSI)); <br />
<br />
%% classify<br />
pathogene = ((sSI > 0.85) == 1) & ((Z > 235) == 1); <br />
<br />
mask = ones( size(imc) );<br />
seg = zeros( size(imc) );<br />
<br />
<br />
%% output<br />
for i=1:size(im,1)<br />
for j=1:size(im,2)<br />
<br />
if (pathogene(i,j) == 1)<br />
seg(i,j,1:3) = [255 0 0];<br />
mask(i, j, 1:3) = [0 0 0];<br />
end<br />
end<br />
end<br />
end<br />
</code></pre><br />
</div><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
== Achievements ==<br />
<span class="anchor" id="measurartyachievements"></span><br />
<br />
''Measurarty'' is the image analysis logic behind our project.<br />
It is comprised of simple constructs put together into a pipeline, that is clearly laid out, easily maintainable and - if needed - easily adaptable.<br />
For example, changing from green to red fluorescence, only means to change the ''createMask'' function to select another target area.<br />
<br />
Overall the results look convincing. We have not yet performed a comparison to a manual delineation, however, by eye the results look promising and have a low error.<br />
<br />
Talking about computational complexity, the MATLAB code of course performs better than our own C++ implementation, which must be regarded as a proof-of-principle.<br />
<br />
Space-wise, the code depends heavily on the image size $O( x \cdot y)$ (width $x$, height $y$, which also limits the number of edges in SRM between regions, as each pixel is one region to start with. However, it cannot take less memory, as the image is stored in an uncompressed format.<br />
<br />
On the computational side, the thresholding, image conversion and gradient steps are linear in the number of pixels, and are thus in $O(x \cdot y)$.<br />
Unfortunately, the summation of the gradient for the smoothness index adds a heavy factor to it (k-neighbourhood for smoothness index).<br />
Due to the merging step in our C++-SRM algorithm implementation, our code has to do $O(x^2 \cdot y^2)$ comparisons, which then finally results in a runtime complexity of $O( x^2 \cdot y^2)$.<br />
<br />
*include image here<br />
<br />
From the above figure it can also be seen that the detected amount of pathogenic-area correlates with time after induction.<br />
The lag-phase can be explained first by the lag-phase of the cells, which first need to generate a response to the pathogen, and on the other hand, by too low fluorescence which is not detectable.<br />
The pixel count also meets the expectation when looking at the sample files by eye.<br />
<br />
It can be concluded that the ''Measurarty'' pipeline defines a robustly working chip-analysis algorithm which can detect pathogens from images supplied by ''WatsOn''.<br />
Therefore, this algorithm closes the gap between our biology, detection hardware and the user who wants easy-to-interpret results.<br />
<br />
For future prospects, it would be interesting to do a proper performance analysis on our code, to find hotspots and optimize the code. Many ''for''-loops leave plenty of room for vectorization and loop-unrolling. Parallelization, specifically with respect to embedded hardware such as the Raspberry Pi or Odroid U3, is limited to the extend that the overhead created would probably eliminate the improvements.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== Source Code ==<br />
<span class="anchor" id="source"></span><br />
<br />
''Measuarty'' is the image analysis logic behind our project. It has been prototyped and developed in [http://www.mathworks.de/academia/student-competitions/igem/ MATLAB], and only later been ported into our ''WatsOn'' GUI.<br />
<br />
We are happy to provide you with a zip-ped download of our MATLAB code here, as well as on the iGEM softwarerepository on [https://github.com/orgs/igemsoftware/teams/aachen2014 github].<br />
<br />
* MATLAB code<br />
* link [https://github.com/orgs/igemsoftware/teams/aachen2014 github]<br />
<br />
For the C++ conversion please see [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsonsoftware our ''WatsOn'' Software] section.<br />
<br />
=== Using the MATLAB Code ===<br />
<br />
In general, please follow the included ''README.MD'' file. Our package comes with a set of test files from one of our experiments.<br />
After installing the Statistical Region Merging code (see readme), you can simply run ''igem_srm_demo.m''. Select your current folder, and MATLAB will automatically segment and classify the included jpg-images.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
<span class="anchor" id="measurartyrefs"></span><br />
<br />
* Boltz, S. (2009, October 20). Image segmentation using statistical region merging - File Exchange - MATLAB Central. Image segmentation using statistical region merging. Retrieved December 12, 2013, from http://www.mathworks.com/matlabcentral/fileexchange/25619-image-segmentation-using-statistical-region-merging<br />
<br />
* Joppich, M., Rausch, D., & Kuhlen, T. (2013). Adaptive human motion prediction using multiple model approaches.. Virtuelle und erweiterte Realität (p. 169–180). 10. Workshop der GI-Fachgruppe VR/AR: Shaker.<br />
<br />
* Nock, R., & Nielsen, F. (2004). Statistical region merging. IEEE Transactions on Pattern Analysis and Machine Intelligence, 26(11), 1452-1458.<br />
<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Software/MeasurartyTeam:Aachen/Notebook/Software/Measurarty2014-10-17T21:30:29Z<p>StefanReinhold: /* Source Code */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Aachen/Scripts/highlight.pack.default.css?action=raw&ctype=text/css"><br />
<script src="https://2014.igem.org/Team:Aachen/Scripts/highlight.pack.js?action=raw&ctype=text/javascript"></script><br />
<script>hljs.initHighlightingOnLoad();</script><br />
</html><br />
<br />
= ''Measurarty'' =<br />
<br />
''Measurarty'' is the evil player in the game of ''Cellock Holmes'' and ''WatsOn''.<br />
''Measurarty'' is the pathogen detection logic behind our project.<br />
Using our ''Measurarty'' algorithm, we want to automatically detect pathogens from the chip photos delivered by WatsOn, without human interaction.<br />
Besides reducing the risk of human errors, this makes our device usable by almost everyone.<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<!-- Overview --><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#intro" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Intro</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1b/Aachen_Measurarty_Intro_button.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#SRM" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">SRM!</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_Puzzels_button.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#segment" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Segment!</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/e/e1/Aachen_SEgment_button.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#classification" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Classify!</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/f/f9/Aachen_Classify_button.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width: 156px;margin-left: 8px;margin-right: 8px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty#measurartyachievements" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Achieve-<br/>ments</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_Measurarty_Intro_button.png|right|150px]]<br />
<br />
== ''Measurarty'' - An Introduction ==<br />
<span class="anchor" id="intro"></span><br />
<br />
Our [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsonsoftware device control software] is able to take images of incubated chips inside WatsOn. Yet, that does not bring the user closer to the answer of the question:<br />
<br />
<center>'''What's on the chip?'''</center><br />
<br />
In fact, answering this question seems trivial for a human: Just check whether a colony grown has grown on the chip and you're done. This task is even easier with our chip system, because these show fluorescence wherever a pathogen has been detected.<br />
<br />
But is this an easy task for a computer? Actually not. The task of automatic detection is tried by several disciplines in computer science, from pattern recognition over machine learning to by medical imaging chairs.<br />
<br />
Here, we would like to present a pipeline for this task that makes use of '''easy segmentation and classification algorithms'''.<br />
First, ''Measurarty'' segments the target image using '''Statistical Region Merging (SRM)''' in order to find regions of similar properties. After this step, we can segment the picture using '''histogram thresholding''' in [http://en.wikipedia.org/wiki/HSL_and_HSV HSV color space] to find candidate regions for pathogens.<br />
Finally, a classification algorithm can detect the pathogen on our chips.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_Puzzels_button.png|right|150px]]<br />
<br />
== Statistical Region Merging (SRM) ==<br />
<span class="anchor" id="SRM"></span><br />
<br />
Before briefly introducing Statistical Region Merging (SRM), we would like to explain why we need this step, and why this algorithm is an ideal choice.<br />
<br />
Compared to other clustering algorithms, SRM is quite leight weight, yet delivers ''deterministic'' results and is not dependent on a certain seed (like ''k''-means, for example).<br />
<br />
On the other hand, it can create as many refinements as one wants and is thus flexible enough for the our purposes. Finally there's already been knowledge about this algorithm in the group.<br />
<br />
Statistical Region Merging (SRM) (Nook and Nielson, 2004) is a clustering technique also used directly for image segmentation.<br />
A region $R$ is a set of pixels and the cardinality $\lvert R \rvert$ determines how many pixels are in one region.<br />
Starting with a sorted set of connected regions (w. r. t. some distance function $f$), two regions $R$ and $R'$ are merged if the qualification criteria $\vert \overline{R'}-\overline{R} \vert \leq \sqrt{b^2(R)+b^2(R')}$ with $b(R) = g \cdot \sqrt{\frac{\ln \frac{\mathcal{R}_{\lvert R \rvert}}{\delta}}{2Q\lvert R \rvert}}$ is fulfilled.<br />
Therefore, $\mathcal{R}_{\lvert R \rvert}$ is the set of regions with $\lvert R \rvert$ pixels.<br />
Typically $Q$ is chosen as $Q \in \lbrack 256, 1\rbrack$ and $\delta = \frac{1}{\lvert I \rvert^2}$.<br />
<br />
The $Q$ parameter mainly influences the merging process. For an example, see the figure ''SRM Regions'' below. The lower the chosen value for $Q$, more coarse the regions become. Using a union-find structure, the segmentation does not need to be recalculated for each $Q$ level. For the step from $q$ to $\frac{q}{2}$, just the qualification criteria needs to be applied to the regions from the $q$ result. A MATLAB implementation is also available (Boltz, 2009).<br />
<br />
{{Team:Aachen/FigureDual|Aachen_srm_regions_3.PNG|Aachen_srm_regions_2.PNG|title1=SRM regions in random colors|title2=SRM regions (average color)|subtitle1=Different regions from an SRM run starting at $Q=256$ (top left) and going to $Q=1$ (bottom right). Each region is assigned a random color.|subtitle2=Different regions from an SRM run starting at $Q=256$ (top left) and going to $Q=1$ (bottom right). Each region is assigned the average color of that region.|width=425px}} <br />
<br />
=== SRM Clustering ===<br />
<br />
In our project, we used Statistical Region Merging for clustering. In contrast to other algorithms, such as ''k-means'', this approach is highly deterministic.<br />
For our purposes we only have one SRM run for $Q=256$.<br />
<br />
In MATLAB, we use the previously mentioned code from MATLAB Fileexchange (Boltz, 2009).<br />
For our Qt-based GUI we implemented the SRM method ourselves.<br />
<br />
The SRM clustering reduces the amount of different colors in the image and hence eases the recognition of parts belonging together.<br />
<br />
<html><br />
<div class="codediv"><br />
<pre><code class="matlab"><br />
Qlevel = 256;<br />
[maps,images]=singlesrm(double(image),Qlevel);<br />
</code></pre><br />
</div><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_SEgment_button.png|right|150px]]<br />
<br />
== Segmentation ==<br />
<span class="anchor" id="segment"></span><br />
<br />
In the segmentation stage all background regions are removed. This task is quite crucial. If one removes too few, the final stage of finding pathogens might get irritated.<br />
On the other hand, if one removes too many regions, positive hits might get removed early before detection. This surely must be avoided.<br />
<br />
We opted for a simple thresholding step because it showed that while being easy, it is an effective weapon against the uniform background. In fact, the good image quality we wanted to reach with our device allows now less sophisticated methods.<br />
Also the less computational intensive the steps are, the better they might even run directly on the Raspberry Pi in our device!<br />
<br />
The HSV thresholding is performed on each component seperately. For more information on the HSV color space we refer to [http://en.wikipedia.org/wiki/HSL_and_HSV Wikipedia]. The first component is the hue which we select to be inbetween $0.462$ and $0.520$ to select any blue-greenish color. We will not see bright green due to the filter selection in our device.<br />
The saturation value must be high, between $0.99$ and $1.0$.<br />
Moreover, the value component of the HSV image has to lie between $0.25$ and $0.32$, which assumes a relatively dark color.<br />
<br />
Indeed, these values are not problem specific, but specific for each setup and therefore have to be determined empirically.<br />
<br />
The remainder of this stage creates a mask of pixels that fulfill the conditions.<br />
<br />
* image of masked bit<br />
<br />
<html><br />
<div class="codediv"><br />
<pre><code class="matlab"><br />
% Auto-generated by colorThresholder app on 15-Oct-2014<br />
%-------------------------------------------------------<br />
function [maskedRGBImage] = createMask(srmimg)<br />
RGB = srmimg;<br />
<br />
% Convert RGB image to chosen color space<br />
I = rgb2hsv(RGB);<br />
<br />
% Define thresholds for channel 1 based on histogram settings<br />
channel1Min = 0.462;<br />
channel1Max = 0.520;<br />
<br />
% Define thresholds for channel 2 based on histogram settings<br />
channel2Min = 0.99;<br />
channel2Max = 1.000;<br />
<br />
% Define thresholds for channel 3 based on histogram settings<br />
channel3Min = 0.25;<br />
channel3Max = 0.32;<br />
<br />
% Create mask based on chosen histogram thresholds<br />
BW = (I(:,:,1) >= channel1Min ) & (I(:,:,1) <= channel1Max) & ...<br />
(I(:,:,2) >= channel2Min ) & (I(:,:,2) <= channel2Max) & ...<br />
(I(:,:,3) >= channel3Min ) & (I(:,:,3) <= channel3Max);<br />
<br />
% Initialize output masked image based on input image.<br />
maskedRGBImage = RGB;<br />
<br />
% Set background pixels where BW is false to zero.<br />
maskedRGBImage(repmat(~BW,[1 1 3])) = 0;<br />
<br />
end<br />
</code></pre><br />
</div><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_Classify_button.png|right|150px]]<br />
<br />
== Classification ==<br />
<span class="anchor" id="classification"></span><br />
<br />
=== Smoothness Index ===<br />
<br />
For position prediction in virtual environments, jitter or noise in the output signal is not wanted though often present.<br />
Since discovering smooth areas is a similar problem to jitter detection, a simple method for determining jitter can be used to measure non-jitter, smoothness (Joppich, Rausch and Kuhlen, 2013).<br />
It is assumed that jitter-free areas of a position signal do not differ in velocity.<br />
<br />
Smooth areas do not differ in intensity, and therefore only low changes in velocity (intensity change) can be recorded.<br />
For the reduction of noise, this operation is performed on the smoothed input image.<br />
Then the smoothness $s$ of a pixel $p$ in its k-neighbourhood $\mathcal{N}_k$ can be determined as:<br />
\begin{equation}<br />
s(p) = \sum\limits_{p' \in \mathcal{N}_k} \nabla(p') / \arg\max\limits_{p} s(p)<br />
\end{equation}<br />
<br />
Using thresholding, $TS_l \leq s(p) \leq TS_u \wedge TI_l \leq I \leq TI_u$, different areas, such as background or pathogen, can be selected.<br />
<br />
For the empirical choice of thresholds, it can be argued that these are tailored to the specific case.<br />
While this surely is true to a certain extent, the here presented method has been successfully tested on images from a completely different domain, and no changes to the thresholds have been made to make it work.<br />
A proper theoretical evaluation is emphasized, however, is probably not the aim of the iGEM competition.<br />
<br />
Finally, selecting for the red region, this delivers the location of possible pathogens.<br />
Since the size of the agar chips is variable but fixed a quantitative analysis can be performed by counting pixels for instance.<br />
<br />
=== Empirical Evaluation ===<br />
<br />
Using our MATLAB code we found the lower threshold for the smoothness index to be $TS_l = 0.85$ and the upper threshold $TS_u = \infty$.<br />
Similarly, for $TI_l = 235$ and $TI_u = \infty$.<br />
<br />
Using these settings, we can find a response already in images taken after 42&nbsp;minutes.<br />
<br />
Ideally, one would rate the quality of the image segmentation using some ground truth, such as manual delineations. This still has to be done for our method.<br />
However, from visual observations, our method is showing promising results.<br />
<br />
* image of smoothness index<br />
<br />
=== Automatic Classification ===<br />
<br />
<br />
<html><br />
<div class="codediv"><br />
<pre><code class="matlab"><br />
function [mask, seg] = automaticseeds(im)<br />
<br />
imc = im;<br />
<br />
%% to grayscale and filtering<br />
Z = double(rgb2gray(im));<br />
Z = 255 * Z / max(max(Z));<br />
<br />
filtertype = 'disk';<br />
Z = filter2(fspecial(filtertype), Z);<br />
Z = filter2(fspecial(filtertype), filter2(fspecial(filtertype), Z));<br />
Z = 255 * Z / max(max(Z)); <br />
<br />
%% calculating similarity score/smoothness index<br />
k=4;<br />
sSI = similarity(Z,k);<br />
sSI = sSI / max(max(sSI)); <br />
<br />
%% classify<br />
pathogene = ((sSI > 0.85) == 1) & ((Z > 235) == 1); <br />
<br />
mask = ones( size(imc) );<br />
seg = zeros( size(imc) );<br />
<br />
<br />
%% output<br />
for i=1:size(im,1)<br />
for j=1:size(im,2)<br />
<br />
if (pathogene(i,j) == 1)<br />
seg(i,j,1:3) = [255 0 0];<br />
mask(i, j, 1:3) = [0 0 0];<br />
end<br />
end<br />
end<br />
end<br />
</code></pre><br />
</div><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
== Achievements ==<br />
<span class="anchor" id="measurartyachievements"></span><br />
<br />
''Measurarty'' is the image analysis logic behind our project.<br />
It is comprised of simple constructs put together into a pipeline, that is clearly laid out, easily maintainable and - if needed - easily adaptable.<br />
For example, changing from green to red fluorescence, only means to change the ''createMask'' function to select another target area.<br />
<br />
Overall the results look convincing. We have not yet performed a comparison to a manual delineation, however, by eye the results look promising and have a low error.<br />
<br />
Talking about computational complexity, the MATLAB code of course performs better than our own C++ implementation, which must be regarded as a proof-of-principle.<br />
<br />
Space-wise, the code depends heavily on the image size $O( x \cdot y)$ (width $x$, height $y$, which also limits the number of edges in SRM between regions, as each pixel is one region to start with. However, it cannot take less memory, as the image is stored in an uncompressed format.<br />
<br />
On the computational side, the thresholding, image conversion and gradient steps are linear in the number of pixels, and are thus in $O(x \cdot y)$.<br />
Unfortunately, the summation of the gradient for the smoothness index adds a heavy factor to it (k-neighbourhood for smoothness index).<br />
Due to the merging step in our C++-SRM algorithm implementation, our code has to do $O(x^2 \cdot y^2)$ comparisons, which then finally results in a runtime complexity of $O( x^2 \cdot y^2)$.<br />
<br />
*include image here<br />
<br />
From the above figure it can also be seen that the detected amount of pathogenic-area correlates with time after induction.<br />
The lag-phase can be explained first by the lag-phase of the cells, which first need to generate a response to the pathogen, and on the other hand, by too low fluorescence which is not detectable.<br />
The pixel count also meets the expectation when looking at the sample files by eye.<br />
<br />
It can be concluded that the ''Measurarty'' pipeline defines a robustly working chip-analysis algorithm which can detect pathogens from images supplied by ''WatsOn''.<br />
Therefore, this algorithm closes the gap between our biology, detection hardware and the user who wants easy-to-interpret results.<br />
<br />
For future prospects, it would be interesting to do a proper performance analysis on our code, to find hotspots and optimize the code. Many ''for''-loops leave plenty of room for vectorization and loop-unrolling. Parallelization, specifically with respect to embedded hardware such as the Raspberry Pi or Odroid U3, is limited to the extend that the overhead created would probably eliminate the improvements.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== Source Code ==<br />
<span class="anchor" id="source"></span><br />
<br />
''Measuarty'' is the image analysis logic behind our project. It has been prototyped and developed in [http://www.mathworks.de/academia/student-competitions/igem/ MATLAB], and only later been ported into our ''WatsOn'' GUI.<br />
<br />
We are happy to provide you with a zip-ped download of our MATLAB code here, as well as on the iGEM softwarerepository on [https://github.com/orgs/igemsoftware/teams/aachen2014 github].<br />
<br />
* MATLAB code<br />
* link [https://github.com/orgs/igemsoftware/teams/aachen2014 github]<br />
<br />
For the C++ conversion please see [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsonsoftware our WatsOn Software] section.<br />
<br />
=== Using the MATLAB Code ===<br />
<br />
In general, please follow the included ''README.MD'' file. Our package comes with a set of test files from one of our experiments.<br />
After installing the Statistical Region Merging code (see readme), you can simply run ''igem_srm_demo.m''. Select your current folder, and MATLAB will automatically segment and classify the included jpg-images.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
<span class="anchor" id="measurartyrefs"></span><br />
<br />
* Boltz, S. (2009, October 20). Image segmentation using statistical region merging - File Exchange - MATLAB Central. Image segmentation using statistical region merging. Retrieved December 12, 2013, from http://www.mathworks.com/matlabcentral/fileexchange/25619-image-segmentation-using-statistical-region-merging<br />
<br />
* Joppich, M., Rausch, D., & Kuhlen, T. (2013). Adaptive human motion prediction using multiple model approaches.. Virtuelle und erweiterte Realität (p. 169–180). 10. Workshop der GI-Fachgruppe VR/AR: Shaker.<br />
<br />
* Nock, R., & Nielsen, F. (2004). Statistical region merging. IEEE Transactions on Pattern Analysis and Machine Intelligence, 26(11), 1452-1458.<br />
<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/ODFTeam:Aachen/Notebook/Engineering/ODF2014-10-17T21:29:20Z<p>StefanReinhold: /* Construction Steps */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
{{Team:Aachen/Stylesheet}}<br />
= OD/F Device =<br />
<br />
On this page we present the technical details of our OD/F Device. You can skip to specific chapters by clicking on the panels below:<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#dev" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br><br />
<b>General Considerations</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#od" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>OD Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/04/Aachen_Cuvette_button_v1_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#f" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>F Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
= General Considerations =<br />
<span class="anchor" id="dev"></span><br />
<br />
Building the OD/F Device has been an interesting task. While this device has been developed mainly by the IT division of our team, we got an immense support from the biologists suffering from color-blindness, yet eager to help selecting the best color filters for the LEDs.<br />
<br />
The measuring principle and guidelines for this project have already been presented in the [https://2014.igem.org/Team:Aachen/OD/F_device project] section.<br />
Here, details about selecting filters, code and a construction manual are presented.<br />
<br />
=== Cuvette Holder ===<br />
The essential part of this device is the '''cuvette holder'''. In short, we had to overcome a dilemma created by the need for an optimal height for the sensor:<br />
* A too low sensor position bears problems with sedimentation as well as light diffraction from the bottom of the cuvette.<br />
* The sensor has to be as close as possible to the bottom so that enough light shines through for the fluorescence measurement.<br />
<br />
As a compromise, we place the sensor at a height of 0.75&nbsp;cm. It is comparable to one of the standard heights (0.2&nbsp;cm, 0.8&nbsp;cm, 1.2&nbsp;cm) of OD meters. It is important to note that our device works with filling volumens of just 1&nbsp;mL, which in fact comes close to reality in the lab.<br />
<br />
The final cuvette holder design is rendered from a [https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=raw stl-file] shown below:<br />
<br />
<html><br />
<center> <br />
<iframe src="https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=render<br />
" width=500px height=500px frameBorder="0"></iframe><br />
<br/><br />
<b>Cuvette Holder devloped for our OD/F Device.</b><br />
</center><br />
</html><br />
<br />
=== Light Filters ===<br />
'''Finding the right and optimal filters is a tough challenge'''.<br />
The main goal throughout our project has been to choose easily available parts which are also inexpensive. Thus choosing Schott glasses as filters could not be considered. Alternatively, filters used for illumination of theaters were found to be an ideal solution.<br />
<br />
We tested serveral filters and the optimal configuration of filters used is listed below.<br />
<br />
{| class="wikitable"<br />
! Mode<br />
! Fluorescence Protein<br />
! Filter Name<br />
! Filter<br />
! Peak Excitation<br />
! Peak Emission<br />
|-<br />
| Fluorescence<br />
| [http://parts.igem.org/Part:BBa_E0040 GFPmut3b]<br />
| [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green]<br />
| [[File:Aachen_Filter_736.png|200px]]<br />
| 501nm<br />
| 511nm<br />
|-<br />
| Optical Density<br />
| --<br />
| [http://leefilters.com/lighting/colour-details.html#019 Fire]<br />
| [[File:Aachen_Filter_019.png|200px]]<br />
| 600nm<br />
| 600nm<br />
|}<br />
<br />
The fluorescence protein [http://parts.igem.org/Part:BBa_E0040 GFPmut3b] has a peak excitation at 501&nbsp;nm and a peak emission at 511&nbsp;nm - too close together for our low-cost filters to block the excitation light but transmit the emitted light. Thus, we chose to excite at around 485&nbsp;nm reduce false positive results below 500&nbsp;nm. However, no adequate filter for these settings could be found.<br />
Eventually, using the dark greenish [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green] filter only little amounts of light shorter than 500&nbsp;nm gets through, reducing any bias from excitation illumination significantly. Unfortunately, the transmission rate of this filter is quite bad, 20% only, for the target emission wavelength of 511&nbsp;nm.<br />
<br />
== Linearity of the Hardware Light Sensor ==<br />
<span class="anchor" id="lin"></span><br />
It is crucial that the selected hardware is mapping reality into the digital world of our $\mu$-Controller.<br />
In order to sense reality our setup uses a light to frequency sensor, [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf TSL235R-LF].<br />
The light to frequency sensor resembles the most to a photo transistor and thus is less sensible to temperature than a light dependant resistor.<br />
Additionally counting a frequency using interrupts seems to be easier and more accurate than using the analog to digital converter.<br />
<br />
Using a dilution series of purified [https://2011.igem.org/Team:Glasgow/LOV2 iLOV] we could determine the characteristic curve for the light sensor. Finally we can conclude that the sensor is linear as expected and shown in the [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf datasheet].<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Linearity iFG.PNG|title=Linearity of TSL235R-LF sensor|subtitle=Dilution series of GFP expressing ''E. coli'' showing linearity between fluorescence count and dilution. The linearity of the chosen sensor can be determined.|width=700px}}<br />
<br />
We are measuring optical density using our in-house developed cuvette holder.<br />
Particularly for optical density measurement, the amount of light shining through the sample is crucial.<br />
If there is too few light, there will be not enough light registered at the sensor, and the resolution of the measurement shrinks. This should be prevented.<br />
The chosen light to frequency sensor is reported to be very sensitive on the amount of light shining on it.<br />
There are reports of the sensor breaking when put into [https://www.sparkfun.com/products/9768 sunlight on a nice day], and not being sensitive at both high light or low light [http://kesslerarduino.wordpress.com/author/kevinmkessler/page/2/ conditions].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
[[File:Aachen_Cuvette_button_v1_ipo.png|right|150px]]<br />
<br />
= Evaluation of the Optical Density Measurement =<br />
<span class="anchor" id="od"></span><br />
<br />
=== From Transmittance to True Optical Density ===<br />
At very low levels, uncorrected photometric determinations of cell densities show a decreasing proportionaility to actual cell density.<br />
<br />
This can also be observed using our device.<br />
<br />
In general, photometric determination of bacterial concentrations depends primarily on light scattering, rather than light absorption. Therefore, often not absorption is measured, but transmittance. For this, the relationship between optical density (OD) and transmitted light $\frac{I_0}{I}$ exists as:<br />
<br />
$$ OD = \frac{I_0}{I} = \kappa \cdot c$$<br />
<br />
where $I_0$ is the intensity of incoming light and $I$ the amount of the light passing through.<br />
<br />
However, this equation is linear only in a certain range.<br />
While one can tackle this non-linearity by using dilutions of the culture, correcting the error systematically is another way to overcome this limitation.<br />
<br />
For our OD device we needed to correlate the transmittance measured by our sensor to an optical density anyway.<br />
Our team members from the deterministic sciences emphasized on the correction method, which was conducted according to Lawrence and Maier (2006):<br />
<br />
* The relative density ($RD$) of each sample in a dilution series is calculated using $\frac{min(dilution)}{dilution}$.<br />
* The uncorrected optical density is derived from the transmission T [%]: $OD = 2 - \log T$<br />
* Finally, the unit optical density is calculated as $\frac{OD}{TD}$.<br />
* The average of the stable unit optical densities is used to calculate the true optical density $ OD_{unit} \cdot RD $.<br />
This way, the correlation between transmission and true optical density can be computed.<br />
The derived function allows the conversion from transmission to optical density on our device and therefore calibrates our device.<br />
<br />
<br />
In our experiments, we find in accordance to Lawrence and Maier that the correction majorly depends on the technical equipment used, especially the LED, sensor and cuvettes.<br />
While this at first sight looks disappointing, it is also expected:<br />
Transmittance is the fraction of light not absorbed by some medium relative to the cell-free and clear medium.<br />
However, the transmittance is not only dependent on the amount of cells in the way of the light's beam, but also how much light shines through the cuvette in which fashion, and in which fraction is received by the sensor in which angles.<br />
<br />
Using the above formula we performed this experiment for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae'' and asked team [https://2014.igem.org/Team:Aachen/Collaborations/Freiburg Freiburg] to perform the same experiment using mamallian cells.<br />
<br />
=== Experiments ===<br />
<br />
We performed several experiments during the development of the device.<br />
Finally, we can relate the measured transmittance to the true Optical Density (true OD), and further, we can relate the true OD to the true OD of the photospectrometer in our lab.<br />
By doing so, we can calibrate our device to meaningful values.<br />
<br />
We have done this according to the previous section for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae''.<br />
<br />
The final function for calculating the OD from the transmission calculated by our device can be calculated as<br />
<br />
$$ OD(T) = f(T) \circ g(device) $$<br />
<br />
where $f$ transforms transforms transmittance $T$ to true optical density for our device, and $g$ transforms true optical density of our device into the true optical density of the photospectrometer. This way our device is calibrated according to the photospectrometer.<br />
<br />
==== ''Pseudomonas putida'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida iFG.PNG|title=True Optical Density to Transmittance plot for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
==== ''Saccharomyces cerevisiae'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer iFG.PNG|title=True Optical Density to Transmittance plot for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
From these plots, it can be seen that our device delivers robust and reproducible results for both procaryotes and eucaryotes.<br />
Also the function from transmittance to true OD follows a clear pattern, making its calculation possible on a low-end device like a microcontroller.<br />
<br />
It is interesting to observer that function $g$, mapping the true OD of our device to the true OD of the photospectrometer, are close together for both ''P. putida'' and ''S. cerivisae'', as seen by the regression coefficient.<br />
In fact, 3.416 and 3.461 are such close together, that the minor deviation could be just measuring inaccuracy.<br />
Therefore, we fix the regression coefficient for converting true OD of our device to true OD of the photospectrometer to an average of 3.432 .<br />
<br />
Additionally the function $f$ for mapping transmittance to true OD for our device is similar for all cell types, as seen in the following figure. Therefore the exponential regression curve for all cell types specifies this function.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_ODallstrains1.png|title=Transmission of different cell types at OD-values from 0.001-1|subtitle=The transmittance data of NIH&nbsp;3T3 cells (mouse fibroblasts) align with the transmittance of ''P.&nbsp;putida'' and ''S.&nbsp;cerevisiae'' strains, even though the measured optical densities are lower by 1-2 orders of magnitude.|width=800px}}<br />
</center><br />
Finally, we have empirically determined our $OD(T)$ function by finding $f$ and $g$, such that we can convert true OD to the optical density of the photospectrometer.<br />
<br />
By this evaluation, we have shown that our self-build OD/F Device can compete with commercial systems.<br />
It is easy to calibrate by just calculating the true optical density.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_17-10-14_Glowing_cuvette-ipo.png|right|150px]]<br />
<br />
= Evaluation of the Fluorescence Measurement =<br />
<span class="anchor" id="f"></span><br />
<br />
For the evaluation of the fluorescence measurement, we performed a dilution series of a constitutively GFPmut3b expressing ''E. coli''.<br />
<br />
The below figure shows the absolute measurements for both the platereader and our OD/F Device. The abrupt jump at 50% concentration can be explained by a second dilution step and is prevalent in both devices.<br />
It can be seen that the platereader show a much higher difference between the GFP and non-GFP cell culture at a higher standard deviation.<br />
Another interesting metric is the difference between the GFP and non-GFP, which can be seen as the normalized fluorescence measure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachn 15-10-14 F platereader ODF iFG.PNG|title=Fluorescence Measurement comparison OD/F Device and Platereader (absolute values)|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F Device shows no significant linearity.|width=700px}}<br />
</center><br />
<br />
If one compares the results there, as in the below figure with normalized fluorescence values, interesting observations can be made.<br />
First, both platereader and OD/F Device show very similar results.<br />
The regression curves differ only in a linear factor.<br />
Most interestingly the general fit of the OD/F Device to a linear function seems to be better than the platereader.<br />
Overall the linearity which has been observed earlier (in testing the general setup) could be verified.<br />
Therefore our do-it-yourself OD/F Device can be used to determine fluorescence.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 F platereader ODF2 iFG.PNG|title=Fluorescence Measurement comparison OD/F Device and platereader using normalized fluorescence values|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F Device shows no significant. A non-GFP expressing ''E. coli'' dilution has been used to normalize the GFP dilution series. A linear correlation can be seen.|width=700px}}<br />
</center><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How to Build Your Own Device =<br />
<span class="anchor" id="diy"></span><br />
== Technical Components ==<br />
<br />
While the casing and the cuvette holder are custom made, most of the parts are pre-made and can be readily bought. The previous section lists all needed parts.<br />
To get all these parts for creating your own OD/F Device is easy using the internet. Thus all '''potential customers have a market access''' to the used components. <br />
<br />
Please find our custom parts for download below. Despite being custom parts, these are quite inenxpensive - so feel free to give our OD/F Device a test! For printing the 3D model of our cuvette holder and laser cutting our case, we want to express many thanks to [http://hci.rwth-aachen.de/fablab Fablab Aachen].<span class="anchor" id="ref2"></span><br />
<br />
* cuvette holder [https://2014.igem.org/Template:Team:Aachen/cuvette.stl?action=raw STL file]<br />
* casing single device [https://2014.igem.org/File:Aachen_ODF_device_casing.svg.zip SVG file]<br />
* lid combined device [https://2014.igem.org/File:Aachen_Odf_device_combined_lid.svg.zip SVG file]<br />
* Arduino Code for single device [https://2014.igem.org/Template:Team:Aachen/arduino_single.ino?action=raw Sketchbook (.ino)]<br />
* Arduino Code for combined device [https://2014.igem.org/Template:Team:Aachen/arduino_combined.ino?action=raw Sketchbook (.ino)]<br />
<br />
You will need a special [http://www.exp-tech.de/images/product_images/description%20images/YWRobot/1602/LiquidCrystal_I2C1602V2.rar library] for the display, which can not be uploaded for legal reasons.<br />
<br />
<br />
<center><br />
'''All needed components their quantities and prices for creating your own OD/F Device'''<br />
{| class="wikitable"<br />
! align="center" |'''OD/F Device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs [€] !! Costs [$] !! Final [€] !! Final [$] <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]||9.17||11.65||9.17||11.65 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/ams/TSL235R-LF/?qs=14HO7rLZPQsjmBHaoYCzkA%3D%3D TSL 235R]||2.47||3.14||2.47||3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356 Display 16x2]||2.58||3.28||2.58||3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]||1.57||1.99||1.57||1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]||2.90||3.69||2.90||3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]||1.57||2.00||1.57||2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]||0.09||0.11||1.80||2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]||1.98||2.51||1.98||2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893 power supply]||2.20||2.80||2.20||2.80<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)||7.98||10.14||7.98||10.14<br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913 Prototype Universal Printed Circuit Board]||2.27||2.88||2.27||2.88<br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191o Male Headers]||2.14||2.72||2.14||2.72<br />
|- style="border-top: 2px solid #808080;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600&nbsp;nm]||0.94||1.19||0.94||1.19<br />
|-<br />
! -!!Total OD!!-!!-!! 46.01 !! 58.45 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
! -!!Total F!!-!!-!! 46.06 !! 58.52 <br />
|- style="border-top: 2px solid #808080;;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]||0.94||1.19||0.94||1.19 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
! -!!Total OD/F!!-!!-!! 53.44 !! 67.89 <br />
|-<br />
|}<br />
</center><br />
<br />
For more detailed economical information about the OD/F project visit our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
== Breadboards ==<br />
<br />
=== Optical Density ===<br />
<br />
{{Team:Aachen/Figure|Aachen ODdevice Steckplatine.png|align=center|title=Breadboard of our OD device|subtitle=To build your own OD device, connect the parts as shown in this diagram.|width=900px}}<br />
<br />
If you want to build our OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#019 Fire 019]<br />
* LED: [http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== 600 nm] Dialight 550-2505F<br />
<br />
=== Fluorescence ===<br />
<br />
{{Team:Aachen/Figure|Aachen_Fdevice_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
If you want to build the OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#736 Twickenham Green 736]<br />
* LED: [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html 480 nm] NSPBR70BSS LED<br />
<br />
=== Combined Device ===<br />
Even though evaluation of the measurements have been performed in two separate device, it is fairly well possible to put everything into one casing.<br />
All you need to do is choosing another lid, and connect a second light to frequency sensor to your Arduino.<br />
Right at the bottom we present you the differences in wiring things up.<br />
Building the combined device is straight forward and very similar to the single device. You will need a slightly larger connector, a different lid for your case, and some more cables. The corresponding fritzing-layout is presented below.<br />
<br />
{{Team:Aachen/Figure|Aachen_ODF_combined_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
<br />
== Construction Steps ==<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_ODF_9.JPG|300px]] || First we want to assemble the casing. Once you have all the cut parts, you can start to assemble them. For cutting, we really recommend using a laser cutter.<br />
|-<br />
| [[File:Aachen_ODF_8.JPG|300px]] || Attach the cuvette-holder holders such that the cuvette holder is placed directly under the opening hole.<br />
|-<br />
| [[File:Aachen_ODF_4.JPG|300px]] || Next build the lid of the device. At this stage you can already mount the button. We recommend to glue any parts.<br />
|-<br />
| [[File:Aachen_ODF_3.JPG|300px]] || Your lid finally should look like this.<br />
|-<br />
| [[File:Aachen_ODF_11.JPG|150px]][[File:Aachen_ODF_10.JPG|150px]] || Next we want to assemble the cuvette holders. On the side with the square hole attach the light-to-frequency sensor with glue. For the OD case place the orange LED opposite, or for fluorescence, the LED in the hole in the bottom. Make sure to close any remaining open hole! Please attach a piece of filter foil (approx. $7 \times 7 mm^2$) from the inside in front of the light to frequency converter. Forceps is highly recommended.<br />
|-<br />
| [[File:Aachen_ODF_12.JPG|300px]] || Your final assembly should then look like this. Now place the correct filter into the cuvette holder, directly in front of the sensor. Make sure that the filter does not degrade due to the glue!<br />
|-<br />
| [[File:Aachen_ODF_14.JPG|300px]] || As the case can be used for both, fluorescence and OD measurement, we use a combined plug. Just three header rows (7 pins, 9pins for combined) and connect them as we did.<br />
|-<br />
| [[File:Aachen_ODF_1.JPG|300px]] || Now we're doing the wiring. Connect the Arduino 5V and GND such that you have one 5V and one GND line on your breadboard.<br />
|-<br />
| [[File:Aachen_ODF_2.JPG|300px]] || Then connect the button to 5V on the one side, and to GND via a resistor on the other side. Connect this side also to port __ on your Arduino. This will sense the blank. Next connect the display to the Arduino and our connector. See the Fritzing diagram at the bottom for a detailed information.<br />
|-<br />
| [[File:Aachen_ODF_13.JPG|300px]] || Now put everything into the case and ...<br />
|-<br />
| [[File:Aachen_ODF_6.JPG|300px]] || ... also place the cuvette holder into the device. Attach the display to the device lid and close the casing.<br />
|-<br />
| [[File:Aachen_ODF_7.JPG|300px]] || Congratulations! You have finished constructing your own OD/F Device!<br />
|-<br />
| [[File:Aachen_zwei_Kuevetten.jpg|300px]] || ... or even the combined device!<br />
|}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
Lawrence, J. V., & Maier, S. (1977). Correction for the inherent error in optical density readings. Applied and Environmental Microbiology, 33(2), 482–484. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=170707&tool=pmcentrez&rendertype=abstract.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/ODFTeam:Aachen/Notebook/Engineering/ODF2014-10-17T21:29:03Z<p>StefanReinhold: /* Technical Components */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
{{Team:Aachen/Stylesheet}}<br />
= OD/F Device =<br />
<br />
On this page we present the technical details of our OD/F Device. You can skip to specific chapters by clicking on the panels below:<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#dev" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br><br />
<b>General Considerations</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#od" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>OD Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/04/Aachen_Cuvette_button_v1_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#f" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>F Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
= General Considerations =<br />
<span class="anchor" id="dev"></span><br />
<br />
Building the OD/F Device has been an interesting task. While this device has been developed mainly by the IT division of our team, we got an immense support from the biologists suffering from color-blindness, yet eager to help selecting the best color filters for the LEDs.<br />
<br />
The measuring principle and guidelines for this project have already been presented in the [https://2014.igem.org/Team:Aachen/OD/F_device project] section.<br />
Here, details about selecting filters, code and a construction manual are presented.<br />
<br />
=== Cuvette Holder ===<br />
The essential part of this device is the '''cuvette holder'''. In short, we had to overcome a dilemma created by the need for an optimal height for the sensor:<br />
* A too low sensor position bears problems with sedimentation as well as light diffraction from the bottom of the cuvette.<br />
* The sensor has to be as close as possible to the bottom so that enough light shines through for the fluorescence measurement.<br />
<br />
As a compromise, we place the sensor at a height of 0.75&nbsp;cm. It is comparable to one of the standard heights (0.2&nbsp;cm, 0.8&nbsp;cm, 1.2&nbsp;cm) of OD meters. It is important to note that our device works with filling volumens of just 1&nbsp;mL, which in fact comes close to reality in the lab.<br />
<br />
The final cuvette holder design is rendered from a [https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=raw stl-file] shown below:<br />
<br />
<html><br />
<center> <br />
<iframe src="https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=render<br />
" width=500px height=500px frameBorder="0"></iframe><br />
<br/><br />
<b>Cuvette Holder devloped for our OD/F Device.</b><br />
</center><br />
</html><br />
<br />
=== Light Filters ===<br />
'''Finding the right and optimal filters is a tough challenge'''.<br />
The main goal throughout our project has been to choose easily available parts which are also inexpensive. Thus choosing Schott glasses as filters could not be considered. Alternatively, filters used for illumination of theaters were found to be an ideal solution.<br />
<br />
We tested serveral filters and the optimal configuration of filters used is listed below.<br />
<br />
{| class="wikitable"<br />
! Mode<br />
! Fluorescence Protein<br />
! Filter Name<br />
! Filter<br />
! Peak Excitation<br />
! Peak Emission<br />
|-<br />
| Fluorescence<br />
| [http://parts.igem.org/Part:BBa_E0040 GFPmut3b]<br />
| [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green]<br />
| [[File:Aachen_Filter_736.png|200px]]<br />
| 501nm<br />
| 511nm<br />
|-<br />
| Optical Density<br />
| --<br />
| [http://leefilters.com/lighting/colour-details.html#019 Fire]<br />
| [[File:Aachen_Filter_019.png|200px]]<br />
| 600nm<br />
| 600nm<br />
|}<br />
<br />
The fluorescence protein [http://parts.igem.org/Part:BBa_E0040 GFPmut3b] has a peak excitation at 501&nbsp;nm and a peak emission at 511&nbsp;nm - too close together for our low-cost filters to block the excitation light but transmit the emitted light. Thus, we chose to excite at around 485&nbsp;nm reduce false positive results below 500&nbsp;nm. However, no adequate filter for these settings could be found.<br />
Eventually, using the dark greenish [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green] filter only little amounts of light shorter than 500&nbsp;nm gets through, reducing any bias from excitation illumination significantly. Unfortunately, the transmission rate of this filter is quite bad, 20% only, for the target emission wavelength of 511&nbsp;nm.<br />
<br />
== Linearity of the Hardware Light Sensor ==<br />
<span class="anchor" id="lin"></span><br />
It is crucial that the selected hardware is mapping reality into the digital world of our $\mu$-Controller.<br />
In order to sense reality our setup uses a light to frequency sensor, [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf TSL235R-LF].<br />
The light to frequency sensor resembles the most to a photo transistor and thus is less sensible to temperature than a light dependant resistor.<br />
Additionally counting a frequency using interrupts seems to be easier and more accurate than using the analog to digital converter.<br />
<br />
Using a dilution series of purified [https://2011.igem.org/Team:Glasgow/LOV2 iLOV] we could determine the characteristic curve for the light sensor. Finally we can conclude that the sensor is linear as expected and shown in the [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf datasheet].<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Linearity iFG.PNG|title=Linearity of TSL235R-LF sensor|subtitle=Dilution series of GFP expressing ''E. coli'' showing linearity between fluorescence count and dilution. The linearity of the chosen sensor can be determined.|width=700px}}<br />
<br />
We are measuring optical density using our in-house developed cuvette holder.<br />
Particularly for optical density measurement, the amount of light shining through the sample is crucial.<br />
If there is too few light, there will be not enough light registered at the sensor, and the resolution of the measurement shrinks. This should be prevented.<br />
The chosen light to frequency sensor is reported to be very sensitive on the amount of light shining on it.<br />
There are reports of the sensor breaking when put into [https://www.sparkfun.com/products/9768 sunlight on a nice day], and not being sensitive at both high light or low light [http://kesslerarduino.wordpress.com/author/kevinmkessler/page/2/ conditions].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
[[File:Aachen_Cuvette_button_v1_ipo.png|right|150px]]<br />
<br />
= Evaluation of the Optical Density Measurement =<br />
<span class="anchor" id="od"></span><br />
<br />
=== From Transmittance to True Optical Density ===<br />
At very low levels, uncorrected photometric determinations of cell densities show a decreasing proportionaility to actual cell density.<br />
<br />
This can also be observed using our device.<br />
<br />
In general, photometric determination of bacterial concentrations depends primarily on light scattering, rather than light absorption. Therefore, often not absorption is measured, but transmittance. For this, the relationship between optical density (OD) and transmitted light $\frac{I_0}{I}$ exists as:<br />
<br />
$$ OD = \frac{I_0}{I} = \kappa \cdot c$$<br />
<br />
where $I_0$ is the intensity of incoming light and $I$ the amount of the light passing through.<br />
<br />
However, this equation is linear only in a certain range.<br />
While one can tackle this non-linearity by using dilutions of the culture, correcting the error systematically is another way to overcome this limitation.<br />
<br />
For our OD device we needed to correlate the transmittance measured by our sensor to an optical density anyway.<br />
Our team members from the deterministic sciences emphasized on the correction method, which was conducted according to Lawrence and Maier (2006):<br />
<br />
* The relative density ($RD$) of each sample in a dilution series is calculated using $\frac{min(dilution)}{dilution}$.<br />
* The uncorrected optical density is derived from the transmission T [%]: $OD = 2 - \log T$<br />
* Finally, the unit optical density is calculated as $\frac{OD}{TD}$.<br />
* The average of the stable unit optical densities is used to calculate the true optical density $ OD_{unit} \cdot RD $.<br />
This way, the correlation between transmission and true optical density can be computed.<br />
The derived function allows the conversion from transmission to optical density on our device and therefore calibrates our device.<br />
<br />
<br />
In our experiments, we find in accordance to Lawrence and Maier that the correction majorly depends on the technical equipment used, especially the LED, sensor and cuvettes.<br />
While this at first sight looks disappointing, it is also expected:<br />
Transmittance is the fraction of light not absorbed by some medium relative to the cell-free and clear medium.<br />
However, the transmittance is not only dependent on the amount of cells in the way of the light's beam, but also how much light shines through the cuvette in which fashion, and in which fraction is received by the sensor in which angles.<br />
<br />
Using the above formula we performed this experiment for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae'' and asked team [https://2014.igem.org/Team:Aachen/Collaborations/Freiburg Freiburg] to perform the same experiment using mamallian cells.<br />
<br />
=== Experiments ===<br />
<br />
We performed several experiments during the development of the device.<br />
Finally, we can relate the measured transmittance to the true Optical Density (true OD), and further, we can relate the true OD to the true OD of the photospectrometer in our lab.<br />
By doing so, we can calibrate our device to meaningful values.<br />
<br />
We have done this according to the previous section for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae''.<br />
<br />
The final function for calculating the OD from the transmission calculated by our device can be calculated as<br />
<br />
$$ OD(T) = f(T) \circ g(device) $$<br />
<br />
where $f$ transforms transforms transmittance $T$ to true optical density for our device, and $g$ transforms true optical density of our device into the true optical density of the photospectrometer. This way our device is calibrated according to the photospectrometer.<br />
<br />
==== ''Pseudomonas putida'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida iFG.PNG|title=True Optical Density to Transmittance plot for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
==== ''Saccharomyces cerevisiae'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer iFG.PNG|title=True Optical Density to Transmittance plot for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
From these plots, it can be seen that our device delivers robust and reproducible results for both procaryotes and eucaryotes.<br />
Also the function from transmittance to true OD follows a clear pattern, making its calculation possible on a low-end device like a microcontroller.<br />
<br />
It is interesting to observer that function $g$, mapping the true OD of our device to the true OD of the photospectrometer, are close together for both ''P. putida'' and ''S. cerivisae'', as seen by the regression coefficient.<br />
In fact, 3.416 and 3.461 are such close together, that the minor deviation could be just measuring inaccuracy.<br />
Therefore, we fix the regression coefficient for converting true OD of our device to true OD of the photospectrometer to an average of 3.432 .<br />
<br />
Additionally the function $f$ for mapping transmittance to true OD for our device is similar for all cell types, as seen in the following figure. Therefore the exponential regression curve for all cell types specifies this function.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_ODallstrains1.png|title=Transmission of different cell types at OD-values from 0.001-1|subtitle=The transmittance data of NIH&nbsp;3T3 cells (mouse fibroblasts) align with the transmittance of ''P.&nbsp;putida'' and ''S.&nbsp;cerevisiae'' strains, even though the measured optical densities are lower by 1-2 orders of magnitude.|width=800px}}<br />
</center><br />
Finally, we have empirically determined our $OD(T)$ function by finding $f$ and $g$, such that we can convert true OD to the optical density of the photospectrometer.<br />
<br />
By this evaluation, we have shown that our self-build OD/F Device can compete with commercial systems.<br />
It is easy to calibrate by just calculating the true optical density.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_17-10-14_Glowing_cuvette-ipo.png|right|150px]]<br />
<br />
= Evaluation of the Fluorescence Measurement =<br />
<span class="anchor" id="f"></span><br />
<br />
For the evaluation of the fluorescence measurement, we performed a dilution series of a constitutively GFPmut3b expressing ''E. coli''.<br />
<br />
The below figure shows the absolute measurements for both the platereader and our OD/F Device. The abrupt jump at 50% concentration can be explained by a second dilution step and is prevalent in both devices.<br />
It can be seen that the platereader show a much higher difference between the GFP and non-GFP cell culture at a higher standard deviation.<br />
Another interesting metric is the difference between the GFP and non-GFP, which can be seen as the normalized fluorescence measure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachn 15-10-14 F platereader ODF iFG.PNG|title=Fluorescence Measurement comparison OD/F Device and Platereader (absolute values)|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F Device shows no significant linearity.|width=700px}}<br />
</center><br />
<br />
If one compares the results there, as in the below figure with normalized fluorescence values, interesting observations can be made.<br />
First, both platereader and OD/F Device show very similar results.<br />
The regression curves differ only in a linear factor.<br />
Most interestingly the general fit of the OD/F Device to a linear function seems to be better than the platereader.<br />
Overall the linearity which has been observed earlier (in testing the general setup) could be verified.<br />
Therefore our do-it-yourself OD/F Device can be used to determine fluorescence.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 F platereader ODF2 iFG.PNG|title=Fluorescence Measurement comparison OD/F Device and platereader using normalized fluorescence values|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F Device shows no significant. A non-GFP expressing ''E. coli'' dilution has been used to normalize the GFP dilution series. A linear correlation can be seen.|width=700px}}<br />
</center><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How to Build Your Own Device =<br />
<span class="anchor" id="diy"></span><br />
== Technical Components ==<br />
<br />
While the casing and the cuvette holder are custom made, most of the parts are pre-made and can be readily bought. The previous section lists all needed parts.<br />
To get all these parts for creating your own OD/F Device is easy using the internet. Thus all '''potential customers have a market access''' to the used components. <br />
<br />
Please find our custom parts for download below. Despite being custom parts, these are quite inenxpensive - so feel free to give our OD/F Device a test! For printing the 3D model of our cuvette holder and laser cutting our case, we want to express many thanks to [http://hci.rwth-aachen.de/fablab Fablab Aachen].<span class="anchor" id="ref2"></span><br />
<br />
* cuvette holder [https://2014.igem.org/Template:Team:Aachen/cuvette.stl?action=raw STL file]<br />
* casing single device [https://2014.igem.org/File:Aachen_ODF_device_casing.svg.zip SVG file]<br />
* lid combined device [https://2014.igem.org/File:Aachen_Odf_device_combined_lid.svg.zip SVG file]<br />
* Arduino Code for single device [https://2014.igem.org/Template:Team:Aachen/arduino_single.ino?action=raw Sketchbook (.ino)]<br />
* Arduino Code for combined device [https://2014.igem.org/Template:Team:Aachen/arduino_combined.ino?action=raw Sketchbook (.ino)]<br />
<br />
You will need a special [http://www.exp-tech.de/images/product_images/description%20images/YWRobot/1602/LiquidCrystal_I2C1602V2.rar library] for the display, which can not be uploaded for legal reasons.<br />
<br />
<br />
<center><br />
'''All needed components their quantities and prices for creating your own OD/F Device'''<br />
{| class="wikitable"<br />
! align="center" |'''OD/F Device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs [€] !! Costs [$] !! Final [€] !! Final [$] <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]||9.17||11.65||9.17||11.65 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/ams/TSL235R-LF/?qs=14HO7rLZPQsjmBHaoYCzkA%3D%3D TSL 235R]||2.47||3.14||2.47||3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356 Display 16x2]||2.58||3.28||2.58||3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]||1.57||1.99||1.57||1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]||2.90||3.69||2.90||3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]||1.57||2.00||1.57||2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]||0.09||0.11||1.80||2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]||1.98||2.51||1.98||2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893 power supply]||2.20||2.80||2.20||2.80<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)||7.98||10.14||7.98||10.14<br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913 Prototype Universal Printed Circuit Board]||2.27||2.88||2.27||2.88<br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191o Male Headers]||2.14||2.72||2.14||2.72<br />
|- style="border-top: 2px solid #808080;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600&nbsp;nm]||0.94||1.19||0.94||1.19<br />
|-<br />
! -!!Total OD!!-!!-!! 46.01 !! 58.45 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
! -!!Total F!!-!!-!! 46.06 !! 58.52 <br />
|- style="border-top: 2px solid #808080;;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]||0.94||1.19||0.94||1.19 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
! -!!Total OD/F!!-!!-!! 53.44 !! 67.89 <br />
|-<br />
|}<br />
</center><br />
<br />
For more detailed economical information about the OD/F project visit our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
== Breadboards ==<br />
<br />
=== Optical Density ===<br />
<br />
{{Team:Aachen/Figure|Aachen ODdevice Steckplatine.png|align=center|title=Breadboard of our OD device|subtitle=To build your own OD device, connect the parts as shown in this diagram.|width=900px}}<br />
<br />
If you want to build our OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#019 Fire 019]<br />
* LED: [http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== 600 nm] Dialight 550-2505F<br />
<br />
=== Fluorescence ===<br />
<br />
{{Team:Aachen/Figure|Aachen_Fdevice_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
If you want to build the OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#736 Twickenham Green 736]<br />
* LED: [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html 480 nm] NSPBR70BSS LED<br />
<br />
=== Combined Device ===<br />
Even though evaluation of the measurements have been performed in two separate device, it is fairly well possible to put everything into one casing.<br />
All you need to do is choosing another lid, and connect a second light to frequency sensor to your Arduino.<br />
Right at the bottom we present you the differences in wiring things up.<br />
Building the combined device is straight forward and very similar to the single device. You will need a slightly larger connector, a different lid for your case, and some more cables. The corresponding fritzing-layout is presented below.<br />
<br />
{{Team:Aachen/Figure|Aachen_ODF_combined_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
<br />
== Construction Steps ==<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_ODF_9.JPG|300px]] || First we want to assemble the casing. Once you have all the cut parts, you can start to assemble them. For cutting, we really recommend using a laser cutter.<br />
|-<br />
| [[File:Aachen_ODF_8.JPG|300px]] || Attach the cuvette-holder holders such that the cuvette holder is placed directly under the opening hole.<br />
|-<br />
| [[File:Aachen_ODF_4.JPG|300px]] || Next build the lid of the device. At this stage you can already mount the button. We recommend to glue any parts.<br />
|-<br />
| [[File:Aachen_ODF_3.JPG|300px]] || Your lid finally should look like this.<br />
|-<br />
| [[File:Aachen_ODF_11.JPG|150px]][[File:Aachen_ODF_10.JPG|150px]] || Next we want to assemble the cuvette holders. On the side with the square hole attach the light-to-frequency sensor with glue. For the OD case place the orange LED opposite, or for fluorescence, the LED in the hole in the bottom. Make sure to close any remaining open hole! Please attach a piece of filter foil (approx. $7 \times 7 mm^2$) from the inside in front of the light to frequency converter. Forceps is highly recommended.<br />
|-<br />
| [[File:Aachen_ODF_12.JPG|300px]] || Your final assembly should then look like this. Now place the correct filter into the cuvette holder, directly in front of the sensor. Make sure that the filter does not degrade due to the glue!<br />
|-<br />
| [[File:Aachen_ODF_14.JPG|300px]] || As the case can be used for both, fluorescence and OD measurement, we use a combined plug. Just three header rows (7 pins, 9pins for combined) and connect them as we did.<br />
|-<br />
| [[File:Aachen_ODF_1.JPG|300px]] || Now we're doing the wiring. Connect the Arduino 5V and GND such that you have one 5V and one GND line on your breadboard.<br />
|-<br />
| [[File:Aachen_ODF_2.JPG|300px]] || Then connect the button to 5V on the one side, and to GND via a resistor on the other side. Connect this side also to port __ on your Arduino. This will sense the blank. Next connect the display to the Arduino and our connector. See the Fritzing diagram at the bottom for a detailed information.<br />
|-<br />
| [[File:Aachen_ODF_13.JPG|300px]] || Now put everything into the case and ...<br />
|-<br />
| [[File:Aachen_ODF_6.JPG|300px]] || ... also place the cuvette holder into the device. Attach the display to the device lid and close the casing.<br />
|-<br />
| [[File:Aachen_ODF_7.JPG|300px]] || Congratulations! You have finished constructing your own OD/F device!<br />
|-<br />
| [[File:Aachen_zwei_Kuevetten.jpg|300px]] || ... or even the combined device!<br />
|}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
Lawrence, J. V., & Maier, S. (1977). Correction for the inherent error in optical density readings. Applied and Environmental Microbiology, 33(2), 482–484. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=170707&tool=pmcentrez&rendertype=abstract.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/ODFTeam:Aachen/Notebook/Engineering/ODF2014-10-17T21:28:30Z<p>StefanReinhold: /* Evaluation of the Fluorescence Measurement */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
{{Team:Aachen/Stylesheet}}<br />
= OD/F Device =<br />
<br />
On this page we present the technical details of our OD/F Device. You can skip to specific chapters by clicking on the panels below:<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#dev" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br><br />
<b>General Considerations</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#od" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>OD Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/04/Aachen_Cuvette_button_v1_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#f" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>F Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
= General Considerations =<br />
<span class="anchor" id="dev"></span><br />
<br />
Building the OD/F Device has been an interesting task. While this device has been developed mainly by the IT division of our team, we got an immense support from the biologists suffering from color-blindness, yet eager to help selecting the best color filters for the LEDs.<br />
<br />
The measuring principle and guidelines for this project have already been presented in the [https://2014.igem.org/Team:Aachen/OD/F_device project] section.<br />
Here, details about selecting filters, code and a construction manual are presented.<br />
<br />
=== Cuvette Holder ===<br />
The essential part of this device is the '''cuvette holder'''. In short, we had to overcome a dilemma created by the need for an optimal height for the sensor:<br />
* A too low sensor position bears problems with sedimentation as well as light diffraction from the bottom of the cuvette.<br />
* The sensor has to be as close as possible to the bottom so that enough light shines through for the fluorescence measurement.<br />
<br />
As a compromise, we place the sensor at a height of 0.75&nbsp;cm. It is comparable to one of the standard heights (0.2&nbsp;cm, 0.8&nbsp;cm, 1.2&nbsp;cm) of OD meters. It is important to note that our device works with filling volumens of just 1&nbsp;mL, which in fact comes close to reality in the lab.<br />
<br />
The final cuvette holder design is rendered from a [https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=raw stl-file] shown below:<br />
<br />
<html><br />
<center> <br />
<iframe src="https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=render<br />
" width=500px height=500px frameBorder="0"></iframe><br />
<br/><br />
<b>Cuvette Holder devloped for our OD/F Device.</b><br />
</center><br />
</html><br />
<br />
=== Light Filters ===<br />
'''Finding the right and optimal filters is a tough challenge'''.<br />
The main goal throughout our project has been to choose easily available parts which are also inexpensive. Thus choosing Schott glasses as filters could not be considered. Alternatively, filters used for illumination of theaters were found to be an ideal solution.<br />
<br />
We tested serveral filters and the optimal configuration of filters used is listed below.<br />
<br />
{| class="wikitable"<br />
! Mode<br />
! Fluorescence Protein<br />
! Filter Name<br />
! Filter<br />
! Peak Excitation<br />
! Peak Emission<br />
|-<br />
| Fluorescence<br />
| [http://parts.igem.org/Part:BBa_E0040 GFPmut3b]<br />
| [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green]<br />
| [[File:Aachen_Filter_736.png|200px]]<br />
| 501nm<br />
| 511nm<br />
|-<br />
| Optical Density<br />
| --<br />
| [http://leefilters.com/lighting/colour-details.html#019 Fire]<br />
| [[File:Aachen_Filter_019.png|200px]]<br />
| 600nm<br />
| 600nm<br />
|}<br />
<br />
The fluorescence protein [http://parts.igem.org/Part:BBa_E0040 GFPmut3b] has a peak excitation at 501&nbsp;nm and a peak emission at 511&nbsp;nm - too close together for our low-cost filters to block the excitation light but transmit the emitted light. Thus, we chose to excite at around 485&nbsp;nm reduce false positive results below 500&nbsp;nm. However, no adequate filter for these settings could be found.<br />
Eventually, using the dark greenish [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green] filter only little amounts of light shorter than 500&nbsp;nm gets through, reducing any bias from excitation illumination significantly. Unfortunately, the transmission rate of this filter is quite bad, 20% only, for the target emission wavelength of 511&nbsp;nm.<br />
<br />
== Linearity of the Hardware Light Sensor ==<br />
<span class="anchor" id="lin"></span><br />
It is crucial that the selected hardware is mapping reality into the digital world of our $\mu$-Controller.<br />
In order to sense reality our setup uses a light to frequency sensor, [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf TSL235R-LF].<br />
The light to frequency sensor resembles the most to a photo transistor and thus is less sensible to temperature than a light dependant resistor.<br />
Additionally counting a frequency using interrupts seems to be easier and more accurate than using the analog to digital converter.<br />
<br />
Using a dilution series of purified [https://2011.igem.org/Team:Glasgow/LOV2 iLOV] we could determine the characteristic curve for the light sensor. Finally we can conclude that the sensor is linear as expected and shown in the [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf datasheet].<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Linearity iFG.PNG|title=Linearity of TSL235R-LF sensor|subtitle=Dilution series of GFP expressing ''E. coli'' showing linearity between fluorescence count and dilution. The linearity of the chosen sensor can be determined.|width=700px}}<br />
<br />
We are measuring optical density using our in-house developed cuvette holder.<br />
Particularly for optical density measurement, the amount of light shining through the sample is crucial.<br />
If there is too few light, there will be not enough light registered at the sensor, and the resolution of the measurement shrinks. This should be prevented.<br />
The chosen light to frequency sensor is reported to be very sensitive on the amount of light shining on it.<br />
There are reports of the sensor breaking when put into [https://www.sparkfun.com/products/9768 sunlight on a nice day], and not being sensitive at both high light or low light [http://kesslerarduino.wordpress.com/author/kevinmkessler/page/2/ conditions].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
[[File:Aachen_Cuvette_button_v1_ipo.png|right|150px]]<br />
<br />
= Evaluation of the Optical Density Measurement =<br />
<span class="anchor" id="od"></span><br />
<br />
=== From Transmittance to True Optical Density ===<br />
At very low levels, uncorrected photometric determinations of cell densities show a decreasing proportionaility to actual cell density.<br />
<br />
This can also be observed using our device.<br />
<br />
In general, photometric determination of bacterial concentrations depends primarily on light scattering, rather than light absorption. Therefore, often not absorption is measured, but transmittance. For this, the relationship between optical density (OD) and transmitted light $\frac{I_0}{I}$ exists as:<br />
<br />
$$ OD = \frac{I_0}{I} = \kappa \cdot c$$<br />
<br />
where $I_0$ is the intensity of incoming light and $I$ the amount of the light passing through.<br />
<br />
However, this equation is linear only in a certain range.<br />
While one can tackle this non-linearity by using dilutions of the culture, correcting the error systematically is another way to overcome this limitation.<br />
<br />
For our OD device we needed to correlate the transmittance measured by our sensor to an optical density anyway.<br />
Our team members from the deterministic sciences emphasized on the correction method, which was conducted according to Lawrence and Maier (2006):<br />
<br />
* The relative density ($RD$) of each sample in a dilution series is calculated using $\frac{min(dilution)}{dilution}$.<br />
* The uncorrected optical density is derived from the transmission T [%]: $OD = 2 - \log T$<br />
* Finally, the unit optical density is calculated as $\frac{OD}{TD}$.<br />
* The average of the stable unit optical densities is used to calculate the true optical density $ OD_{unit} \cdot RD $.<br />
This way, the correlation between transmission and true optical density can be computed.<br />
The derived function allows the conversion from transmission to optical density on our device and therefore calibrates our device.<br />
<br />
<br />
In our experiments, we find in accordance to Lawrence and Maier that the correction majorly depends on the technical equipment used, especially the LED, sensor and cuvettes.<br />
While this at first sight looks disappointing, it is also expected:<br />
Transmittance is the fraction of light not absorbed by some medium relative to the cell-free and clear medium.<br />
However, the transmittance is not only dependent on the amount of cells in the way of the light's beam, but also how much light shines through the cuvette in which fashion, and in which fraction is received by the sensor in which angles.<br />
<br />
Using the above formula we performed this experiment for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae'' and asked team [https://2014.igem.org/Team:Aachen/Collaborations/Freiburg Freiburg] to perform the same experiment using mamallian cells.<br />
<br />
=== Experiments ===<br />
<br />
We performed several experiments during the development of the device.<br />
Finally, we can relate the measured transmittance to the true Optical Density (true OD), and further, we can relate the true OD to the true OD of the photospectrometer in our lab.<br />
By doing so, we can calibrate our device to meaningful values.<br />
<br />
We have done this according to the previous section for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae''.<br />
<br />
The final function for calculating the OD from the transmission calculated by our device can be calculated as<br />
<br />
$$ OD(T) = f(T) \circ g(device) $$<br />
<br />
where $f$ transforms transforms transmittance $T$ to true optical density for our device, and $g$ transforms true optical density of our device into the true optical density of the photospectrometer. This way our device is calibrated according to the photospectrometer.<br />
<br />
==== ''Pseudomonas putida'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida iFG.PNG|title=True Optical Density to Transmittance plot for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
==== ''Saccharomyces cerevisiae'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer iFG.PNG|title=True Optical Density to Transmittance plot for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
From these plots, it can be seen that our device delivers robust and reproducible results for both procaryotes and eucaryotes.<br />
Also the function from transmittance to true OD follows a clear pattern, making its calculation possible on a low-end device like a microcontroller.<br />
<br />
It is interesting to observer that function $g$, mapping the true OD of our device to the true OD of the photospectrometer, are close together for both ''P. putida'' and ''S. cerivisae'', as seen by the regression coefficient.<br />
In fact, 3.416 and 3.461 are such close together, that the minor deviation could be just measuring inaccuracy.<br />
Therefore, we fix the regression coefficient for converting true OD of our device to true OD of the photospectrometer to an average of 3.432 .<br />
<br />
Additionally the function $f$ for mapping transmittance to true OD for our device is similar for all cell types, as seen in the following figure. Therefore the exponential regression curve for all cell types specifies this function.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_ODallstrains1.png|title=Transmission of different cell types at OD-values from 0.001-1|subtitle=The transmittance data of NIH&nbsp;3T3 cells (mouse fibroblasts) align with the transmittance of ''P.&nbsp;putida'' and ''S.&nbsp;cerevisiae'' strains, even though the measured optical densities are lower by 1-2 orders of magnitude.|width=800px}}<br />
</center><br />
Finally, we have empirically determined our $OD(T)$ function by finding $f$ and $g$, such that we can convert true OD to the optical density of the photospectrometer.<br />
<br />
By this evaluation, we have shown that our self-build OD/F Device can compete with commercial systems.<br />
It is easy to calibrate by just calculating the true optical density.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_17-10-14_Glowing_cuvette-ipo.png|right|150px]]<br />
<br />
= Evaluation of the Fluorescence Measurement =<br />
<span class="anchor" id="f"></span><br />
<br />
For the evaluation of the fluorescence measurement, we performed a dilution series of a constitutively GFPmut3b expressing ''E. coli''.<br />
<br />
The below figure shows the absolute measurements for both the platereader and our OD/F Device. The abrupt jump at 50% concentration can be explained by a second dilution step and is prevalent in both devices.<br />
It can be seen that the platereader show a much higher difference between the GFP and non-GFP cell culture at a higher standard deviation.<br />
Another interesting metric is the difference between the GFP and non-GFP, which can be seen as the normalized fluorescence measure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachn 15-10-14 F platereader ODF iFG.PNG|title=Fluorescence Measurement comparison OD/F Device and Platereader (absolute values)|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F Device shows no significant linearity.|width=700px}}<br />
</center><br />
<br />
If one compares the results there, as in the below figure with normalized fluorescence values, interesting observations can be made.<br />
First, both platereader and OD/F Device show very similar results.<br />
The regression curves differ only in a linear factor.<br />
Most interestingly the general fit of the OD/F Device to a linear function seems to be better than the platereader.<br />
Overall the linearity which has been observed earlier (in testing the general setup) could be verified.<br />
Therefore our do-it-yourself OD/F Device can be used to determine fluorescence.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 F platereader ODF2 iFG.PNG|title=Fluorescence Measurement comparison OD/F Device and platereader using normalized fluorescence values|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F Device shows no significant. A non-GFP expressing ''E. coli'' dilution has been used to normalize the GFP dilution series. A linear correlation can be seen.|width=700px}}<br />
</center><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How to Build Your Own Device =<br />
<span class="anchor" id="diy"></span><br />
== Technical Components ==<br />
<br />
While the casing and the cuvette holder are custom made, most of the parts are pre-made and can be readily bought. The previous section lists all needed parts.<br />
To get all these parts for creating your own OD/F device is easy using the internet. Thus all '''potential customers have a market access''' to the used components. <br />
<br />
Please find our custom parts for download below. Despite being custom parts, these are quite inenxpensive - so feel free to give our OD/F device a test! For printing the 3D model of our cuvette holder and laser cutting our case, we want to express many thanks to [http://hci.rwth-aachen.de/fablab Fablab Aachen].<span class="anchor" id="ref2"></span><br />
<br />
* cuvette holder [https://2014.igem.org/Template:Team:Aachen/cuvette.stl?action=raw STL file]<br />
* casing single device [https://2014.igem.org/File:Aachen_ODF_device_casing.svg.zip SVG file]<br />
* lid combined device [https://2014.igem.org/File:Aachen_Odf_device_combined_lid.svg.zip SVG file]<br />
* Arduino Code for single device [https://2014.igem.org/Template:Team:Aachen/arduino_single.ino?action=raw Sketchbook (.ino)]<br />
* Arduino Code for combined device [https://2014.igem.org/Template:Team:Aachen/arduino_combined.ino?action=raw Sketchbook (.ino)]<br />
<br />
You will need a special [http://www.exp-tech.de/images/product_images/description%20images/YWRobot/1602/LiquidCrystal_I2C1602V2.rar library] for the display, which can not be uploaded for legal reasons.<br />
<br />
<br />
<center><br />
'''All needed components their quantities and prices for creating your own OD/F device'''<br />
{| class="wikitable"<br />
! align="center" |'''OD/F device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs [€] !! Costs [$] !! Final [€] !! Final [$] <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]||9.17||11.65||9.17||11.65 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/ams/TSL235R-LF/?qs=14HO7rLZPQsjmBHaoYCzkA%3D%3D TSL 235R]||2.47||3.14||2.47||3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356 Display 16x2]||2.58||3.28||2.58||3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]||1.57||1.99||1.57||1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]||2.90||3.69||2.90||3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]||1.57||2.00||1.57||2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]||0.09||0.11||1.80||2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]||1.98||2.51||1.98||2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893 power supply]||2.20||2.80||2.20||2.80<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)||7.98||10.14||7.98||10.14<br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913 Prototype Universal Printed Circuit Board]||2.27||2.88||2.27||2.88<br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191o Male Headers]||2.14||2.72||2.14||2.72<br />
|- style="border-top: 2px solid #808080;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600&nbsp;nm]||0.94||1.19||0.94||1.19<br />
|-<br />
! -!!Total OD!!-!!-!! 46.01 !! 58.45 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
! -!!Total F!!-!!-!! 46.06 !! 58.52 <br />
|- style="border-top: 2px solid #808080;;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]||0.94||1.19||0.94||1.19 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
! -!!Total OD/F!!-!!-!! 53.44 !! 67.89 <br />
|-<br />
|}<br />
</center><br />
<br />
For more detailed economical information about the OD/F project visit our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
== Breadboards ==<br />
<br />
=== Optical Density ===<br />
<br />
{{Team:Aachen/Figure|Aachen ODdevice Steckplatine.png|align=center|title=Breadboard of our OD device|subtitle=To build your own OD device, connect the parts as shown in this diagram.|width=900px}}<br />
<br />
If you want to build our OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#019 Fire 019]<br />
* LED: [http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== 600 nm] Dialight 550-2505F<br />
<br />
=== Fluorescence ===<br />
<br />
{{Team:Aachen/Figure|Aachen_Fdevice_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
If you want to build the OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#736 Twickenham Green 736]<br />
* LED: [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html 480 nm] NSPBR70BSS LED<br />
<br />
=== Combined Device ===<br />
Even though evaluation of the measurements have been performed in two separate device, it is fairly well possible to put everything into one casing.<br />
All you need to do is choosing another lid, and connect a second light to frequency sensor to your Arduino.<br />
Right at the bottom we present you the differences in wiring things up.<br />
Building the combined device is straight forward and very similar to the single device. You will need a slightly larger connector, a different lid for your case, and some more cables. The corresponding fritzing-layout is presented below.<br />
<br />
{{Team:Aachen/Figure|Aachen_ODF_combined_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
<br />
== Construction Steps ==<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_ODF_9.JPG|300px]] || First we want to assemble the casing. Once you have all the cut parts, you can start to assemble them. For cutting, we really recommend using a laser cutter.<br />
|-<br />
| [[File:Aachen_ODF_8.JPG|300px]] || Attach the cuvette-holder holders such that the cuvette holder is placed directly under the opening hole.<br />
|-<br />
| [[File:Aachen_ODF_4.JPG|300px]] || Next build the lid of the device. At this stage you can already mount the button. We recommend to glue any parts.<br />
|-<br />
| [[File:Aachen_ODF_3.JPG|300px]] || Your lid finally should look like this.<br />
|-<br />
| [[File:Aachen_ODF_11.JPG|150px]][[File:Aachen_ODF_10.JPG|150px]] || Next we want to assemble the cuvette holders. On the side with the square hole attach the light-to-frequency sensor with glue. For the OD case place the orange LED opposite, or for fluorescence, the LED in the hole in the bottom. Make sure to close any remaining open hole! Please attach a piece of filter foil (approx. $7 \times 7 mm^2$) from the inside in front of the light to frequency converter. Forceps is highly recommended.<br />
|-<br />
| [[File:Aachen_ODF_12.JPG|300px]] || Your final assembly should then look like this. Now place the correct filter into the cuvette holder, directly in front of the sensor. Make sure that the filter does not degrade due to the glue!<br />
|-<br />
| [[File:Aachen_ODF_14.JPG|300px]] || As the case can be used for both, fluorescence and OD measurement, we use a combined plug. Just three header rows (7 pins, 9pins for combined) and connect them as we did.<br />
|-<br />
| [[File:Aachen_ODF_1.JPG|300px]] || Now we're doing the wiring. Connect the Arduino 5V and GND such that you have one 5V and one GND line on your breadboard.<br />
|-<br />
| [[File:Aachen_ODF_2.JPG|300px]] || Then connect the button to 5V on the one side, and to GND via a resistor on the other side. Connect this side also to port __ on your Arduino. This will sense the blank. Next connect the display to the Arduino and our connector. See the Fritzing diagram at the bottom for a detailed information.<br />
|-<br />
| [[File:Aachen_ODF_13.JPG|300px]] || Now put everything into the case and ...<br />
|-<br />
| [[File:Aachen_ODF_6.JPG|300px]] || ... also place the cuvette holder into the device. Attach the display to the device lid and close the casing.<br />
|-<br />
| [[File:Aachen_ODF_7.JPG|300px]] || Congratulations! You have finished constructing your own OD/F device!<br />
|-<br />
| [[File:Aachen_zwei_Kuevetten.jpg|300px]] || ... or even the combined device!<br />
|}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
Lawrence, J. V., & Maier, S. (1977). Correction for the inherent error in optical density readings. Applied and Environmental Microbiology, 33(2), 482–484. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=170707&tool=pmcentrez&rendertype=abstract.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/ODFTeam:Aachen/Notebook/Engineering/ODF2014-10-17T21:27:37Z<p>StefanReinhold: /* Saccharomyces cerevisiae */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
{{Team:Aachen/Stylesheet}}<br />
= OD/F Device =<br />
<br />
On this page we present the technical details of our OD/F Device. You can skip to specific chapters by clicking on the panels below:<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#dev" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br><br />
<b>General Considerations</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#od" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>OD Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/04/Aachen_Cuvette_button_v1_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#f" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>F Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
= General Considerations =<br />
<span class="anchor" id="dev"></span><br />
<br />
Building the OD/F Device has been an interesting task. While this device has been developed mainly by the IT division of our team, we got an immense support from the biologists suffering from color-blindness, yet eager to help selecting the best color filters for the LEDs.<br />
<br />
The measuring principle and guidelines for this project have already been presented in the [https://2014.igem.org/Team:Aachen/OD/F_device project] section.<br />
Here, details about selecting filters, code and a construction manual are presented.<br />
<br />
=== Cuvette Holder ===<br />
The essential part of this device is the '''cuvette holder'''. In short, we had to overcome a dilemma created by the need for an optimal height for the sensor:<br />
* A too low sensor position bears problems with sedimentation as well as light diffraction from the bottom of the cuvette.<br />
* The sensor has to be as close as possible to the bottom so that enough light shines through for the fluorescence measurement.<br />
<br />
As a compromise, we place the sensor at a height of 0.75&nbsp;cm. It is comparable to one of the standard heights (0.2&nbsp;cm, 0.8&nbsp;cm, 1.2&nbsp;cm) of OD meters. It is important to note that our device works with filling volumens of just 1&nbsp;mL, which in fact comes close to reality in the lab.<br />
<br />
The final cuvette holder design is rendered from a [https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=raw stl-file] shown below:<br />
<br />
<html><br />
<center> <br />
<iframe src="https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=render<br />
" width=500px height=500px frameBorder="0"></iframe><br />
<br/><br />
<b>Cuvette Holder devloped for our OD/F Device.</b><br />
</center><br />
</html><br />
<br />
=== Light Filters ===<br />
'''Finding the right and optimal filters is a tough challenge'''.<br />
The main goal throughout our project has been to choose easily available parts which are also inexpensive. Thus choosing Schott glasses as filters could not be considered. Alternatively, filters used for illumination of theaters were found to be an ideal solution.<br />
<br />
We tested serveral filters and the optimal configuration of filters used is listed below.<br />
<br />
{| class="wikitable"<br />
! Mode<br />
! Fluorescence Protein<br />
! Filter Name<br />
! Filter<br />
! Peak Excitation<br />
! Peak Emission<br />
|-<br />
| Fluorescence<br />
| [http://parts.igem.org/Part:BBa_E0040 GFPmut3b]<br />
| [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green]<br />
| [[File:Aachen_Filter_736.png|200px]]<br />
| 501nm<br />
| 511nm<br />
|-<br />
| Optical Density<br />
| --<br />
| [http://leefilters.com/lighting/colour-details.html#019 Fire]<br />
| [[File:Aachen_Filter_019.png|200px]]<br />
| 600nm<br />
| 600nm<br />
|}<br />
<br />
The fluorescence protein [http://parts.igem.org/Part:BBa_E0040 GFPmut3b] has a peak excitation at 501&nbsp;nm and a peak emission at 511&nbsp;nm - too close together for our low-cost filters to block the excitation light but transmit the emitted light. Thus, we chose to excite at around 485&nbsp;nm reduce false positive results below 500&nbsp;nm. However, no adequate filter for these settings could be found.<br />
Eventually, using the dark greenish [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green] filter only little amounts of light shorter than 500&nbsp;nm gets through, reducing any bias from excitation illumination significantly. Unfortunately, the transmission rate of this filter is quite bad, 20% only, for the target emission wavelength of 511&nbsp;nm.<br />
<br />
== Linearity of the Hardware Light Sensor ==<br />
<span class="anchor" id="lin"></span><br />
It is crucial that the selected hardware is mapping reality into the digital world of our $\mu$-Controller.<br />
In order to sense reality our setup uses a light to frequency sensor, [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf TSL235R-LF].<br />
The light to frequency sensor resembles the most to a photo transistor and thus is less sensible to temperature than a light dependant resistor.<br />
Additionally counting a frequency using interrupts seems to be easier and more accurate than using the analog to digital converter.<br />
<br />
Using a dilution series of purified [https://2011.igem.org/Team:Glasgow/LOV2 iLOV] we could determine the characteristic curve for the light sensor. Finally we can conclude that the sensor is linear as expected and shown in the [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf datasheet].<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Linearity iFG.PNG|title=Linearity of TSL235R-LF sensor|subtitle=Dilution series of GFP expressing ''E. coli'' showing linearity between fluorescence count and dilution. The linearity of the chosen sensor can be determined.|width=700px}}<br />
<br />
We are measuring optical density using our in-house developed cuvette holder.<br />
Particularly for optical density measurement, the amount of light shining through the sample is crucial.<br />
If there is too few light, there will be not enough light registered at the sensor, and the resolution of the measurement shrinks. This should be prevented.<br />
The chosen light to frequency sensor is reported to be very sensitive on the amount of light shining on it.<br />
There are reports of the sensor breaking when put into [https://www.sparkfun.com/products/9768 sunlight on a nice day], and not being sensitive at both high light or low light [http://kesslerarduino.wordpress.com/author/kevinmkessler/page/2/ conditions].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
[[File:Aachen_Cuvette_button_v1_ipo.png|right|150px]]<br />
<br />
= Evaluation of the Optical Density Measurement =<br />
<span class="anchor" id="od"></span><br />
<br />
=== From Transmittance to True Optical Density ===<br />
At very low levels, uncorrected photometric determinations of cell densities show a decreasing proportionaility to actual cell density.<br />
<br />
This can also be observed using our device.<br />
<br />
In general, photometric determination of bacterial concentrations depends primarily on light scattering, rather than light absorption. Therefore, often not absorption is measured, but transmittance. For this, the relationship between optical density (OD) and transmitted light $\frac{I_0}{I}$ exists as:<br />
<br />
$$ OD = \frac{I_0}{I} = \kappa \cdot c$$<br />
<br />
where $I_0$ is the intensity of incoming light and $I$ the amount of the light passing through.<br />
<br />
However, this equation is linear only in a certain range.<br />
While one can tackle this non-linearity by using dilutions of the culture, correcting the error systematically is another way to overcome this limitation.<br />
<br />
For our OD device we needed to correlate the transmittance measured by our sensor to an optical density anyway.<br />
Our team members from the deterministic sciences emphasized on the correction method, which was conducted according to Lawrence and Maier (2006):<br />
<br />
* The relative density ($RD$) of each sample in a dilution series is calculated using $\frac{min(dilution)}{dilution}$.<br />
* The uncorrected optical density is derived from the transmission T [%]: $OD = 2 - \log T$<br />
* Finally, the unit optical density is calculated as $\frac{OD}{TD}$.<br />
* The average of the stable unit optical densities is used to calculate the true optical density $ OD_{unit} \cdot RD $.<br />
This way, the correlation between transmission and true optical density can be computed.<br />
The derived function allows the conversion from transmission to optical density on our device and therefore calibrates our device.<br />
<br />
<br />
In our experiments, we find in accordance to Lawrence and Maier that the correction majorly depends on the technical equipment used, especially the LED, sensor and cuvettes.<br />
While this at first sight looks disappointing, it is also expected:<br />
Transmittance is the fraction of light not absorbed by some medium relative to the cell-free and clear medium.<br />
However, the transmittance is not only dependent on the amount of cells in the way of the light's beam, but also how much light shines through the cuvette in which fashion, and in which fraction is received by the sensor in which angles.<br />
<br />
Using the above formula we performed this experiment for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae'' and asked team [https://2014.igem.org/Team:Aachen/Collaborations/Freiburg Freiburg] to perform the same experiment using mamallian cells.<br />
<br />
=== Experiments ===<br />
<br />
We performed several experiments during the development of the device.<br />
Finally, we can relate the measured transmittance to the true Optical Density (true OD), and further, we can relate the true OD to the true OD of the photospectrometer in our lab.<br />
By doing so, we can calibrate our device to meaningful values.<br />
<br />
We have done this according to the previous section for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae''.<br />
<br />
The final function for calculating the OD from the transmission calculated by our device can be calculated as<br />
<br />
$$ OD(T) = f(T) \circ g(device) $$<br />
<br />
where $f$ transforms transforms transmittance $T$ to true optical density for our device, and $g$ transforms true optical density of our device into the true optical density of the photospectrometer. This way our device is calibrated according to the photospectrometer.<br />
<br />
==== ''Pseudomonas putida'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida iFG.PNG|title=True Optical Density to Transmittance plot for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
==== ''Saccharomyces cerevisiae'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer iFG.PNG|title=True Optical Density to Transmittance plot for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
From these plots, it can be seen that our device delivers robust and reproducible results for both procaryotes and eucaryotes.<br />
Also the function from transmittance to true OD follows a clear pattern, making its calculation possible on a low-end device like a microcontroller.<br />
<br />
It is interesting to observer that function $g$, mapping the true OD of our device to the true OD of the photospectrometer, are close together for both ''P. putida'' and ''S. cerivisae'', as seen by the regression coefficient.<br />
In fact, 3.416 and 3.461 are such close together, that the minor deviation could be just measuring inaccuracy.<br />
Therefore, we fix the regression coefficient for converting true OD of our device to true OD of the photospectrometer to an average of 3.432 .<br />
<br />
Additionally the function $f$ for mapping transmittance to true OD for our device is similar for all cell types, as seen in the following figure. Therefore the exponential regression curve for all cell types specifies this function.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_ODallstrains1.png|title=Transmission of different cell types at OD-values from 0.001-1|subtitle=The transmittance data of NIH&nbsp;3T3 cells (mouse fibroblasts) align with the transmittance of ''P.&nbsp;putida'' and ''S.&nbsp;cerevisiae'' strains, even though the measured optical densities are lower by 1-2 orders of magnitude.|width=800px}}<br />
</center><br />
Finally, we have empirically determined our $OD(T)$ function by finding $f$ and $g$, such that we can convert true OD to the optical density of the photospectrometer.<br />
<br />
By this evaluation, we have shown that our self-build OD/F Device can compete with commercial systems.<br />
It is easy to calibrate by just calculating the true optical density.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_17-10-14_Glowing_cuvette-ipo.png|right|150px]]<br />
<br />
= Evaluation of the Fluorescence Measurement =<br />
<span class="anchor" id="f"></span><br />
<br />
For the evaluation of the fluorescence measurement, we performed a dilution series of a constitutively GFPmut3b expressing ''E. coli''.<br />
<br />
The below figure shows the absolute measurements for both the platereader and our OD/F device. The abrupt jump at 50% concentration can be explained by a second dilution step and is prevalent in both devices.<br />
It can be seen that the platereader show a much higher difference between the GFP and non-GFP cell culture at a higher standard deviation.<br />
Another interesting metric is the difference between the GFP and non-GFP, which can be seen as the normalized fluorescence measure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachn 15-10-14 F platereader ODF iFG.PNG|title=Fluorescence Measurement comparison OD/F device and Platereader (absolute values)|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant linearity.|width=700px}}<br />
</center><br />
<br />
If one compares the results there, as in the below figure with normalized fluorescence values, interesting observations can be made.<br />
First, both platereader and OD/F device show very similar results.<br />
The regression curves differ only in a linear factor.<br />
Most interestingly the general fit of the OD/F device to a linear function seems to be better than the platereader.<br />
Overall the linearity which has been observed earlier (in testing the general setup) could be verified.<br />
Therefore our do-it-yourself OD/F device can be used to determine fluorescence.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 F platereader ODF2 iFG.PNG|title=Fluorescence Measurement comparison OD/F device and platereader using normalized fluorescence values|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant. A non-GFP expressing ''E. coli'' dilution has been used to normalize the GFP dilution series. A linear correlation can be seen.|width=700px}}<br />
</center><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How to Build Your Own Device =<br />
<span class="anchor" id="diy"></span><br />
== Technical Components ==<br />
<br />
While the casing and the cuvette holder are custom made, most of the parts are pre-made and can be readily bought. The previous section lists all needed parts.<br />
To get all these parts for creating your own OD/F device is easy using the internet. Thus all '''potential customers have a market access''' to the used components. <br />
<br />
Please find our custom parts for download below. Despite being custom parts, these are quite inenxpensive - so feel free to give our OD/F device a test! For printing the 3D model of our cuvette holder and laser cutting our case, we want to express many thanks to [http://hci.rwth-aachen.de/fablab Fablab Aachen].<span class="anchor" id="ref2"></span><br />
<br />
* cuvette holder [https://2014.igem.org/Template:Team:Aachen/cuvette.stl?action=raw STL file]<br />
* casing single device [https://2014.igem.org/File:Aachen_ODF_device_casing.svg.zip SVG file]<br />
* lid combined device [https://2014.igem.org/File:Aachen_Odf_device_combined_lid.svg.zip SVG file]<br />
* Arduino Code for single device [https://2014.igem.org/Template:Team:Aachen/arduino_single.ino?action=raw Sketchbook (.ino)]<br />
* Arduino Code for combined device [https://2014.igem.org/Template:Team:Aachen/arduino_combined.ino?action=raw Sketchbook (.ino)]<br />
<br />
You will need a special [http://www.exp-tech.de/images/product_images/description%20images/YWRobot/1602/LiquidCrystal_I2C1602V2.rar library] for the display, which can not be uploaded for legal reasons.<br />
<br />
<br />
<center><br />
'''All needed components their quantities and prices for creating your own OD/F device'''<br />
{| class="wikitable"<br />
! align="center" |'''OD/F device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs [€] !! Costs [$] !! Final [€] !! Final [$] <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]||9.17||11.65||9.17||11.65 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/ams/TSL235R-LF/?qs=14HO7rLZPQsjmBHaoYCzkA%3D%3D TSL 235R]||2.47||3.14||2.47||3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356 Display 16x2]||2.58||3.28||2.58||3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]||1.57||1.99||1.57||1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]||2.90||3.69||2.90||3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]||1.57||2.00||1.57||2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]||0.09||0.11||1.80||2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]||1.98||2.51||1.98||2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893 power supply]||2.20||2.80||2.20||2.80<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)||7.98||10.14||7.98||10.14<br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913 Prototype Universal Printed Circuit Board]||2.27||2.88||2.27||2.88<br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191o Male Headers]||2.14||2.72||2.14||2.72<br />
|- style="border-top: 2px solid #808080;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600&nbsp;nm]||0.94||1.19||0.94||1.19<br />
|-<br />
! -!!Total OD!!-!!-!! 46.01 !! 58.45 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
! -!!Total F!!-!!-!! 46.06 !! 58.52 <br />
|- style="border-top: 2px solid #808080;;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]||0.94||1.19||0.94||1.19 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
! -!!Total OD/F!!-!!-!! 53.44 !! 67.89 <br />
|-<br />
|}<br />
</center><br />
<br />
For more detailed economical information about the OD/F project visit our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
== Breadboards ==<br />
<br />
=== Optical Density ===<br />
<br />
{{Team:Aachen/Figure|Aachen ODdevice Steckplatine.png|align=center|title=Breadboard of our OD device|subtitle=To build your own OD device, connect the parts as shown in this diagram.|width=900px}}<br />
<br />
If you want to build our OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#019 Fire 019]<br />
* LED: [http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== 600 nm] Dialight 550-2505F<br />
<br />
=== Fluorescence ===<br />
<br />
{{Team:Aachen/Figure|Aachen_Fdevice_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
If you want to build the OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#736 Twickenham Green 736]<br />
* LED: [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html 480 nm] NSPBR70BSS LED<br />
<br />
=== Combined Device ===<br />
Even though evaluation of the measurements have been performed in two separate device, it is fairly well possible to put everything into one casing.<br />
All you need to do is choosing another lid, and connect a second light to frequency sensor to your Arduino.<br />
Right at the bottom we present you the differences in wiring things up.<br />
Building the combined device is straight forward and very similar to the single device. You will need a slightly larger connector, a different lid for your case, and some more cables. The corresponding fritzing-layout is presented below.<br />
<br />
{{Team:Aachen/Figure|Aachen_ODF_combined_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
<br />
== Construction Steps ==<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_ODF_9.JPG|300px]] || First we want to assemble the casing. Once you have all the cut parts, you can start to assemble them. For cutting, we really recommend using a laser cutter.<br />
|-<br />
| [[File:Aachen_ODF_8.JPG|300px]] || Attach the cuvette-holder holders such that the cuvette holder is placed directly under the opening hole.<br />
|-<br />
| [[File:Aachen_ODF_4.JPG|300px]] || Next build the lid of the device. At this stage you can already mount the button. We recommend to glue any parts.<br />
|-<br />
| [[File:Aachen_ODF_3.JPG|300px]] || Your lid finally should look like this.<br />
|-<br />
| [[File:Aachen_ODF_11.JPG|150px]][[File:Aachen_ODF_10.JPG|150px]] || Next we want to assemble the cuvette holders. On the side with the square hole attach the light-to-frequency sensor with glue. For the OD case place the orange LED opposite, or for fluorescence, the LED in the hole in the bottom. Make sure to close any remaining open hole! Please attach a piece of filter foil (approx. $7 \times 7 mm^2$) from the inside in front of the light to frequency converter. Forceps is highly recommended.<br />
|-<br />
| [[File:Aachen_ODF_12.JPG|300px]] || Your final assembly should then look like this. Now place the correct filter into the cuvette holder, directly in front of the sensor. Make sure that the filter does not degrade due to the glue!<br />
|-<br />
| [[File:Aachen_ODF_14.JPG|300px]] || As the case can be used for both, fluorescence and OD measurement, we use a combined plug. Just three header rows (7 pins, 9pins for combined) and connect them as we did.<br />
|-<br />
| [[File:Aachen_ODF_1.JPG|300px]] || Now we're doing the wiring. Connect the Arduino 5V and GND such that you have one 5V and one GND line on your breadboard.<br />
|-<br />
| [[File:Aachen_ODF_2.JPG|300px]] || Then connect the button to 5V on the one side, and to GND via a resistor on the other side. Connect this side also to port __ on your Arduino. This will sense the blank. Next connect the display to the Arduino and our connector. See the Fritzing diagram at the bottom for a detailed information.<br />
|-<br />
| [[File:Aachen_ODF_13.JPG|300px]] || Now put everything into the case and ...<br />
|-<br />
| [[File:Aachen_ODF_6.JPG|300px]] || ... also place the cuvette holder into the device. Attach the display to the device lid and close the casing.<br />
|-<br />
| [[File:Aachen_ODF_7.JPG|300px]] || Congratulations! You have finished constructing your own OD/F device!<br />
|-<br />
| [[File:Aachen_zwei_Kuevetten.jpg|300px]] || ... or even the combined device!<br />
|}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
Lawrence, J. V., & Maier, S. (1977). Correction for the inherent error in optical density readings. Applied and Environmental Microbiology, 33(2), 482–484. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=170707&tool=pmcentrez&rendertype=abstract.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/ODFTeam:Aachen/Notebook/Engineering/ODF2014-10-17T21:27:11Z<p>StefanReinhold: /* Pseudomonas putida */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
{{Team:Aachen/Stylesheet}}<br />
= OD/F Device =<br />
<br />
On this page we present the technical details of our OD/F Device. You can skip to specific chapters by clicking on the panels below:<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#dev" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br><br />
<b>General Considerations</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#od" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>OD Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/04/Aachen_Cuvette_button_v1_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#f" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>F Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
= General Considerations =<br />
<span class="anchor" id="dev"></span><br />
<br />
Building the OD/F Device has been an interesting task. While this device has been developed mainly by the IT division of our team, we got an immense support from the biologists suffering from color-blindness, yet eager to help selecting the best color filters for the LEDs.<br />
<br />
The measuring principle and guidelines for this project have already been presented in the [https://2014.igem.org/Team:Aachen/OD/F_device project] section.<br />
Here, details about selecting filters, code and a construction manual are presented.<br />
<br />
=== Cuvette Holder ===<br />
The essential part of this device is the '''cuvette holder'''. In short, we had to overcome a dilemma created by the need for an optimal height for the sensor:<br />
* A too low sensor position bears problems with sedimentation as well as light diffraction from the bottom of the cuvette.<br />
* The sensor has to be as close as possible to the bottom so that enough light shines through for the fluorescence measurement.<br />
<br />
As a compromise, we place the sensor at a height of 0.75&nbsp;cm. It is comparable to one of the standard heights (0.2&nbsp;cm, 0.8&nbsp;cm, 1.2&nbsp;cm) of OD meters. It is important to note that our device works with filling volumens of just 1&nbsp;mL, which in fact comes close to reality in the lab.<br />
<br />
The final cuvette holder design is rendered from a [https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=raw stl-file] shown below:<br />
<br />
<html><br />
<center> <br />
<iframe src="https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=render<br />
" width=500px height=500px frameBorder="0"></iframe><br />
<br/><br />
<b>Cuvette Holder devloped for our OD/F Device.</b><br />
</center><br />
</html><br />
<br />
=== Light Filters ===<br />
'''Finding the right and optimal filters is a tough challenge'''.<br />
The main goal throughout our project has been to choose easily available parts which are also inexpensive. Thus choosing Schott glasses as filters could not be considered. Alternatively, filters used for illumination of theaters were found to be an ideal solution.<br />
<br />
We tested serveral filters and the optimal configuration of filters used is listed below.<br />
<br />
{| class="wikitable"<br />
! Mode<br />
! Fluorescence Protein<br />
! Filter Name<br />
! Filter<br />
! Peak Excitation<br />
! Peak Emission<br />
|-<br />
| Fluorescence<br />
| [http://parts.igem.org/Part:BBa_E0040 GFPmut3b]<br />
| [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green]<br />
| [[File:Aachen_Filter_736.png|200px]]<br />
| 501nm<br />
| 511nm<br />
|-<br />
| Optical Density<br />
| --<br />
| [http://leefilters.com/lighting/colour-details.html#019 Fire]<br />
| [[File:Aachen_Filter_019.png|200px]]<br />
| 600nm<br />
| 600nm<br />
|}<br />
<br />
The fluorescence protein [http://parts.igem.org/Part:BBa_E0040 GFPmut3b] has a peak excitation at 501&nbsp;nm and a peak emission at 511&nbsp;nm - too close together for our low-cost filters to block the excitation light but transmit the emitted light. Thus, we chose to excite at around 485&nbsp;nm reduce false positive results below 500&nbsp;nm. However, no adequate filter for these settings could be found.<br />
Eventually, using the dark greenish [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green] filter only little amounts of light shorter than 500&nbsp;nm gets through, reducing any bias from excitation illumination significantly. Unfortunately, the transmission rate of this filter is quite bad, 20% only, for the target emission wavelength of 511&nbsp;nm.<br />
<br />
== Linearity of the Hardware Light Sensor ==<br />
<span class="anchor" id="lin"></span><br />
It is crucial that the selected hardware is mapping reality into the digital world of our $\mu$-Controller.<br />
In order to sense reality our setup uses a light to frequency sensor, [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf TSL235R-LF].<br />
The light to frequency sensor resembles the most to a photo transistor and thus is less sensible to temperature than a light dependant resistor.<br />
Additionally counting a frequency using interrupts seems to be easier and more accurate than using the analog to digital converter.<br />
<br />
Using a dilution series of purified [https://2011.igem.org/Team:Glasgow/LOV2 iLOV] we could determine the characteristic curve for the light sensor. Finally we can conclude that the sensor is linear as expected and shown in the [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf datasheet].<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Linearity iFG.PNG|title=Linearity of TSL235R-LF sensor|subtitle=Dilution series of GFP expressing ''E. coli'' showing linearity between fluorescence count and dilution. The linearity of the chosen sensor can be determined.|width=700px}}<br />
<br />
We are measuring optical density using our in-house developed cuvette holder.<br />
Particularly for optical density measurement, the amount of light shining through the sample is crucial.<br />
If there is too few light, there will be not enough light registered at the sensor, and the resolution of the measurement shrinks. This should be prevented.<br />
The chosen light to frequency sensor is reported to be very sensitive on the amount of light shining on it.<br />
There are reports of the sensor breaking when put into [https://www.sparkfun.com/products/9768 sunlight on a nice day], and not being sensitive at both high light or low light [http://kesslerarduino.wordpress.com/author/kevinmkessler/page/2/ conditions].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
[[File:Aachen_Cuvette_button_v1_ipo.png|right|150px]]<br />
<br />
= Evaluation of the Optical Density Measurement =<br />
<span class="anchor" id="od"></span><br />
<br />
=== From Transmittance to True Optical Density ===<br />
At very low levels, uncorrected photometric determinations of cell densities show a decreasing proportionaility to actual cell density.<br />
<br />
This can also be observed using our device.<br />
<br />
In general, photometric determination of bacterial concentrations depends primarily on light scattering, rather than light absorption. Therefore, often not absorption is measured, but transmittance. For this, the relationship between optical density (OD) and transmitted light $\frac{I_0}{I}$ exists as:<br />
<br />
$$ OD = \frac{I_0}{I} = \kappa \cdot c$$<br />
<br />
where $I_0$ is the intensity of incoming light and $I$ the amount of the light passing through.<br />
<br />
However, this equation is linear only in a certain range.<br />
While one can tackle this non-linearity by using dilutions of the culture, correcting the error systematically is another way to overcome this limitation.<br />
<br />
For our OD device we needed to correlate the transmittance measured by our sensor to an optical density anyway.<br />
Our team members from the deterministic sciences emphasized on the correction method, which was conducted according to Lawrence and Maier (2006):<br />
<br />
* The relative density ($RD$) of each sample in a dilution series is calculated using $\frac{min(dilution)}{dilution}$.<br />
* The uncorrected optical density is derived from the transmission T [%]: $OD = 2 - \log T$<br />
* Finally, the unit optical density is calculated as $\frac{OD}{TD}$.<br />
* The average of the stable unit optical densities is used to calculate the true optical density $ OD_{unit} \cdot RD $.<br />
This way, the correlation between transmission and true optical density can be computed.<br />
The derived function allows the conversion from transmission to optical density on our device and therefore calibrates our device.<br />
<br />
<br />
In our experiments, we find in accordance to Lawrence and Maier that the correction majorly depends on the technical equipment used, especially the LED, sensor and cuvettes.<br />
While this at first sight looks disappointing, it is also expected:<br />
Transmittance is the fraction of light not absorbed by some medium relative to the cell-free and clear medium.<br />
However, the transmittance is not only dependent on the amount of cells in the way of the light's beam, but also how much light shines through the cuvette in which fashion, and in which fraction is received by the sensor in which angles.<br />
<br />
Using the above formula we performed this experiment for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae'' and asked team [https://2014.igem.org/Team:Aachen/Collaborations/Freiburg Freiburg] to perform the same experiment using mamallian cells.<br />
<br />
=== Experiments ===<br />
<br />
We performed several experiments during the development of the device.<br />
Finally, we can relate the measured transmittance to the true Optical Density (true OD), and further, we can relate the true OD to the true OD of the photospectrometer in our lab.<br />
By doing so, we can calibrate our device to meaningful values.<br />
<br />
We have done this according to the previous section for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae''.<br />
<br />
The final function for calculating the OD from the transmission calculated by our device can be calculated as<br />
<br />
$$ OD(T) = f(T) \circ g(device) $$<br />
<br />
where $f$ transforms transforms transmittance $T$ to true optical density for our device, and $g$ transforms true optical density of our device into the true optical density of the photospectrometer. This way our device is calibrated according to the photospectrometer.<br />
<br />
==== ''Pseudomonas putida'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida iFG.PNG|title=True Optical Density to Transmittance plot for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida OD iFG.PNG|title=Corrolating the true optical density of the OD/F Device to true optical density of the photospectrometer for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
==== ''Saccharomyces cerevisiae'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer iFG.PNG|title=True Optical Density to Transmittance plot for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer OD iFG.PNG|title=Corrolating the true optical density of the OD/F device to true optical density of the photospectrometer for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
From these plots, it can be seen that our device delivers robust and reproducible results for both procaryotes and eucaryotes.<br />
Also the function from transmittance to true OD follows a clear pattern, making its calculation possible on a low-end device like a microcontroller.<br />
<br />
It is interesting to observer that function $g$, mapping the true OD of our device to the true OD of the photospectrometer, are close together for both ''P. putida'' and ''S. cerivisae'', as seen by the regression coefficient.<br />
In fact, 3.416 and 3.461 are such close together, that the minor deviation could be just measuring inaccuracy.<br />
Therefore, we fix the regression coefficient for converting true OD of our device to true OD of the photospectrometer to an average of 3.432 .<br />
<br />
Additionally the function $f$ for mapping transmittance to true OD for our device is similar for all cell types, as seen in the following figure. Therefore the exponential regression curve for all cell types specifies this function.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_ODallstrains1.png|title=Transmission of different cell types at OD-values from 0.001-1|subtitle=The transmittance data of NIH&nbsp;3T3 cells (mouse fibroblasts) align with the transmittance of ''P.&nbsp;putida'' and ''S.&nbsp;cerevisiae'' strains, even though the measured optical densities are lower by 1-2 orders of magnitude.|width=800px}}<br />
</center><br />
Finally, we have empirically determined our $OD(T)$ function by finding $f$ and $g$, such that we can convert true OD to the optical density of the photospectrometer.<br />
<br />
By this evaluation, we have shown that our self-build OD/F device can compete with commercial systems.<br />
It is easy to calibrate by just calculating the true optical density.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_17-10-14_Glowing_cuvette-ipo.png|right|150px]]<br />
<br />
= Evaluation of the Fluorescence Measurement =<br />
<span class="anchor" id="f"></span><br />
<br />
For the evaluation of the fluorescence measurement, we performed a dilution series of a constitutively GFPmut3b expressing ''E. coli''.<br />
<br />
The below figure shows the absolute measurements for both the platereader and our OD/F device. The abrupt jump at 50% concentration can be explained by a second dilution step and is prevalent in both devices.<br />
It can be seen that the platereader show a much higher difference between the GFP and non-GFP cell culture at a higher standard deviation.<br />
Another interesting metric is the difference between the GFP and non-GFP, which can be seen as the normalized fluorescence measure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachn 15-10-14 F platereader ODF iFG.PNG|title=Fluorescence Measurement comparison OD/F device and Platereader (absolute values)|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant linearity.|width=700px}}<br />
</center><br />
<br />
If one compares the results there, as in the below figure with normalized fluorescence values, interesting observations can be made.<br />
First, both platereader and OD/F device show very similar results.<br />
The regression curves differ only in a linear factor.<br />
Most interestingly the general fit of the OD/F device to a linear function seems to be better than the platereader.<br />
Overall the linearity which has been observed earlier (in testing the general setup) could be verified.<br />
Therefore our do-it-yourself OD/F device can be used to determine fluorescence.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 F platereader ODF2 iFG.PNG|title=Fluorescence Measurement comparison OD/F device and platereader using normalized fluorescence values|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant. A non-GFP expressing ''E. coli'' dilution has been used to normalize the GFP dilution series. A linear correlation can be seen.|width=700px}}<br />
</center><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How to Build Your Own Device =<br />
<span class="anchor" id="diy"></span><br />
== Technical Components ==<br />
<br />
While the casing and the cuvette holder are custom made, most of the parts are pre-made and can be readily bought. The previous section lists all needed parts.<br />
To get all these parts for creating your own OD/F device is easy using the internet. Thus all '''potential customers have a market access''' to the used components. <br />
<br />
Please find our custom parts for download below. Despite being custom parts, these are quite inenxpensive - so feel free to give our OD/F device a test! For printing the 3D model of our cuvette holder and laser cutting our case, we want to express many thanks to [http://hci.rwth-aachen.de/fablab Fablab Aachen].<span class="anchor" id="ref2"></span><br />
<br />
* cuvette holder [https://2014.igem.org/Template:Team:Aachen/cuvette.stl?action=raw STL file]<br />
* casing single device [https://2014.igem.org/File:Aachen_ODF_device_casing.svg.zip SVG file]<br />
* lid combined device [https://2014.igem.org/File:Aachen_Odf_device_combined_lid.svg.zip SVG file]<br />
* Arduino Code for single device [https://2014.igem.org/Template:Team:Aachen/arduino_single.ino?action=raw Sketchbook (.ino)]<br />
* Arduino Code for combined device [https://2014.igem.org/Template:Team:Aachen/arduino_combined.ino?action=raw Sketchbook (.ino)]<br />
<br />
You will need a special [http://www.exp-tech.de/images/product_images/description%20images/YWRobot/1602/LiquidCrystal_I2C1602V2.rar library] for the display, which can not be uploaded for legal reasons.<br />
<br />
<br />
<center><br />
'''All needed components their quantities and prices for creating your own OD/F device'''<br />
{| class="wikitable"<br />
! align="center" |'''OD/F device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs [€] !! Costs [$] !! Final [€] !! Final [$] <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]||9.17||11.65||9.17||11.65 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/ams/TSL235R-LF/?qs=14HO7rLZPQsjmBHaoYCzkA%3D%3D TSL 235R]||2.47||3.14||2.47||3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356 Display 16x2]||2.58||3.28||2.58||3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]||1.57||1.99||1.57||1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]||2.90||3.69||2.90||3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]||1.57||2.00||1.57||2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]||0.09||0.11||1.80||2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]||1.98||2.51||1.98||2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893 power supply]||2.20||2.80||2.20||2.80<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)||7.98||10.14||7.98||10.14<br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913 Prototype Universal Printed Circuit Board]||2.27||2.88||2.27||2.88<br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191o Male Headers]||2.14||2.72||2.14||2.72<br />
|- style="border-top: 2px solid #808080;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600&nbsp;nm]||0.94||1.19||0.94||1.19<br />
|-<br />
! -!!Total OD!!-!!-!! 46.01 !! 58.45 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
! -!!Total F!!-!!-!! 46.06 !! 58.52 <br />
|- style="border-top: 2px solid #808080;;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]||0.94||1.19||0.94||1.19 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
! -!!Total OD/F!!-!!-!! 53.44 !! 67.89 <br />
|-<br />
|}<br />
</center><br />
<br />
For more detailed economical information about the OD/F project visit our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
== Breadboards ==<br />
<br />
=== Optical Density ===<br />
<br />
{{Team:Aachen/Figure|Aachen ODdevice Steckplatine.png|align=center|title=Breadboard of our OD device|subtitle=To build your own OD device, connect the parts as shown in this diagram.|width=900px}}<br />
<br />
If you want to build our OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#019 Fire 019]<br />
* LED: [http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== 600 nm] Dialight 550-2505F<br />
<br />
=== Fluorescence ===<br />
<br />
{{Team:Aachen/Figure|Aachen_Fdevice_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
If you want to build the OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#736 Twickenham Green 736]<br />
* LED: [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html 480 nm] NSPBR70BSS LED<br />
<br />
=== Combined Device ===<br />
Even though evaluation of the measurements have been performed in two separate device, it is fairly well possible to put everything into one casing.<br />
All you need to do is choosing another lid, and connect a second light to frequency sensor to your Arduino.<br />
Right at the bottom we present you the differences in wiring things up.<br />
Building the combined device is straight forward and very similar to the single device. You will need a slightly larger connector, a different lid for your case, and some more cables. The corresponding fritzing-layout is presented below.<br />
<br />
{{Team:Aachen/Figure|Aachen_ODF_combined_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
<br />
== Construction Steps ==<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_ODF_9.JPG|300px]] || First we want to assemble the casing. Once you have all the cut parts, you can start to assemble them. For cutting, we really recommend using a laser cutter.<br />
|-<br />
| [[File:Aachen_ODF_8.JPG|300px]] || Attach the cuvette-holder holders such that the cuvette holder is placed directly under the opening hole.<br />
|-<br />
| [[File:Aachen_ODF_4.JPG|300px]] || Next build the lid of the device. At this stage you can already mount the button. We recommend to glue any parts.<br />
|-<br />
| [[File:Aachen_ODF_3.JPG|300px]] || Your lid finally should look like this.<br />
|-<br />
| [[File:Aachen_ODF_11.JPG|150px]][[File:Aachen_ODF_10.JPG|150px]] || Next we want to assemble the cuvette holders. On the side with the square hole attach the light-to-frequency sensor with glue. For the OD case place the orange LED opposite, or for fluorescence, the LED in the hole in the bottom. Make sure to close any remaining open hole! Please attach a piece of filter foil (approx. $7 \times 7 mm^2$) from the inside in front of the light to frequency converter. Forceps is highly recommended.<br />
|-<br />
| [[File:Aachen_ODF_12.JPG|300px]] || Your final assembly should then look like this. Now place the correct filter into the cuvette holder, directly in front of the sensor. Make sure that the filter does not degrade due to the glue!<br />
|-<br />
| [[File:Aachen_ODF_14.JPG|300px]] || As the case can be used for both, fluorescence and OD measurement, we use a combined plug. Just three header rows (7 pins, 9pins for combined) and connect them as we did.<br />
|-<br />
| [[File:Aachen_ODF_1.JPG|300px]] || Now we're doing the wiring. Connect the Arduino 5V and GND such that you have one 5V and one GND line on your breadboard.<br />
|-<br />
| [[File:Aachen_ODF_2.JPG|300px]] || Then connect the button to 5V on the one side, and to GND via a resistor on the other side. Connect this side also to port __ on your Arduino. This will sense the blank. Next connect the display to the Arduino and our connector. See the Fritzing diagram at the bottom for a detailed information.<br />
|-<br />
| [[File:Aachen_ODF_13.JPG|300px]] || Now put everything into the case and ...<br />
|-<br />
| [[File:Aachen_ODF_6.JPG|300px]] || ... also place the cuvette holder into the device. Attach the display to the device lid and close the casing.<br />
|-<br />
| [[File:Aachen_ODF_7.JPG|300px]] || Congratulations! You have finished constructing your own OD/F device!<br />
|-<br />
| [[File:Aachen_zwei_Kuevetten.jpg|300px]] || ... or even the combined device!<br />
|}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
Lawrence, J. V., & Maier, S. (1977). Correction for the inherent error in optical density readings. Applied and Environmental Microbiology, 33(2), 482–484. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=170707&tool=pmcentrez&rendertype=abstract.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/ODFTeam:Aachen/Notebook/Engineering/ODF2014-10-17T21:26:53Z<p>StefanReinhold: /* General Considerations */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
{{Team:Aachen/Stylesheet}}<br />
= OD/F Device =<br />
<br />
On this page we present the technical details of our OD/F Device. You can skip to specific chapters by clicking on the panels below:<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#dev" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br><br />
<b>General Considerations</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#od" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>OD Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/04/Aachen_Cuvette_button_v1_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#f" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>F Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
= General Considerations =<br />
<span class="anchor" id="dev"></span><br />
<br />
Building the OD/F Device has been an interesting task. While this device has been developed mainly by the IT division of our team, we got an immense support from the biologists suffering from color-blindness, yet eager to help selecting the best color filters for the LEDs.<br />
<br />
The measuring principle and guidelines for this project have already been presented in the [https://2014.igem.org/Team:Aachen/OD/F_device project] section.<br />
Here, details about selecting filters, code and a construction manual are presented.<br />
<br />
=== Cuvette Holder ===<br />
The essential part of this device is the '''cuvette holder'''. In short, we had to overcome a dilemma created by the need for an optimal height for the sensor:<br />
* A too low sensor position bears problems with sedimentation as well as light diffraction from the bottom of the cuvette.<br />
* The sensor has to be as close as possible to the bottom so that enough light shines through for the fluorescence measurement.<br />
<br />
As a compromise, we place the sensor at a height of 0.75&nbsp;cm. It is comparable to one of the standard heights (0.2&nbsp;cm, 0.8&nbsp;cm, 1.2&nbsp;cm) of OD meters. It is important to note that our device works with filling volumens of just 1&nbsp;mL, which in fact comes close to reality in the lab.<br />
<br />
The final cuvette holder design is rendered from a [https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=raw stl-file] shown below:<br />
<br />
<html><br />
<center> <br />
<iframe src="https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=render<br />
" width=500px height=500px frameBorder="0"></iframe><br />
<br/><br />
<b>Cuvette Holder devloped for our OD/F Device.</b><br />
</center><br />
</html><br />
<br />
=== Light Filters ===<br />
'''Finding the right and optimal filters is a tough challenge'''.<br />
The main goal throughout our project has been to choose easily available parts which are also inexpensive. Thus choosing Schott glasses as filters could not be considered. Alternatively, filters used for illumination of theaters were found to be an ideal solution.<br />
<br />
We tested serveral filters and the optimal configuration of filters used is listed below.<br />
<br />
{| class="wikitable"<br />
! Mode<br />
! Fluorescence Protein<br />
! Filter Name<br />
! Filter<br />
! Peak Excitation<br />
! Peak Emission<br />
|-<br />
| Fluorescence<br />
| [http://parts.igem.org/Part:BBa_E0040 GFPmut3b]<br />
| [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green]<br />
| [[File:Aachen_Filter_736.png|200px]]<br />
| 501nm<br />
| 511nm<br />
|-<br />
| Optical Density<br />
| --<br />
| [http://leefilters.com/lighting/colour-details.html#019 Fire]<br />
| [[File:Aachen_Filter_019.png|200px]]<br />
| 600nm<br />
| 600nm<br />
|}<br />
<br />
The fluorescence protein [http://parts.igem.org/Part:BBa_E0040 GFPmut3b] has a peak excitation at 501&nbsp;nm and a peak emission at 511&nbsp;nm - too close together for our low-cost filters to block the excitation light but transmit the emitted light. Thus, we chose to excite at around 485&nbsp;nm reduce false positive results below 500&nbsp;nm. However, no adequate filter for these settings could be found.<br />
Eventually, using the dark greenish [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green] filter only little amounts of light shorter than 500&nbsp;nm gets through, reducing any bias from excitation illumination significantly. Unfortunately, the transmission rate of this filter is quite bad, 20% only, for the target emission wavelength of 511&nbsp;nm.<br />
<br />
== Linearity of the Hardware Light Sensor ==<br />
<span class="anchor" id="lin"></span><br />
It is crucial that the selected hardware is mapping reality into the digital world of our $\mu$-Controller.<br />
In order to sense reality our setup uses a light to frequency sensor, [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf TSL235R-LF].<br />
The light to frequency sensor resembles the most to a photo transistor and thus is less sensible to temperature than a light dependant resistor.<br />
Additionally counting a frequency using interrupts seems to be easier and more accurate than using the analog to digital converter.<br />
<br />
Using a dilution series of purified [https://2011.igem.org/Team:Glasgow/LOV2 iLOV] we could determine the characteristic curve for the light sensor. Finally we can conclude that the sensor is linear as expected and shown in the [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf datasheet].<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Linearity iFG.PNG|title=Linearity of TSL235R-LF sensor|subtitle=Dilution series of GFP expressing ''E. coli'' showing linearity between fluorescence count and dilution. The linearity of the chosen sensor can be determined.|width=700px}}<br />
<br />
We are measuring optical density using our in-house developed cuvette holder.<br />
Particularly for optical density measurement, the amount of light shining through the sample is crucial.<br />
If there is too few light, there will be not enough light registered at the sensor, and the resolution of the measurement shrinks. This should be prevented.<br />
The chosen light to frequency sensor is reported to be very sensitive on the amount of light shining on it.<br />
There are reports of the sensor breaking when put into [https://www.sparkfun.com/products/9768 sunlight on a nice day], and not being sensitive at both high light or low light [http://kesslerarduino.wordpress.com/author/kevinmkessler/page/2/ conditions].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
[[File:Aachen_Cuvette_button_v1_ipo.png|right|150px]]<br />
<br />
= Evaluation of the Optical Density Measurement =<br />
<span class="anchor" id="od"></span><br />
<br />
=== From Transmittance to True Optical Density ===<br />
At very low levels, uncorrected photometric determinations of cell densities show a decreasing proportionaility to actual cell density.<br />
<br />
This can also be observed using our device.<br />
<br />
In general, photometric determination of bacterial concentrations depends primarily on light scattering, rather than light absorption. Therefore, often not absorption is measured, but transmittance. For this, the relationship between optical density (OD) and transmitted light $\frac{I_0}{I}$ exists as:<br />
<br />
$$ OD = \frac{I_0}{I} = \kappa \cdot c$$<br />
<br />
where $I_0$ is the intensity of incoming light and $I$ the amount of the light passing through.<br />
<br />
However, this equation is linear only in a certain range.<br />
While one can tackle this non-linearity by using dilutions of the culture, correcting the error systematically is another way to overcome this limitation.<br />
<br />
For our OD device we needed to correlate the transmittance measured by our sensor to an optical density anyway.<br />
Our team members from the deterministic sciences emphasized on the correction method, which was conducted according to Lawrence and Maier (2006):<br />
<br />
* The relative density ($RD$) of each sample in a dilution series is calculated using $\frac{min(dilution)}{dilution}$.<br />
* The uncorrected optical density is derived from the transmission T [%]: $OD = 2 - \log T$<br />
* Finally, the unit optical density is calculated as $\frac{OD}{TD}$.<br />
* The average of the stable unit optical densities is used to calculate the true optical density $ OD_{unit} \cdot RD $.<br />
This way, the correlation between transmission and true optical density can be computed.<br />
The derived function allows the conversion from transmission to optical density on our device and therefore calibrates our device.<br />
<br />
<br />
In our experiments, we find in accordance to Lawrence and Maier that the correction majorly depends on the technical equipment used, especially the LED, sensor and cuvettes.<br />
While this at first sight looks disappointing, it is also expected:<br />
Transmittance is the fraction of light not absorbed by some medium relative to the cell-free and clear medium.<br />
However, the transmittance is not only dependent on the amount of cells in the way of the light's beam, but also how much light shines through the cuvette in which fashion, and in which fraction is received by the sensor in which angles.<br />
<br />
Using the above formula we performed this experiment for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae'' and asked team [https://2014.igem.org/Team:Aachen/Collaborations/Freiburg Freiburg] to perform the same experiment using mamallian cells.<br />
<br />
=== Experiments ===<br />
<br />
We performed several experiments during the development of the device.<br />
Finally, we can relate the measured transmittance to the true Optical Density (true OD), and further, we can relate the true OD to the true OD of the photospectrometer in our lab.<br />
By doing so, we can calibrate our device to meaningful values.<br />
<br />
We have done this according to the previous section for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae''.<br />
<br />
The final function for calculating the OD from the transmission calculated by our device can be calculated as<br />
<br />
$$ OD(T) = f(T) \circ g(device) $$<br />
<br />
where $f$ transforms transforms transmittance $T$ to true optical density for our device, and $g$ transforms true optical density of our device into the true optical density of the photospectrometer. This way our device is calibrated according to the photospectrometer.<br />
<br />
==== ''Pseudomonas putida'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida iFG.PNG|title=True Optical Density to Transmittance plot for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida OD iFG.PNG|title=Corrolating the true optical density of the OD/F device to true optical density of the photospectrometer for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
==== ''Saccharomyces cerevisiae'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer iFG.PNG|title=True Optical Density to Transmittance plot for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer OD iFG.PNG|title=Corrolating the true optical density of the OD/F device to true optical density of the photospectrometer for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
From these plots, it can be seen that our device delivers robust and reproducible results for both procaryotes and eucaryotes.<br />
Also the function from transmittance to true OD follows a clear pattern, making its calculation possible on a low-end device like a microcontroller.<br />
<br />
It is interesting to observer that function $g$, mapping the true OD of our device to the true OD of the photospectrometer, are close together for both ''P. putida'' and ''S. cerivisae'', as seen by the regression coefficient.<br />
In fact, 3.416 and 3.461 are such close together, that the minor deviation could be just measuring inaccuracy.<br />
Therefore, we fix the regression coefficient for converting true OD of our device to true OD of the photospectrometer to an average of 3.432 .<br />
<br />
Additionally the function $f$ for mapping transmittance to true OD for our device is similar for all cell types, as seen in the following figure. Therefore the exponential regression curve for all cell types specifies this function.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_ODallstrains1.png|title=Transmission of different cell types at OD-values from 0.001-1|subtitle=The transmittance data of NIH&nbsp;3T3 cells (mouse fibroblasts) align with the transmittance of ''P.&nbsp;putida'' and ''S.&nbsp;cerevisiae'' strains, even though the measured optical densities are lower by 1-2 orders of magnitude.|width=800px}}<br />
</center><br />
Finally, we have empirically determined our $OD(T)$ function by finding $f$ and $g$, such that we can convert true OD to the optical density of the photospectrometer.<br />
<br />
By this evaluation, we have shown that our self-build OD/F device can compete with commercial systems.<br />
It is easy to calibrate by just calculating the true optical density.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_17-10-14_Glowing_cuvette-ipo.png|right|150px]]<br />
<br />
= Evaluation of the Fluorescence Measurement =<br />
<span class="anchor" id="f"></span><br />
<br />
For the evaluation of the fluorescence measurement, we performed a dilution series of a constitutively GFPmut3b expressing ''E. coli''.<br />
<br />
The below figure shows the absolute measurements for both the platereader and our OD/F device. The abrupt jump at 50% concentration can be explained by a second dilution step and is prevalent in both devices.<br />
It can be seen that the platereader show a much higher difference between the GFP and non-GFP cell culture at a higher standard deviation.<br />
Another interesting metric is the difference between the GFP and non-GFP, which can be seen as the normalized fluorescence measure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachn 15-10-14 F platereader ODF iFG.PNG|title=Fluorescence Measurement comparison OD/F device and Platereader (absolute values)|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant linearity.|width=700px}}<br />
</center><br />
<br />
If one compares the results there, as in the below figure with normalized fluorescence values, interesting observations can be made.<br />
First, both platereader and OD/F device show very similar results.<br />
The regression curves differ only in a linear factor.<br />
Most interestingly the general fit of the OD/F device to a linear function seems to be better than the platereader.<br />
Overall the linearity which has been observed earlier (in testing the general setup) could be verified.<br />
Therefore our do-it-yourself OD/F device can be used to determine fluorescence.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 F platereader ODF2 iFG.PNG|title=Fluorescence Measurement comparison OD/F device and platereader using normalized fluorescence values|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant. A non-GFP expressing ''E. coli'' dilution has been used to normalize the GFP dilution series. A linear correlation can be seen.|width=700px}}<br />
</center><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How to Build Your Own Device =<br />
<span class="anchor" id="diy"></span><br />
== Technical Components ==<br />
<br />
While the casing and the cuvette holder are custom made, most of the parts are pre-made and can be readily bought. The previous section lists all needed parts.<br />
To get all these parts for creating your own OD/F device is easy using the internet. Thus all '''potential customers have a market access''' to the used components. <br />
<br />
Please find our custom parts for download below. Despite being custom parts, these are quite inenxpensive - so feel free to give our OD/F device a test! For printing the 3D model of our cuvette holder and laser cutting our case, we want to express many thanks to [http://hci.rwth-aachen.de/fablab Fablab Aachen].<span class="anchor" id="ref2"></span><br />
<br />
* cuvette holder [https://2014.igem.org/Template:Team:Aachen/cuvette.stl?action=raw STL file]<br />
* casing single device [https://2014.igem.org/File:Aachen_ODF_device_casing.svg.zip SVG file]<br />
* lid combined device [https://2014.igem.org/File:Aachen_Odf_device_combined_lid.svg.zip SVG file]<br />
* Arduino Code for single device [https://2014.igem.org/Template:Team:Aachen/arduino_single.ino?action=raw Sketchbook (.ino)]<br />
* Arduino Code for combined device [https://2014.igem.org/Template:Team:Aachen/arduino_combined.ino?action=raw Sketchbook (.ino)]<br />
<br />
You will need a special [http://www.exp-tech.de/images/product_images/description%20images/YWRobot/1602/LiquidCrystal_I2C1602V2.rar library] for the display, which can not be uploaded for legal reasons.<br />
<br />
<br />
<center><br />
'''All needed components their quantities and prices for creating your own OD/F device'''<br />
{| class="wikitable"<br />
! align="center" |'''OD/F device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs [€] !! Costs [$] !! Final [€] !! Final [$] <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]||9.17||11.65||9.17||11.65 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/ams/TSL235R-LF/?qs=14HO7rLZPQsjmBHaoYCzkA%3D%3D TSL 235R]||2.47||3.14||2.47||3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356 Display 16x2]||2.58||3.28||2.58||3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]||1.57||1.99||1.57||1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]||2.90||3.69||2.90||3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]||1.57||2.00||1.57||2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]||0.09||0.11||1.80||2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]||1.98||2.51||1.98||2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893 power supply]||2.20||2.80||2.20||2.80<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)||7.98||10.14||7.98||10.14<br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913 Prototype Universal Printed Circuit Board]||2.27||2.88||2.27||2.88<br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191o Male Headers]||2.14||2.72||2.14||2.72<br />
|- style="border-top: 2px solid #808080;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600&nbsp;nm]||0.94||1.19||0.94||1.19<br />
|-<br />
! -!!Total OD!!-!!-!! 46.01 !! 58.45 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
! -!!Total F!!-!!-!! 46.06 !! 58.52 <br />
|- style="border-top: 2px solid #808080;;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]||0.94||1.19||0.94||1.19 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
! -!!Total OD/F!!-!!-!! 53.44 !! 67.89 <br />
|-<br />
|}<br />
</center><br />
<br />
For more detailed economical information about the OD/F project visit our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
== Breadboards ==<br />
<br />
=== Optical Density ===<br />
<br />
{{Team:Aachen/Figure|Aachen ODdevice Steckplatine.png|align=center|title=Breadboard of our OD device|subtitle=To build your own OD device, connect the parts as shown in this diagram.|width=900px}}<br />
<br />
If you want to build our OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#019 Fire 019]<br />
* LED: [http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== 600 nm] Dialight 550-2505F<br />
<br />
=== Fluorescence ===<br />
<br />
{{Team:Aachen/Figure|Aachen_Fdevice_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
If you want to build the OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#736 Twickenham Green 736]<br />
* LED: [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html 480 nm] NSPBR70BSS LED<br />
<br />
=== Combined Device ===<br />
Even though evaluation of the measurements have been performed in two separate device, it is fairly well possible to put everything into one casing.<br />
All you need to do is choosing another lid, and connect a second light to frequency sensor to your Arduino.<br />
Right at the bottom we present you the differences in wiring things up.<br />
Building the combined device is straight forward and very similar to the single device. You will need a slightly larger connector, a different lid for your case, and some more cables. The corresponding fritzing-layout is presented below.<br />
<br />
{{Team:Aachen/Figure|Aachen_ODF_combined_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
<br />
== Construction Steps ==<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_ODF_9.JPG|300px]] || First we want to assemble the casing. Once you have all the cut parts, you can start to assemble them. For cutting, we really recommend using a laser cutter.<br />
|-<br />
| [[File:Aachen_ODF_8.JPG|300px]] || Attach the cuvette-holder holders such that the cuvette holder is placed directly under the opening hole.<br />
|-<br />
| [[File:Aachen_ODF_4.JPG|300px]] || Next build the lid of the device. At this stage you can already mount the button. We recommend to glue any parts.<br />
|-<br />
| [[File:Aachen_ODF_3.JPG|300px]] || Your lid finally should look like this.<br />
|-<br />
| [[File:Aachen_ODF_11.JPG|150px]][[File:Aachen_ODF_10.JPG|150px]] || Next we want to assemble the cuvette holders. On the side with the square hole attach the light-to-frequency sensor with glue. For the OD case place the orange LED opposite, or for fluorescence, the LED in the hole in the bottom. Make sure to close any remaining open hole! Please attach a piece of filter foil (approx. $7 \times 7 mm^2$) from the inside in front of the light to frequency converter. Forceps is highly recommended.<br />
|-<br />
| [[File:Aachen_ODF_12.JPG|300px]] || Your final assembly should then look like this. Now place the correct filter into the cuvette holder, directly in front of the sensor. Make sure that the filter does not degrade due to the glue!<br />
|-<br />
| [[File:Aachen_ODF_14.JPG|300px]] || As the case can be used for both, fluorescence and OD measurement, we use a combined plug. Just three header rows (7 pins, 9pins for combined) and connect them as we did.<br />
|-<br />
| [[File:Aachen_ODF_1.JPG|300px]] || Now we're doing the wiring. Connect the Arduino 5V and GND such that you have one 5V and one GND line on your breadboard.<br />
|-<br />
| [[File:Aachen_ODF_2.JPG|300px]] || Then connect the button to 5V on the one side, and to GND via a resistor on the other side. Connect this side also to port __ on your Arduino. This will sense the blank. Next connect the display to the Arduino and our connector. See the Fritzing diagram at the bottom for a detailed information.<br />
|-<br />
| [[File:Aachen_ODF_13.JPG|300px]] || Now put everything into the case and ...<br />
|-<br />
| [[File:Aachen_ODF_6.JPG|300px]] || ... also place the cuvette holder into the device. Attach the display to the device lid and close the casing.<br />
|-<br />
| [[File:Aachen_ODF_7.JPG|300px]] || Congratulations! You have finished constructing your own OD/F device!<br />
|-<br />
| [[File:Aachen_zwei_Kuevetten.jpg|300px]] || ... or even the combined device!<br />
|}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
Lawrence, J. V., & Maier, S. (1977). Correction for the inherent error in optical density readings. Applied and Environmental Microbiology, 33(2), 482–484. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=170707&tool=pmcentrez&rendertype=abstract.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Engineering/ODFTeam:Aachen/Notebook/Engineering/ODF2014-10-17T21:26:09Z<p>StefanReinhold: /* OD/F Device */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
{{Team:Aachen/Stylesheet}}<br />
= OD/F Device =<br />
<br />
On this page we present the technical details of our OD/F Device. You can skip to specific chapters by clicking on the panels below:<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#dev" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br><br />
<b>General Considerations</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#od" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>OD Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/0/04/Aachen_Cuvette_button_v1_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#f" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>F Device</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b>DIY</b><br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9e/Aachen_14-10-15_DIY_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
= General Considerations =<br />
<span class="anchor" id="dev"></span><br />
<br />
Building the OD/F device has been an interesting task. While this device has been developed mainly by the IT division of our team, we got an immense support from the biologists suffering from color-blindness, yet eager to help selecting the best color filters for the LEDs.<br />
<br />
The measuring principle and guidelines for this project have already been presented in the [https://2014.igem.org/Team:Aachen/OD/F_device project] section.<br />
Here, details about selecting filters, code and a construction manual are presented.<br />
<br />
=== Cuvette Holder ===<br />
The essential part of this device is the '''cuvette holder'''. In short, we had to overcome a dilemma created by the need for an optimal height for the sensor:<br />
* A too low sensor position bears problems with sedimentation as well as light diffraction from the bottom of the cuvette.<br />
* The sensor has to be as close as possible to the bottom so that enough light shines through for the fluorescence measurement.<br />
<br />
As a compromise, we place the sensor at a height of 0.75&nbsp;cm. It is comparable to one of the standard heights (0.2&nbsp;cm, 0.8&nbsp;cm, 1.2&nbsp;cm) of OD meters. It is important to note that our device works with filling volumens of just 1&nbsp;mL, which in fact comes close to reality in the lab.<br />
<br />
The final cuvette holder design is rendered from a [https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=raw stl-file] shown below:<br />
<br />
<html><br />
<center> <br />
<iframe src="https://2014.igem.org/Team:Aachen/Notebook/Engineering/Cuvette3D?action=render<br />
" width=500px height=500px frameBorder="0"></iframe><br />
<br/><br />
<b>Cuvette Holder devloped for our OD/F device.</b><br />
</center><br />
</html><br />
<br />
=== Light Filters ===<br />
'''Finding the right and optimal filters is a tough challenge'''.<br />
The main goal throughout our project has been to choose easily available parts which are also inexpensive. Thus choosing Schott glasses as filters could not be considered. Alternatively, filters used for illumination of theaters were found to be an ideal solution.<br />
<br />
We tested serveral filters and the optimal configuration of filters used is listed below.<br />
<br />
{| class="wikitable"<br />
! Mode<br />
! Fluorescence Protein<br />
! Filter Name<br />
! Filter<br />
! Peak Excitation<br />
! Peak Emission<br />
|-<br />
| Fluorescence<br />
| [http://parts.igem.org/Part:BBa_E0040 GFPmut3b]<br />
| [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green]<br />
| [[File:Aachen_Filter_736.png|200px]]<br />
| 501nm<br />
| 511nm<br />
|-<br />
| Optical Density<br />
| --<br />
| [http://leefilters.com/lighting/colour-details.html#019 Fire]<br />
| [[File:Aachen_Filter_019.png|200px]]<br />
| 600nm<br />
| 600nm<br />
|}<br />
<br />
The fluorescence protein [http://parts.igem.org/Part:BBa_E0040 GFPmut3b] has a peak excitation at 501&nbsp;nm and a peak emission at 511&nbsp;nm - too close together for our low-cost filters to block the excitation light but transmit the emitted light. Thus, we chose to excite at around 485&nbsp;nm reduce false positive results below 500&nbsp;nm. However, no adequate filter for these settings could be found.<br />
Eventually, using the dark greenish [http://leefilters.com/lighting/colour-details.html#736 Twickenham Green] filter only little amounts of light shorter than 500&nbsp;nm gets through, reducing any bias from excitation illumination significantly. Unfortunately, the transmission rate of this filter is quite bad, 20% only, for the target emission wavelength of 511&nbsp;nm.<br />
<br />
== Linearity of the Hardware Light Sensor ==<br />
<span class="anchor" id="lin"></span><br />
It is crucial that the selected hardware is mapping reality into the digital world of our $\mu$-Controller.<br />
In order to sense reality our setup uses a light to frequency sensor, [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf TSL235R-LF].<br />
The light to frequency sensor resembles the most to a photo transistor and thus is less sensible to temperature than a light dependant resistor.<br />
Additionally counting a frequency using interrupts seems to be easier and more accurate than using the analog to digital converter.<br />
<br />
Using a dilution series of purified [https://2011.igem.org/Team:Glasgow/LOV2 iLOV] we could determine the characteristic curve for the light sensor. Finally we can conclude that the sensor is linear as expected and shown in the [https://www.sparkfun.com/datasheets/Sensors/Imaging/TSL235R-LF.pdf datasheet].<br />
<br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Linearity iFG.PNG|title=Linearity of TSL235R-LF sensor|subtitle=Dilution series of GFP expressing ''E. coli'' showing linearity between fluorescence count and dilution. The linearity of the chosen sensor can be determined.|width=700px}}<br />
<br />
We are measuring optical density using our in-house developed cuvette holder.<br />
Particularly for optical density measurement, the amount of light shining through the sample is crucial.<br />
If there is too few light, there will be not enough light registered at the sensor, and the resolution of the measurement shrinks. This should be prevented.<br />
The chosen light to frequency sensor is reported to be very sensitive on the amount of light shining on it.<br />
There are reports of the sensor breaking when put into [https://www.sparkfun.com/products/9768 sunlight on a nice day], and not being sensitive at both high light or low light [http://kesslerarduino.wordpress.com/author/kevinmkessler/page/2/ conditions].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
[[File:Aachen_Cuvette_button_v1_ipo.png|right|150px]]<br />
<br />
= Evaluation of the Optical Density Measurement =<br />
<span class="anchor" id="od"></span><br />
<br />
=== From Transmittance to True Optical Density ===<br />
At very low levels, uncorrected photometric determinations of cell densities show a decreasing proportionaility to actual cell density.<br />
<br />
This can also be observed using our device.<br />
<br />
In general, photometric determination of bacterial concentrations depends primarily on light scattering, rather than light absorption. Therefore, often not absorption is measured, but transmittance. For this, the relationship between optical density (OD) and transmitted light $\frac{I_0}{I}$ exists as:<br />
<br />
$$ OD = \frac{I_0}{I} = \kappa \cdot c$$<br />
<br />
where $I_0$ is the intensity of incoming light and $I$ the amount of the light passing through.<br />
<br />
However, this equation is linear only in a certain range.<br />
While one can tackle this non-linearity by using dilutions of the culture, correcting the error systematically is another way to overcome this limitation.<br />
<br />
For our OD device we needed to correlate the transmittance measured by our sensor to an optical density anyway.<br />
Our team members from the deterministic sciences emphasized on the correction method, which was conducted according to Lawrence and Maier (2006):<br />
<br />
* The relative density ($RD$) of each sample in a dilution series is calculated using $\frac{min(dilution)}{dilution}$.<br />
* The uncorrected optical density is derived from the transmission T [%]: $OD = 2 - \log T$<br />
* Finally, the unit optical density is calculated as $\frac{OD}{TD}$.<br />
* The average of the stable unit optical densities is used to calculate the true optical density $ OD_{unit} \cdot RD $.<br />
This way, the correlation between transmission and true optical density can be computed.<br />
The derived function allows the conversion from transmission to optical density on our device and therefore calibrates our device.<br />
<br />
<br />
In our experiments, we find in accordance to Lawrence and Maier that the correction majorly depends on the technical equipment used, especially the LED, sensor and cuvettes.<br />
While this at first sight looks disappointing, it is also expected:<br />
Transmittance is the fraction of light not absorbed by some medium relative to the cell-free and clear medium.<br />
However, the transmittance is not only dependent on the amount of cells in the way of the light's beam, but also how much light shines through the cuvette in which fashion, and in which fraction is received by the sensor in which angles.<br />
<br />
Using the above formula we performed this experiment for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae'' and asked team [https://2014.igem.org/Team:Aachen/Collaborations/Freiburg Freiburg] to perform the same experiment using mamallian cells.<br />
<br />
=== Experiments ===<br />
<br />
We performed several experiments during the development of the device.<br />
Finally, we can relate the measured transmittance to the true Optical Density (true OD), and further, we can relate the true OD to the true OD of the photospectrometer in our lab.<br />
By doing so, we can calibrate our device to meaningful values.<br />
<br />
We have done this according to the previous section for ''Pseudomonas putida'' and ''Saccharomyces cerevisiae''.<br />
<br />
The final function for calculating the OD from the transmission calculated by our device can be calculated as<br />
<br />
$$ OD(T) = f(T) \circ g(device) $$<br />
<br />
where $f$ transforms transforms transmittance $T$ to true optical density for our device, and $g$ transforms true optical density of our device into the true optical density of the photospectrometer. This way our device is calibrated according to the photospectrometer.<br />
<br />
==== ''Pseudomonas putida'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida iFG.PNG|title=True Optical Density to Transmittance plot for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Pputida OD iFG.PNG|title=Corrolating the true optical density of the OD/F device to true optical density of the photospectrometer for ''P. putida''|subtitle=|width=700px}}<br />
</center><br />
<br />
==== ''Saccharomyces cerevisiae'' ====<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer iFG.PNG|title=True Optical Density to Transmittance plot for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 Scer OD iFG.PNG|title=Corrolating the true optical density of the OD/F device to true optical density of the photospectrometer for ''S. cerivisiae''|subtitle=|width=700px}}<br />
</center><br />
<br />
From these plots, it can be seen that our device delivers robust and reproducible results for both procaryotes and eucaryotes.<br />
Also the function from transmittance to true OD follows a clear pattern, making its calculation possible on a low-end device like a microcontroller.<br />
<br />
It is interesting to observer that function $g$, mapping the true OD of our device to the true OD of the photospectrometer, are close together for both ''P. putida'' and ''S. cerivisae'', as seen by the regression coefficient.<br />
In fact, 3.416 and 3.461 are such close together, that the minor deviation could be just measuring inaccuracy.<br />
Therefore, we fix the regression coefficient for converting true OD of our device to true OD of the photospectrometer to an average of 3.432 .<br />
<br />
Additionally the function $f$ for mapping transmittance to true OD for our device is similar for all cell types, as seen in the following figure. Therefore the exponential regression curve for all cell types specifies this function.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_ODallstrains1.png|title=Transmission of different cell types at OD-values from 0.001-1|subtitle=The transmittance data of NIH&nbsp;3T3 cells (mouse fibroblasts) align with the transmittance of ''P.&nbsp;putida'' and ''S.&nbsp;cerevisiae'' strains, even though the measured optical densities are lower by 1-2 orders of magnitude.|width=800px}}<br />
</center><br />
Finally, we have empirically determined our $OD(T)$ function by finding $f$ and $g$, such that we can convert true OD to the optical density of the photospectrometer.<br />
<br />
By this evaluation, we have shown that our self-build OD/F device can compete with commercial systems.<br />
It is easy to calibrate by just calculating the true optical density.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_17-10-14_Glowing_cuvette-ipo.png|right|150px]]<br />
<br />
= Evaluation of the Fluorescence Measurement =<br />
<span class="anchor" id="f"></span><br />
<br />
For the evaluation of the fluorescence measurement, we performed a dilution series of a constitutively GFPmut3b expressing ''E. coli''.<br />
<br />
The below figure shows the absolute measurements for both the platereader and our OD/F device. The abrupt jump at 50% concentration can be explained by a second dilution step and is prevalent in both devices.<br />
It can be seen that the platereader show a much higher difference between the GFP and non-GFP cell culture at a higher standard deviation.<br />
Another interesting metric is the difference between the GFP and non-GFP, which can be seen as the normalized fluorescence measure.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachn 15-10-14 F platereader ODF iFG.PNG|title=Fluorescence Measurement comparison OD/F device and Platereader (absolute values)|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant linearity.|width=700px}}<br />
</center><br />
<br />
If one compares the results there, as in the below figure with normalized fluorescence values, interesting observations can be made.<br />
First, both platereader and OD/F device show very similar results.<br />
The regression curves differ only in a linear factor.<br />
Most interestingly the general fit of the OD/F device to a linear function seems to be better than the platereader.<br />
Overall the linearity which has been observed earlier (in testing the general setup) could be verified.<br />
Therefore our do-it-yourself OD/F device can be used to determine fluorescence.<br />
<br />
<center><br />
{{Team:Aachen/Figure|align=center|Aachen 15-10-14 F platereader ODF2 iFG.PNG|title=Fluorescence Measurement comparison OD/F device and platereader using normalized fluorescence values|subtitle=Comparison of a fluorescence measurement of our device and the platereader. Our OD/F device shows no significant. A non-GFP expressing ''E. coli'' dilution has been used to normalize the GFP dilution series. A linear correlation can be seen.|width=700px}}<br />
</center><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_DIY_Cellocks_iNB.png|right|150px]]<br />
<br />
= DIY: How to Build Your Own Device =<br />
<span class="anchor" id="diy"></span><br />
== Technical Components ==<br />
<br />
While the casing and the cuvette holder are custom made, most of the parts are pre-made and can be readily bought. The previous section lists all needed parts.<br />
To get all these parts for creating your own OD/F device is easy using the internet. Thus all '''potential customers have a market access''' to the used components. <br />
<br />
Please find our custom parts for download below. Despite being custom parts, these are quite inenxpensive - so feel free to give our OD/F device a test! For printing the 3D model of our cuvette holder and laser cutting our case, we want to express many thanks to [http://hci.rwth-aachen.de/fablab Fablab Aachen].<span class="anchor" id="ref2"></span><br />
<br />
* cuvette holder [https://2014.igem.org/Template:Team:Aachen/cuvette.stl?action=raw STL file]<br />
* casing single device [https://2014.igem.org/File:Aachen_ODF_device_casing.svg.zip SVG file]<br />
* lid combined device [https://2014.igem.org/File:Aachen_Odf_device_combined_lid.svg.zip SVG file]<br />
* Arduino Code for single device [https://2014.igem.org/Template:Team:Aachen/arduino_single.ino?action=raw Sketchbook (.ino)]<br />
* Arduino Code for combined device [https://2014.igem.org/Template:Team:Aachen/arduino_combined.ino?action=raw Sketchbook (.ino)]<br />
<br />
You will need a special [http://www.exp-tech.de/images/product_images/description%20images/YWRobot/1602/LiquidCrystal_I2C1602V2.rar library] for the display, which can not be uploaded for legal reasons.<br />
<br />
<br />
<center><br />
'''All needed components their quantities and prices for creating your own OD/F device'''<br />
{| class="wikitable"<br />
! align="center" |'''OD/F device'''<br />
!! align="center" | <br />
!! align="center" |''' 1€='''<br />
!! align="center" |''' $1.27'''<br />
!! align="center" |''' on 14/10/2014'''<br />
!! align="center" | <br />
|-<br />
! Quantity!!Component!! Costs [€] !! Costs [$] !! Final [€] !! Final [$] <br />
|-<br />
| 1||[http://www.dx.com/p/uno-r3-development-board-microcontroller-mega328p-atmega16u2-compat-for-arduino-blue-black-215600#.VDzwV9ysWBp Arduino UNO R3]||9.17||11.65||9.17||11.65 <br />
|-<br />
| 1||[http://www.mouser.de/ProductDetail/ams/TSL235R-LF/?qs=14HO7rLZPQsjmBHaoYCzkA%3D%3D TSL 235R]||2.47||3.14||2.47||3.14 <br />
|-<br />
| 1||[http://www.dx.com/p/16-x-2-character-lcd-display-module-with-blue-backlight-121356 Display 16x2]||2.58||3.28||2.58||3.28 <br />
|-<br />
| 1||[http://www.dx.com/p/lcd1602-adapter-board-w-iic-i2c-interface-black-works-with-official-arduino-boards-216865#.VDzxHNysWBp LCD Display to I2C]||1.57||1.99||1.57||1.99 <br />
|-<br />
| 1||[http://www.newark.com/multicomp/mcpas6b1m1ce3/switch-pushbutton-spst-400ma-125v/dp/12P7696?ost=1638329 Pushbutton]||2.90||3.69||2.90||3.69 <br />
|-<br />
| 1||[http://shop.leefiltersusa.com/Swatch-Book-Designers-Edition-SWB.htm filter leaflet]||1.57||2.00||1.57||2.00 <br />
|-<br />
| 20||[http://www.dx.com/p/diy-male-to-female-dupont-breadboard-jumper-wires-black-multi-color-40-pcs-10cm-339078#.VDzxSdysWBp jumper wire cables]||0.09||0.11||1.80||2.28 <br />
|-<br />
| 1||[http://www.dx.com/p/syb-170-mini-breadboard-for-diy-project-red-140101#.VDzyudysWBo small breadboard]||1.98||2.51||1.98||2.51 <br />
|-<br />
| 1||[http://www.dx.com/p/universal-ac-charger-w-dual-usb-output-for-iphone-ipad-ipod-white-us-plug-244893 power supply]||2.20||2.80||2.20||2.80<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
| 1||3&nbsp;mm acrylic glas (black)||7.98||10.14||7.98||10.14<br />
|-<br />
| 1||[http://www.dx.com/p/prototype-universal-printed-circuit-board-breadboard-golden-10-piece-pack-143913 Prototype Universal Printed Circuit Board]||2.27||2.88||2.27||2.88<br />
|-<br />
| 1||[http://www.dx.com/p/2-54mm-1x40-pin-breakaway-straight-male-header-10-piece-pack-144191o Male Headers]||2.14||2.72||2.14||2.72<br />
|- style="border-top: 2px solid #808080;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600&nbsp;nm]||0.94||1.19||0.94||1.19<br />
|-<br />
! -!!Total OD!!-!!-!! 46.01 !! 58.45 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
! -!!Total F!!-!!-!! 46.06 !! 58.52 <br />
|- style="border-top: 2px solid #808080;;"<br />
| 1||[http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== LED 600nm]||0.94||1.19||0.94||1.19 <br />
|-<br />
| 1||[http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html LED 480&nbsp;nm]||0.99||1.26||0.99||1.26<br />
|-<br />
| 1||cuvette holder (3D print service of your choice)||6.44||8.18||6.44||8.18<br />
|-<br />
! -!!Total OD/F!!-!!-!! 53.44 !! 67.89 <br />
|-<br />
|}<br />
</center><br />
<br />
For more detailed economical information about the OD/F project visit our [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View] page.<br />
<br />
== Breadboards ==<br />
<br />
=== Optical Density ===<br />
<br />
{{Team:Aachen/Figure|Aachen ODdevice Steckplatine.png|align=center|title=Breadboard of our OD device|subtitle=To build your own OD device, connect the parts as shown in this diagram.|width=900px}}<br />
<br />
If you want to build our OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#019 Fire 019]<br />
* LED: [http://www.mouser.de/ProductDetail/Dialight/550-2505F/?qs=0KZIkTEbAAvqMAW7suDOXg== 600 nm] Dialight 550-2505F<br />
<br />
=== Fluorescence ===<br />
<br />
{{Team:Aachen/Figure|Aachen_Fdevice_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
If you want to build the OD device, make sure to use the following secret ingredients:<br />
* Filter: [http://www.leefilters.com/lighting/colour-details.html#736 Twickenham Green 736]<br />
* LED: [http://www.leds.de/Low-Mid-Power-LEDs/SuperFlux-LEDs/Nichia-Superflux-LED-blau-3lm-100-NSPBR70BSS.html 480 nm] NSPBR70BSS LED<br />
<br />
=== Combined Device ===<br />
Even though evaluation of the measurements have been performed in two separate device, it is fairly well possible to put everything into one casing.<br />
All you need to do is choosing another lid, and connect a second light to frequency sensor to your Arduino.<br />
Right at the bottom we present you the differences in wiring things up.<br />
Building the combined device is straight forward and very similar to the single device. You will need a slightly larger connector, a different lid for your case, and some more cables. The corresponding fritzing-layout is presented below.<br />
<br />
{{Team:Aachen/Figure|Aachen_ODF_combined_Steckplatine.png|align=center|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=900px}}<br />
<br />
== Construction Steps ==<br />
{| class="wikitable centered"<br />
|-<br />
| [[File:Aachen_ODF_9.JPG|300px]] || First we want to assemble the casing. Once you have all the cut parts, you can start to assemble them. For cutting, we really recommend using a laser cutter.<br />
|-<br />
| [[File:Aachen_ODF_8.JPG|300px]] || Attach the cuvette-holder holders such that the cuvette holder is placed directly under the opening hole.<br />
|-<br />
| [[File:Aachen_ODF_4.JPG|300px]] || Next build the lid of the device. At this stage you can already mount the button. We recommend to glue any parts.<br />
|-<br />
| [[File:Aachen_ODF_3.JPG|300px]] || Your lid finally should look like this.<br />
|-<br />
| [[File:Aachen_ODF_11.JPG|150px]][[File:Aachen_ODF_10.JPG|150px]] || Next we want to assemble the cuvette holders. On the side with the square hole attach the light-to-frequency sensor with glue. For the OD case place the orange LED opposite, or for fluorescence, the LED in the hole in the bottom. Make sure to close any remaining open hole! Please attach a piece of filter foil (approx. $7 \times 7 mm^2$) from the inside in front of the light to frequency converter. Forceps is highly recommended.<br />
|-<br />
| [[File:Aachen_ODF_12.JPG|300px]] || Your final assembly should then look like this. Now place the correct filter into the cuvette holder, directly in front of the sensor. Make sure that the filter does not degrade due to the glue!<br />
|-<br />
| [[File:Aachen_ODF_14.JPG|300px]] || As the case can be used for both, fluorescence and OD measurement, we use a combined plug. Just three header rows (7 pins, 9pins for combined) and connect them as we did.<br />
|-<br />
| [[File:Aachen_ODF_1.JPG|300px]] || Now we're doing the wiring. Connect the Arduino 5V and GND such that you have one 5V and one GND line on your breadboard.<br />
|-<br />
| [[File:Aachen_ODF_2.JPG|300px]] || Then connect the button to 5V on the one side, and to GND via a resistor on the other side. Connect this side also to port __ on your Arduino. This will sense the blank. Next connect the display to the Arduino and our connector. See the Fritzing diagram at the bottom for a detailed information.<br />
|-<br />
| [[File:Aachen_ODF_13.JPG|300px]] || Now put everything into the case and ...<br />
|-<br />
| [[File:Aachen_ODF_6.JPG|300px]] || ... also place the cuvette holder into the device. Attach the display to the device lid and close the casing.<br />
|-<br />
| [[File:Aachen_ODF_7.JPG|300px]] || Congratulations! You have finished constructing your own OD/F device!<br />
|-<br />
| [[File:Aachen_zwei_Kuevetten.jpg|300px]] || ... or even the combined device!<br />
|}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== References ==<br />
Lawrence, J. V., & Maier, S. (1977). Correction for the inherent error in optical density readings. Applied and Environmental Microbiology, 33(2), 482–484. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=170707&tool=pmcentrez&rendertype=abstract.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Protocols/detectionTeam:Aachen/Notebook/Protocols/detection2014-10-17T21:23:53Z<p>StefanReinhold: /* Measurement of Fluorescence */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= 2D Detection of IPTG and HSL =<br />
<br />
The method of the chip production was developed by this year's iGEM Team Aachen with [https://2014.igem.org/User:Aschechtel Anna] as driving force and person in charge. A lot of parameters were tested and the final protocol for the production of the sensor chips the way there were used for detection in the project is published below.<br />
<br />
== Chip Production ==<br />
<br />
'''Cell Preparation'''<br />
<br />
# over night culture of sensor cells (50&nbsp;ml in a 250&nbsp;ml flask with) max. 16&nbsp;h<br />
# centrifuge all 50&nbsp;ml by 3000&nbsp;g for 10&nbsp;min at RT (21°C).<br />
# discard the supernatant<br />
# re-suspend the pellet in 1&nbsp;mL tempered (~21°C) LB-medium.<br />
<br />
<br />
'''Agar Preparation'''<br />
<br />
# autoclave 50&nbsp;ml medium with 1.5%(w/v) agarose (has to be multiplied with the number of chips prepared).<br />
# cool it down to 45°C in a water bath.<br />
<br />
<br />
'''Chip Preparation'''<br />
<br />
# mix the cooled medium with the cells by inverting gently.<br />
# pour it in the chip mold, avoiding bubble formation (!).<br />
# wait for approximately 20 min until the agar has solidified.<br />
# cut out the chips with a scalpel.<br />
# put two chips into a labeled petri dish and store additional 4 chips in labeled petri dishs in the refrigerator.<br />
# incubate two chips for 1&nbsp;h at 37°C prior to induction.<br />
<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen 14-10-09 flowsheet chip manufacturingV8 ipo.png|title=Sensor-chip manufacturing|subtitle=Scheme illustrating the work flow during chip production. For the production steps see above.|width=1000px}}<br />
</center><br />
<br />
== Measurement of Fluorescence ==<br />
<br />
For measurement of a fluorescence response in our sensor chips we used three different methods.<br />
<br />
'''First''', the '''Gel Doc™ XR+''' (BIO-RAD) was used, exciting with UV light for an exposure time of 1&nbsp;s.<br />
<br />
'''Second''', we used our own device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device '''''WatsOn'''''] with blue light for excitation (450 or 480&nbsp;nm) and special filters infront of the camera for selecting the appropriate emission spectrum. You can read even more about building your own ''WatsOn'' [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn here].<br />
<br />
'''Third''', we used the '''Synergy Mx microplate reader''' (BioTek), putting the sensor chips into the lid of a common clear well plate. GFP was measured with an excitation of 496&nbsp;±&nbsp;9&nbsp;nm and an emission of 516&nbsp;±&nbsp;9&nbsp;nm and iLOV with an excitation of 450&nbsp;±&nbsp;9&nbsp;nm and emission of 495&nbsp;±&nbsp;9&nbsp;nm.<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/File:Team_Aachen_Teamfoto.pngFile:Team Aachen Teamfoto.png2014-10-17T21:21:08Z<p>StefanReinhold: uploaded a new version of &quot;File:Team Aachen Teamfoto.png&quot;: Reverted to version as of 20:25, 17 October 2014</p>
<hr />
<div>Picture for landing page</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/OctoberTeam:Aachen/Notebook/Wetlab/October2014-10-17T21:18:55Z<p>StefanReinhold: /* 3rd */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= October =<br />
== 1st ==<br />
* Prepartations for sensor-chip production the following day (2014-10-02) was done accoringly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 18:30 we prepared over-night cultures from K1319042, B0015 and K131026 by inoculating 250&nbsp;ml Erlenmeyer flasks each containing 50&nbsp;ml LB medium . The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
== 2nd ==<br />
<br />
* At 8:30, we did a plasmid prep of dublicate samples of K1319011 clone #1 and #6. We measured the DNA yield, and the higher concentrated sample of clone #1 and #6, respectively, were sent in for sequencing.<br />
* made precultures and a master plate of 6 colonies of K3139008 in psB1C3 in NEB10β cells that had been plated at 5:30 this morning.<br />
<br />
* Production of sensor-chips was done accordingly to [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Briefly:<br />
** At 10:00 we prepared 150&nbsp;ml 1.5%&nbsp;(w/v) LB+agarose solution. The LB+agarose solution was autoclaved and subsequently tempered to 45°C. Precultures (50&nbsp;ml each) of K1319042, B0015 and K131026 were spun down at 3000&nbsp;g for 10&nbsp;min at 21°C and re-suspended in 1&nbsp;ml pretempered (21°C) LB medium. The re-suspended cultures were mixed with 50&nbsp;ml LB+agarose and poured onto three sensor-chip-templates (one template per culture). Sensor chips were cut out from the template and incubated at 37°C for 1&nbsp;h.<br />
** K1319042 and B0015 were induced with 0.2&nbsp;µl IPTG (100&nbsp;mM) subsequently to incubation and K131026 was induced with 0.2&nbsp;µl homoserinlacton stock solution (500&nbsp;µg/ml) 30 minutes after induction of the K1319042 and B0015. The induced sensor-chips were read out every 30 minutes for 180 minutes in total. An additional readout was conducted 285 minutes post induction. The readout was done at 450&nbsp;nm and 480&nbsp;nm wavelength. <br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_10_2014_B0015_serie.png|title=Sensor Chips with B0015 in NEB in LB (480&nbsp;nm): first try with final device|subtitle=Sensor chips with B0015 in NEB in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 100&nbsp;mM IPTG B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
* Gibson assembly of K1319008<br />
** template Backbone: I746909, Insert: K1319004<br />
** transformation in ''E.coli'' NEB10β and BL21<br />
<br />
* PCRs for Gibson assembly of K1319010 and K1319015<br />
** template Backbone: I20260 for K1319010 and K1319015<br />
** template Insert: K1319000 for K1319010 and K1319015 (but different primer)<br />
<br />
* made precultures of K1319013 and K1319014 in pSB3K3<br />
<br />
* K1319011 in pSB1C3 prepped for sequencing<br />
<br />
* Gibson assembly of K1319017 (PCRs, Gibson assembly, restriction with DnpI, transformation into NEB10β)<br />
** template Backbone: B0015<br />
** template Insert 1: LasI synthesized gene<br />
** template Insert 2: K660004<br />
<br />
==3rd==<br />
<br />
* made master plates of K1319008 in NEB10β and BL21 and precultures<br />
<br />
* check PCR for K1319008 to validate the Gibson assembly check for potential I746909 residues<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_K1319008_insert_colonyPCR.png|title=Check PCR K1319008|subtitle=K1319008 was checked with the Primers K1319008_Check_R and I746909_Check_R (both with G00100 Alternative as froward primer) for presence of K1319008 or I746909. All tested clones were positive for K1319008 and negative for I746909.|width=800px}}<br />
</center><br />
<br />
* did a plasmid prep and made cryo stocks of K1319008 in NEB (clones #1, #2, #3) and BL21 (clones #1, #2)<br />
<br />
* plasmid prep of K1319013 and K1319014 in pSB3K3<br />
<br />
* Gibson assembly for K1319010 and transformation into NEB10β<br />
<br />
* made cryo stocks of K1319011 clone #6<br />
<br />
* restriction of K1319012, k1319013 and K1319014 with EcoRI and PstI. Restriction of linearized plasmid backbone pSB1C3 with EcoRI and PstI. Ligation of K1319012, K1319013 and K1319014 into pSB1C3. Transformation into NEB10β. <br />
<br />
* Gibson assembly of K1319015 and transformation into NEB10β<br />
<br />
* colony PCR of K1319017<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_colony_PCR_K1319017.png|title=colony PCR K1319017|subtitle=K1319017 was checked with a colony PCR for the right insert length. Clones #2 and #4 were correct and used forthwith.|width=800px}}<br />
</center><br />
<br />
* did plasmid prep and cryo of clones #2 and #4 of K1319017<br />
<br />
* new plasmid backbone of pSB1C3 was made using the [http://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones|standard protocol].<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and K1319013 into BL21 (two plasmids in one cell).<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and k1319014 into BL21 (two plasmids in one cell).<br />
<br />
* OD measurements of three biological triplicates from ''E. coli'' BW21 113, ''P. putida'' and ''S. cerevisiae''. Measurement as an analytic triplicate in the spectrophotometer (absorbance and transmission) and our own OD/F Device.<br />
<br />
* Gibson assembly of K1319021 <br />
** template Backbone: K1319008<br />
** template Insert: LasI gene synthesis<br />
<br />
* At 19:00 we measured OD (our OD-device), absorption (spectrophotometer) and transmission (spectrophotometer) for 19 diltuions in the range of 2.5-100% from yeast (''Saccharomyces cerevisiae'') and ''P. putida'' liquid cultures. Measurements were conducted in biological as well as technical triplicates. Aim of this experiment was the comparison of our OD-device to commonly used devices in terms of OD determination.<br />
<br />
* Prepartations for sensor-chip production the following day (2014-10-04) were done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 22:00 we prepared over-night cultures from B0015, K1319017 and K131026 by inoculating 250&nbsp;mL Erlenmeyer flasks each containing 50&nbsp;mL LB medium for sensor-chip manufacturing the next day. The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
* Our BioBrick K1319021 enables expression of the TEV protease inducible by the autoinducers of ''Pseumomonas aeruginosa''. In order to construct this BioBrick, a Gibson assembly of K1319008 (IPTG-inducible expression of TEV protease) and the synthezised composite HSL-promotor J23101.B0032.C0079.B0015.J64010.B0034 activated by the respective autoinducers (HomoSerineLactones) was perfomed. Prior to this, we used two PCRs to linearize pSB1C3-K1319008, serving as backbone for Gibson assembly, and cutting out J23101.B0032.C0079.B0015.J64010.B0034 as well as adding adequate overlapping sequences.<br />
<br />
<center><br />
{| class="wikitable"<br />
| <div style="text-align: center;">'''PCRs'''</div> || colspan="2" | <div style="text-align: center;">'''K1319008'''</div> || colspan="2"| <div style="text-align: center;">'''HSL-Promotor'''</div> ||<br />
|-<br />
! step !! time [mm:ss] !! temperature [°C] !! time [mm:ss] !! temperature [°C] !! <br />
|-<br />
| Initial denaturation || 05:00 || 98 || 05:00 || 98 ||<br />
|-<br />
| '''Denaturation''' || '''00:30''' || '''98''' || '''00:30''' || '''98''' || rowspan="3" | '''30 cycles'''<br />
|-<br />
| '''Annealing''' || '''00:30''' || '''55''' || '''00:30''' || '''51''' <br />
|-<br />
| '''Elongation''' || '''01:35''' || '''72''' || '''00:37''' || '''72'''<br />
|-<br />
| Final elongation || 05:00 || 72 || 05:00 || 72 ||<br />
|}<br />
</center><br />
<br />
==4th ==<br />
<br />
* colony PCR of K1319015 and Check PCR of K1319010<br />
** K1319010: clone #1 was positive<br />
** K1319015: in all clones the inserts were too short. <br />
<br />
* new digestion of Gibson master mix of K1319015 with DnpI<br />
<br />
* transformation of new Gibson master mix into NEB 10β<br />
<br />
* restriction of K1319010, K1319012, K1319013 and K1319014 (all in pSB3K3) with EcoRI and PstI, cutting of pSB1C3 with EcoRI and PstI, and then ligation.<br />
<br />
* made master plates and precultures of the transformations of K1319008 in BL21, K1319013 + K1319008 in BL21 and K1319014 + K1319008 in BL21<br />
<br />
* colony PCR of the master plates with the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008<br />
<br />
* sent the first BioBricks to the iGEM headquarters:<br />
** K1319000: RFC25 version of E0030<br />
** K1319001: REACh1 (Quencher)<br />
** K1319002: REACh2 (Quencher)<br />
** K1319003: Galectin 3<br />
** K1319004: TEV protease<br />
** K1319008: IPTG inducible expression of TEV protease<br />
** K1319011: J23101.B0032.K1319001.B0015<br />
** K1319017: HSL inducible expression of iLOV<br />
** K1319020: B0034.K1319009.B0015 in pSBX1A3<br />
** K1319042: IPTG inducible expression of iLOV<br />
<br />
* shake flask experiments with K1319008 (clone #1), K1319013 + K1319008 (clone #2) and K1319014 + K1319008 (clone #2) in LB (2 flasks each); inoculation with 50&nbsp;µL preculture and inducing with iPTG at OD of 1.5.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 13:30 we prepared sensor chips from pre-cultures of B0015, K1319017 and K131026.<br />
** Subsequently to 1&nbsp;h icubation at 37°C B0015, K1319017 and K131026 were induced with 0.2&nbsp;µL homoserinlacton stock solution (500&nbsp;µg/ml). The induced sensor-chips were read out every 30 minutes for 240 minutes in total. Readout was conducted at 450&nbsp;nm and 480&nbsp;nm wavelength. An additional readout was conducted after 12 hours.<br />
<br />
* At 17:00 we prepared 4 liquid cultures from the K1319010_pSB3K3 master plate (clone#1) in 5&nbsp;mL LB-medium, each. The liquid cultures were prepared in order to create cryo stocks from K1319010-pSB3K3. Kanamycin was added to the liquid cultures as antibiotic at an concentration of 1&nbsp;µL/mL.<br />
<br />
* At 18:00 we prepared a master plate (LB+C) and corresonding liquid cultures from 6 clones of ''E.coli'' NEB10B k1319021-psB1C3. Liquid cultures and master plate were incubated at 37°C.<br />
<br />
* At 23:30 we prepared liquid cultures from K1319015-pSB3K3 clones #7, #8 and #9 in 5&nbsp;mL LB-medium. Kanamycin was used as antibiotic and the cultures were incubated at 37°C. Purpose of the cultures was cryo stock preparation and plasmid prep.<br />
<br />
==5th ==<br />
<br />
* At 11:45 we prepared cryo stocks from NEB K1319010-pSB3k3 #1, K1319015-pSB3K3 #7, K1319015-pSB3K3 #8 and K1319015-pSB3K3 #9 by mixing 750&nbsp;µl lquid culture with 750&nbsp;µl 50%&nbsp;(v/v) Glycerol-solution in 2&nbsp;ml eppis.<br />
**Plasmid prep was also done for the cultures mentioned above.<br />
<br />
* At 12:00 we prepared liquid cultures from K139010-pSB3K3, K139011-pSB3K3, K139012-pSB3K3, K139013-pSB3K3, K139014-pSB3K3, K139015-pSB3K3 in 5&nbsp;ml LB-medium each. Kanamycin was used as antibiotic. Purpose for the cultures was the characterization of constituitive expression and an additional plasmid prep of K139013-pSB3K3 and K139014-pSB3K3.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 13:00 we prepared sensor chips from shake flask pre-cultures of BL21 pSB1C3-K1319008+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015.<br />
**Subsequently to 1&nbsp;h incubation at 37°C, BL21 pSB1C3-K131900+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015 were induced with 0.2&nbsp;µL IPTG. The induced sensor-chips were read out every 30&nbsp;minutes for 360&nbsp;minutes in total. K1319013 was induced earlier and thus measurements were taken for 450&nbsp;min in total. Readout was conducted at 480&nbsp;nm wavelength. An additional readout was conducted next day at 11:00.<br />
<br />
* At 15:30 we prepared liquid cultures for the characterization of ITPG inducible expression:<br />
** I746909 in pSB1C3<br />
** I20260 in pSB3K3<br />
** K731520 in pSB1C3<br />
** K1319008 in pSB1C3<br />
** K1319013 in pSB3K3<br />
** K1319014 in pSB3K3<br />
** B0015 in pSB1C3<br />
** K1319013 in pSB3K3 + K1319008 in pSB1C3<br />
** B0015 in pSB1C3<br />
** K1319014 in pSB3K3 + K1319008 in pSB1C3<br />
<br />
* prepared a colony PCR from K1319014-pSB1C3 clones #3, #4, #5 and#6. H20 and K1319014-pSB3K3 were used as controls.<br />
<br />
* At 22:20 we prepared 1&nbsp;L LB+C plates (2.5&nbsp;g NaCl, 10&nbsp;g Agar, 2.5&nbsp;g yeast extract and 5&nbsp;g Trypton). N-Z-amine (peptone from casein) was used instead of tryptone, because the tryptone stock was depleted.<br />
<br />
* prepped multiple cultures K1319013 in pSB3K3 and K1319014 in pSB3K3. Now we have sufficient amount of both plasmids.<br />
<br />
* Plates were made for the following constructs:<br />
<br />
<center><br />
{| class="wikitable"<br />
! part in vector !! strain !! resistance<br />
|-<br />
| K1319008 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319010 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319011 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319012 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319013 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319014 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319015 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319017 in pSB1C3 || NEB10β || C<br />
|-<br />
| K1319042 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319008 in pSB1C3 + K1319013 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| K1319008 in pSB1C3 + K1319014 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| I746909 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K731520 in pSB1C3 || DH5α || C<br />
|-<br />
| I20260 in pSB3K3 || NEB10β || K<br />
|-<br />
| B0015 in pSB1C3 || NEB10β || C<br />
|}<br />
</center><br />
<br />
* To determine whether the conducted Gibson assembly of K1319021 and subsequent transformation into ''E. coli'' NEB 10β were successful, a colony PCR on these cells was performed. Primers binding to each of the templates used for Gibson assembly were used: LasI_Insert_F binding in J23101.B0032.C0079.B0015.J64010.B0034 and K1319004_Check_R binding in pSB1C3-K1319008. Bands at 1341&nbsp;bp would indicate the successful construction and transformation of K1319021. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-05_Check_PCR_on_K1319021.png|title=Check PCR on K1319021|subtitle=(Homoserinlactone-inducible expression of the TEV protease)|width=800px}}<br />
</center><br />
<br />
Since Bands >2000&nbsp;bp were observed, another PCR was performed by using primers binding upstream and downstream of the insert in pSB1C3: G00100_alternative and G00101_alternative. Here, bands with a length of 2210&nbsp;bp would verify the correct length of K1319021.<br />
<br />
==6th ==<br />
<br />
* made a SDS page of K1319010-15 and J23101.E0240<br />
<br />
* made a master plate at 15:30 containing two clones of K1319015 plate from yesterday.<br />
<br />
* At 22:00 we inocculated two 500&nbsp;ml flasks containing 50 ml&nbsp;LB-medium with 1&nbsp;ml pre-culture of K1319017, which had been prepared from a master-plate earlier this day. Chloramphinicol was used as antibiotic. The flasks were incubated at 37°C. One culture (50&nbsp;ml) was induced with 25&nbsp;µg homoserinlacton after an OD of 0.6 was reached and the induced culture as well as the control were used for fluorescence characterization. Fluorescene and OD were monitored once per hour. The OD of the induced culture stagnated at ~0.7 while the non induced culture grew further.<br />
<br />
== 7th ==<br />
<br />
* Two conducted colony PCRs confirmed that our double plasmid systems of K1319008 and K13190013/14 contain nothing but the desired BioBricks, which were used as positive controls. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-07_colonyPCR_on_characterization_constructs.png|title=colony PCR cells harboring the double plasmid system pSB3K3-K1319008 pSB1C3-K1319013/14|subtitle=(IPTG-inducible expression of the TEV protease and constitutive expression of our GFP-Quencher-Constructs)|width=800px}}<br />
</center><br />
<br />
*Characterisation of the biobrick K1319008 together with the biobricks K1319014 and K1319013.<br />
<br />
*Therefore the following biobricks were cultivated in biological triplicates:<br />
<br />
<center><br />
{|class="wikitable"<br />
!biobrick !! strain !! plasmid !! induced with iPTG<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || no<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || yes<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K731520 || BL21 || pSB1C3 || no<br />
|- <br />
|K731520 || BL21 || pSB1C3 || yes<br />
|-<br />
|I746909 || BL21 || pSB1C3 || no<br />
|-<br />
|I746909 || BL21 || pSB1C3 || yes<br />
|-<br />
|B0015 || NEB 10 Beta || pSB1C3 || no<br />
|-<br />
|I20260 || BL21 || pSB3K3 || no<br />
|-<br />
|}<br />
</center><br />
<br />
* overnight culture of K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 for chip production ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]).<br />
<br />
== 8th ==<br />
* We prepared sensor-chips with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and B0015 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Images were made every 30 min with our own device.<br />
* made precultures with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and K731520. <br />
* cutting K1319013, K1319014 ans a pSB1A3 vector backbone with EcoRI and SpeI and K1319008 with XbaI and PstI<br />
* Ligation of K1319013/K1319014 with K1319008 and then ligation into pSB1A3<br />
*Transformation of the ligation product into BL21<br />
<br />
== 9th ==<br />
* SOC medium was added to the transformation before the heat shock had occurred by mistake.<br />
* At 02:00 the precultures for the characterization experiment were transferred to 250&nbsp;ml shake flasks (3&nbsp;ml culture + 10&nbsp;ml LB+antibiotics).<br />
* new transformation of the ligation product was conducted into BL21 and DH5α<br />
* At 23:00 a 500&nbsp;ml flask containing 50&nbsp;ml LB-medium was inocculated from a K131026 BL21 cryo stock for sensor-chip manufacturing the following day.<br />
<br />
== 10th ==<br />
* made master plates of the new transformation of the ligation product and overnight cultures<br />
* made chips with K131026 in BL21. Images were taken automaticly every 5 min with our own device<br />
<br />
* For sensor-chip manufacturing the following day, we inocculated 500&nbsp;ml flasks containing 50&nbsp;ml LB-medium with NEB10β K1319017.pSB1C3 clone #2 and with BL21 K1319042.pSB1C3 clone 2# accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Inoccultion was done at 21:35.<br />
*In preparation for an additional main charcterization experiment we inocculated 200 ml flasks or 300 ml flasks as available containing 25 ml LB-medium with seven of our own constructs listd below. Inoccuaation was done at 22:00.<br />
**K1319010<br />
**K1319011<br />
**B0015<br />
**I20260<br />
**K1319015<br />
**K1319014<br />
**K1319012<br />
**k1319013<br />
<br />
==11th==<br />
<br />
*At 21:00 we inocculted two 500 ml flasks containing 50 ml LB-medium with BL21 K1319042.pSB1C3 (from plate) and DH5α K1319026.pSB1C3 (from cryo), respectively. Chloramphenicol was used as antibiotik. Both cultures were required for chip manufacturing the next day ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]). The chips´ fluorescence was meant to be measured with a plate reader starting ~11:00 the next day. The chips were meant to be measured in parallel.<br />
<br />
*At 20:30 eight cultures listed below were plated out for additional characterization experiments on monday.<br />
**B0015 in pSB1C3<br />
**I20260 in pSB3K3<br />
**K731520 pSB1C3 #2<br />
**I746909 in pSB1C3<br />
**K1319042 i pSB1C3 #2<br />
**K1319008 in pSB1C3 #1<br />
**K1319008/13 in pSB1C3/3K3 #1<br />
**K1319008/14 in pSB1C3/3K3 #2<br />
<br />
==12th==<br />
<br />
*At 9:00 sensor-chips were prepared from precultures of BL21 K1319042.pSB1C3 and DH5α K1319026pSB1C.pSB1C3 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. The cultures were induced at ~11:00 and fluorescence was measured using a plate-reader. K1319026 was additionally measured in our device for its fluorescence.<br />
* Media with different antibiotics for the experiment for collaboration with Heidelberg were prepared. Also media for Robolektor were made.<br />
* Cultures of I13507 in seven vectors listed below were solued in 0,9% NaCl for the OD measurment. Then all cultures and an additional positive control were inoculated in 96-wellsplate with resulted OD of 0,648. The cultures were required for calibration of the plate-reader used for fluorescence measurement, which was part of the Heidelberg chracaterization project. Inocculation was done at ~19:15.<br />
**pSBX1A3<br />
**pSBX4A5<br />
**pSBX1C3<br />
**pSBX4C5<br />
**pSBX1K3<br />
**pSBX4K5<br />
**pSBX1T3<br />
<br />
*At 22:15 a 300 ml flask containing 30 ml LB-medium was inocculated with I746909.pSB1C3. The culture was required for calibration of the robolector (Jülich FHZ). Cloramphenicol was used as antibiotic.<br />
<br />
==13th==<br />
* overnight culture of K131026 in BL21 for chips<br />
<br />
==14th==<br />
* made chips of K131026 in BL21 in LB. Images were taken nearly every 5 or 2&nbsp;min with our own device. Chips were induced with 2&nbsp;µl of ''Pseudomonas aeruginosa'' liquid culture or 500&nbsp;µg/ml HSL<br />
* overnight cultures of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 in BL21 for chips<br />
<br />
== 15th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 (BL21) in LB. Images were taken every 2&nbsp;min with our own device and every 4&nbsp;min in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
* made overnight cultures of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 for chips<br />
<br />
== 16th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 in LB. Images were taken every 2&nbsp;min with our own device from K731520 and I746909 and every 4&nbsp;min from all strains in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T21:16:34Z<p>StefanReinhold: /* 19th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5α cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5α, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F Device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5α for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F Device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F Device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Collaborations/MakerFaireTeam:Aachen/Collaborations/MakerFaire2014-10-17T21:11:16Z<p>StefanReinhold: /* Representing iGEM and Synthetic Biology at the MakerFaire Hannover */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
<br />
{{Team:Aachen/Test/GalleryHeader}}<br />
<br />
[[File:Aachen_14-10-10_Logo_MakerFaire_with_Border_iNB.png|right|150px]]<br />
<br />
= Representing iGEM and Synthetic Biology at the MakerFaire Hannover =<br />
<br />
On July 4th-7th, [[User:fgohr|Florian]], [[User:R.hanke|René]] and [[User:mosthege|Michael]] joined [[User:Ansgar|Ansgar]] on a trip to the [http://makerfairehannover.com/ MakerFaire Hannover 2014].<br />
<br />
The MakerFaire is an exhibition with things that people built on their own using readily available tools. Dozens of 3D printers and microcontrollers can be examined, and there are a lot of devices visitors can interact with.<br />
Among the fire-spitting dragon, our OD and fluorescence measurement devices attracted a lot of attention. We spoke with hundreds of visitors and had a lot of interesting conversations.<br />
<br />
Saturday evening, Carsten Ludwig from the [[Team:Braunschweig|iGEM Team Braunschweig]] visited us. We showed him the most fascinating stands and afterwards went to the city to walk the [http://www.roterfaden-hannover.de/ ''Red Thread of Hannover''], a track going past 36 very central tourist attractions as e.g. the roofless church.<br />
<br />
On this quick sightseeing trip we took a nice [[Media:Aachen_MakerFairePanorama.jpg|panorama of the ''Aegidienkirche'']].<br />
<html><br/><br/><br />
<center><br />
<iframe frameborder="0" src="http://photosynth.net/embed.aspx?cid=561cee62-8a5a-49df-8167-85e3c6be0590&delayLoad=true&slideShowPlaying=false" width="500" height="300"></iframe><br />
</center><br />
<br/></html><br />
<br />
When the #NEDCRC soccer game started, we settled for some hamburgers, fermentation broth and exchanged funny stories about our lab experience.<br />
<br />
On Saturday, the run on our stand had been so enormous that we had to improvise and print new flyers at our hostel for Sunday, the second and last day of the fair. Just like the day before, a lot of people showed interest in our stand, and especially René passionately demonstrated our devices and informed about synthetic biology as well as our project ''Cellock Holmes''.<br />
<br />
At about midday, Manuel, advisor of [[Team:Bielefeld-CeBiTec|Team Bielefeld]], visited us and got to experience our measurement device, too.<br />
<br />
When we left Hannover Monday morning, we decided to stop by in Bielefeld to meet the rest of their team. This way they, too, got to test our OD and fluorescence measurement device and we got to eat some ''delicious'' ribes cake :)<br />
<br />
Five hours later, we left the Bielefeld team to eat some incredibly spicy pizza and continued our journey back home to Aachen. On the autobahn, we took the time to write down all experiences and things we learned to share them with our team in the coming days.<br />
<br />
'''tl;dr:''' We had an awesome trip to the MakerFaire Hannover, presented our devices to hundreds of people and met the teams Braunschweig and Bielefeld.<br />
<br />
<br/><br />
<center><br />
'''If you like to see more about our weekend have a look at the following gallery =)'''<br />
<br />
<html><br />
<div id="slider1_container" style="position: relative; width: 600px; height: 500px; background-color: #000; overflow: hidden; "><br />
<br />
<br />
<div u="loading" style="position: absolute; top: 0px; left: 0px;"><br />
<div style="filter: alpha(opacity=70); opacity:0.7; position: absolute; display: block;<br />
background-color: #000; top: 0px; left: 0px;width: 100%;height:100%;"><br />
</div><br />
<div style="position: absolute; display: block; background: url(../img/loading.gif) no-repeat center center;<br />
top: 0px; left: 0px;width: 100%;height:100%;"><br />
</div><br />
</div><br />
<br />
<!-- Slides Container --><br />
<div u="slides" style="cursor: move; position: absolute; left: 0px; top: 0px; width: 600px; height: 500px;<br />
overflow: hidden;"><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/a/ad/Aachen_MakerFaire_01.JPG" alt="Trying to squeeze everything into the much too small trunk..." /></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/8/85/Aachen_MakerFaire_02.JPG" /></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/2/2f/Aachen_MakerFaire_03.JPG"/></a><br />
</div><br />
<!--<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/c/ca/Aachen_MakerFaire_04.jpg"/></a><br />
</div>--><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/5/50/Aachen_MakerFaire_06.JPG"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/f/f5/Aachen_MakerFaire_07.JPG"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/4/49/Aachen_MakerFaire_08.JPG"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/d/d0/Aachen_MakerFaire_09.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/9/9e/Aachen_MakerFaire_10.jpg"/></a><br />
</div><br />
<!--<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/0/0e/Aachen_MakerFaire_11.jpg"/></a><br />
</div>--><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/5/5b/Aachen_MakerFaire_12.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/e/ea/Aachen_MakerFaire_13.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/8/84/Aachen_MakerFaire_14.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/a/ab/Aachen_MakerFaire_15.jpg"/></a><br />
</div><br />
<!--<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/4/45/Aachen_MakerFaire_16.jpg"/></a><br />
</div>--><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/f/fd/Aachen_MakerFaire_17.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/5/5a/Aachen_MakerFaire_18.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/6/6e/Aachen_MakerFaire_19.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/c/cf/Aachen_MakerFaire_20.jpg"/></a><br />
</div><br />
<!--<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/8/86/Aachen_MakerFaire_21.jpg"/></a><br />
</div>--><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/4/4a/Aachen_MakerFaire_22.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/d/d3/Aachen_MakerFaire_23.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/7/75/Aachen_MakerFaire_24.jpg"/></a><br />
</div><br />
</div><br />
<a style="display: none" href="http://www.jssor.com">jquery slider example</a> <br />
<div u="navigator" class="jssorb13" style="position: absolute; bottom: 16px; right: 6px;"><br />
<div u="prototype" style="POSITION: absolute; WIDTH: 21px; HEIGHT: 21px;"></div><br />
</div><br />
</div><br />
<br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Aachen/Scripts/highlight.pack.default.css?action=raw&ctype=text/css"><br />
<script src="https://2014.igem.org/Team:Aachen/Scripts/highlight.pack.js?action=raw&ctype=text/javascript"></script><br />
<script>hljs.initHighlightingOnLoad();</script><br />
</body><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/File:Team_Aachen_Teamfoto.pngFile:Team Aachen Teamfoto.png2014-10-17T21:10:10Z<p>StefanReinhold: uploaded a new version of &quot;File:Team Aachen Teamfoto.png&quot;</p>
<hr />
<div>Picture for landing page</div>StefanReinholdhttp://2014.igem.org/File:Team_Aachen_Teamfoto.pngFile:Team Aachen Teamfoto.png2014-10-17T21:07:26Z<p>StefanReinhold: uploaded a new version of &quot;File:Team Aachen Teamfoto.png&quot;</p>
<hr />
<div>Picture for landing page</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Collaborations/Kaiser-Karls-GymnasiumTeam:Aachen/Collaborations/Kaiser-Karls-Gymnasium2014-10-17T21:03:13Z<p>StefanReinhold: /* Lessons 5 & 6 - Glowing Vanilla Pudding */</p>
<hr />
<div>__NOTOC__<br />
{{Team:Aachen/Header}}<br />
<html><link href="https://2014.igem.org/Template:Team:Aachen/Scripts/jquery.skitter.styles?action=raw&ctype=text/css" type="text/css" media="all" rel="stylesheet" /> <br />
<script type="text/javascript" src="https://2014.igem.org/Template:Team:Aachen/Scripts/jquery-1.6.3.min?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Template:Team:Aachen/Scripts/jquery.easing.1.3?action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript" src="https://2014.igem.org/Template:Team:Aachen/Scripts/jquery.skitter.min?action=raw&ctype=text/javascript"></script><br />
</html><br />
<br />
[[File:Aachen_14-10-10_Logo_Kaiser-Karls-Gymnasium_with_Border_iNB.png|right|150px]]<br />
<br />
= Teaching Module "Synthetic Biology" for Highschools =<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_10368603_641110722633054_705291843_o.jpg|align=center|width=500px|title=Science in Action|subtitle=Students at Kaiser-Karls-Gymnasium preparing vanilla pudding solution for fluorescence measurement.}}<br />
</center><br />
<br />
In the course of our cooperation with the grade 9 biology-chemistry class at Kaiser-Karl-Gymnasium, a secondary school in Aachen, we developed a teaching module about “Synthetic Biology”. The scope of the module is 8 school classes 45 min. each. Topics include<br />
*sources of and exposure to microorganisms in our environment<br />
*antibiotic resistances<br />
*quorum sensing<br />
*fluorescence and measurement thereof<br />
*the bio-molecular aspect of our iGEM project. <br />
To wrap up the module we did some career-exploration in synthetic biology and related fields.<br />
<br />
The teaching module is suitable for the subjects biology, biology-chemistry and sciences. The students should have completed grade 8, and know about the central dogma of biology as well as protein biosynthesis. Because our work is going to be evaluated based on this wiki, we would like to take photos during the lessons. In order to publish the photos on our homepage and our wiki, we need a consent form signed by the students’ parents. If you, too, are interested in collaborating with our team write us an email at igem@rwth-aachen.de<br />
<br />
We have carried out this teaching module in cooperation with Kaiser-Karls-Gymnasium. Here are some impressions of this collaboration:<br />
<br />
{{Team:Aachen/Test/GalleryHeader}}<br />
<center><br />
<html><br />
<div id="slider1_container" style="position: relative; width: 600px; height: 500px; background-color: #000; overflow: hidden; "><br />
<br />
<br />
<div u="loading" style="position: absolute; top: 0px; left: 0px;"><br />
<div style="filter: alpha(opacity=70); opacity:0.7; position: absolute; display: block;<br />
background-color: #000; top: 0px; left: 0px;width: 100%;height:100%;"><br />
</div><br />
<div style="position: absolute; display: block; background: url(../img/loading.gif) no-repeat center center;<br />
top: 0px; left: 0px;width: 100%;height:100%;"><br />
</div><br />
</div><br />
<br />
<!-- Slides Container --><br />
<div u="slides" style="cursor: move; position: absolute; left: 0px; top: 0px; width: 600px; height: 500px;<br />
overflow: hidden;"><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/3/37/Aachen_KKG_%281%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/1/1d/Aachen_KKG_%286%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/e/e9/Aachen_KKG_%284%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/e/e2/Aachen_KKG_%285%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/1/14/Aachen_KKG_%287%29.jpg"/></a><br />
</div><br />
<br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/6/6d/Aachen_KKG_%289%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/0/0d/Aachen_KKG_%282%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/b/b3/Aachen_KKG_%2815%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/b/bf/Aachen_KKG_%2811%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/d/dc/Aachen_KKG_%2812%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/7/7d/Aachen_KKG_%2814%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/c/cc/Aachen_KKG_%2813%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/9/9b/Aachen_KKG_%2810%29.jpg"/></a><br />
</div><br />
<div><br />
<a u=image href="#"><img src="https://static.igem.org/mediawiki/2014/f/ff/Aachen_KKG_%2816%29.jpg"/></a><br />
</div><br />
</div><br />
<a style="display: none" href="http://www.jssor.com">jquery slider example</a> <br />
<div u="navigator" class="jssorb13" style="position: absolute; bottom: 16px; right: 6px;"><br />
<div u="prototype" style="POSITION: absolute; WIDTH: 21px; HEIGHT: 21px;"></div><br />
</div><br />
</div><br />
<br />
<link rel="stylesheet" href="https://2014.igem.org/Team:Aachen/Scripts/highlight.pack.default.css?action=raw&ctype=text/css"><br />
<script src="https://2014.igem.org/Team:Aachen/Scripts/highlight.pack.js?action=raw&ctype=text/javascript"></script><br />
<script>hljs.initHighlightingOnLoad();</script><br />
</body><br />
</html><br />
</center><br />
<br />
For each of the lessons we also recorded our experience. Read about the outcome of our work below.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== Lesson 1 - School Project Kick-Off ==<br />
<br />
By [[Nina:NBailly|Nina]] 20:48, April 28 2014 (CDT) <br />
<br />
Today was the kick-off for the cooperation between our iGEM team and the Kaiser-Karl-Gymnasium, a secondary school in Aachen. In the upcoming weeks, exciting school lessons with members of our iGEM team await the students of the 9th grade biology-chemistry class. Different aspects of our project will be highlighted and explained to the students. Demonstrative experiments will explain the practical relevance. <br />
<br />
In today's lesson, our members Nina and René offered the students a short impression of what to expect in the course of this teaching module. We also explained synthetic biology and the goal of our project. <br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== Lesson 2 - iGEM team members back 2 school ==<br />
<br />
By [[User:NBailly|Nina]] 16:00, May 22 2014 (CDT) <br />
<br />
Since our last visit, the student of the biology-chemistry course at Kaiser-Karl-Gymnasium in Aachen have been busy studying the basics of protein biosynthesis and the "lock and key" model. Now the 9th graders are prepared to have a closer look at synthetic biology and our project.<br />
<br />
[[File:Aachen_Kaiser-Karls-Gymnasium.jpg|800px]]<br />
<br />
Each year, many people die of nosocominal infections - infections that the patients acquired in a hospital. However, these infections would be preventable in large part through better hygiene programs. Diseases caused by multi-resistant pathogens are especially critical because therapy options are very limited in these cases.<br />
<br />
But actually, what are pathogens exactly and where do they come from? In order to answer these questions, we start the teaching module with the topic "Microorganisms in our Environment". In this part, we explain which germs we encounter every day, and how be can best protect ourselves from them.<br />
<br />
In order to demonstrate how many and which microorganisms are our steady companions, we conduct an experiment with the students. A pair of students received 3 agar plates: one with regular LB agar, one plate with agar supplemented by an antibiotic, and one selective agar plate for yeasts and fungi. Equipped with the plates, the students wander through their school and take contact samples from places they think many microorganisms grow there. We will incubate the plates over the weekend so that we can show the students in the next lesson what has grown on their samples.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== Lessons 3 & 4 - Microorganisms on the rise ==<br />
<br />
By [[User:NBailly|Nina]] 16:05, May 26 2014 (CDT) <br />
<br />
Last lesson students at Kaiser-Karl-Gymnasium took environmental samples using a variety of different contact agar plates. On the weekend, René examined the plates under the microscope and took photos. Today René and Nina presented the results of the experiment. Most of the students have been really astonished about the diverse microbial fauna found on themselves and their classroom. But first, we showed the students an excerpt from the TV show "Planetopia" that broaches the issue "Hygiene in every-day life".<br />
<br />
[[File:10404745_641111075966352_965198584_o.jpg|800px]]<br />
<br />
[[File:14-05-25_Fotos_Versuchsergebnisse_(12_14).jpg|800px]]<br />
<br />
<br />
<em>Staphylo-</em> and <em>micrococci</em> as well as <em>Enterobacteria</em>, <em>Candida</em> yeasts and miscellaneous fungi are found on the majority of plates. But why is there no growth on the plates containing the antibiotic? Actually, what is an antibiotic, how does it work and why are there multi-resistant pathogens? Nina explained the answer to all these questions to the students using descriptive graphics, and concluded the topic "Microorganisms in our Environment" with a short summmary.<br />
<br />
As a starter for our next topic that is relevant to our project, we distribute a worksheet about quorum sensing among the students. For the remainder of the lesson, the students read the text and begin to answer the attached questions.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== Lessons 5 & 6 - Glowing Vanilla Pudding ==<br />
<br />
By [[User:NBailly|Nina]] 16:16, June 02 2014 (CDT)<br />
<br />
The topics of today's double lesson was quorum sensing as well as measurement of fluorescence. At the beginning of class, the students form 6 groups and start an experiment dealing with fluorescence: Each group weighs and dissolves 4g of vanilla pudding powder in 50mL of water. While conducting the experiment, each group is supervised by a member of our iGEM team.<br />
<br />
<br />
<html><a style="text-align: center; display: block;" href="http://igem.rwth-aachen.de/wordpress/wp-content/uploads/2014/06/10435248_641110302633096_1365222319_o.jpg"><img src="http://igem.rwth-aachen.de/wordpress/wp-content/uploads/2014/06/10435248_641110302633096_1365222319_o-1024x682.jpg" alt="Vanillepudding 1" width="590" height="392" class="aligncenter size-large wp-image-184" /></a></html><br />
<br />
<br />
While we give the powder some time to dissolve, René discusses the worksheet about quorum sensing that we gave out to the students last week. In doing so, the students learn what quorum sensing actually is, how it is used in different ways by a variety of bacteria, and how we want to use this function for our project.<br />
<br />
<br />
<html><a style="text-align: center; display: block;" href="http://igem.rwth-aachen.de/wordpress/wp-content/uploads/2014/06/10371107_641111112633015_62538188_o.jpg"><img src="http://igem.rwth-aachen.de/wordpress/wp-content/uploads/2014/06/10371107_641111112633015_62538188_o-1024x682.jpg" alt="Quorum Sensing Folie" width="590" height="392" class="aligncenter size-large wp-image-186" /></a></html><br />
<br />
<br />
Meanwhile the powder had dissolved in the water. Excess powder accumulated at the bottom of the beaker. Using a syringe, the students suck 2mL of supernatant out of the beaker, and press it through a filter into a cuvette. A part of our project involves the development of a fluorescence measurement device named ''Cellock Holmes''. Each group of students at a time places its cuvette in the ''Cellock Holmes'' prototype, and notes down the values displayed on the cellphone display. Of course, each group also measures the fluorescence of a positive (pure riboflavin in water) and a negative (chalk dust in water) control.<br />
<br />
<br />
<html><a style="text-align: center; display: block;" href="http://igem.rwth-aachen.de/wordpress/wp-content/uploads/2014/06/10172978_641110589299734_1681172065_o.jpg"><img src="http://igem.rwth-aachen.de/wordpress/wp-content/uploads/2014/06/10172978_641110589299734_1681172065_o-1024x682.jpg" alt="Measuring with ''Cellock Holmes''" width="590" height="392" class="aligncenter size-large wp-image-187" /></a></html><br />
<br />
<br />
While the other groups wait for their turn, their supervisors explain the background of this experiment: The electrons in some molecules change into energy states when irradiated with electromagnetic waves. When returning to the normal state, the electrons dissipate excess energy, also in the form of electromagnetic radiation. This process is called fluorescence. Vanilla pudding contains the molecule riboflavin (vitamin B2). When riboflavin is irradiated with blue light, the molecule fluoresces green. The intensity of the green light is visually recorded by our device. Special software processes the data and the measured value is displayed on the cellphone connected to the device via Bluetooth. We will discuss the results of the experiment next class.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== Lesson 7 - Teaching Module Wrap-Up ==<br />
<br />
By [[User:NBailly|Nina]] 16:32, June 05 2014 (CDT)<br />
<br />
Today Nina and Arne discussed last class's experiment. Arne explained to the students the meaning behind the values measured, and how the students can use the value to determine the concentration of riboflavin in their vanilla pudding samples.<br />
<br />
<html><a style="text-align: center; display: block;" href="http://igem.rwth-aachen.de/wordpress/wp-content/uploads/2014/04/cellock_stehend.png"><img src="http://igem.rwth-aachen.de/wordpress/wp-content/uploads/2014/04/cellock_stehend-268x300.png" alt="cellock_stehend" width="268" height="300" class="aligncenter size-medium wp-image-194" /></a></html><br />
<br />
Subsequently, Nina explained the students how we are going to manipulate regular E. coli cells, using synthetic biology methods, to carry out the desired functions. The students also learned, what role promoters play in gene regulation, and how our iGEM team wants to regulate the expression of the genes artificially inserted into the E. coli cells.<br />
<br />
Now we have individually discussed all aspects of our project. Therefore, Nina summarized all the topic together with the students, and outlined the link between all these different topics and our iGEM project idea. In doing so, we almost arrived at the end of our teaching module "Synthetic Biology". Next class, we will visit the biology-chemistry course of Kaiser-Karl-Gymnasium for the last time, and do some career-exploration in synthetic biology and related fields.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== Lesson 8 - Students Explore Careers in Synthetic Biology ==<br />
<br />
By [[User:NBailly|Nina]] 21:11, June 12 2014 (CDT) <br />
<br />
Our "Synthetic Biology" teaching module has come to an end. Today was our last day at Kaiser-Karl-Gymnasium in Aachen, where we have worked together with a grade 9 biology-chemistry class for past 1 1/2 months. <!--more-->The students have learned about the iGEM and synthetic biology in general. We presented our project to the class, and explained various aspects for our endeavour in more detail.<br />
<br />
To give interested students some overview of how they can get involved in synthetic biology, Vera, Florian, Ansgar and Björn gave short presentations about each university program at RWTH represented in our team: Biology, Biotechnology, Computational Engineering Science and Informatics, respectively. We gave them examples for typical classes and specialization options as well as career perspectives in each program.<br />
<br />
<br />
<html><a style="text-align: center; display: block;" href="https://2014.igem.org/File:Cellock_liegend.png"><img class="size-medium wp-image-218" src="https://static.igem.org/mediawiki/2014/b/ba/Cellock_liegend.png" alt="cellock_liegend" width="300" height="194" /></a></html><br />
<br />
<br />
While discussing some more career perspectives, we handed an evaluation sheet out to each student. This way the class could give us some feedback about our work, and leave some comments on what they liked best and what we can still improve on. On average, the students gave us an A (1,9 or 87%) for the teaching module. We are really happy about this great mark, and will try to improve on all the things the students suggested.<br />
<br />
Unfortunately, the bell already rang when the students finished handing in their evaluation sheets. However, some students still followed our invitation to stay after class to ask more questions about paths into synthetic biology, and for some cookies.<br />
<br />
Overall, all parties seemed really satisfied with our collaboration and we are looking forward to repeating the teaching module with other high school classes!<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Project/2D_BiosensorTeam:Aachen/Project/2D Biosensor2014-10-17T21:00:54Z<p>StefanReinhold: /* Equipment and medium selection */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= 2D Biosensor =<br />
<br />
With our 2D biosensor technology we are able to detect the pathogen ''Pseudomonas aeruginosa'' on solid surfaces. The sensor system is comprised of '''two distinct but inseparable modules''', a biological and a technical part:<br />
<br />
* Sensor chips containing '''''Cellocks''''', our '''engineered detective cells''' that fluoresce in the presence of the pathogen, make up the biological part of ''Cellock Holmes''.<br />
* Our '''measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn'']''' and the complementary '''software [https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty ''Measurarty'']''' complete our sensing technology on the technical side. <br />
<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorpoo" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Principle of Operation</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/6e/Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensordevelopment" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Development & Optimization</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/a/a7/Aachen_14-10-16_Iterative_Process_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Achievements</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensoroutlook" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Outlook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png|right|150px]]<br />
<br />
== Principle of Operation ==<br />
<span class="anchor" id="biosensorpoo"></span><br />
<br />
''Cellock Holmes'' is designed upon a SynBio approach comprising a '''two-dimensional biosensor and a measurement unit'''. The two-dimensional biosensor is devised to recognize quorum sensing molecules secreted by the pathogen cells and to generate a distinct fluorescence signal; while the measurement device recognizes and analyzes the produced signal. <br />
<br>On the molecular side, we use the '''[https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh construct]''' to transform regular ''E. coli'' cells into ''Cellocks''.<br />
<br />
{{Team:Aachen/Figure|Aachen 17-10-14 The basics of quorum sensing ipo.png||title=The principle of quorum sensing|subtitle=Microorganisms can sense the presence of their own kind based on quorum sensing which is a form of chemical communication. Depending on their cell density, quorum sensing allows these cells to activate or deactivate certain gene expression cascades (Waters and Bassler, 2005) for a specific function.|width=900px}}<br />
<br />
Our '''sensor cells, ''Cellocks'', are immobilized in agar chips'''. To make the chips, we mix the ''Cellocks'' with liquid LB agar. <br />
In the course of our project, we designed a casting mold specifically for the production of our agar chips. When the agar has cooled down, the chips are cut out of the mold and are ready to use. Storage of the readily usable sensor chips is possible for up to 2 days at 4°C when using LB medium or up to 5 days if TB medium is used. A detailed description of the sensor chip manufacturing can be found in our [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection Protocols] section.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part1 ipo.png|title=Assay to detect ''P.&nbsp;aeruginosa'' using ''Cellock Holmes''|subtitle=This flow sheet shows the procedure to sample and detect ''P.&nbsp;aeruginosa'': A sampling chip is briefly put onto the potentially contaminated surface, added onto one of our sensor chips and inserted into ''WatsOn''.|width=900px}}<br />
<br />
Using ''Cellock Holmes'', we developed a simple assay to detect ''P.&nbsp;aeruginosa''.<br />
<br>Initially, a so called sampling chip is placed on a solid surface that is potentially contaminated with the pathogen. Subsequently, the sampling chip is removed from the surface and put onto one of our sensor chips. Theorectically, the sensor chips could be directly used for sampling, however, this was avoided in our project to '''match [https://2014.igem.org/Team:Aachen/Safety biosafety regulations]''' and to prevent the spread of genetically modified organisms (GMOs) into the environment. The two layered chip-stack is then put into a petri dish which is inserted into our measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] for evalutation.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part2 ipo.png|title=Mode of action inside ''WatsOn''|subtitle=Chips are incubated at 37°C to stimulate cell growth and then illuminated with blue light to excite fluorescence. A picture is taken and analyzed for fluorescence signals using the software ''Measurarty''.|width=900px}}<br />
<br />
Inside ''WatsOn'', the chips are incubated at 37°C and the sampled populations of microorganisms attached on the sampling chip start to grow and multiply. During incubation the chips can be '''illuminated with blue light''' at any time, and a '''photo of the chips''' is taken. The '''software ''Measurarty''''' then analyzes any fluorescent signal.<br>''P.&nbsp;aeruginosa'' secrets an increasing number of quorum sensing molecules that are recognized by ''Cellocks'', thereby producing a fluorescence signal. For detection of ''P.&nbsp;aeruginosa'', we focused on a quorum sensing molecule called N-3-oxo-dodecanoyl-L-homoserine lactone (for short: 3-oxo-C<sub>12</sub>-HSL), which is involved in virulence regulation of ''P.&nbsp;aeruginosa'' (Jimenez, Koch, Thompson et al., 2012). The incorporation of the 3-oxo-C<sub>12</sub>-HSL detection system into the ''Cellocks'' is explained in detail in the [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh Construct] section.<br />
<br />
<br />
</center><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
<!-- ==A Novel Molecular Approach==<br />
<span class="anchor" id="biosensormolecularapproach"></span><br />
<br />
For our biosensor, our team genetically modified ''E. coli'' cells to be able to elecit a '''fluorescent response to autoinducers''' produced by the pathogen ''Pseudomonas aeruginosa'' during quorum sensing. In the case of ''P.&nbsp;aeruginosa'', these autoinducers are N-3-oxo-dodecanoyl-L-homoserine lactone, or 3-oxo-C-12-HSL for short. The quorum sensing system of this pathogen contains the '''LasR activator''' which binds 3-oxo-C-12-HSL, and the '''LasI promoter''', which is activated by the LasR-HSL complex. Both LasR activator and LasI promoter are available as BioBricks [http://parts.igem.org/Part:BBa_C0179 C0179] and [http://parts.igem.org/Part:BBa_J64010 J64010].<br />
<br />
As a reporter gene, we use '''GFP'''. However, expression of GFP is not simply controlled through the LasI promoter activity in our approach. Instead, our sensor cells contain genes for a constitutively expressed fusion protein consisting of GFP and a dark quencher, and an '''HSL-inducible protease'''. We use the REACh protein as dark quencher for GFP and the TEV protease to cleave the complex; [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter here] you can read more about the REACh construct and the TEV protease. <br />
<br />
{{Team:Aachen/Figure|align=center|Aachen_REACh_approach.png|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=500px}}<br />
<br />
When ''P.&nbsp;aeruginosa cells'' are stuck on our agar chip and come close to our sensor cells, the latter take up the HSL molecules secreted by the pathogens. Inside the sensor cells, the autoinducer binds to the LasR gene product and activate the expression of the TEV protease. The protease then cleaves the GFP-REACh construct. When '''illuminated with light of 480&nbsp;nm''', the excitation wavelenght of GFP, our sensor cells in the vicinity of ''P.&nbsp;aeruginosa'' give a '''fluorescence signal'''. On the other hand, sensor cells that were not anywhere close to the pathogens do not express the protease. Therefore, the GFP will still be attached to the dark quencher in these cells, and no fluorescence is produced.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}} --><br />
[[File:Aachen_14-10-16_Iterative_Process_iNB.png|right|150px]]<br />
<br />
== Development & Optimization ==<br />
<span class="anchor" id="biosensordevelopment"></span><br />
<br />
{{Team:Aachen/FigureFloat|Aachen_ILOV_GFP_HM_1,5h.png|title=iLOV and GFP in the Gel Doc<sup>TM</sup>|subtitle=Sensor cells producing iLOV (A) and GFP (B) 1.5&nbsp;h after induction.|left|width=500px}}<br />
=== Equipment and medium selection ===<br />
Our first approach (before developing our own device) was to use the Molecular Imager&reg; Gel Doc™ XR+ from BIO-RAD in our lab to detect fluorescence, which uses UV and white light illuminators. However, only two different filters were available for the excitation light wavelength, which resulted in very limited possibilities for the excitation of fluorescent molecules. For example, it was possible to detect the expression of iLOV in our sensor chips, but in contrast the detection of GFP was not possible. Hence, the '''Gel Doc™ was not suitable for our project'''.<br />
{{Team:Aachen/FigureFloat|Aachen_Chip_medium_geldoc.png|title=Differend medium in the Gel Doc™|subtitle=complex media exhibited high background fluorescence while less back- ground fluorescence was observed with the minimal media (HM, M9, NA).|right|width=500px}}<br />
{{Team:Aachen/FigureFloat|Aachen_5days_K131026_neb_tb_1,5h.jpg |title=Testing our chips' shelf-life|subtitle= Chips of [http://parts.igem.org/Part:BBa_K131026 K131026] in NEB were stored 5 days at 4°C. The right chip was induced with 0.2&nbsp;µL of 500&nbsp;µg/mL HSL and an image was taken after 1.5&nbsp;h.|left|width=500px}}<br />
We tested different media (i.e. LB, M9, NA, HM and TB) for the preparation of our sensor chips. The details of media composition can be found in the [https://2014.igem.org/Team:Aachen/Notebook/Protocols Protocols] section. We screened for an optimized media composition that results in minimal background fluorescence and supports cell growth. The resuts of the analysis are presented in the table below. Because of the reduced fluorescence compared to TB medium when using ''WatsOn'' for sensor chip evaluation and because of sufficient cultivation conditions for our ''Cellocks'' '''LB&nbsp;medium was chosen over TB medium for sensor hip manufacturing'''.<br />
<br />
<center><br />
{| class="wikitable"<br />
! !! LB !! TB !! NA !! M9 !! HM <br />
|-<br />
| Growth of ''Cellock'' || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|-<br />
| Background fluorescence in GelDoc || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|-<br />
| Background fluorescence in ''WatsOn'' || <div style="text-align: center;">-</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|}<br />
</center><br />
<br />
Experiments were conducted to test '''long-time storage''' of the sensor chips at low temperature and by the addition of glycerol. Storage at -20°C resulted in the loss of our sensor cells. Adding 5-10% (v/v) glycerol ensured survival of the sensor cells, but resulted in an expression stop of fluorescence proteins. Hence, we concluded that long time storage of the sensor chips is not possible under the tested conditions. However, it is possible to store 'ready-to-use' sensor chips for 2 days at 4°C when using LB medium and storage for 5 days was possible with chips made from TB medium.<br />
<!--Regarding the medium used for our sensor chips, LB medium showed a high background fluorescence when exposed to UV light in the Gel Doc. Surprisingly, the background fluorescence resulting from the LB medium was too high to detect a signal emitted by our sensor cells. Hence, minimal media (NA, M9, Hartman (HM)) was used to minimize background fluorescence, but this approach resulted in less to no growth of our sensor cells. In our device ''WatsOn'', optimized wavelengths of 450&nbsp;nm and 480&nbsp;nm were used for excitation of iLOV and GFP, respectively. When exposed to either excitation wavelength TB medium, which is basically an improved LB medium and highly supports cell growth, showed strong background fluorescence in our own device. High background fluorescence was also observed for TB medum when using the Gel Doc. In contrast to the Gel Doc LB medium showed minimal fluorescence in our device ''WatsOn'' and no difficulties in cultivation of our ''Cellocks'' were observed. Because of the reduced fluorescence compared to TB medium when using ''Watson'' for sensor chip evaluation and because of sufficient cultivation conditions for our 'Cellocks'' LB medium was chosen over TB mediium for sensor chip manufacturing. --><br />
<br />
{{Team:Aachen/FigureFloat|Aachen_2_chipform.jpg|title=Sensor chip manufacturing using the closed mold|subtitle=When injecting the liquid agar into a closed mold we encounter problems due to frequent bubble formation.|left|width=500px}}<br />
=== Optimal agarose concentration for sensor chip manufacturing ===<br />
For the sensor chip manufacturing, agarose was preferred over agar, because of a uniform linkage that resulted in a better chip homogeneity. In addition, agarose reduced diffusion of the inducer molecules through the chip. A reduced diffusion is vital to observe distinct fluorescent spots on the sensor chips and thus further optimzation of our 2D biosensor was done using agarose-based chips.<br />
=== Optimal chip configuration ===<br />
Several approaches were tested for the production of agarose-based sensor chips with reproducible quality. The first approach was to cast every sensor chip individually. To achieve a plain chip surface (a requisite for high quality images), we casted the sensor chips between two microscope slides in an initial attempt. However, this approach was rejected, because the agar was too liquid and leaked from the microscope slides. In the second approach, we prepared a closed mold into which liquid agar was injected with a pipette, but we encountered a high number of bubbles in the resulting chips. Bubbles in the sensor chips interfered with fluorescence evaluation. Finally, we used an open mold into which the agar was poured right after mixing with the sensor cells. Chips were cut out along precast indentations in the casting mold after the agar solidified. An advantage of the open mold was the ability to simultaneously produce nine sensor chips while the surface tension of the liquid agar ensured a plane chip surface.<br />
<br />
{{Team:Aachen/FigureFloat|Aachen_Final_chipform.jpg|title=The finalized chip mold|subtitle=An open casting mold was found to be optimal for sensor chip manufacturing, because this approach was fast, easy to handle and generated a reproducible chip quality. In addition nine sensor chips could be produced simultaneously.|left|width=500px}}<br />
=== Induction of the sensor chips ===<br />
For initial testing of our molecular constructs, we simulated the presence of ''P.&nbsp;aeruginosa'' using IPTG or 3-oxo-C12 HSL. However, for induction a minimal volume is required as our initial experiments showed that diffusion of the inducers through the chip hindered the formation of distinct spots on the chips. An optimal and low volume of 0.2&nbsp;µl was chosen for induction. Sensor cells based on ''E. coli'' BL21, which incorporated the [https://2014.igem.org/Team:Aachen/Parts#partsK1319042 K1319042] construct were able to detect IPTG concentrations down to 1 mM (0.2&nbsp;µl), and as well for the sensor cells based on ''E. coli'' BL21 which incorporated the REACh constructs. Sensor cells based on ''E. coli'' BL21, which incorporated the [http://parts.igem.org/Part:BBa_K131026 K131026] construct were able to detect HSL concentrations down to 500&nbsp;µg/ml (0.2&nbsp;µl). Furthermore, detection of growing ''P. aeruginosa'' cells based on secreted HSLs was possible using the [http://parts.igem.org/Part:BBa_K131026 K131026] construct. The experiments conducted during induction of our sensor chips are described in more detail in the [https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements Achievements] section.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
==Achievements==<br />
<span class="anchor" id="biosensorachievements"></span><br />
<br />
We are able to detect IPTG, 3-oxo-C{{sub|12}} HSL and ''Pseudomonas aeruginosa''. To prove that the sensor constructs produce the flourescence signal and not the medium or ''E. coli'' in its own we have [http://parts.igem.org/Part:BBa_B0015 B0015] in NEB as a negativ control for IPTG, HSL and ''Pseudomonas aeruginosa'' induction.<br />
<br />
{{Team:Aachen/Figure|Aachen_B0015_IPTG_HSL_Pseudomonas.png|title=Negativ control |subtitle=B0015 in NEB as negativ control induced with A) 0.2&nbsp;µl of 100&nbsp;mM IPTG, image taken after 2.5&nbsp;h; B) 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12), image after 2.5&nbsp;h; C) with 5 spots of ''Pseudomonas aeruginosa'' on the left and one big spot on the right, image taken after 2&nbsp;h|width=900px}}<br />
<br />
=== Testing our Sensor Chips in a Plate Reader ===<br />
{{Team:Aachen/FigureFloat|Aachen_K1319042_Platereader.gif|title=Testing K1319042 in our sensor chips|subtitle=K1319042 in our sensor chip induced with 2&nbsp;µL IPTG and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=260px}}<br />
<br />
To establish a prove of principle we used our construct [http://parts.igem.org/Part:BBa_K1319042 K1319042] an IPTG inducible iLOV. They were introduced into our sensor chips and then fluorescence was measured every 15 minutes after an induction with 2&nbsp;µl 100&nbsp;mM IPTG (gif on the left).<br />
<br />
There is a clear difference in fluorescence between the not induced chip (top) and the induced chip (bottom). It is distinctively visible that the middle of the bottom chip start to exhibit fluorescence and then the fluorescence increases over time and spreads outward. The top chip also shows a slight increase in measured fluorescence but it is nowhere near the level of the induced chip and is primarily attributable to a leaky promoter and the background fluorescence. <br />
<br />
This demonstrates a general proof of principle of the sensor chip design. Therefore the next was testing the detection of 3-oxo-C{{sub|12}} HSL.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
=== Detecting 3-oxo-C{{sub|12}} HSL with Sensor Chips ===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_Platereader.gif|title=Testing K131026 in our sensor chips|subtitle=K131026 in our sensor chip induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=360px}}<br />
<br />
As a next step, we used [http://parts.igem.org/Part:BBa_K131026 K131026] from the 2008 iGEM Team Calgary in our sensor chips to detect 3-oxo-C{{sub|12}} HSL which is produced by ''Pseudomonas&nbsp;aeruginosa'' during quorum sensing. First, we tested them by direct induction with purified 3-oxo-C{{sub|12}} HSL (0.2&nbsp;µL, 500&nbsp;µg/mL). A fluorescence measurement was taken every 15&nbsp;minutes with an excitation wavelength of 496&nbsp;nm and an emission wavelength of 516&nbsp;nm (for GFP).<br />
<br />
The measured fluorescence again showed a distinct signal on the induced chip (bottom) compared to the uninduced chip (top). The fluorescence clearly starts in the middle of the chip (point of induction) and then extends outwards, still showing an ever increasing signal of fluorescence. The base level of fluorescence is attributed to leakiness of the promoter and general background fluorescence of growing ''E. coli'' cells. In the induced chip (bottom), the background fluorescence is a lot lower than in the uninduced chip (top) because the signal masks the noise. The difference between the induced and uninduced chips indicates a clear response to the HSL and a proof for the ability of our sensor chip design to detect the HSL produced by ''Pseudomonas&nbsp; aeruginosa''.<br />
<br />
=== Detecting IPTG with Sensor Chips ===<br />
{{Team:Aachen/FigureFloat|Aachen_I746909_slower_reduced.gif|title=IPTG inducible superfolder GFP (I746909) in sensor chips|subtitle=IPTG inducible superfolder GFP (I746909) is induced with IPTG (2 µl, 100mM) on the right chip with a non induced chip on the left|width=480px}}<br />
<br />
This video shows the construct [http://parts.igem.org/Part:BBa_I746909 I746909] from the 2007 iGEM Team Cambridge. This BioBrick is a producer of superfolder GFP under the control of a T7 promoter. It was introduced into BL21(DE3) cells making the expression IPTG inducible through the T7 RNA Polymerase encoded in the genome of BL21(DE3) under the control of a lacI promoter. <br />
<br />
The left chip does not show visible fluorescence and the right chip exhibits a strong fluorescence signal showing clearly the ability of the sensor chip technology to detect IPTG. On top of that, the fluorescence response is strong enough to be detected and analyzed by the measurement device WatsOn.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
===Detecting the 3-oxo-C{{sub|12}} HSL with K131026 in our Sensor Chips with ''WatsOn''===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_HSLdetection_slow.gif|title=Detection of 3-oxo-C{{sub|12}} HSL with K131026|subtitle=0.2 µL of 3-oxo-C{{sub|12}} HSL was placed in the middle of the chip and then incubated at 37°C in ''WatsOn''.|width=480px}}<br />
<br />
The next step towards the final goal to detect ''Pseudomonas&nbsp;aeruginosa'' was to replicate the detection of 3-oxo-C{{sub|12}} HSL, which was established in the plate reader, in our own [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] device. Therefore, we again used K131026 as our construct in ''E. coli'' BL21(DE3) cells and induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL with a concentration of 500&nbsp;µg/mL. The right chip was induced and - as a negative control - the left chip was not induced. Pictures were taken every 4&nbsp;minutes.<br />
<br />
The result was a clear replication of the success of the plate reader experiment. The induced chip shows a clear fluorescence response eminating from the center where the induction with HSL took place. This demonstrates the ability of not only our sensor chips but also our measurement device ''WatsOn'' to successfully detect 3-oxo-C{{sub|12}} HSL.<br />
<br />
===Detecting ''Pseudomonas&nbsp;aeruginosa'' with K131026 in our Sensor Chip with ''WatsOn''===<br />
{{Team:Aachen/FigureFloat|Aachen_K131026_Pseudomonas_aeruginosa_detection.gif|title=Detection of ''Pseudomonas aeruginosa'' with K131026|subtitle=Direct detection of ''Pseudomonas aeruginosa'' on our sensor chips. Sensor cell used were K131026.|width=480px}}<br />
<br />
After establishing the successful detection of 3-oxo-C{{sub|12}} with our sensor chips the next step was the detection of ''Pseudomonas aeruginosa'' with our measurement device ''WatsOn''. Therefore sensor chips with K131026 were again prepared and the right chip was induced with 0.2&nbsp;µl of a ''Pseudomonas aeruginosa'' culture while the left chip was not induced. <br />
<br />
The results clearly demonstrate our ability to detect ''Pseudomonas aeruginosa'' with our measurement device ''WatsOn''. On the induced chip a definite fluorescence response is visible in response to ''Pseudomonas aeruginosa''. The fluorescence eminates outward from the induction point and shows a significant difference to the non induced chip. Therefore detection of ''Pseudomonas aeruginosa'' is possible with our sensor chip technology in our measurement device ''WatsOn''!<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="biosensoroutlook"></span><br />
<br />
After successfully detecting ''P.&nbsp;aeruginosa'', the next step in developing our sensor chip platform further is an '''improvement of the sampling chip'''. The current technique of using a simple agarose chip is not sufficient to collect all microorganisms from the sampled surface. Therefore, the aim is to improve the sampling chip by trying different, more adhesive material. <br />
<br />
Furthermore, diffusion in the sensor chips will be reduced to '''limit the spread of the fluorescence signal'''. Currently, the fluorescence spot grows at lot beyond the point of detection and makes it difficult to successfully differentitate between multiple points of induction. By introducing different diffusion barriers into our chips, the growth of the fluorescence spots might be limited, thus enabling the detection of multiple sources of fluorescence lying close together. <br />
<br />
Additionally, the application of our sensor chips in combination with our ''WatsOn'' device is currently being evaluated for the detection of signals other than fluorescence. '''Detecting bio- and chemiluminescence''' has been identified as an area of potential future application. <br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
==References==<br />
<br />
* Waters, C. M., & Bassler, B. L. (2005). QUORUM SENSING: Cell-to-Cell Communication In Bacteria. Annual Review of Cell and Developmental Biology, 21(1), 319-346. Available online at http://www.annualreviews.org/doi/full/10.1146/annurev.cellbio.21.012704.131001.<br />
<br />
* Jimenez, P. N., Koch, G., Thompson, J. A., Xavier, K. B., Cool, R. H., & Quax, W. J. (2012). The Multiple Signaling Systems Regulating Virulence in Pseudomonas aeruginosa. Microbiology and Molecular Biology Reviews, 76(1), 46-65. Available online at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3294424/#B63.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/OD/F_deviceTeam:Aachen/OD/F device2014-10-17T20:59:34Z<p>StefanReinhold: /* Measuring Principle */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= OD/F Device =<br />
<br />
Measuring '''Optical Density''' (OD) or absorbance is one of the key and indispensable element in the field of microbiology. One question that has to be answered often is '''how many cells are in a suspension'''? Here, the OD can give a hint. However, the commercially available [http://www.laboratory-equipment.com/laboratory-equipment/cell-density-meter.php OD meters] are expensive and limit its application and usage in low budget institutions.<br />
<br />
Therefore, here we present our OD/F Device. The device is specifically designed for biohackspaces, Do It Yourself (DIY), community laboratories and schools. With our OD/F Device, we aim to enable precise and inexpensive science research at a low cost.<br />
<br />
Further, in Synthetic Biology, the task of measuring OD and fluorescence are often performed at the same time. Hence, here we present a device that can be configured to '''simultaneously measure both fluorescence and OD'''. With such a configuration of the OD/F Device, the production of fluorescence signal can be correlated to cell growth using a single and a portable device.<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<!-- Overview --><br />
<br />
<li><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/OD/F_device#odfmeasuringprinciple" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Measuring Principle</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/0/0f/Aachen_14-10-10_ODF_Button_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/OD/F_device#odfapplication" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Application</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_17-10-14_Glowing_cuvette-ipo.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/OD/F_device#odfachievements" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Achieve-<br/>ments</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/OD/F_device#odfoutlook" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Outlook</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-10_ODF_Button_ipo.png|right|150px]]<br />
<br />
== Measuring Principle ==<br />
<span class="anchor" id="odfmeasuringprinciple"></span><br />
<br />
Measuring Principle<br />
The measuring principle for both optical density (OD) and fluorescence measurement is shown below. For OD measurement, the sample is illuminated with an LED and a fixed slit width. A filter blocks any light less than 600 nm. In this way, the sensor mainly senses the 600 nm light which is needed for OD{{sub|600}} measurement.<br />
<br />
For the fluorescence measurement, a similar approach is followed. The filter, again, is used to block the exciting light from being sensed. In this way, only the emitted light from the fluorescence protein is detected and measured.<br />
<br />
Further details about selecting filters, code, a construction manual and evaluation can be found [https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF here].<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_odf_schemes.png|title=Measuring principle for OD/F Device|subtitle=The left image shows the measurement approach for the optical density. The light shines through the sample with a fixed width. The right image shows the fluorescence measurement approach, exciting the fluorescence proteins from below and measuring from the side.|width=500px}}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_ODF_7.JPG|title=The combined OD/F Device for optical density and fluorescence measurement.|subtitle= |width=650px}}<br />
</center><br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen 17-10-14 Glowing cuvette-ipo.png|right|150px]]<br />
<br />
== ''Modus operandi'' of the OD/F Device==<br />
<span class="anchor" id="odfapplication"></span><br />
<br />
The device is constructed to make it easy-to-handle for the end users. The standard operating procedure to operate and measure optical density or fluorescence is schematically shown in the figure below.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-09 Flowsheet OD-device ipo.png|title=|subtitle=|width=1000px}}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
== Achievements ==<br />
<span class="anchor" id="odfachievements"></span><br />
<br />
When building the OD/F Device, '''our goal''' was to develop a system that<br />
<br />
* easy-to-handle<br />
* precise, stable, and reproducible results<br />
* portable<br />
* easy to build from Open Source parts<br />
* combined measurement of optical density and fluorescence<br />
* low cost<br />
<br />
Commercially available equipment uses lasers and a set of two fine filters, one between laser and sample and one between sample and sensor. To reduce the cost, our OD/F Device uses a simpler measuring principle: it is designed with one low-cost filter, between sample and sensor, and illuminates with an LED instead of a laser. Nevertheless, one main goal was to produce an inexpensive device. Given that, we therefore had to compromise some of the measurement quality, were we still able to produce stable, precise and good data?<br />
<br />
{{Team:Aachen/Figure|Aachen_ODallstrains1.png|title=Transmission of different cell types at OD-values from 0.001-1|subtitle=The transmittance data of NIH&nbsp;3T3 (mouse fibroblasts) cells align with the transmittance of ''P.&nbsp;putida'' and ''S.&nbsp;cerevisiae'' strains, even though the measured optical densities are lower by 1-2 orders of magnitude.|width=800px}}<br />
<br />
The answer is: Yes! With the optimal design of our cuvette holder we achieved good-quality results albeit using the cheap filter. The transmission to true OD conversion is stable for all cell types as expected.<br />
<br />
Have we been re-inventing the wheel? No!<br />
In fact, you can find some DIY posts for turbidity meters such as [http://www.thingiverse.com/thing:74415 turbidity sensors]. However, a proper assessment of their linearity as well as a calculated OD-value are missing. <br />
<br />
Regarding fluorescence, we are also not re-inventing the wheel. The [https://2010.igem.org/Team:Cambridge 2010 iGEM Cambridge] team actually built a very similar device, the [https://2010.igem.org/Team:Cambridge/Tools/Eglometer E.glometer]. However, there's no data available showing an actual comparison of the data from their device and some proven commercial system to, for example, assess linearity of the measurement.<br />
<br />
We made a commercial assessment of the OD/F Device that results in a total cost of 60 $. The unit is built from acrylic glass for the casing. The compact design results in a weight which is less than 200g. The device can be easily connected to any power adapter via USB. The technical details and a construction manual of OD/F Device is [https://2014.igem.org/Team:Aachen/Notebook/Engineering/ODF#diy published] on our wiki.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="odfoutlook"></span><br />
<br />
We have proven that our device is capable of delivering good results, even in hard conditions as low cell concentrations.<br />
Yet there is room for improvement.<br />
The calibration process is quite intensive work. An application to do this automatically would help for this process.<br />
For the ease of use and to prevent data loss from noting down measured values manually, a smartphone application that can directly correlate OD and fluorescence values would be a great addition. This addition will be implemented in the next version.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Project/Measurement_DeviceTeam:Aachen/Project/Measurement Device2014-10-17T20:58:52Z<p>StefanReinhold: /* Modus Operandi */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= ''WatsOn'' =<br />
<br />
<html><br></html><br />
The ''WatsOn'' device aims to answer the central question "What's on the chip?". The device is designed to incubate the sensing cells and capture images. <html><br></html>The interactive ''WatsOn'' software enables the end user not only to take images and time lapse shootings, but also analyzes the images and visualizes the presence/absence of a pathogen.<br />
<br />
The construction manual and the technical details are published in our [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsondiy wiki].<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_Device_11.jpg|title=''WatsOn''|subtitle= |width=270px}}<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<!-- Overview --><br />
<br />
<li><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/Measurement_Device#watsonapplication" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Modus Operandi</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/thumb/c/c7/Aachen_WatsOn_easy.png/600px-Aachen_WatsOn_easy.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/Measurement_Device#watsonhardware" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Hardware</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/5/59/Aachen_14-10-16_Hardware_button_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/Measurement_Device#watsonsoftware" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Software</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/13/Aachen_14-10-16_Software_button_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/Measurement_Device#watsonmeasurarty" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Measurarty</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/21/Aachen_14-10-16_Measurarty_button_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<li><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Project/Measurement_Device#watsonachievements" style="color:black"><br />
<div class="menusmall-item menusmall-info" ><div class="menukachel">Achieve-<br/>ments</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%"><br />
</div><br />
</a><br />
</li><br />
<br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
== Modus Operandi ==<br />
<span class="anchor" id="watsonapplication"></span><br />
<br />
{{Team:Aachen/Figure|How_two_use_watsOn_flowsheet_V7_ipo.png|title=How to use ''WatsOn''|subtitle=This scheme illustrates handling ''WatsOn'' when testing the 2D biosensor chip for a fluorescent signal.|width=1000px}}<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Hardware_button_iNB.png|right|150px]]<br />
<br />
== Hardware ==<br />
<span class="anchor" id="watsonhardware"></span><br />
<br />
{{Team:Aachen/Figure|Aachen_Device_Elektronikkomponenten1.jpg|title=Hardware components|subtitle=From top left to bottom right: Arduino, Peltier element, Raspberry Pi, relay, cables, MOSFET, temperature display, camera, LEDs and resistors.|width=520px}}<br />
<br />
Our hardware consists of the casing and the electronical components. The casing which can be seen in the first section was build from laser cutted acrylic glass.<br />
<br />
The electronic circuit is a combination of the components displayed in the image above. We combined the Raspberry Pi - a small single-board computer running a Linux operating system - and an Arduino board which is a programmable microcontroller. The Arduino operates the excitation LEDs and a Peltier heater for incubation. For taking images of the sensor chips we used the Raspberry Pi camera module which is directly connected to the board.<br />
<br />
''WatsOn'' is designed such that it can be easily copied. Our work heavily emphasizes the Open Source concept. Therefore a detailed description of all components and the wiring can be found in the [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsonhardware Engineering section of our Notebook].<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
<!-- [[File:Aachen_14-10-16_Software_button_iNB.png|right|150px]] --><br />
<br />
== Software ==<br />
<span class="anchor" id="watsonsoftware"></span><br />
<br />
{{Team:Aachen/FigureDual|Aachen_WatsOn_igem_GUI_originalImage.png|Aachen_WatsOn_igem_GUI_analyzedImage.png|title1=image taken with the camera |title2=analyzed image |subtitle1= |subtitle2= |width=500px}}<br />
<br />
The ''WatsOn'' software is responsible for presenting a user interface on the display of the device and to take images with the LED wavelength selected by the user. Therefore, it is separated into three single components: the graphical user interface (GUI) with a backend script running on the Raspberry Pi and the code on the Arduino board.<html><br/></html><br />
The GUI (left image) provides the user with the option to take a single image or a time lapse shooting and specify parameters for the camera and the wavelength of the LEDs. The wavelength used in our device are 480nm for GFP and 450nm for iLOV. Furthermore, the images are analysed for the presence or absence of P. aeruginosa by analysing the image and providing the user with a visual feedback (right image). All taken images can be saved to disk manually for single images and automatically for time lapse shootings.<html><br/></html><br />
Further details on the software including the backend which gives the possibility of using the GUI remotely on a different device (e.g. notebook) in the same local network can be found here [https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn#watsonsoftware].<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Measurarty_button_iNB.png|right|150px]]<br />
<br />
== ''Measurarty'' ==<br />
<span class="anchor" id="watsonmeasurarty"></span><br />
<center><br />
{{Team:Aachen/Figure|Aachen_srm_regions_3.PNG|title=SRM component of our image analysis component ''Measurarty''|subtitle=SRM is one of the core components of our image analysis approach. This image shows the different regions created.|width=500px}}<br />
</center><br />
<br />
''Measurarty'' is the '''image analysis software''' of our device and is designed to allow an automatic segmentation and classification of our '''agar chip pictures'''.<br />
Therefore, it accepts an image from ''WatsOn'' as an input and produces an output image with pathogenic regions marked in red.<br />
<br />
This component mainly focuses on recognizing pathogens early, such that pure thresholding is not necessary.<br />
We therefore designed a pipeline and established a smoothness index to make statements about the pathogenity of a chip as early as possible, but also with as much certainty as possible.<br />
<br />
A sample output of the segmentation is presented below, showing that the pipeline works as intended.<br />
<br />
<center><br />
<div class="figure" style="float:{{{align|center}}}; margin: 0px 10px 10px 0px; border:{{{border|0px solid #aaa}}};width:{{{width|960px}}};padding:10px 10px 0px 0px;"><br />
{|<br />
|<html> <img src="https://static.igem.org/mediawiki/2014/f/fc/Aachen_Measurarty_combined_slow.gif" width="960px"></html><br />
|-<br />
|'''{{{title|Detecting ''P. aeroginosa'' with K131026}}}'''<br />{{{subtitle|Measurarty identifies the fluorescence signal given by K131026 in response to ''P. aeruginosa''.}}}<br />
|}<br />
</div><br />
</center><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
== Achievements ==<br />
<span class="anchor" id="watsonachievements"></span><br />
<br />
We developed ''WatsOn'' to meet the following requirements: i.e. the device<br />
*incubates the sensing cells and the sampling chip <br />
*illuminates the chip with the right excitation wavelength for our fluorescence proteins<br />
*takes pictures and time lapse shootings of the chips<br />
*uses cheap filter slides to block the light emitted from the LEDs<br />
*analyzes the fluorescence signal<br />
*gives feedback to the user about the presence or absence of P. aeruginosa through a GUI (graphical user interface)<br />
*prevents escape of potentially sampled pathogens and our genetically engineered cells<br />
*is portable and fast in analyzing the images<br />
<br />
With our final device we achieved all of the above mentioned goal. ''WatsOn'' is housed in a closed casing and is able to take images and time lapse shooting using LEDs with required wavelengths, analyze the image and visualize the result.<br />
<br />
All technical details including laser cutting plans, the list of needed components, source codes for the different software and a building instruction are open-source and available on our wiki[https://2014.igem.org/Team:Aachen/Notebook/Engineering/WatsOn].<br />
<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Project/2D_BiosensorTeam:Aachen/Project/2D Biosensor2014-10-17T20:57:53Z<p>StefanReinhold: /* Detecting the 3-oxo-C{{sub|12}} HSL with K131026 in our Sensor Chips with WatsOn */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= 2D Biosensor =<br />
<br />
With our 2D biosensor technology we are able to detect the pathogen ''Pseudomonas aeruginosa'' on solid surfaces. The sensor system is comprised of '''two distinct but inseparable modules''', a biological and a technical part:<br />
<br />
* Sensor chips containing '''''Cellocks''''', our '''engineered detective cells''' that fluoresce in the presence of the pathogen, make up the biological part of ''Cellock Holmes''.<br />
* Our '''measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn'']''' and the complementary '''software [https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty ''Measurarty'']''' complete our sensing technology on the technical side. <br />
<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorpoo" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Principle of Operation</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/6e/Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensordevelopment" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Development & Optimization</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/a/a7/Aachen_14-10-16_Iterative_Process_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Achievements</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensoroutlook" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Outlook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png|right|150px]]<br />
<br />
== Principle of Operation ==<br />
<span class="anchor" id="biosensorpoo"></span><br />
<br />
''Cellock Holmes'' is designed upon a SynBio approach comprising a '''two-dimensional biosensor and a measurement unit'''. The two-dimensional biosensor is devised to recognize quorum sensing molecules secreted by the pathogen cells and to generate a distinct fluorescence signal; while the measurement device recognizes and analyzes the produced signal. <br />
<br>On the molecular side, we use the '''[https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh construct]''' to transform regular ''E. coli'' cells into ''Cellocks''.<br />
<br />
{{Team:Aachen/Figure|Aachen 17-10-14 The basics of quorum sensing ipo.png||title=The principle of quorum sensing|subtitle=Microorganisms can sense the presence of their own kind based on quorum sensing which is a form of chemical communication. Depending on their cell density, quorum sensing allows these cells to activate or deactivate certain gene expression cascades (Waters and Bassler, 2005) for a specific function.|width=900px}}<br />
<br />
Our '''sensor cells, ''Cellocks'', are immobilized in agar chips'''. To make the chips, we mix the ''Cellocks'' with liquid LB agar. <br />
In the course of our project, we designed a casting mold specifically for the production of our agar chips. When the agar has cooled down, the chips are cut out of the mold and are ready to use. Storage of the readily usable sensor chips is possible for up to 2 days at 4°C when using LB medium or up to 5 days if TB medium is used. A detailed description of the sensor chip manufacturing can be found in our [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection Protocols] section.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part1 ipo.png|title=Assay to detect ''P.&nbsp;aeruginosa'' using ''Cellock Holmes''|subtitle=This flow sheet shows the procedure to sample and detect ''P.&nbsp;aeruginosa'': A sampling chip is briefly put onto the potentially contaminated surface, added onto one of our sensor chips and inserted into ''WatsOn''.|width=900px}}<br />
<br />
Using ''Cellock Holmes'', we developed a simple assay to detect ''P.&nbsp;aeruginosa''.<br />
<br>Initially, a so called sampling chip is placed on a solid surface that is potentially contaminated with the pathogen. Subsequently, the sampling chip is removed from the surface and put onto one of our sensor chips. Theorectically, the sensor chips could be directly used for sampling, however, this was avoided in our project to '''match [https://2014.igem.org/Team:Aachen/Safety biosafety regulations]''' and to prevent the spread of genetically modified organisms (GMOs) into the environment. The two layered chip-stack is then put into a petri dish which is inserted into our measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] for evalutation.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part2 ipo.png|title=Mode of action inside ''WatsOn''|subtitle=Chips are incubated at 37°C to stimulate cell growth and then illuminated with blue light to excite fluorescence. A picture is taken and analyzed for fluorescence signals using the software ''Measurarty''.|width=900px}}<br />
<br />
Inside ''WatsOn'', the chips are incubated at 37°C and the sampled populations of microorganisms attached on the sampling chip start to grow and multiply. During incubation the chips can be '''illuminated with blue light''' at any time, and a '''photo of the chips''' is taken. The '''software ''Measurarty''''' then analyzes any fluorescent signal.<br>''P.&nbsp;aeruginosa'' secrets an increasing number of quorum sensing molecules that are recognized by ''Cellocks'', thereby producing a fluorescence signal. For detection of ''P.&nbsp;aeruginosa'', we focused on a quorum sensing molecule called N-3-oxo-dodecanoyl-L-homoserine lactone (for short: 3-oxo-C<sub>12</sub>-HSL), which is involved in virulence regulation of ''P.&nbsp;aeruginosa'' (Jimenez, Koch, Thompson et al., 2012). The incorporation of the 3-oxo-C<sub>12</sub>-HSL detection system into the ''Cellocks'' is explained in detail in the [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh Construct] section.<br />
<br />
<br />
</center><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
<!-- ==A Novel Molecular Approach==<br />
<span class="anchor" id="biosensormolecularapproach"></span><br />
<br />
For our biosensor, our team genetically modified ''E. coli'' cells to be able to elecit a '''fluorescent response to autoinducers''' produced by the pathogen ''Pseudomonas aeruginosa'' during quorum sensing. In the case of ''P.&nbsp;aeruginosa'', these autoinducers are N-3-oxo-dodecanoyl-L-homoserine lactone, or 3-oxo-C-12-HSL for short. The quorum sensing system of this pathogen contains the '''LasR activator''' which binds 3-oxo-C-12-HSL, and the '''LasI promoter''', which is activated by the LasR-HSL complex. Both LasR activator and LasI promoter are available as BioBricks [http://parts.igem.org/Part:BBa_C0179 C0179] and [http://parts.igem.org/Part:BBa_J64010 J64010].<br />
<br />
As a reporter gene, we use '''GFP'''. However, expression of GFP is not simply controlled through the LasI promoter activity in our approach. Instead, our sensor cells contain genes for a constitutively expressed fusion protein consisting of GFP and a dark quencher, and an '''HSL-inducible protease'''. We use the REACh protein as dark quencher for GFP and the TEV protease to cleave the complex; [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter here] you can read more about the REACh construct and the TEV protease. <br />
<br />
{{Team:Aachen/Figure|align=center|Aachen_REACh_approach.png|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=500px}}<br />
<br />
When ''P.&nbsp;aeruginosa cells'' are stuck on our agar chip and come close to our sensor cells, the latter take up the HSL molecules secreted by the pathogens. Inside the sensor cells, the autoinducer binds to the LasR gene product and activate the expression of the TEV protease. The protease then cleaves the GFP-REACh construct. When '''illuminated with light of 480&nbsp;nm''', the excitation wavelenght of GFP, our sensor cells in the vicinity of ''P.&nbsp;aeruginosa'' give a '''fluorescence signal'''. On the other hand, sensor cells that were not anywhere close to the pathogens do not express the protease. Therefore, the GFP will still be attached to the dark quencher in these cells, and no fluorescence is produced.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}} --><br />
[[File:Aachen_14-10-16_Iterative_Process_iNB.png|right|150px]]<br />
<br />
== Development & Optimization ==<br />
<span class="anchor" id="biosensordevelopment"></span><br />
<br />
=== Equipment and medium selection ===<br />
{{Team:Aachen/FigureFloat|Aachen_ILOV_GFP_HM_1,5h.png|title=iLOV and GFP in the Gel Doc<sup>TM</sup>|subtitle=Sensor cells producing iLOV (A) and GFP (B) 1.5&nbsp;h after induction.|left|width=500px}}<br />
<br />
Our first approach (before developing our own device) was to use the Molecular Imager&reg; Gel Doc™ XR+ from BIO-RAD in our lab to detect fluorescence, which uses UV and white light illuminators. However, only two different filters were available for the excitation light wavelength, which resulted in very limited possibilities for the excitation of fluorescent molecules. For example, it was possible to detect the expression of iLOV in our sensor chips, but in contrast the detection of GFP was not possible. Hence, the '''Gel Doc™ was not suitable for our project'''.<br />
{{Team:Aachen/FigureFloat|Aachen_Chip_medium_geldoc.png|title=Differend medium in the Gel Doc™|subtitle=complex media exhibited high background fluorescence while less back- ground fluorescence was observed with the minimal media (HM, M9, NA).|right|width=500px}}<br />
{{Team:Aachen/FigureFloat|Aachen_5days_K131026_neb_tb_1,5h.jpg |title=Testing our chips' shelf-life|subtitle= Chips of [http://parts.igem.org/Part:BBa_K131026 K131026] in NEB were stored 5 days at 4°C. The right chip was induced with 0.2&nbsp;µL of 500&nbsp;µg/mL HSL and an image was taken after 1.5&nbsp;h.|left|width=500px}}<br />
<br> We tested different media (i.e. LB, M9, NA, HM and TB) for the preparation of our sensor chips. The details of media composition can be found in the [https://2014.igem.org/Team:Aachen/Notebook/Protocols Protocols] section. We screened for an optimized media composition that results in minimal background fluorescence and supports cell growth. The resuts of the analysis are presented in the table below. Because of the reduced fluorescence compared to TB medium when using ''WatsOn'' for sensor chip evaluation and because of sufficient cultivation conditions for our ''Cellocks'' '''LB&nbsp;medium was chosen over TB medium for sensor hip manufacturing'''.<br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! !! LB !! TB !! NA !! M9 !! HM <br />
|-<br />
| Growth of Cellock || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|-<br />
| Background fluorescence in GelDoc || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|-<br />
| Background fluorescence in ''WatsOn'' || <div style="text-align: center;">-</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|}<br />
</center><br />
<br />
<br />
Experiments were conducted to test '''long-time storage''' of the sensor chips at low temperature and by the addition of glycerol. Storage at -20°C resulted in the loss of our sensor cells. Adding 5-10% (v/v) glycerol ensured survival of the sensor cells, but resulted in an expression stop of fluorescence proteins. Hence, we concluded that long time storage of the sensor chips is not possible under the tested conditions. However, it is possible to store 'ready-to-use' sensor chips for 2 days at 4°C when using LB medium and storage for 5 days was possible with chips made from TB medium.<br />
<!--Regarding the medium used for our sensor chips, LB medium showed a high background fluorescence when exposed to UV light in the Gel Doc. Surprisingly, the background fluorescence resulting from the LB medium was too high to detect a signal emitted by our sensor cells. Hence, minimal media (NA, M9, Hartman (HM)) was used to minimize background fluorescence, but this approach resulted in less to no growth of our sensor cells. In our device ''WatsOn'', optimized wavelengths of 450&nbsp;nm and 480&nbsp;nm were used for excitation of iLOV and GFP, respectively. When exposed to either excitation wavelength TB medium, which is basically an improved LB medium and highly supports cell growth, showed strong background fluorescence in our own device. High background fluorescence was also observed for TB medum when using the Gel Doc. In contrast to the Gel Doc LB medium showed minimal fluorescence in our device ''WatsOn'' and no difficulties in cultivation of our ''Cellocks'' were observed. Because of the reduced fluorescence compared to TB medium when using ''Watson'' for sensor chip evaluation and because of sufficient cultivation conditions for our 'Cellocks'' LB medium was chosen over TB mediium for sensor chip manufacturing. --><br />
<br />
=== Optimal agarose concentration for sensor chip manufacturing ===<br />
For the sensor chip manufacturing, agarose was preferred over agar, because of a uniform linkage that resulted in a better chip homogeneity. In addition, agarose reduced diffusion of the inducer molecules through the chip. A reduced diffusion is vital to observe distinct fluorescent spots on the sensor chips and thus further optimzation of our 2D biosensor was done using agarose-based chips.<br />
<br />
<br />
{{Team:Aachen/FigureFloat|Aachen_2_chipform.jpg|title=Sensor chip manufacturing using the closed mold|subtitle=When injecting the liquid agar into a closed mold we encounter problems due to frequent bubble formation.|left|width=500px}}<br />
=== Optimal chip configuration ===<br />
Several approaches were tested for the production of agarose-based sensor chips with reproducible quality. The first approach was to cast every sensor chip individually. To achieve a plain chip surface (a requisite for high quality images), we casted the sensor chips between two microscope slides in an initial attempt. However, this approach was rejected, because the agar was too liquid and leaked from the microscope slides. In the second approach, we prepared a closed mold into which liquid agar was injected with a pipette, but we encountered a high number of bubbles in the resulting chips. Bubbles in the sensor chips interfered with fluorescence evaluation. Finally, we used an open mold into which the agar was poured right after mixing with the sensor cells. Chips were cut out along precast indentations in the casting mold after the agar solidified. An advantage of the open mold was the ability to simultaneously produce nine sensor chips while the surface tension of the liquid agar ensured a plane chip surface.<br />
<br />
{{Team:Aachen/FigureFloat|Aachen_Final_chipform.jpg|title=The finalized chip mold|subtitle=An open casting mold was found to be optimal for sensor chip manufacturing, because this approach was fast, easy to handle and generated a reproducible chip quality. In addition nine sensor chips could be produced simultaneously.|left|width=500px}}<br />
<br />
=== Induction of the sensor chips ===<br />
<br />
For initial testing of our molecular constructs, we simulated the presence of ''P.&nbsp;aeruginosa'' using IPTG or 3-oxo-C12 HSL. However, for induction a minimal volume is required as our initial experiments showed that diffusion of the inducers through the chip hindered the formation of distinct spots on the chips. An optimal and low volume of 0.2&nbsp;µl was chosen for induction. Sensor cells based on ''E. coli'' BL21, which incorporated the [https://2014.igem.org/Team:Aachen/Parts#partsK1319042 K1319042] construct were able to detect IPTG concentrations down to 1 mM (0.2&nbsp;µl), and as well for the sensor cells based on ''E. coli'' BL21 which incorporated the REACh constructs. Sensor cells based on ''E. coli'' BL21, which incorporated the [http://parts.igem.org/Part:BBa_K131026 K131026] construct were able to detect HSL concentrations down to 500&nbsp;µg/ml (0.2&nbsp;µl). Furthermore, detection of growing ''P. aeruginosa'' cells based on secreted HSLs was possible using the [http://parts.igem.org/Part:BBa_K131026 K131026] construct. The experiments conducted during induction of our sensor chips are described in more detail in the [https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements Achievements] section.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
==Achievements==<br />
<span class="anchor" id="biosensorachievements"></span><br />
<br />
We are able to detect IPTG, 3-oxo-C{{sub|12}} HSL and ''Pseudomonas aeruginosa''. To prove that the sensor constructs produce the flourescence signal and not the medium or ''E. coli'' in its own we have [http://parts.igem.org/Part:BBa_B0015 B0015] in NEB as a negativ control for IPTG, HSL and ''Pseudomonas aeruginosa'' induction.<br />
<br />
{{Team:Aachen/Figure|Aachen_B0015_IPTG_HSL_Pseudomonas.png|title=Negativ control |subtitle=B0015 in NEB as negativ control induced with A) 0.2&nbsp;µl of 100&nbsp;mM IPTG, image taken after 2.5&nbsp;h; B) 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12), image after 2.5&nbsp;h; C) with 5 spots of ''Pseudomonas aeruginosa'' on the left and one big spot on the right, image taken after 2&nbsp;h|width=900px}}<br />
<br />
=== Testing our Sensor Chips in a Plate Reader ===<br />
{{Team:Aachen/FigureFloat|Aachen_K1319042_Platereader.gif|title=Testing K1319042 in our sensor chips|subtitle=K1319042 in our sensor chip induced with 2&nbsp;µL IPTG and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=260px}}<br />
<br />
To establish a prove of principle we used our construct [http://parts.igem.org/Part:BBa_K1319042 K1319042] an IPTG inducible iLOV. They were introduced into our sensor chips and then fluorescence was measured every 15 minutes after an induction with 2&nbsp;µl 100&nbsp;mM IPTG (gif on the left).<br />
<br />
There is a clear difference in fluorescence between the not induced chip (top) and the induced chip (bottom). It is distinctively visible that the middle of the bottom chip start to exhibit fluorescence and then the fluorescence increases over time and spreads outward. The top chip also shows a slight increase in measured fluorescence but it is nowhere near the level of the induced chip and is primarily attributable to a leaky promoter and the background fluorescence. <br />
<br />
This demonstrates a general proof of principle of the sensor chip design. Therefore the next was testing the detection of 3-oxo-C{{sub|12}} HSL.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
=== Detecting 3-oxo-C{{sub|12}} HSL with Sensor Chips ===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_Platereader.gif|title=Testing K131026 in our sensor chips|subtitle=K131026 in our sensor chip induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=360px}}<br />
<br />
As a next step, we used [http://parts.igem.org/Part:BBa_K131026 K131026] from the 2008 iGEM Team Calgary in our sensor chips to detect 3-oxo-C{{sub|12}} HSL which is produced by ''Pseudomonas&nbsp;aeruginosa'' during quorum sensing. First, we tested them by direct induction with purified 3-oxo-C{{sub|12}} HSL (0.2&nbsp;µL, 500&nbsp;µg/mL). A fluorescence measurement was taken every 15&nbsp;minutes with an excitation wavelength of 496&nbsp;nm and an emission wavelength of 516&nbsp;nm (for GFP).<br />
<br />
The measured fluorescence again showed a distinct signal on the induced chip (bottom) compared to the uninduced chip (top). The fluorescence clearly starts in the middle of the chip (point of induction) and then extends outwards, still showing an ever increasing signal of fluorescence. The base level of fluorescence is attributed to leakiness of the promoter and general background fluorescence of growing ''E. coli'' cells. In the induced chip (bottom), the background fluorescence is a lot lower than in the uninduced chip (top) because the signal masks the noise. The difference between the induced and uninduced chips indicates a clear response to the HSL and a proof for the ability of our sensor chip design to detect the HSL produced by ''Pseudomonas&nbsp; aeruginosa''.<br />
<br />
=== Detecting IPTG with Sensor Chips ===<br />
{{Team:Aachen/FigureFloat|Aachen_I746909_slower_reduced.gif|title=IPTG inducible superfolder GFP (I746909) in sensor chips|subtitle=IPTG inducible superfolder GFP (I746909) is induced with IPTG (2 µl, 100mM) on the right chip with a non induced chip on the left|width=480px}}<br />
<br />
This video shows the construct [http://parts.igem.org/Part:BBa_I746909 I746909] from the 2007 iGEM Team Cambridge. This BioBrick is a producer of superfolder GFP under the control of a T7 promoter. It was introduced into BL21(DE3) cells making the expression IPTG inducible through the T7 RNA Polymerase encoded in the genome of BL21(DE3) under the control of a lacI promoter. <br />
<br />
The left chip does not show visible fluorescence and the right chip exhibits a strong fluorescence signal showing clearly the ability of the sensor chip technology to detect IPTG. On top of that, the fluorescence response is strong enough to be detected and analyzed by the measurement device WatsOn.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
===Detecting the 3-oxo-C{{sub|12}} HSL with K131026 in our Sensor Chips with ''WatsOn''===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_HSLdetection_slow.gif|title=Detection of 3-oxo-C{{sub|12}} HSL with K131026|subtitle=0.2 µL of 3-oxo-C{{sub|12}} HSL was placed in the middle of the chip and then incubated at 37°C in ''WatsOn''.|width=480px}}<br />
<br />
The next step towards the final goal to detect ''Pseudomonas&nbsp;aeruginosa'' was to replicate the detection of 3-oxo-C{{sub|12}} HSL, which was established in the plate reader, in our own [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] device. Therefore, we again used K131026 as our construct in ''E. coli'' BL21(DE3) cells and induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL with a concentration of 500&nbsp;µg/mL. The right chip was induced and - as a negative control - the left chip was not induced. Pictures were taken every 4&nbsp;minutes.<br />
<br />
The result was a clear replication of the success of the plate reader experiment. The induced chip shows a clear fluorescence response eminating from the center where the induction with HSL took place. This demonstrates the ability of not only our sensor chips but also our measurement device ''WatsOn'' to successfully detect 3-oxo-C{{sub|12}} HSL.<br />
<br />
===Detecting ''Pseudomonas&nbsp;aeruginosa'' with K131026 in our Sensor Chip with ''WatsOn''===<br />
{{Team:Aachen/FigureFloat|Aachen_K131026_Pseudomonas_aeruginosa_detection.gif|title=Detection of ''Pseudomonas aeruginosa'' with K131026|subtitle=Direct detection of ''Pseudomonas aeruginosa'' on our sensor chips. Sensor cell used were K131026.|width=480px}}<br />
<br />
After establishing the successful detection of 3-oxo-C{{sub|12}} with our sensor chips the next step was the detection of ''Pseudomonas aeruginosa'' with our measurement device ''WatsOn''. Therefore sensor chips with K131026 were again prepared and the right chip was induced with 0.2&nbsp;µl of a ''Pseudomonas aeruginosa'' culture while the left chip was not induced. <br />
<br />
The results clearly demonstrate our ability to detect ''Pseudomonas aeruginosa'' with our measurement device ''WatsOn''. On the induced chip a definite fluorescence response is visible in response to ''Pseudomonas aeruginosa''. The fluorescence eminates outward from the induction point and shows a significant difference to the non induced chip. Therefore detection of ''Pseudomonas aeruginosa'' is possible with our sensor chip technology in our measurement device ''WatsOn''!<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="biosensoroutlook"></span><br />
<br />
After successfully detecting ''P.&nbsp;aeruginosa'', the next step in developing our sensor chip platform further is an '''improvement of the sampling chip'''. The current technique of using a simple agarose chip is not sufficient to collect all microorganisms from the sampled surface. Therefore, the aim is to improve the sampling chip by trying different, more adhesive material. <br />
<br />
Furthermore, diffusion in the sensor chips will be reduced to '''limit the spread of the fluorescence signal'''. Currently, the fluorescence spot grows at lot beyond the point of detection and makes it difficult to successfully differentitate between multiple points of induction. By introducing different diffusion barriers into our chips, the growth of the fluorescence spots might be limited, thus enabling the detection of multiple sources of fluorescence lying close together. <br />
<br />
Additionally, the application of our sensor chips in combination with our ''WatsOn'' device is currently being evaluated for the detection of signals other than fluorescence. '''Detecting bio- and chemiluminescence''' has been identified as an area of potential future application. <br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
==References==<br />
<br />
* Waters, C. M., & Bassler, B. L. (2005). QUORUM SENSING: Cell-to-Cell Communication In Bacteria. Annual Review of Cell and Developmental Biology, 21(1), 319-346. Available online at http://www.annualreviews.org/doi/full/10.1146/annurev.cellbio.21.012704.131001.<br />
<br />
* Jimenez, P. N., Koch, G., Thompson, J. A., Xavier, K. B., Cool, R. H., & Quax, W. J. (2012). The Multiple Signaling Systems Regulating Virulence in Pseudomonas aeruginosa. Microbiology and Molecular Biology Reviews, 76(1), 46-65. Available online at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3294424/#B63.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Project/2D_BiosensorTeam:Aachen/Project/2D Biosensor2014-10-17T20:57:36Z<p>StefanReinhold: /* Detecting Pseudomonas&nbsp;aeruginosa with K131026 in our Sensor Chip with WatsOn */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= 2D Biosensor =<br />
<br />
With our 2D biosensor technology we are able to detect the pathogen ''Pseudomonas aeruginosa'' on solid surfaces. The sensor system is comprised of '''two distinct but inseparable modules''', a biological and a technical part:<br />
<br />
* Sensor chips containing '''''Cellocks''''', our '''engineered detective cells''' that fluoresce in the presence of the pathogen, make up the biological part of ''Cellock Holmes''.<br />
* Our '''measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn'']''' and the complementary '''software [https://2014.igem.org/Team:Aachen/Notebook/Software/Measurarty ''Measurarty'']''' complete our sensing technology on the technical side. <br />
<br />
<center><br />
<html><ul class="team-grid" style="width:1064px;"><br />
<!-- Overview --><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorpoo" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Principle of Operation</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/6e/Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensordevelopment" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Development & Optimization</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/a/a7/Aachen_14-10-16_Iterative_Process_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Achievements</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/e/ef/Aachen_14-10-15_Medal_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensoroutlook" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<div class="menukachel">Outlook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-16_Outlook_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_15-10-14_Principle_of_operation_2D_sensor_ipo.png|right|150px]]<br />
<br />
== Principle of Operation ==<br />
<span class="anchor" id="biosensorpoo"></span><br />
<br />
''Cellock Holmes'' is designed upon a SynBio approach comprising a '''two-dimensional biosensor and a measurement unit'''. The two-dimensional biosensor is devised to recognize quorum sensing molecules secreted by the pathogen cells and to generate a distinct fluorescence signal; while the measurement device recognizes and analyzes the produced signal. <br />
<br>On the molecular side, we use the '''[https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh construct]''' to transform regular ''E. coli'' cells into ''Cellocks''.<br />
<br />
{{Team:Aachen/Figure|Aachen 17-10-14 The basics of quorum sensing ipo.png||title=The principle of quorum sensing|subtitle=Microorganisms can sense the presence of their own kind based on quorum sensing which is a form of chemical communication. Depending on their cell density, quorum sensing allows these cells to activate or deactivate certain gene expression cascades (Waters and Bassler, 2005) for a specific function.|width=900px}}<br />
<br />
Our '''sensor cells, ''Cellocks'', are immobilized in agar chips'''. To make the chips, we mix the ''Cellocks'' with liquid LB agar. <br />
In the course of our project, we designed a casting mold specifically for the production of our agar chips. When the agar has cooled down, the chips are cut out of the mold and are ready to use. Storage of the readily usable sensor chips is possible for up to 2 days at 4°C when using LB medium or up to 5 days if TB medium is used. A detailed description of the sensor chip manufacturing can be found in our [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection Protocols] section.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part1 ipo.png|title=Assay to detect ''P.&nbsp;aeruginosa'' using ''Cellock Holmes''|subtitle=This flow sheet shows the procedure to sample and detect ''P.&nbsp;aeruginosa'': A sampling chip is briefly put onto the potentially contaminated surface, added onto one of our sensor chips and inserted into ''WatsOn''.|width=900px}}<br />
<br />
Using ''Cellock Holmes'', we developed a simple assay to detect ''P.&nbsp;aeruginosa''.<br />
<br>Initially, a so called sampling chip is placed on a solid surface that is potentially contaminated with the pathogen. Subsequently, the sampling chip is removed from the surface and put onto one of our sensor chips. Theorectically, the sensor chips could be directly used for sampling, however, this was avoided in our project to '''match [https://2014.igem.org/Team:Aachen/Safety biosafety regulations]''' and to prevent the spread of genetically modified organisms (GMOs) into the environment. The two layered chip-stack is then put into a petri dish which is inserted into our measurement device [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] for evalutation.<br />
<br />
{{Team:Aachen/Figure|Aachen 14-10-14 Flowsheet OD-device part2 ipo.png|title=Mode of action inside ''WatsOn''|subtitle=Chips are incubated at 37°C to stimulate cell growth and then illuminated with blue light to excite fluorescence. A picture is taken and analyzed for fluorescence signals using the software ''Measurarty''.|width=900px}}<br />
<br />
Inside ''WatsOn'', the chips are incubated at 37°C and the sampled populations of microorganisms attached on the sampling chip start to grow and multiply. During incubation the chips can be '''illuminated with blue light''' at any time, and a '''photo of the chips''' is taken. The '''software ''Measurarty''''' then analyzes any fluorescent signal.<br>''P.&nbsp;aeruginosa'' secrets an increasing number of quorum sensing molecules that are recognized by ''Cellocks'', thereby producing a fluorescence signal. For detection of ''P.&nbsp;aeruginosa'', we focused on a quorum sensing molecule called N-3-oxo-dodecanoyl-L-homoserine lactone (for short: 3-oxo-C<sub>12</sub>-HSL), which is involved in virulence regulation of ''P.&nbsp;aeruginosa'' (Jimenez, Koch, Thompson et al., 2012). The incorporation of the 3-oxo-C<sub>12</sub>-HSL detection system into the ''Cellocks'' is explained in detail in the [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter REACh Construct] section.<br />
<br />
<br />
</center><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
<!-- ==A Novel Molecular Approach==<br />
<span class="anchor" id="biosensormolecularapproach"></span><br />
<br />
For our biosensor, our team genetically modified ''E. coli'' cells to be able to elecit a '''fluorescent response to autoinducers''' produced by the pathogen ''Pseudomonas aeruginosa'' during quorum sensing. In the case of ''P.&nbsp;aeruginosa'', these autoinducers are N-3-oxo-dodecanoyl-L-homoserine lactone, or 3-oxo-C-12-HSL for short. The quorum sensing system of this pathogen contains the '''LasR activator''' which binds 3-oxo-C-12-HSL, and the '''LasI promoter''', which is activated by the LasR-HSL complex. Both LasR activator and LasI promoter are available as BioBricks [http://parts.igem.org/Part:BBa_C0179 C0179] and [http://parts.igem.org/Part:BBa_J64010 J64010].<br />
<br />
As a reporter gene, we use '''GFP'''. However, expression of GFP is not simply controlled through the LasI promoter activity in our approach. Instead, our sensor cells contain genes for a constitutively expressed fusion protein consisting of GFP and a dark quencher, and an '''HSL-inducible protease'''. We use the REACh protein as dark quencher for GFP and the TEV protease to cleave the complex; [https://2014.igem.org/Team:Aachen/Project/FRET_Reporter here] you can read more about the REACh construct and the TEV protease. <br />
<br />
{{Team:Aachen/Figure|align=center|Aachen_REACh_approach.png|title=Our novel biosensor approach|subtitle=Expression of the TEV protease is induced by HSL. The protease cleaves the GFP-REACh fusion protein to elecit a fluorescence response.|width=500px}}<br />
<br />
When ''P.&nbsp;aeruginosa cells'' are stuck on our agar chip and come close to our sensor cells, the latter take up the HSL molecules secreted by the pathogens. Inside the sensor cells, the autoinducer binds to the LasR gene product and activate the expression of the TEV protease. The protease then cleaves the GFP-REACh construct. When '''illuminated with light of 480&nbsp;nm''', the excitation wavelenght of GFP, our sensor cells in the vicinity of ''P.&nbsp;aeruginosa'' give a '''fluorescence signal'''. On the other hand, sensor cells that were not anywhere close to the pathogens do not express the protease. Therefore, the GFP will still be attached to the dark quencher in these cells, and no fluorescence is produced.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}} --><br />
[[File:Aachen_14-10-16_Iterative_Process_iNB.png|right|150px]]<br />
<br />
== Development & Optimization ==<br />
<span class="anchor" id="biosensordevelopment"></span><br />
<br />
=== Equipment and medium selection ===<br />
{{Team:Aachen/FigureFloat|Aachen_ILOV_GFP_HM_1,5h.png|title=iLOV and GFP in the Gel Doc<sup>TM</sup>|subtitle=Sensor cells producing iLOV (A) and GFP (B) 1.5&nbsp;h after induction.|left|width=500px}}<br />
<br />
Our first approach (before developing our own device) was to use the Molecular Imager&reg; Gel Doc™ XR+ from BIO-RAD in our lab to detect fluorescence, which uses UV and white light illuminators. However, only two different filters were available for the excitation light wavelength, which resulted in very limited possibilities for the excitation of fluorescent molecules. For example, it was possible to detect the expression of iLOV in our sensor chips, but in contrast the detection of GFP was not possible. Hence, the '''Gel Doc™ was not suitable for our project'''.<br />
{{Team:Aachen/FigureFloat|Aachen_Chip_medium_geldoc.png|title=Differend medium in the Gel Doc™|subtitle=complex media exhibited high background fluorescence while less back- ground fluorescence was observed with the minimal media (HM, M9, NA).|right|width=500px}}<br />
{{Team:Aachen/FigureFloat|Aachen_5days_K131026_neb_tb_1,5h.jpg |title=Testing our chips' shelf-life|subtitle= Chips of [http://parts.igem.org/Part:BBa_K131026 K131026] in NEB were stored 5 days at 4°C. The right chip was induced with 0.2&nbsp;µL of 500&nbsp;µg/mL HSL and an image was taken after 1.5&nbsp;h.|left|width=500px}}<br />
<br> We tested different media (i.e. LB, M9, NA, HM and TB) for the preparation of our sensor chips. The details of media composition can be found in the [https://2014.igem.org/Team:Aachen/Notebook/Protocols Protocols] section. We screened for an optimized media composition that results in minimal background fluorescence and supports cell growth. The resuts of the analysis are presented in the table below. Because of the reduced fluorescence compared to TB medium when using ''WatsOn'' for sensor chip evaluation and because of sufficient cultivation conditions for our ''Cellocks'' '''LB&nbsp;medium was chosen over TB medium for sensor hip manufacturing'''.<br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! !! LB !! TB !! NA !! M9 !! HM <br />
|-<br />
| Growth of Cellock || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|-<br />
| Background fluorescence in GelDoc || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|-<br />
| Background fluorescence in ''WatsOn'' || <div style="text-align: center;">-</div> || <div style="text-align: center;">'''+'''</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div> || <div style="text-align: center;">-</div><br />
|}<br />
</center><br />
<br />
<br />
Experiments were conducted to test '''long-time storage''' of the sensor chips at low temperature and by the addition of glycerol. Storage at -20°C resulted in the loss of our sensor cells. Adding 5-10% (v/v) glycerol ensured survival of the sensor cells, but resulted in an expression stop of fluorescence proteins. Hence, we concluded that long time storage of the sensor chips is not possible under the tested conditions. However, it is possible to store 'ready-to-use' sensor chips for 2 days at 4°C when using LB medium and storage for 5 days was possible with chips made from TB medium.<br />
<!--Regarding the medium used for our sensor chips, LB medium showed a high background fluorescence when exposed to UV light in the Gel Doc. Surprisingly, the background fluorescence resulting from the LB medium was too high to detect a signal emitted by our sensor cells. Hence, minimal media (NA, M9, Hartman (HM)) was used to minimize background fluorescence, but this approach resulted in less to no growth of our sensor cells. In our device ''WatsOn'', optimized wavelengths of 450&nbsp;nm and 480&nbsp;nm were used for excitation of iLOV and GFP, respectively. When exposed to either excitation wavelength TB medium, which is basically an improved LB medium and highly supports cell growth, showed strong background fluorescence in our own device. High background fluorescence was also observed for TB medum when using the Gel Doc. In contrast to the Gel Doc LB medium showed minimal fluorescence in our device ''WatsOn'' and no difficulties in cultivation of our ''Cellocks'' were observed. Because of the reduced fluorescence compared to TB medium when using ''Watson'' for sensor chip evaluation and because of sufficient cultivation conditions for our 'Cellocks'' LB medium was chosen over TB mediium for sensor chip manufacturing. --><br />
<br />
=== Optimal agarose concentration for sensor chip manufacturing ===<br />
For the sensor chip manufacturing, agarose was preferred over agar, because of a uniform linkage that resulted in a better chip homogeneity. In addition, agarose reduced diffusion of the inducer molecules through the chip. A reduced diffusion is vital to observe distinct fluorescent spots on the sensor chips and thus further optimzation of our 2D biosensor was done using agarose-based chips.<br />
<br />
=== Optimal chip configuration ===<br />
{{Team:Aachen/FigureFloat|Aachen_2_chipform.jpg|title=Sensor chip manufacturing using the closed mold|subtitle=When injecting the liquid agar into a closed mold we encounter problems due to frequent bubble formation.|left|width=500px}}<br />
Several approaches were tested for the production of agarose-based sensor chips with reproducible quality. The first approach was to cast every sensor chip individually. To achieve a plain chip surface (a requisite for high quality images), we casted the sensor chips between two microscope slides in an initial attempt. However, this approach was rejected, because the agar was too liquid and leaked from the microscope slides. In the second approach, we prepared a closed mold into which liquid agar was injected with a pipette, but we encountered a high number of bubbles in the resulting chips. Bubbles in the sensor chips interfered with fluorescence evaluation. Finally, we used an open mold into which the agar was poured right after mixing with the sensor cells. Chips were cut out along precast indentations in the casting mold after the agar solidified. An advantage of the open mold was the ability to simultaneously produce nine sensor chips while the surface tension of the liquid agar ensured a plane chip surface.<br />
<br />
{{Team:Aachen/FigureFloat|Aachen_Final_chipform.jpg|title=The finalized chip mold|subtitle=An open casting mold was found to be optimal for sensor chip manufacturing, because this approach was fast, easy to handle and generated a reproducible chip quality. In addition nine sensor chips could be produced simultaneously.|left|width=500px}}<br />
<br />
=== Induction of the sensor chips ===<br />
<br />
For initial testing of our molecular constructs, we simulated the presence of ''P.&nbsp;aeruginosa'' using IPTG or 3-oxo-C12 HSL. However, for induction a minimal volume is required as our initial experiments showed that diffusion of the inducers through the chip hindered the formation of distinct spots on the chips. An optimal and low volume of 0.2&nbsp;µl was chosen for induction. Sensor cells based on ''E. coli'' BL21, which incorporated the [https://2014.igem.org/Team:Aachen/Parts#partsK1319042 K1319042] construct were able to detect IPTG concentrations down to 1 mM (0.2&nbsp;µl), and as well for the sensor cells based on ''E. coli'' BL21 which incorporated the REACh constructs. Sensor cells based on ''E. coli'' BL21, which incorporated the [http://parts.igem.org/Part:BBa_K131026 K131026] construct were able to detect HSL concentrations down to 500&nbsp;µg/ml (0.2&nbsp;µl). Furthermore, detection of growing ''P. aeruginosa'' cells based on secreted HSLs was possible using the [http://parts.igem.org/Part:BBa_K131026 K131026] construct. The experiments conducted during induction of our sensor chips are described in more detail in the [https://2014.igem.org/Team:Aachen/Project/2D_Biosensor#biosensorachievements Achievements] section.<br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-15_Medal_Cellocks_iNB.png|right|150px]]<br />
<br />
==Achievements==<br />
<span class="anchor" id="biosensorachievements"></span><br />
<br />
We are able to detect IPTG, 3-oxo-C{{sub|12}} HSL and ''Pseudomonas aeruginosa''. To prove that the sensor constructs produce the flourescence signal and not the medium or ''E. coli'' in its own we have [http://parts.igem.org/Part:BBa_B0015 B0015] in NEB as a negativ control for IPTG, HSL and ''Pseudomonas aeruginosa'' induction.<br />
<br />
{{Team:Aachen/Figure|Aachen_B0015_IPTG_HSL_Pseudomonas.png|title=Negativ control |subtitle=B0015 in NEB as negativ control induced with A) 0.2&nbsp;µl of 100&nbsp;mM IPTG, image taken after 2.5&nbsp;h; B) 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12), image after 2.5&nbsp;h; C) with 5 spots of ''Pseudomonas aeruginosa'' on the left and one big spot on the right, image taken after 2&nbsp;h|width=900px}}<br />
<br />
=== Testing our Sensor Chips in a Plate Reader ===<br />
{{Team:Aachen/FigureFloat|Aachen_K1319042_Platereader.gif|title=Testing K1319042 in our sensor chips|subtitle=K1319042 in our sensor chip induced with 2&nbsp;µL IPTG and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=260px}}<br />
<br />
To establish a prove of principle we used our construct [http://parts.igem.org/Part:BBa_K1319042 K1319042] an IPTG inducible iLOV. They were introduced into our sensor chips and then fluorescence was measured every 15 minutes after an induction with 2&nbsp;µl 100&nbsp;mM IPTG (gif on the left).<br />
<br />
There is a clear difference in fluorescence between the not induced chip (top) and the induced chip (bottom). It is distinctively visible that the middle of the bottom chip start to exhibit fluorescence and then the fluorescence increases over time and spreads outward. The top chip also shows a slight increase in measured fluorescence but it is nowhere near the level of the induced chip and is primarily attributable to a leaky promoter and the background fluorescence. <br />
<br />
This demonstrates a general proof of principle of the sensor chip design. Therefore the next was testing the detection of 3-oxo-C{{sub|12}} HSL.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
=== Detecting 3-oxo-C{{sub|12}} HSL with Sensor Chips ===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_Platereader.gif|title=Testing K131026 in our sensor chips|subtitle=K131026 in our sensor chip induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL and measured with a plate reader. Blue color indicates no fluorescence, red color indicates fluorescence. Top chip is not induced, bottom chip is induced with IPTG.|width=360px}}<br />
<br />
As a next step, we used [http://parts.igem.org/Part:BBa_K131026 K131026] from the 2008 iGEM Team Calgary in our sensor chips to detect 3-oxo-C{{sub|12}} HSL which is produced by ''Pseudomonas&nbsp;aeruginosa'' during quorum sensing. First, we tested them by direct induction with purified 3-oxo-C{{sub|12}} HSL (0.2&nbsp;µL, 500&nbsp;µg/mL). A fluorescence measurement was taken every 15&nbsp;minutes with an excitation wavelength of 496&nbsp;nm and an emission wavelength of 516&nbsp;nm (for GFP).<br />
<br />
The measured fluorescence again showed a distinct signal on the induced chip (bottom) compared to the uninduced chip (top). The fluorescence clearly starts in the middle of the chip (point of induction) and then extends outwards, still showing an ever increasing signal of fluorescence. The base level of fluorescence is attributed to leakiness of the promoter and general background fluorescence of growing ''E. coli'' cells. In the induced chip (bottom), the background fluorescence is a lot lower than in the uninduced chip (top) because the signal masks the noise. The difference between the induced and uninduced chips indicates a clear response to the HSL and a proof for the ability of our sensor chip design to detect the HSL produced by ''Pseudomonas&nbsp; aeruginosa''.<br />
<br />
=== Detecting IPTG with Sensor Chips ===<br />
{{Team:Aachen/FigureFloat|Aachen_I746909_slower_reduced.gif|title=IPTG inducible superfolder GFP (I746909) in sensor chips|subtitle=IPTG inducible superfolder GFP (I746909) is induced with IPTG (2 µl, 100mM) on the right chip with a non induced chip on the left|width=480px}}<br />
<br />
This video shows the construct [http://parts.igem.org/Part:BBa_I746909 I746909] from the 2007 iGEM Team Cambridge. This BioBrick is a producer of superfolder GFP under the control of a T7 promoter. It was introduced into BL21(DE3) cells making the expression IPTG inducible through the T7 RNA Polymerase encoded in the genome of BL21(DE3) under the control of a lacI promoter. <br />
<br />
The left chip does not show visible fluorescence and the right chip exhibits a strong fluorescence signal showing clearly the ability of the sensor chip technology to detect IPTG. On top of that, the fluorescence response is strong enough to be detected and analyzed by the measurement device WatsOn.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
===Detecting the 3-oxo-C{{sub|12}} HSL with K131026 in our Sensor Chips with WatsOn===<br />
<br />
{{Team:Aachen/FigureFloatRight|Aachen_K131026_HSLdetection_slow.gif|title=Detection of 3-oxo-C{{sub|12}} HSL with K131026|subtitle=0.2 µL of 3-oxo-C{{sub|12}} HSL was placed in the middle of the chip and then incubated at 37°C in WatsOn.|width=480px}}<br />
<br />
The next step towards the final goal to detect ''Pseudomonas&nbsp;aeruginosa'' was to replicate the detection of 3-oxo-C{{sub|12}} HSL, which was established in the plate reader, in our own [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] device. Therefore, we again used K131026 as our construct in ''E. coli'' BL21(DE3) cells and induced with 0.2&nbsp;µL 3-oxo-C{{sub|12}} HSL with a concentration of 500&nbsp;µg/mL. The right chip was induced and - as a negative control - the left chip was not induced. Pictures were taken every 4&nbsp;minutes.<br />
<br />
The result was a clear replication of the success of the plate reader experiment. The induced chip shows a clear fluorescence response eminating from the center where the induction with HSL took place. This demonstrates the ability of not only our sensor chips but also our measurement device WatsOn to successfully detect 3-oxo-C{{sub|12}} HSL.<br />
<br />
===Detecting ''Pseudomonas&nbsp;aeruginosa'' with K131026 in our Sensor Chip with ''WatsOn''===<br />
{{Team:Aachen/FigureFloat|Aachen_K131026_Pseudomonas_aeruginosa_detection.gif|title=Detection of ''Pseudomonas aeruginosa'' with K131026|subtitle=Direct detection of ''Pseudomonas aeruginosa'' on our sensor chips. Sensor cell used were K131026.|width=480px}}<br />
<br />
After establishing the successful detection of 3-oxo-C{{sub|12}} with our sensor chips the next step was the detection of ''Pseudomonas aeruginosa'' with our measurement device ''WatsOn''. Therefore sensor chips with K131026 were again prepared and the right chip was induced with 0.2&nbsp;µl of a ''Pseudomonas aeruginosa'' culture while the left chip was not induced. <br />
<br />
The results clearly demonstrate our ability to detect ''Pseudomonas aeruginosa'' with our measurement device ''WatsOn''. On the induced chip a definite fluorescence response is visible in response to ''Pseudomonas aeruginosa''. The fluorescence eminates outward from the induction point and shows a significant difference to the non induced chip. Therefore detection of ''Pseudomonas aeruginosa'' is possible with our sensor chip technology in our measurement device ''WatsOn''!<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-16_Outlook_Cellocks_iNB.png|right|150px]]<br />
<br />
== Outlook ==<br />
<span class="anchor" id="biosensoroutlook"></span><br />
<br />
After successfully detecting ''P.&nbsp;aeruginosa'', the next step in developing our sensor chip platform further is an '''improvement of the sampling chip'''. The current technique of using a simple agarose chip is not sufficient to collect all microorganisms from the sampled surface. Therefore, the aim is to improve the sampling chip by trying different, more adhesive material. <br />
<br />
Furthermore, diffusion in the sensor chips will be reduced to '''limit the spread of the fluorescence signal'''. Currently, the fluorescence spot grows at lot beyond the point of detection and makes it difficult to successfully differentitate between multiple points of induction. By introducing different diffusion barriers into our chips, the growth of the fluorescence spots might be limited, thus enabling the detection of multiple sources of fluorescence lying close together. <br />
<br />
Additionally, the application of our sensor chips in combination with our ''WatsOn'' device is currently being evaluated for the detection of signals other than fluorescence. '''Detecting bio- and chemiluminescence''' has been identified as an area of potential future application. <br />
<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
==References==<br />
<br />
* Waters, C. M., & Bassler, B. L. (2005). QUORUM SENSING: Cell-to-Cell Communication In Bacteria. Annual Review of Cell and Developmental Biology, 21(1), 319-346. Available online at http://www.annualreviews.org/doi/full/10.1146/annurev.cellbio.21.012704.131001.<br />
<br />
* Jimenez, P. N., Koch, G., Thompson, J. A., Xavier, K. B., Cool, R. H., & Quax, W. J. (2012). The Multiple Signaling Systems Regulating Virulence in Pseudomonas aeruginosa. Microbiology and Molecular Biology Reviews, 76(1), 46-65. Available online at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3294424/#B63.<br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:AachenTeam:Aachen2014-10-17T20:38:15Z<p>StefanReinhold: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
[[File:Aachen_Cellock_rand.png|left|250px]]<br />
<br />
<span style="font-size:300%;">Cellock Holmes - A Case of Identity</span><br />
<br />
'''Welcome to the Aachen 2014 iGEM Wiki!''' <br />
<br />
To navigate through our website, you can use the navigation bar at the top or the buttons below:<br />
<br />
<html><br />
<ul class="team-grid" style="width:840px;margin-right:0px;float:right"><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Project</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_14-10-16_Project_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Interlab_Study" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Interlab Study</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/3/39/Aachen_Interlab_Cellocks.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/PolicyPractices" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Policy & Practices</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/b/b7/Aachen_14-10-16_PolicyPractices_main_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Collaborations" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Collaborations</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/8/81/Aachen_14-10-15_Collaborating_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Notebook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/4/42/Aachen_14-10-14_NotebookiFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Attributions" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Team</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/c/cf/Aachen_main_Team.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
</ul><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<!--<br />
This project would not have been possible without the generous help and advice from many great people and organizations. We thank all the partners listed below for their essential contributions and financial support that covered registration fees, travel costs, the organization of the meetup in September, laboratory materials and expenses for services and materials.<br />
--><br />
<div align="center"><br />
<br />
{{Team:Aachen/Figure|Team Aachen Teamfoto.png|width=950px}}<br />
<br />
{|cellpadding="12"<br />
|[[File:Logo_Buergerstiftung-Aachen_hoch.jpg|80px|center|link=http://www.buergerstiftung-aachen.de|Bürgerstiftung Aachen]]<br />
|[[File:Aachen_Niersverband_Firmenlogo.jpg|159px|link=http://www.niersverband.de/|Niersverband]]<br />
|[[File:Aachen_Genscript_Logo.png|120px|link=http://www.genscript.com/|Genscript]]<br />
|[[File:Aachen_Eurofinsgenomics.png|97px|link=http://www.eurofinsgenomics.eu/|Eurofins Genomics]]<br />
|[[File:Aachen_Labomedic_Logo.jpg|128px|link=http://www.labomedic.de/|Labomedic]]<br />
|}<br />
<br />
{|cellpadding="18"<br />
|[[File:Aachen_bmbf.jpg|163px|link=http://www.bmbf.de/de/24140.php|BMBF]]<br />
|[[File:Aachen_idt_.png|109px|link=http://www.idt-biologika.de/|IDT]]<br />
|[[File:M2p_labs_logo.jpg|52px|link=http://www.m2p-labs.com/|m2p labs]]<br />
|[[File:Aachen_Roth_Logo.png|55px|link=http://www.carlroth.com/pages/index/COM/index.jsp?market=COM&lang=en-com|Carl Roth]]<br />
|[[File:Aachen_ProRWTH_logo.png|62px|link=http://www.prorwth.de/|pro RWTH]]<br />
|}<br />
{|cellpadding="13"<br />
|[[File:Aachen_Logo_iAMB.png|115px|link=http://www.iamb.rwth-aachen.de|Institute of Applied Microbiology - iAMB]]<br />
|[[File:Aachen_Logo_bio7.png|115px|link=http://www.molbiotech.rwth-aachen.de|Institute for Molecular Biotechnology]]<br />
|[[File:Aachen_Logo_HISynBio.png|123px|link=http://www.helmholtz.de/en/about_us/initiating_and_networking/assuring_excellence/synthetic_biology|Helmholtz Association - Initiative on Synthetic Biology]]<br />
|[[File:Aachen_Logo_ABBt.png|105px|link=http://www.biologie.rwth-aachen.de|Aachen Biology and Biotechnology - ABBt]]<br />
|[[File:Aachen_juelich.png|120px|link=http://www.fz-juelich.de/|Forschungszentrum Jülich]]<br />
|[[File:Aachen_FabLabAachenLogo.jpg|105px|link=http://hci.rwth-aachen.de/fablab|Fab Lab Aachen]]<br />
|[[File:Aachen_Schwaneberg_Group.png|75px|link=http://www.biotec.rwth-aachen.de|Schwaneberg Group]]<br />
|}<br />
<div><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:AachenTeam:Aachen2014-10-17T20:37:42Z<p>StefanReinhold: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
[[File:Aachen_Cellock_rand.png|left|250px]]<br />
<br />
<span style="font-size:300%;">Cellock Holmes - A Case of Identity</span><br />
<br />
'''Welcome to the Aachen 2014 iGEM Wiki!''' <br />
<br />
To navigate through our website, you can use the navigation bar at the top or the buttons below:<br />
<br />
<html><br />
<ul class="team-grid" style="width:840px;margin-right:0px;float:right"><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Project</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_14-10-16_Project_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Interlab_Study" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Interlab Study</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/3/39/Aachen_Interlab_Cellocks.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/PolicyPractices" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Policy & Practices</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/b/b7/Aachen_14-10-16_PolicyPractices_main_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Collaborations" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Collaborations</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/8/81/Aachen_14-10-15_Collaborating_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Notebook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/4/42/Aachen_14-10-14_NotebookiFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Attributions" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Team</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/c/cf/Aachen_main_Team.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
</ul><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<!--<br />
This project would not have been possible without the generous help and advice from many great people and organizations. We thank all the partners listed below for their essential contributions and financial support that covered registration fees, travel costs, the organization of the meetup in September, laboratory materials and expenses for services and materials.<br />
--><br />
<div align="center"><br />
<br />
{{Team:Aachen/Figure|Team Aachen Teamfoto.png|width=900px}}<br />
<br />
{|cellpadding="12"<br />
|[[File:Logo_Buergerstiftung-Aachen_hoch.jpg|80px|center|link=http://www.buergerstiftung-aachen.de|Bürgerstiftung Aachen]]<br />
|[[File:Aachen_Niersverband_Firmenlogo.jpg|159px|link=http://www.niersverband.de/|Niersverband]]<br />
|[[File:Aachen_Genscript_Logo.png|120px|link=http://www.genscript.com/|Genscript]]<br />
|[[File:Aachen_Eurofinsgenomics.png|97px|link=http://www.eurofinsgenomics.eu/|Eurofins Genomics]]<br />
|[[File:Aachen_Labomedic_Logo.jpg|128px|link=http://www.labomedic.de/|Labomedic]]<br />
|}<br />
<br />
{|cellpadding="18"<br />
|[[File:Aachen_bmbf.jpg|163px|link=http://www.bmbf.de/de/24140.php|BMBF]]<br />
|[[File:Aachen_idt_.png|109px|link=http://www.idt-biologika.de/|IDT]]<br />
|[[File:M2p_labs_logo.jpg|52px|link=http://www.m2p-labs.com/|m2p labs]]<br />
|[[File:Aachen_Roth_Logo.png|55px|link=http://www.carlroth.com/pages/index/COM/index.jsp?market=COM&lang=en-com|Carl Roth]]<br />
|[[File:Aachen_ProRWTH_logo.png|62px|link=http://www.prorwth.de/|pro RWTH]]<br />
|}<br />
{|cellpadding="13"<br />
|[[File:Aachen_Logo_iAMB.png|115px|link=http://www.iamb.rwth-aachen.de|Institute of Applied Microbiology - iAMB]]<br />
|[[File:Aachen_Logo_bio7.png|115px|link=http://www.molbiotech.rwth-aachen.de|Institute for Molecular Biotechnology]]<br />
|[[File:Aachen_Logo_HISynBio.png|123px|link=http://www.helmholtz.de/en/about_us/initiating_and_networking/assuring_excellence/synthetic_biology|Helmholtz Association - Initiative on Synthetic Biology]]<br />
|[[File:Aachen_Logo_ABBt.png|105px|link=http://www.biologie.rwth-aachen.de|Aachen Biology and Biotechnology - ABBt]]<br />
|[[File:Aachen_juelich.png|120px|link=http://www.fz-juelich.de/|Forschungszentrum Jülich]]<br />
|[[File:Aachen_FabLabAachenLogo.jpg|105px|link=http://hci.rwth-aachen.de/fablab|Fab Lab Aachen]]<br />
|[[File:Aachen_Schwaneberg_Group.png|75px|link=http://www.biotec.rwth-aachen.de|Schwaneberg Group]]<br />
|}<br />
<div><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:AachenTeam:Aachen2014-10-17T20:37:08Z<p>StefanReinhold: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
[[File:Aachen_Cellock_rand.png|left|250px]]<br />
<br />
<span style="font-size:300%;">Cellock Holmes - A Case of Identity</span><br />
<br />
'''Welcome to the Aachen 2014 iGEM Wiki!''' <br />
<br />
To navigate through our website, you can use the navigation bar at the top or the buttons below:<br />
<br />
<html><br />
<ul class="team-grid" style="width:840px;margin-right:0px;float:right"><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Project</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_14-10-16_Project_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Interlab_Study" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Interlab Study</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/3/39/Aachen_Interlab_Cellocks.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/PolicyPractices" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Policy & Practices</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/b/b7/Aachen_14-10-16_PolicyPractices_main_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Collaborations" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Collaborations</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/8/81/Aachen_14-10-15_Collaborating_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Notebook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/4/42/Aachen_14-10-14_NotebookiFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Attributions" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Team</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/c/cf/Aachen_main_Team.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
</ul><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<!--<br />
This project would not have been possible without the generous help and advice from many great people and organizations. We thank all the partners listed below for their essential contributions and financial support that covered registration fees, travel costs, the organization of the meetup in September, laboratory materials and expenses for services and materials.<br />
--><br />
<div align="center"><br />
<br />
{{Team:Aachen/Figure|Team Aachen Teamfoto.png|width=950px}}<br />
<br />
{|cellpadding="12"<br />
|[[File:Logo_Buergerstiftung-Aachen_hoch.jpg|80px|center|link=http://www.buergerstiftung-aachen.de|Bürgerstiftung Aachen]]<br />
|[[File:Aachen_Niersverband_Firmenlogo.jpg|159px|link=http://www.niersverband.de/|Niersverband]]<br />
|[[File:Aachen_Genscript_Logo.png|120px|link=http://www.genscript.com/|Genscript]]<br />
|[[File:Aachen_Eurofinsgenomics.png|97px|link=http://www.eurofinsgenomics.eu/|Eurofins Genomics]]<br />
|[[File:Aachen_Labomedic_Logo.jpg|128px|link=http://www.labomedic.de/|Labomedic]]<br />
|}<br />
<br />
{|cellpadding="18"<br />
|[[File:Aachen_bmbf.jpg|163px|link=http://www.bmbf.de/de/24140.php|BMBF]]<br />
|[[File:Aachen_idt_.png|109px|link=http://www.idt-biologika.de/|IDT]]<br />
|[[File:M2p_labs_logo.jpg|52px|link=http://www.m2p-labs.com/|m2p labs]]<br />
|[[File:Aachen_Roth_Logo.png|55px|link=http://www.carlroth.com/pages/index/COM/index.jsp?market=COM&lang=en-com|Carl Roth]]<br />
|[[File:Aachen_ProRWTH_logo.png|62px|link=http://www.prorwth.de/|pro RWTH]]<br />
|}<br />
{|cellpadding="13"<br />
|[[File:Aachen_Logo_iAMB.png|115px|link=http://www.iamb.rwth-aachen.de|Institute of Applied Microbiology - iAMB]]<br />
|[[File:Aachen_Logo_bio7.png|115px|link=http://www.molbiotech.rwth-aachen.de|Institute for Molecular Biotechnology]]<br />
|[[File:Aachen_Logo_HISynBio.png|123px|link=http://www.helmholtz.de/en/about_us/initiating_and_networking/assuring_excellence/synthetic_biology|Helmholtz Association - Initiative on Synthetic Biology]]<br />
|[[File:Aachen_Logo_ABBt.png|105px|link=http://www.biologie.rwth-aachen.de|Aachen Biology and Biotechnology - ABBt]]<br />
|[[File:Aachen_juelich.png|120px|link=http://www.fz-juelich.de/|Forschungszentrum Jülich]]<br />
|[[File:Aachen_FabLabAachenLogo.jpg|105px|link=http://hci.rwth-aachen.de/fablab|Fab Lab Aachen]]<br />
|[[File:Aachen_Schwaneberg_Group.png|75px|link=http://www.biotec.rwth-aachen.de|Schwaneberg Group]]<br />
|}<br />
<div><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:AachenTeam:Aachen2014-10-17T20:36:47Z<p>StefanReinhold: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
[[File:Aachen_Cellock_rand.png|left|250px]]<br />
<br />
<span style="font-size:300%;">Cellock Holmes - A Case of Identity</span><br />
<br />
'''Welcome to the Aachen 2014 iGEM Wiki!''' <br />
<br />
To navigate through our website, you can use the navigation bar at the top or the buttons below:<br />
<br />
<html><br />
<ul class="team-grid" style="width:840px;margin-right:0px;float:right"><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Project</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_14-10-16_Project_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Interlab_Study" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Interlab Study</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/3/39/Aachen_Interlab_Cellocks.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/PolicyPractices" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Policy & Practices</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/b/b7/Aachen_14-10-16_PolicyPractices_main_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Collaborations" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Collaborations</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/8/81/Aachen_14-10-15_Collaborating_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Notebook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/4/42/Aachen_14-10-14_NotebookiFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Attributions" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Team</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/c/cf/Aachen_main_Team.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
</ul><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<!--<br />
This project would not have been possible without the generous help and advice from many great people and organizations. We thank all the partners listed below for their essential contributions and financial support that covered registration fees, travel costs, the organization of the meetup in September, laboratory materials and expenses for services and materials.<br />
--><br />
<div align="center"><br />
<br />
{{Team:Aachen/Figure|Team Aachen Teamfoto.png|width=1000px}}<br />
<br />
{|cellpadding="12"<br />
|[[File:Logo_Buergerstiftung-Aachen_hoch.jpg|80px|center|link=http://www.buergerstiftung-aachen.de|Bürgerstiftung Aachen]]<br />
|[[File:Aachen_Niersverband_Firmenlogo.jpg|159px|link=http://www.niersverband.de/|Niersverband]]<br />
|[[File:Aachen_Genscript_Logo.png|120px|link=http://www.genscript.com/|Genscript]]<br />
|[[File:Aachen_Eurofinsgenomics.png|97px|link=http://www.eurofinsgenomics.eu/|Eurofins Genomics]]<br />
|[[File:Aachen_Labomedic_Logo.jpg|128px|link=http://www.labomedic.de/|Labomedic]]<br />
|}<br />
<br />
{|cellpadding="18"<br />
|[[File:Aachen_bmbf.jpg|163px|link=http://www.bmbf.de/de/24140.php|BMBF]]<br />
|[[File:Aachen_idt_.png|109px|link=http://www.idt-biologika.de/|IDT]]<br />
|[[File:M2p_labs_logo.jpg|52px|link=http://www.m2p-labs.com/|m2p labs]]<br />
|[[File:Aachen_Roth_Logo.png|55px|link=http://www.carlroth.com/pages/index/COM/index.jsp?market=COM&lang=en-com|Carl Roth]]<br />
|[[File:Aachen_ProRWTH_logo.png|62px|link=http://www.prorwth.de/|pro RWTH]]<br />
|}<br />
{|cellpadding="13"<br />
|[[File:Aachen_Logo_iAMB.png|115px|link=http://www.iamb.rwth-aachen.de|Institute of Applied Microbiology - iAMB]]<br />
|[[File:Aachen_Logo_bio7.png|115px|link=http://www.molbiotech.rwth-aachen.de|Institute for Molecular Biotechnology]]<br />
|[[File:Aachen_Logo_HISynBio.png|123px|link=http://www.helmholtz.de/en/about_us/initiating_and_networking/assuring_excellence/synthetic_biology|Helmholtz Association - Initiative on Synthetic Biology]]<br />
|[[File:Aachen_Logo_ABBt.png|105px|link=http://www.biologie.rwth-aachen.de|Aachen Biology and Biotechnology - ABBt]]<br />
|[[File:Aachen_juelich.png|120px|link=http://www.fz-juelich.de/|Forschungszentrum Jülich]]<br />
|[[File:Aachen_FabLabAachenLogo.jpg|105px|link=http://hci.rwth-aachen.de/fablab|Fab Lab Aachen]]<br />
|[[File:Aachen_Schwaneberg_Group.png|75px|link=http://www.biotec.rwth-aachen.de|Schwaneberg Group]]<br />
|}<br />
<div><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:AachenTeam:Aachen2014-10-17T20:30:12Z<p>StefanReinhold: </p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
[[File:Aachen_Cellock_rand.png|left|250px]]<br />
<br />
<span style="font-size:300%;">Cellock Holmes - A Case of Identity</span><br />
<br />
'''Welcome to the Aachen 2014 iGEM Wiki!''' <br />
<br />
To navigate through our website, you can use the navigation bar at the top or the buttons below:<br />
<br />
<html><br />
<ul class="team-grid" style="width:840px;margin-right:0px;float:right"><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Project" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Project</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/55/Aachen_14-10-16_Project_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Interlab_Study" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Interlab Study</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/3/39/Aachen_Interlab_Cellocks.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/PolicyPractices" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Policy & Practices</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/b/b7/Aachen_14-10-16_PolicyPractices_main_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Collaborations" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Collaborations</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/8/81/Aachen_14-10-15_Collaborating_Cellocks_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Notebook" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Notebook</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/4/42/Aachen_14-10-14_NotebookiFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
<br />
<li style="width:242px;margin-left: 0px;margin-right: 38px;margin-bottom: 38px;margin-top: 0px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Attributions" style="color:black"><br />
<div class="team-item team-info" style="width:236px;height:236px;" ><br />
<div class="menukachel">Team</div><br />
<!-- <br/><br/><br />
<b>Principle of Operation</br><br />
<br/><br/><br />
click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/c/cf/Aachen_main_Team.png); norepeat scroll 0% 0% transparent; background-size:100%;width:236px;height:236px;"> </div></a><br />
</li><br />
</ul><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<!--<br />
This project would not have been possible without the generous help and advice from many great people and organizations. We thank all the partners listed below for their essential contributions and financial support that covered registration fees, travel costs, the organization of the meetup in September, laboratory materials and expenses for services and materials.<br />
--><br />
<div align="center"><br />
<br />
{{Team:Aachen/Figure|Team Aachen Teamfoto.png|width=800px}}<br />
<br />
{|cellpadding="12"<br />
|[[File:Logo_Buergerstiftung-Aachen_hoch.jpg|80px|center|link=http://www.buergerstiftung-aachen.de|Bürgerstiftung Aachen]]<br />
|[[File:Aachen_Niersverband_Firmenlogo.jpg|159px|link=http://www.niersverband.de/|Niersverband]]<br />
|[[File:Aachen_Genscript_Logo.png|120px|link=http://www.genscript.com/|Genscript]]<br />
|[[File:Aachen_Eurofinsgenomics.png|97px|link=http://www.eurofinsgenomics.eu/|Eurofins Genomics]]<br />
|[[File:Aachen_Labomedic_Logo.jpg|128px|link=http://www.labomedic.de/|Labomedic]]<br />
|}<br />
<br />
{|cellpadding="18"<br />
|[[File:Aachen_bmbf.jpg|163px|link=http://www.bmbf.de/de/24140.php|BMBF]]<br />
|[[File:Aachen_idt_.png|109px|link=http://www.idt-biologika.de/|IDT]]<br />
|[[File:M2p_labs_logo.jpg|52px|link=http://www.m2p-labs.com/|m2p labs]]<br />
|[[File:Aachen_Roth_Logo.png|55px|link=http://www.carlroth.com/pages/index/COM/index.jsp?market=COM&lang=en-com|Carl Roth]]<br />
|[[File:Aachen_ProRWTH_logo.png|62px|link=http://www.prorwth.de/|pro RWTH]]<br />
|}<br />
{|cellpadding="13"<br />
|[[File:Aachen_Logo_iAMB.png|115px|link=http://www.iamb.rwth-aachen.de|Institute of Applied Microbiology - iAMB]]<br />
|[[File:Aachen_Logo_bio7.png|115px|link=http://www.molbiotech.rwth-aachen.de|Institute for Molecular Biotechnology]]<br />
|[[File:Aachen_Logo_HISynBio.png|123px|link=http://www.helmholtz.de/en/about_us/initiating_and_networking/assuring_excellence/synthetic_biology|Helmholtz Association - Initiative on Synthetic Biology]]<br />
|[[File:Aachen_Logo_ABBt.png|105px|link=http://www.biologie.rwth-aachen.de|Aachen Biology and Biotechnology - ABBt]]<br />
|[[File:Aachen_juelich.png|120px|link=http://www.fz-juelich.de/|Forschungszentrum Jülich]]<br />
|[[File:Aachen_FabLabAachenLogo.jpg|105px|link=http://hci.rwth-aachen.de/fablab|Fab Lab Aachen]]<br />
|[[File:Aachen_Schwaneberg_Group.png|75px|link=http://www.biotec.rwth-aachen.de|Schwaneberg Group]]<br />
|}<br />
<div><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/File:Team_Aachen_Teamfoto.pngFile:Team Aachen Teamfoto.png2014-10-17T20:25:07Z<p>StefanReinhold: Picture for landing page</p>
<hr />
<div>Picture for landing page</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/PolicyPracticesTeam:Aachen/PolicyPractices2014-10-17T19:33:24Z<p>StefanReinhold: /* Economical View */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
= Policy & Practices =<br />
<br />
During the past summer, we not only refined the technical and biological sides of ''Cellock Holmes'' but also considered other aspects of our iGEM project such as '''social acceptance''', '''biosafety''' and '''economical relevance'''. Will society accept the technology we develop? How can we convince skeptics that synthetic biology is safe? Does our product have economical relevance and how can we best market what we built? What is the target group that might benefit from our devices, and can we make our developments available to not only the privileged population but to everybody in the world? At the meetup of the German iGEM teams in Munich earlier this summer, we also prepared a suggestion on how to handle '''intellectual proporty rights on BioBricks'''.<br />
<br />
These are only a few of the questions we discussed within our team. To read more about the different aspects of our Policy & Practices work, please click on a panel below: <br />
<br />
<center><br />
<html><ul class="team-grid" style="width:1040px"><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/PolicyPractices#ppsocialacceptance" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;" > <div class="menukachel" style="top: 25%;line-height: 1.5em;">Social Acceptance</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/3/35/Aachen_14-10-13_Love_Cell_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/PolicyPractices#ppbiosafety" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;" > <div class="menukachel" style="top: 25%;line-height: 1.5em;">Biosafety</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/11/Aachen_14-10-13_Pathogen_Cell_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/PolicyPractices#ppeconomics" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;" > <div class="menukachel" style="top: 25%;line-height: 1.5em;">Economical View</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/b/bd/Aachen_14-10-13_Money_Cell_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/PolicyPractices#ppbbaip" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;"> <div class="menukachel" style="top: 25%;line-height: 1.5em;">Intellectual Property on BioBricks</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/9/9b/Aachen_14-10-14_IP_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:186px;margin-left: 11px;margin-right: 11px;margin-bottom: 11px;margin-top: 11px;"><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/PolicyPractices#ppblog" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height: 180px; width: 180px;"> <div class="menukachel" style="top: 25%;line-height: 1.5em;">Blog</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/b/b8/Aachen_14-10-13_Blogger_Cell_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height: 180px; width: 180px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Love_Cell_iNB.png|right|150px]]<br />
<br />
== Spreading the Idea of Synthetic Biology ==<br />
<span class="anchor" id="ppsocialacceptance"></span><br />
<br />
How can we convince people that the technology we develop is safe to use and that the problems we tackle with our project concern everybody? Unfortunately, a lot people around the world are scared of genetically modified organisms and any application related to them. Though we believe that '''natural skepticism''' towards new and unproved technologies is not just good but especially desirable, the current fear some people encounter gene technology with is a bit disproportionate and might be counterproductive to technological and scientific advance in related fields.<br />
<br />
However, as reported, for example, in an [http://www.rundschau-online.de/magazin/gentechnik--risiko-oder-chance-,15184902,15929266.html article] published in a major local newspaper's magazine, Kölner Stadtanzeiger, the social acceptance of biotechnological products could be higher if people felt informed better and understood the underlying science. Following up on this, we thought about how we can inform people '''factually but in a comprehensible way''' about gene technology and synthetic biology. Before we talk about fancy devices in synthetic biology, how can we '''get down to the underlying issue''' of social rejection of gene technology in general? <br />
<br />
At the same time, '''young students''' interested in science and engineering are the most valuable future source of innovation. One day, they might be the researchers who develop the solutions to the most pressing issues of our world. For that reason, informing this group of people is of utmost importance and was therefore prioritized in our Policy & Practices work.<br />
<br />
Combining these two thoughts, we visited '''two schools''', the [https://2014.igem.org/Team:Aachen/Collaborations/Kaiser-Karls-Gymnasium Kaiser-Karls-Gymnasium] in Aachen and the [https://2014.igem.org/Team:Aachen/Collaborations/Neanderlab NEAnderLab] in Hilden, where we talked to students about synthetic biology and the iGEM competition, but also explained the scientific background and social aspects of our project. A delegation of our team also visited the [https://2014.igem.org/Team:Aachen/Collaborations/MakerFaire MakerFaire] in Hannover, a family-friendly '''exhibition for tinkerers''' of all kinds, to spread the idea of synthetic biology and to discuss our project with the public. When we organized the [https://2014.igem.org/Team:Aachen/Meetup Aachen iGEM Meetup 2014], we also made sure to include a '''public part''' where all teams who participated in our meetup had the opportunity to present their project to a general audience.<br />
<br />
To read more about our different public projects, please click on the respective logo below.<br />
<br />
<html><ul class="team-grid" style="width:1064px;"><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Collaborations/Kaiser-Karls-Gymnasium" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;" ><br />
<br/><br/><br />
<b> Kaiser-Karls-Gymnasium</b><br />
<br/><br/><br />
Teaching Module "Synthetic Biology" for High Schools<br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/f/f7/Aachen_14-10-10_Logo_Kaiser-Karls-Gymnasium.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Collaborations/Neanderlab" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;"><br />
<br/><br/><br />
<b> NEAnderLab </b><br />
<br/><br/><br />
In Cooperation with the Gymnasium an Neandertal<br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d8/Aachen_14-10-10_Logo_NEAnderLab.jpg); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Collaborations/MakerFaire" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;"><br />
<br/><br/><br />
<b> MakerFaire </b><br />
<br/><br/><br />
Visit of a DIY Exhibition<br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/53/Aachen_14-10-10_Logo_MakerFaire.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"><br />
<a href="https://2014.igem.org/Team:Aachen/Meetup" style="color:black"><br />
<div class="team-item team-info" style="width:214px;height:214px;"><br />
<br/><br/><br />
<b> Aachen iGEM Meetup 2014 </b><br />
<br/><br/><br />
Including Public Presentations<br />
<br/><br/><br />
<!-- click for more information --><br />
</div><br />
<div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/5/5b/Aachen_14-10-10_Meetup_Logo_white_background_iVA.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a><br />
</li><br />
<br />
</ul></html><br />
</center><br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Pathogen_Cell_iNB.png|right|150px]]<br />
<br />
== Biosafety ==<br />
<span class="anchor" id="ppbiosafety"></span><br />
<br />
Our iGEM team is committed to reflect all aspects of the entire project, including biosafety. From the beginning on, the team thoroughly discussed safety issues that could potentially arise with the implementation of ''Cellock Holmes''. The results of these discussions fundamentally influenced the design of [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''Watson''] and the choice of potential application fields. Read more about our safety considerations on our [https://2014.igem.org/Team:Aachen/Safety Safety] page.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Money_Cell_iNB.png|right|150px]]<br />
<br />
== Economical View ==<br />
<span class="anchor" id="ppeconomics"></span><br />
<br />
The economical considerations regarding our project were carried out according to the motto: <br />
<br />
'''Make the world a better place - Open access for scientific advance'''<br />
<br />
For both our [https://2014.igem.org/Team:Aachen/Project/Measurement_Device ''WatsOn''] and our [https://2014.igem.org/Team:Aachen/OD/F_device OD/F Device], we are following an economical strategy focused on the open source principle. Low cost and the use of easily available parts have '''heavily influenced the design choices''' made when developing our devices. You can find more information on our page [https://2014.igem.org/Team:Aachen/PolicyPractices/Economics Economical View].<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-14_IP_iNB.png|right|150px]]<br />
<br />
== Intellectual Property on BioBricks ==<br />
<span class="anchor" id="ppbbaip"></span><br />
<br />
During the meetup of the German iGEM teams from 23rd to 25th May also workshops took place in which amongst others we discussed the topic of bioethics. Moral questions were addressed, regarding the value of life and human influence on it, as well as questions dealing with the possible socioeconomic effects of synthetic biology.<br />
<br />
Especially the topic of an '''open source vs. patent''' controlled field accounted for a large part of the discussion. During the discussion one student brought up the point that the legal status of parts in registry remains unclear, and that there are parts where only upon a closer look it becomes clear that the rights are company–owned. Because the issue of '''uncertain legal status of parts''' in the registry persists, the German iGEM teams '''wrote a proposal''' on how to deal with intellectual property rights in the Registry of Standard Biological Parts.<br />
<br />
For for information on intellectual property on BioBricks, read the [https://2014.igem.org/Team:Aachen/PolicyPractices/BioBrickIntellectualProperty full proposal] the German iGEM teams composed.<br />
<br />
{{Team:Aachen/BlockSeparator}}<br />
<br />
[[File:Aachen_14-10-13_Blogger_Cell_iNB.png|right|150px]]<br />
<br />
== Blog ==<br />
<span class="anchor" id="ppblog"></span><br />
<br />
On our [https://2014.igem.org/Team:Aachen/Blog Blog] we post entries about recent news concerning our team's work and activities. We also write about general news from the field of synthetic biology, biotechnology and medicine. <br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/IndexTeam:Aachen/Notebook/Index2014-10-17T16:37:25Z<p>StefanReinhold: /* List of abbreviations */</p>
<hr />
<div>{{Team:Aachen/Header}}<br />
<br />
= List of abbreviations =<br />
<center><br />
List of commonly used abbreviations:<br />
{| class="wikitable"<br />
! Abbreviation!! Full term<br />
<br />
|-<br />
| ATP || Adenosinetriphosphate<br />
|-<br />
| BFP || Blue fluorescent protein<br />
|-<br />
| BSA || Bovine serum albumin<br />
|-<br />
| CAM|| Chloramphenicol<br />
|-<br />
| CFP|| Cyan fluorescent protein<br />
|-<br />
| CFU|| Colony forming units<br />
|-<br />
| CDS || Coding sequence<br />
|-<br />
| dNTP || Desoxynucleotidtriphosphate<br />
|-<br />
| EDTA || Ethylenediaminetetraacetic acid<br />
|-<br />
| DSMZ || German collection of microorganisms and cell cultures <br />
|-<br />
| DIY || Do it yourself<br />
|-<br />
| eYFP || Enhanced yellow flourescenct protein<br />
|-<br />
| F || Fluorescence <br />
|-<br />
| FRET || Förster resonance energy transfer<br />
|-<br />
| Gal-3 || Galactin-3 <br />
|-<br />
| GFP || Green fluorescent protein <br />
|-<br />
| GUI || Graphical user interface <br />
|-<br />
| His || Histidin<br />
|-<br />
| HM || Hartman Medium<br />
|-<br />
| HSL || Homoserine lactone<br />
|-<br />
| HSV || hue-saturation-value<br />
|-<br />
| HF || High frequency<br />
|-<br />
| IPTG || Isopropyl β-D-1-thiogalactopyranoside <br />
|-<br />
| LPS || Lipopolysaccharide <br />
|-<br />
| MRSA || Multi resistant ''Staphylococcus aureus'' <br />
|-<br />
| NIAID || National Institute of Allergy and Infectious Diseases<br />
|-<br />
| NTA || Nitrilotriacetic acid<br />
|-<br />
| OD || Optical density <br />
|-<br />
| 3-oxo-C{{sub|12}} HSL || 3-Oxo-dodecanoyl homoserine lactone<br />
|-<br />
| PBS || Phosphate buffered saline<br />
|-<br />
| PCR || Polymerase chain reaction<br />
|-<br />
| RBS || Ribosome binding site <br />
|-<br />
| REACh || Resonance Energy-Accepting Chromoprotein<br />
|-<br />
| RFP || Red fluorescent protein <br />
|-<br />
| SDS-PAGE || Sodium dodecyl sulfate polyacrylamide gel electrophoresis<br />
|-<br />
| SRM || Statistical region merging <br />
|-<br />
| TEV || Tobacco etch virus <br />
|-<br />
| WHO || World health organisation<br />
|-<br />
| || <br />
<br />
|}<br />
</center><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methodsTeam:Aachen/Notebook/Protocols/Analytical methods2014-10-17T16:24:43Z<p>StefanReinhold: /* Measurement of Optical Density */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= Analytical Methods =<br />
To determine certain properties of proteins or contructed DNA fragments such as BioBricks, we have used different analytical methods. All used methods are listed below. <br />
== Agarose Gel Electrophoresis==<br />
The Agarose Gel Electrophoresis is used for separation of DNA or RNA fragments (e.g. after a PCR).<br />
<br />
# take 5&nbsp;µl of the PCR product<br />
# mix with 1&nbsp;µl loading dye<br />
# apply onto agarose gel together with a marker<br />
# run at 120&nbsp;mA for 40&nbsp;minutes for a full gel<br />
<br />
== Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) ==<br />
The SDS-PAGE was used to determine certain features of the cells' proteom such as the strength of expression of a desired protein.<br />
<br />
'''Cell Preparation'''<br />
* lysis of cell pellet in lysis buffer<br />
* centrifuge for 15&nbsp;min at 13.000 rpm<br />
* mix the supernatant with 2x lammli buffer with β-mercaptoethanol<br />
* denatured for 5&nbsp;min at 95°C<br />
* sample to the gel <br />
<br />
For some SDS-PAGEs, we used BioRad ready made gels.<br />
<br />
Self-made SDS gels were made as described below:<br />
<br />
'''1.5x Buffer'''<br />
* 1.5&nbsp;M Tris-Cl pH = 8.8<br />
* in 1&nbsp;L is 40&nbsp;ml 10% SDS<br />
<br />
'''Gels'''<br />
<center><br />
{| class="wikitable" style="text-align: right;"<br />
! <br />
!! style="border-left: 2px solid #404040;" colspan="3"|0.75&nbsp;mm 12% RUNNING Gel <br />
!! style="border-left: 2px solid #404040; background-color:#8ebae5;" colspan="3"|1&nbsp;mm 4% STACKING Gel<br />
|-<br />
| <br />
| style="border-left: 2px solid #404040;"| '''1x''' || '''2x''' || '''4x''' <br />
| style="border-left: 2px solid #404040;"| '''1x''' || '''2x''' || '''4x'''<br />
|-<br />
| '''H{{sub|2}}O''' <br />
| style="border-left: 2px solid #404040;"| 1.65&nbsp;ml || 3.3&nbsp;ml || 6.6&nbsp;ml <br />
| style="border-left: 2px solid #404040;"| 1.5&nbsp;ml || 3&nbsp;ml || 6&nbsp;ml<br />
|-<br />
| '''1.5x Gel Buffer''' <br />
| style="border-left: 2px solid #404040;"| 1.3&nbsp;ml || 2.6&nbsp;ml || 5.2&nbsp;ml <br />
| style="border-left: 2px solid #404040;"| 0.65&nbsp;ml || 1.3&nbsp;ml || 2.6&nbsp;ml<br />
|-<br />
| '''30% Acrylamide (37.5:1)''' <br />
| style="border-left: 2px solid #404040;"| 2&nbsp;ml || 4&nbsp;ml || 8&nbsp;ml<br />
| style="border-left: 2px solid #404040;"| 0.325&nbsp;ml || 0.65&nbsp;ml || 1.3&nbsp;ml<br />
|-<br />
| '''10% APS''' <br />
| style="border-left: 2px solid #404040;"| 50&nbsp;µl || 100&nbsp;µl || 200&nbsp;µl <br />
| style="border-left: 2px solid #404040;"| 25&nbsp;µl || 50&nbsp;µl || 100&nbsp;µl<br />
|-<br />
| '''TEMED''' <br />
| style="border-left: 2px solid #404040;"| 10&nbsp;µl || 20&nbsp;µl || 40&nbsp;µl <br />
| style="border-left: 2px solid #404040;"| 5&nbsp;µl || 10&nbsp;µl || 20&nbsp;µl<br />
|-<br />
|}<br />
</center><br />
<br />
'''Run Gel'''<br />
* apply the prepared samples together with a protein marker on the gel<br />
* run the gel for 10&nbsp;min at 60&nbsp;V and after that for ca. 60&nbsp;min at 120&nbsp;V<br />
<br />
== Bradford Assay ==<br />
This assay is used for the determination of the protein concentration in a sample. <br />
* mix the Bradford solution with ddH{{sub|2}}O in a ratio of 1:4<br />
* prepare about 10 solutions 1&nbsp;ml, each between 125–1,000&nbsp;μg/ml BSA for a standard curve<br />
* use pure Bradford solution as a blank<br />
* mix equal amounts of BSA and samples with unknown concentrations (1-3&nbsp;µl) with 1&nbsp;ml of 1x&nbsp;Bradford solution, vortex and incubate for 5&nbsp;min. at room temperature<br />
* measure the OD with a spectrophotometer at 595&nbsp;nm<br />
* build a standard curve within the linear range of the BSA data (concentration against OD) <br />
* derive the concentration of your samples from the calibration curve<br />
<br />
== Measurement of Fluorescence ==<br />
The measurement of fluorescence was performed using the Synergy Mx (BioTek) microplate reader and the Gen5 software.<br />
<br />
* volume of sample in each well: 100&nbsp;µl<br />
* measure GFP fluorescence at an excitation wavelength of 496&nbsp;±&nbsp;9&nbsp;nm and an emission wavelength at 516&nbsp;±&nbsp;9&nbsp;nm<br />
<br />
== Measurement of Optical Density ==<br />
Depending on the number of samples, two different devices were used for measurement of OD, the Unico Spectrophotometer 1201 (Fisher Bioblock Scientific) and the Synergy Mx (BioTek) microplate reader.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">2D Detection of<br/>IPTG & HSL</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/22/Aachen_14-10-14_button_chip_manufacturing_ipo.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Culture_medium_and_conditions" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Culture Media</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/10/Aachen_14-10-13_Yellow_Flask_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Molecular_biological_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Molecular biological methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/75/Aachen_14-10-14_Eppi_with_green_cells_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Protocols/Analytical_methods" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 10%; font-size: 14px;">Analytical methods</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4d/Aachen_14-10-14_Lense_panel_iNB.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/IndexTeam:Aachen/Notebook/Index2014-10-17T16:24:22Z<p>StefanReinhold: /* List of abbreviations */</p>
<hr />
<div>{{Team:Aachen/Header}}<br />
<br />
= List of abbreviations =<br />
<center><br />
List of commonly used abbreviations:<br />
{| class="wikitable"<br />
! Abbreviation!! Full term<br />
<br />
|-<br />
| ATP || Adenosinetriphosphate<br />
|-<br />
| BFP || Blue fluorescent protein<br />
|-<br />
| BSA || Bovine serum albumin<br />
|-<br />
| CAM|| Chloramphenicol<br />
|-<br />
| CFP|| Cyan fluorescent protein<br />
|-<br />
| CFU|| Colony forming units<br />
|-<br />
| CDS || Coding sequence<br />
|-<br />
| dNTP || Desoxynucleotidtriphosphate<br />
|-<br />
| EDTA || Ethylenediaminetetraacetic acid<br />
|-<br />
| DSMZ || German collection of microorganisms and cell cultures <br />
|-<br />
| DIY || Do it yourself<br />
|-<br />
| eYFP || Enhanced yellow flourescenct protein<br />
|-<br />
| F || Fluorescence <br />
|-<br />
| FRET || Förster resonance energy transfer<br />
|-<br />
| Gal-3 || Galactin-3 <br />
|-<br />
| GFP || Green fluorescent protein <br />
|-<br />
| GUI || Graphical user interface <br />
|-<br />
| His || Histidin<br />
|-<br />
| HM || Hartman Medium<br />
|-<br />
| HSL || Homoserine lactone<br />
|-<br />
| HF || High frequency<br />
|-<br />
| IPTG || Isopropyl β-D-1-thiogalactopyranoside <br />
|-<br />
| LPS || Lipopolysaccharide <br />
|-<br />
| MRSA || Multi resistant ''Staphylococcus aureus'' <br />
|-<br />
| NIAID || National Institute of Allergy and Infectious Diseases<br />
|-<br />
| NTA || Nitrilotriacetic acid<br />
|-<br />
| OD || Optical density <br />
|-<br />
| 3-oxo-C{{sub|12}} HSL || 3-Oxo-dodecanoyl homoserine lactone<br />
|-<br />
| PCR || Polymerase chain reaction<br />
|-<br />
| RBS || Ribosome binding site <br />
|-<br />
| REACh || Resonance Energy-Accepting Chromoprotein<br />
|-<br />
| RFP || Red fluorescent protein <br />
|-<br />
| SDS-PAGE || Sodium dodecyl sulfate polyacrylamide gel electrophoresis<br />
|-<br />
| SRM || Super resolution microscopy <br />
|-<br />
| TEV || Tobacco etch virus <br />
|-<br />
| WHO || World health organisation<br />
|-<br />
| || <br />
<br />
|}<br />
</center><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/IndexTeam:Aachen/Notebook/Index2014-10-17T16:22:50Z<p>StefanReinhold: /* List of abbreviations */</p>
<hr />
<div>{{Team:Aachen/Header}}<br />
<br />
= List of abbreviations =<br />
<center><br />
List of commonly used abbreviations:<br />
{| class="wikitable"<br />
! Abbreviation!! Full term<br />
<br />
|-<br />
| ATP|| Adenosinetriphosphate<br />
|-<br />
| BFP|| Blue fluorescent protein<br />
|-<br />
| CAM|| Chloramphenicol<br />
|-<br />
| CFP|| Cyan fluorescent protein<br />
|-<br />
| CFU|| Colony forming units<br />
|-<br />
| CDS || Coding sequence<br />
|-<br />
| dNTP || Desoxynucleotidtriphosphate<br />
|-<br />
| EDTA || Ethylenediaminetetraacetic acid<br />
|-<br />
| DSMZ || German collection of microorganisms and cell cultures <br />
|-<br />
| DIY || Do it yourself<br />
|-<br />
| eYFP || Enhanced yellow flourescenct protein<br />
|-<br />
| F || Fluorescence <br />
|-<br />
| FRET || Förster resonance energy transfer<br />
|-<br />
| Gal-3 || Galactin-3 <br />
|-<br />
| GFP || Green fluorescent protein <br />
|-<br />
| GUI || Graphical user interface <br />
|-<br />
| His || Histidin<br />
|-<br />
| HM || Hartman Medium<br />
|-<br />
| HSL || Homoserine lactone<br />
|-<br />
| HF || High frequency<br />
|-<br />
| IPTG || Isopropyl β-D-1-thiogalactopyranoside <br />
|-<br />
| LPS || Lipopolysaccharide <br />
|-<br />
| MRSA || Multi resistant ''Staphylococcus aureus'' <br />
|-<br />
| NIAID || National Institute of Allergy and Infectious Diseases<br />
|-<br />
| NTA || Nitrilotriacetic acid<br />
|-<br />
| OD || Optical density <br />
|-<br />
| 3-oxo-C{{sub|12}} HSL || 3-Oxo-dodecanoyl homoserine lactone<br />
|-<br />
| PCR || Polymerase chain reaction<br />
|-<br />
| RBS || Ribosome binding site <br />
|-<br />
| REACh || Resonance Energy-Accepting Chromoprotein<br />
|-<br />
| RFP || Red fluorescent protein <br />
|-<br />
| SDS-PAGE || Sodium dodecyl sulfate polyacrylamide gel electrophoresis<br />
|-<br />
| SRM || Super resolution microscopy <br />
|-<br />
| TEV || Tobacco etch virus <br />
|-<br />
| WHO || World health organisation<br />
|-<br />
| || <br />
<br />
|}<br />
</center><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/IndexTeam:Aachen/Notebook/Index2014-10-17T16:21:44Z<p>StefanReinhold: /* List of abbreviations */</p>
<hr />
<div>{{Team:Aachen/Header}}<br />
<br />
= List of abbreviations =<br />
<center><br />
List of commonly used abbreviations:<br />
{| class="wikitable"<br />
! Abbreviation!! Full term<br />
<br />
|-<br />
| BFP|| Blue fluorescent protein<br />
|-<br />
| CAM|| Chloramphenicol<br />
|-<br />
| CFP|| Cyan fluorescent protein<br />
|-<br />
| CFU|| Colony forming units<br />
|-<br />
| CDS || Coding sequence<br />
|-<br />
| dNTP || Desoxynucleotidtriphosphate<br />
|-<br />
| EDTA || Ethylenediaminetetraacetic acid<br />
|-<br />
| DSMZ || German collection of microorganisms and cell cultures <br />
|-<br />
| DIY || Do it yourself<br />
|-<br />
| eYFP || Enhanced yellow flourescenct protein<br />
|-<br />
| F || Fluorescence <br />
|-<br />
| FRET || Förster resonance energy transfer<br />
|-<br />
| Gal-3 || Galactin-3 <br />
|-<br />
| GFP || Green fluorescent protein <br />
|-<br />
| GUI || Graphical user interface <br />
|-<br />
| His || Histidin<br />
|-<br />
| HM || Hartman Medium<br />
|-<br />
| HSL || Homoserine lactone<br />
|-<br />
| HF || High frequency<br />
|-<br />
| IPTG || Isopropyl β-D-1-thiogalactopyranoside <br />
|-<br />
| LPS || Lipopolysaccharide <br />
|-<br />
| MRSA || Multi resistant ''Staphylococcus aureus'' <br />
|-<br />
| NIAID || National Institute of Allergy and Infectious Diseases<br />
|-<br />
| NTA || Nitrilotriacetic acid<br />
|-<br />
| OD || Optical density <br />
|-<br />
| 3-oxo-C{{sub|12}} HSL || 3-Oxo-dodecanoyl homoserine lactone<br />
|-<br />
| PCR || Polymerase chain reaction<br />
|-<br />
| RBS || Ribosome binding site <br />
|-<br />
| REACh || Resonance Energy-Accepting Chromoprotein<br />
|-<br />
| RFP || Red fluorescent protein <br />
|-<br />
| SDS-PAGE || Sodium dodecyl sulfate polyacrylamide gel electrophoresis<br />
|-<br />
| SRM || Super resolution microscopy <br />
|-<br />
| TEV || Tobacco etch virus <br />
|-<br />
| WHO || World health organisation<br />
|-<br />
| || <br />
<br />
|}<br />
</center><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/OctoberTeam:Aachen/Notebook/Wetlab/October2014-10-17T16:19:28Z<p>StefanReinhold: /* 9th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= October =<br />
== 1st ==<br />
* Prepartations for sensor-chip production the following day (2014-10-02) was done accoringly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 18:30 we prepared over-night cultures from K1319042, B0015 and K131026 by inoculating 250&nbsp;ml Erlenmeyer flasks each containing 50&nbsp;ml LB medium . The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
== 2nd ==<br />
<br />
* At 8:30, we did a plasmid prep of dublicate samples of K1319011 clone #1 and #6. We measured the DNA yield, and the higher concentrated sample of clone #1 and #6, respectively, were sent in for sequencing.<br />
* made precultures and a master plate of 6 colonies of K3139008 in psB1C3 in NEB10β cells that had been plated at 5:30 this morning.<br />
<br />
* Production of sensor-chips was done accordingly to [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Briefly:<br />
** At 10:00 we prepared 150&nbsp;ml 1.5%&nbsp;(w/v) LB+agarose solution. The LB+agarose solution was autoclaved and subsequently tempered to 45°C. Precultures (50&nbsp;ml each) of K1319042, B0015 and K131026 were spun down at 3000&nbsp;g for 10&nbsp;min at 21°C and re-suspended in 1&nbsp;ml pretempered (21°C) LB medium. The re-suspended cultures were mixed with 50&nbsp;ml LB+agarose and poured onto three sensor-chip-templates (one template per culture). Sensor chips were cut out from the template and incubated at 37°C for 1&nbsp;h.<br />
** K1319042 and B0015 were induced with 0.2&nbsp;µl IPTG (100&nbsp;mM) subsequently to incubation and K131026 was induced with 0.2&nbsp;µl homoserinlacton stock solution (500&nbsp;µg/ml) 30 minutes after induction of the K1319042 and B0015. The induced sensor-chips were read out every 30 minutes for 180 minutes in total. An additional readout was conducted 285 minutes post induction. The readout was done at 450&nbsp;nm and 480&nbsp;nm wavelength. <br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_10_2014_B0015_serie.png|title=Sensor Chips with B0015 in NEB in LB (480&nbsp;nm): first try with final device|subtitle=Sensor chips with B0015 in NEB in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 100&nbsp;mM IPTG B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
* Gibson assembly of K1319008<br />
** template Backbone: I746909, Insert: K1319004<br />
** transformation in ''E.coli'' NEB10β and BL21<br />
<br />
* PCRs for Gibson assembly of K1319010 and K1319015<br />
** template Backbone: I20260 for K1319010 and K1319015<br />
** template Insert: K1319000 for K1319010 and K1319015 (but different primer)<br />
<br />
* made precultures of K1319013 and K1319014 in pSB3K3<br />
<br />
* K1319011 in pSB1C3 prepped for sequencing<br />
<br />
* Gibson assembly of K1319017 (PCRs, Gibson assembly, restriction with DnpI, transformation into NEB10β)<br />
** template Backbone: B0015<br />
** template Insert 1: LasI synthesized gene<br />
** template Insert 2: K660004<br />
<br />
==3rd==<br />
<br />
* made master plates of K1319008 in NEB10β and BL21 and precultures<br />
<br />
* check PCR for K1319008 to validate the Gibson assembly check for potential I746909 residues<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_K1319008_insert_colonyPCR.png|title=Check PCR K1319008|subtitle=K1319008 was checked with the Primers K1319008_Check_R and I746909_Check_R (both with G00100 Alternative as froward primer) for presence of K1319008 or I746909. All tested clones were positive for K1319008 and negative for I746909.|width=800px}}<br />
</center><br />
<br />
* did a plasmid prep and made cryo stocks of K1319008 in NEB (clones #1, #2, #3) and BL21 (clones #1, #2)<br />
<br />
* plasmid prep of K1319013 and K1319014 in pSB3K3<br />
<br />
* Gibson assembly for K1319010 and transformation into NEB10β<br />
<br />
* made cryo stocks of K1319011 clone #6<br />
<br />
* restriction of K1319012, k1319013 and K1319014 with EcoRI and PstI. Restriction of linearized plasmid backbone pSB1C3 with EcoRI and PstI. Ligation of K1319012, K1319013 and K1319014 into pSB1C3. Transformation into NEB10β. <br />
<br />
* Gibson assembly of K1319015 and transformation into NEB10β<br />
<br />
* colony PCR of K1319017<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-03_colony_PCR_K1319017.png|title=colony PCR K1319017|subtitle=K1319017 was checked with a colony PCR for the right insert length. Clones #2 and #4 were correct and used forthwith.|width=800px}}<br />
</center><br />
<br />
* did plasmid prep and cryo of clones #2 and #4 of K1319017<br />
<br />
* new plasmid backbone of pSB1C3 was made using the [http://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones|standard protocol].<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and K1319013 into BL21 (two plasmids in one cell).<br />
<br />
* transformation of K1319008 clone #1 (from BL21) and k1319014 into BL21 (two plasmids in one cell).<br />
<br />
* OD measurements of three biological triplicates from ''E. coli'' BW21 113, ''P. putida'' and ''S. cerevisiae''. Measurement as an analytic triplicate in the spectrophotometer (absorbance and transmission) and our own OD/F device.<br />
<br />
* Gibson assembly of K1319021 <br />
** template Backbone: K1319008<br />
** template Insert: LasI gene synthesis<br />
<br />
* At 19:00 we measured OD (our OD-device), absorption (spectrophotometer) and transmission (spectrophotometer) for 19 diltuions in the range of 2.5-100% from yeast (''Saccharomyces cerevisiae'') and ''P. putida'' liquid cultures. Measurements were conducted in biological as well as technical triplicates. Aim of this experiment was the comparison of our OD-device to commonly used devices in terms of OD determination.<br />
<br />
* Prepartations for sensor-chip production the following day (2014-10-04) were done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 22:00 we prepared over-night cultures from B0015, K1319017 and K131026 by inoculating 250&nbsp;mL Erlenmeyer flasks each containing 50&nbsp;mL LB medium for sensor-chip manufacturing the next day. The flasks were incubated for ~12 hours at 37°C on a shaker.<br />
<br />
* Our BioBrick K1319021 enables expression of the TEV protease inducible by the autoinducers of ''Pseumomonas aeruginosa''. In order to construct this BioBrick, a Gibson assembly of K1319008 (IPTG-inducible expression of TEV protease) and the synthezised composite HSL-promotor J23101.B0032.C0079.B0015.J64010.B0034 activated by the respective autoinducers (HomoSerineLactones) was perfomed. Prior to this, we used two PCRs to linearize pSB1C3-K1319008, serving as backbone for Gibson assembly, and cutting out J23101.B0032.C0079.B0015.J64010.B0034 as well as adding adequate overlapping sequences.<br />
<br />
<center><br />
{| class="wikitable"<br />
| <div style="text-align: center;">'''PCRs'''</div> || colspan="2" | <div style="text-align: center;">'''K1319008'''</div> || colspan="2"| <div style="text-align: center;">'''HSL-Promotor'''</div> ||<br />
|-<br />
! step !! time [mm:ss] !! temperature [°C] !! time [mm:ss] !! temperature [°C] !! <br />
|-<br />
| Initial denaturation || 05:00 || 98 || 05:00 || 98 ||<br />
|-<br />
| '''Denaturation''' || '''00:30''' || '''98''' || '''00:30''' || '''98''' || rowspan="3" | '''30 cycles'''<br />
|-<br />
| '''Annealing''' || '''00:30''' || '''55''' || '''00:30''' || '''51''' <br />
|-<br />
| '''Elongation''' || '''01:35''' || '''72''' || '''00:37''' || '''72'''<br />
|-<br />
| Final elongation || 05:00 || 72 || 05:00 || 72 ||<br />
|}<br />
</center><br />
<br />
==4th ==<br />
<br />
* colony PCR of K1319015 and Check PCR of K1319010<br />
** K1319010: clone #1 was positive<br />
** K1319015: in all clones the inserts were too short. <br />
<br />
* new digestion of Gibson master mix of K1319015 with DnpI<br />
<br />
* transformation of new Gibson master mix into NEB 10β<br />
<br />
* restriction of K1319010, K1319012, K1319013 and K1319014 (all in pSB3K3) with EcoRI and PstI, cutting of pSB1C3 with EcoRI and PstI, and then ligation.<br />
<br />
* made master plates and precultures of the transformations of K1319008 in BL21, K1319013 + K1319008 in BL21 and K1319014 + K1319008 in BL21<br />
<br />
* colony PCR of the master plates with the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008<br />
<br />
* sent the first BioBricks to the iGEM headquarters:<br />
** K1319000: RFC25 version of E0030<br />
** K1319001: REACh1 (Quencher)<br />
** K1319002: REACh2 (Quencher)<br />
** K1319003: Galectin 3<br />
** K1319004: TEV protease<br />
** K1319008: IPTG inducible expression of TEV protease<br />
** K1319011: J23101.B0032.K1319001.B0015<br />
** K1319017: HSL inducible expression of iLOV<br />
** K1319020: B0034.K1319009.B0015 in pSBX1A3<br />
** K1319042: IPTG inducible expression of iLOV<br />
<br />
* shake flask experiments with K1319008 (clone #1), K1319013 + K1319008 (clone #2) and K1319014 + K1319008 (clone #2) in LB (2 flasks each); inoculation with 50&nbsp;µL preculture and inducing with iPTG at OD of 1.5.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]: <br />
** At 13:30 we prepared sensor chips from pre-cultures of B0015, K1319017 and K131026.<br />
** Subsequently to 1&nbsp;h icubation at 37°C B0015, K1319017 and K131026 were induced with 0.2&nbsp;µL homoserinlacton stock solution (500&nbsp;µg/ml). The induced sensor-chips were read out every 30 minutes for 240 minutes in total. Readout was conducted at 450&nbsp;nm and 480&nbsp;nm wavelength. An additional readout was conducted after 12 hours.<br />
<br />
* At 17:00 we prepared 4 liquid cultures from the K1319010_pSB3K3 master plate (clone#1) in 5&nbsp;mL LB-medium, each. The liquid cultures were prepared in order to create cryo stocks from K1319010-pSB3K3. Kanamycin was added to the liquid cultures as antibiotic at an concentration of 1&nbsp;µL/mL.<br />
<br />
* At 18:00 we prepared a master plate (LB+C) and corresonding liquid cultures from 6 clones of ''E.coli'' NEB10B k1319021-psB1C3. Liquid cultures and master plate were incubated at 37°C.<br />
<br />
* At 23:30 we prepared liquid cultures from K1319015-pSB3K3 clones #7, #8 and #9 in 5&nbsp;mL LB-medium. Kanamycin was used as antibiotic and the cultures were incubated at 37°C. Purpose of the cultures was cryo stock preparation and plasmid prep.<br />
<br />
==5th ==<br />
<br />
* At 11:45 we prepared cryo stocks from NEB K1319010-pSB3k3 #1, K1319015-pSB3K3 #7, K1319015-pSB3K3 #8 and K1319015-pSB3K3 #9 by mixing 750&nbsp;µl lquid culture with 750&nbsp;µl 50%&nbsp;(v/v) Glycerol-solution in 2&nbsp;ml eppis.<br />
**Plasmid prep was also done for the cultures mentioned above.<br />
<br />
* At 12:00 we prepared liquid cultures from K139010-pSB3K3, K139011-pSB3K3, K139012-pSB3K3, K139013-pSB3K3, K139014-pSB3K3, K139015-pSB3K3 in 5&nbsp;ml LB-medium each. Kanamycin was used as antibiotic. Purpose for the cultures was the characterization of constituitive expression and an additional plasmid prep of K139013-pSB3K3 and K139014-pSB3K3.<br />
<br />
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]:<br />
** At 13:00 we prepared sensor chips from shake flask pre-cultures of BL21 pSB1C3-K1319008+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015.<br />
**Subsequently to 1&nbsp;h incubation at 37°C, BL21 pSB1C3-K131900+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015 were induced with 0.2&nbsp;µL IPTG. The induced sensor-chips were read out every 30&nbsp;minutes for 360&nbsp;minutes in total. K1319013 was induced earlier and thus measurements were taken for 450&nbsp;min in total. Readout was conducted at 480&nbsp;nm wavelength. An additional readout was conducted next day at 11:00.<br />
<br />
* At 15:30 we prepared liquid cultures for the characterization of ITPG inducible expression:<br />
** I746909 in pSB1C3<br />
** I20260 in pSB3K3<br />
** K731520 in pSB1C3<br />
** K1319008 in pSB1C3<br />
** K1319013 in pSB3K3<br />
** K1319014 in pSB3K3<br />
** B0015 in pSB1C3<br />
** K1319013 in pSB3K3 + K1319008 in pSB1C3<br />
** B0015 in pSB1C3<br />
** K1319014 in pSB3K3 + K1319008 in pSB1C3<br />
<br />
* prepared a colony PCR from K1319014-pSB1C3 clones #3, #4, #5 and#6. H20 and K1319014-pSB3K3 were used as controls.<br />
<br />
* At 22:20 we prepared 1&nbsp;L LB+C plates (2.5&nbsp;g NaCl, 10&nbsp;g Agar, 2.5&nbsp;g yeast extract and 5&nbsp;g Trypton). N-Z-amine (peptone from casein) was used instead of tryptone, because the tryptone stock was depleted.<br />
<br />
* prepped multiple cultures K1319013 in pSB3K3 and K1319014 in pSB3K3. Now we have sufficient amount of both plasmids.<br />
<br />
* Plates were made for the following constructs:<br />
<br />
<center><br />
{| class="wikitable"<br />
! part in vector !! strain !! resistance<br />
|-<br />
| K1319008 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319010 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319011 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319012 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319013 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319014 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319015 in pSB3K3 || NEB10β || K<br />
|-<br />
| K1319017 in pSB1C3 || NEB10β || C<br />
|-<br />
| K1319042 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K1319008 in pSB1C3 + K1319013 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| K1319008 in pSB1C3 + K1319014 in pSB3K3 || BL21(DE3) || C+K<br />
|-<br />
| I746909 in pSB1C3 || BL21(DE3) || C<br />
|-<br />
| K731520 in pSB1C3 || DH5α || C<br />
|-<br />
| I20260 in pSB3K3 || NEB10β || K<br />
|-<br />
| B0015 in pSB1C3 || NEB10β || C<br />
|}<br />
</center><br />
<br />
* To determine whether the conducted Gibson assembly of K1319021 and subsequent transformation into ''E. coli'' NEB 10β were successful, a colony PCR on these cells was performed. Primers binding to each of the templates used for Gibson assembly were used: LasI_Insert_F binding in J23101.B0032.C0079.B0015.J64010.B0034 and K1319004_Check_R binding in pSB1C3-K1319008. Bands at 1341&nbsp;bp would indicate the successful construction and transformation of K1319021. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-05_Check_PCR_on_K1319021.png|title=Check PCR on K1319021|subtitle=(Homoserinlactone-inducible expression of the TEV protease)|width=800px}}<br />
</center><br />
<br />
Since Bands >2000&nbsp;bp were observed, another PCR was performed by using primers binding upstream and downstream of the insert in pSB1C3: G00100_alternative and G00101_alternative. Here, bands with a length of 2210&nbsp;bp would verify the correct length of K1319021.<br />
<br />
==6th ==<br />
<br />
* made a SDS page of K1319010-15 and J23101.E0240<br />
<br />
* made a master plate at 15:30 containing two clones of K1319015 plate from yesterday.<br />
<br />
* At 22:00 we inocculated two 500&nbsp;ml flasks containing 50 ml&nbsp;LB-medium with 1&nbsp;ml pre-culture of K1319017, which had been prepared from a master-plate earlier this day. Chloramphinicol was used as antibiotic. The flasks were incubated at 37°C. One culture (50&nbsp;ml) was induced with 25&nbsp;µg homoserinlacton after an OD of 0.6 was reached and the induced culture as well as the control were used for fluorescence characterization. Fluorescene and OD were monitored once per hour. The OD of the induced culture stagnated at ~0.7 while the non induced culture grew further.<br />
<br />
== 7th ==<br />
<br />
* Two conducted colony PCRs confirmed that our double plasmid systems of K1319008 and K13190013/14 contain nothing but the desired BioBricks, which were used as positive controls. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-10-07_colonyPCR_on_characterization_constructs.png|title=colony PCR cells harboring the double plasmid system pSB3K3-K1319008 pSB1C3-K1319013/14|subtitle=(IPTG-inducible expression of the TEV protease and constitutive expression of our GFP-Quencher-Constructs)|width=800px}}<br />
</center><br />
<br />
*Characterisation of the biobrick K1319008 together with the biobricks K1319014 and K1319013.<br />
<br />
*Therefore the following biobricks were cultivated in biological triplicates:<br />
<br />
<center><br />
{|class="wikitable"<br />
!biobrick !! strain !! plasmid !! induced with iPTG<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || no<br />
|-<br />
|K1319008 || BL21 || pSB1C3 || yes<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319013 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || no<br />
|-<br />
|K1319014 + K1319008 || BL21 || pSB3K3 + pSB1C3 || yes<br />
|-<br />
|K731520 || BL21 || pSB1C3 || no<br />
|- <br />
|K731520 || BL21 || pSB1C3 || yes<br />
|-<br />
|I746909 || BL21 || pSB1C3 || no<br />
|-<br />
|I746909 || BL21 || pSB1C3 || yes<br />
|-<br />
|B0015 || NEB 10 Beta || pSB1C3 || no<br />
|-<br />
|I20260 || BL21 || pSB3K3 || no<br />
|-<br />
|}<br />
</center><br />
<br />
* overnight culture of K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 for chip production ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]).<br />
<br />
== 8th ==<br />
* We prepared sensor-chips with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and B0015 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Images were made every 30 min with our own device.<br />
* made precultures with K1319013 + K1319008 # 1 and # 2, K1319014 + K1319008 # 1 and # 2 and K731520. <br />
* cutting K1319013, K1319014 ans a pSB1A3 vector backbone with EcoRI and SpeI and K1319008 with XbaI and PstI<br />
* Ligation of K1319013/K1319014 with K1319008 and then ligation into pSB1A3<br />
*Transformation of the ligation product into BL21<br />
<br />
== 9th ==<br />
* SOC medium was added to the transformation before the heat shock had occurred by mistake.<br />
* At 02:00 the precultures for the characterization experiment were transferred to 250&nbsp;ml shake flasks (3&nbsp;ml culture + 10&nbsp;ml LB+antibiotics).<br />
* new transformation of the ligation product was conducted into BL21 and DH5α<br />
* At 23:00 a 500&nbsp;ml flask containing 50&nbsp;ml LB-medium was inocculated from a K131026 BL21 cryo stock for sensor-chip manufacturing the following day.<br />
<br />
== 10th ==<br />
* made master plates of the new transformation of the ligation product and overnight cultures<br />
* made chips with K131026 in BL21. Images were taken automaticly every 5 min with our own device<br />
<br />
* For sensor-chip manufacturing the following day, we inocculated 500&nbsp;ml flasks containing 50&nbsp;ml LB-medium with NEB10β K1319017.pSB1C3 clone #2 and with BL21 K1319042.pSB1C3 clone 2# accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. Inoccultion was done at 21:35.<br />
*In preparation for an additional main charcterization experiment we inocculated 200 ml flasks or 300 ml flasks as available containing 25 ml LB-medium with seven of our own constructs listd below. Inoccuaation was done at 22:00.<br />
**K1319010<br />
**K1319011<br />
**B0015<br />
**I20260<br />
**K1319015<br />
**K1319014<br />
**K1319012<br />
**k1319013<br />
<br />
==11th==<br />
<br />
*At 21:00 we inocculted two 500 ml flasks containing 50 ml LB-medium with BL21 K1319042.pSB1C3 (from plate) and DH5α K1319026.pSB1C3 (from cryo), respectively. Chloramphenicol was used as antibiotik. Both cultures were required for chip manufacturing the next day ([https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]). The chips´ fluorescence was meant to be measured with a plate reader starting ~11:00 the next day. The chips were meant to be measured in parallel.<br />
<br />
*At 20:30 eight cultures listed below were plated out for additional characterization experiments on monday.<br />
**B0015 in pSB1C3<br />
**I20260 in pSB3K3<br />
**K731520 pSB1C3 #2<br />
**I746909 in pSB1C3<br />
**K1319042 i pSB1C3 #2<br />
**K1319008 in pSB1C3 #1<br />
**K1319008/13 in pSB1C3/3K3 #1<br />
**K1319008/14 in pSB1C3/3K3 #2<br />
<br />
==12th==<br />
<br />
*At 9:00 sensor-chips were prepared from precultures of BL21 K1319042.pSB1C3 and DH5α K1319026pSB1C.pSB1C3 accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols/detection sensor-chip manufacturing protocol]. The cultures were induced at ~11:00 and fluorescence was measured using a plate-reader. K1319026 was additionally measured in our device for its fluorescence.<br />
* Media with different antibiotics for the experiment for collaboration with Heidelberg were prepared. Also media for Robolektor were made.<br />
* Cultures of I13507 in seven vectors listed below were solued in 0,9% NaCl for the OD measurment. Then all cultures and an additional positive control were inoculated in 96-wellsplate with resulted OD of 0,648. The cultures were required for calibration of the plate-reader used for fluorescence measurement, which was part of the Heidelberg chracaterization project. Inocculation was done at ~19:15.<br />
**pSBX1A3<br />
**pSBX4A5<br />
**pSBX1C3<br />
**pSBX4C5<br />
**pSBX1K3<br />
**pSBX4K5<br />
**pSBX1T3<br />
<br />
*At 22:15 a 300 ml flask containing 30 ml LB-medium was inocculated with I746909.pSB1C3. The culture was required for calibration of the robolector (Jülich FHZ). Cloramphenicol was used as antibiotic.<br />
<br />
==13th==<br />
* overnight culture of K131026 in BL21 for chips<br />
<br />
==14th==<br />
* made chips of K131026 in BL21 in LB. Images were taken nearly every 5 or 2&nbsp;min with our own device. Chips were induced with 2&nbsp;µl of ''Pseudomonas aeruginosa'' liquid culture or 500&nbsp;µg/ml HSL<br />
* overnight cultures of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 in BL21 for chips<br />
<br />
== 15th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8 and K1319014&nbsp;+&nbsp;8 (BL21) in LB. Images were taken every 2&nbsp;min with our own device and every 4&nbsp;min in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
* made overnight cultures of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 for chips<br />
<br />
== 16th ==<br />
* made chips of K1319013&nbsp;+&nbsp;8, K1319014&nbsp;+&nbsp;8, K731520 and I746909 in LB. Images were taken every 2&nbsp;min with our own device from K731520 and I746909 and every 4&nbsp;min from all strains in the plate reader. Chips were induced with 2&nbsp;µl of IPTG (100&nbsp;mM).<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T16:19:02Z<p>StefanReinhold: /* 19th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5α cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5α, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5α for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/SeptemberTeam:Aachen/Notebook/Wetlab/September2014-10-17T16:18:47Z<p>StefanReinhold: /* 18th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= September =<br />
== 1st ==<br />
* 5&nbsp;ml cultures of K1319003 and K1319004<br />
* plasmid prep<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! DNA [ng/µl] <br />
|-<br />
| J23101.K516032 pSB1K3|| 23.5<br />
|-<br />
| J23115.K516032 pSB1K3|| 20.5<br />
|-<br />
| J04450 pSB1A3|| 57.5<br />
|-<br />
| J04450 pSB1K1|| 63.5<br />
|} </center><br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 2nd ==<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_02_09_2014_K131026_dh5a_serie.png|title=Sensor Chips with K131026 in DH5α in LB taken with the second version of our own device|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
* gel purification of vector backbones <br />
* sent to sequencing:<br />
** K1318003<br />
** K1319004<br />
** J23101.K516032 <br />
** J23115.K516032<br />
<br />
== 3rd ==<br />
* prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.<br />
<br />
== 4th ==<br />
* In the morning, at 10:15, we inoculated the precultures for the interlab study experiment.<br />
* prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:<br />
<br />
<center><br />
{| class="wikitable"<br />
! vector !! concentration [ng/µL]<br />
|-<br />
| pSBX1A3 || 111<br />
|-<br />
| pSBX4A5 || 14.1<br />
|-<br />
| pSBX1C3 || 31<br />
|-<br />
| pSB4C5 || 98.5<br />
|-<br />
| pSBX1K3 || 18<br />
|-<br />
| pSBX4K5 || 30<br />
|-<br />
| pSBX1T3 || 39<br />
|-<br />
| constitutive expression plasmid || 73<br />
|}<br />
</center><br />
<br />
* PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)<br />
<center><br />
{| class="wikitable"<br />
! PCR tube # !! components<br />
|-<br />
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R<br />
|-<br />
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R<br />
|-<br />
|}<br />
</center><br />
<br />
The PCR conditions:<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30", 98°C for 10", 55°C for 30", 72°C for 2'15"<br />
|-<br />
| denature || 98 || 10"<br />
|-<br />
| anneal || 50 (insert) 55 (backbone) || 30"<br />
|-<br />
| elongate || 72 || 0'30" (insert) 2'15" (backbone)<br />
|-<br />
| elongate || 72 || 2"<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* Finally, we did the Gibson assembly and a heat shock transformation into NEB10β cells.<br />
<br />
* At 10:15, we inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.<br />
<br />
== 5th ==<br />
* made master plates of yesterday's transformed cells.<br />
<br />
== 6th ==<br />
* made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.<br />
<br />
== 7th ==<br />
* made cryos stocks of the precultures<br />
* made chips with K131026 in DH5α and NEB and B0015 in NEB. Images were taken every 30 min with our own device <br />
<center><br />
{{Team:Aachen/Figure|Aachen_07_09_2014_B0015_neb_serie.png|title=Sensor Chips with B0015 in NEB (negativ control) in TB taken with the second version of our own device|subtitle=Sensor chips with B0015 in NEB in TB medium with 1,5% agar, right chip induced. A) befor induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 0&nbsp;h after induction C) 0.5&nbsp;h after induction D) 1&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
* purification of the following plasmids:<br />
<br />
<center><br />
{| class="wikitable"<br />
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||<br />
|-<br />
|K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||<br />
|-<br />
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||<br />
|}<br />
</center><br />
<br />
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.<br />
<br />
== 9th ==<br />
* made chips with K131026 in DH5α and NEB and without cells. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_09_09_2014_K131026_neb_agarose_serie.png|title=Sensor Chips with K131026 in DH5α in LB|subtitle=Sensor chips with K131026 in DH5α in LB medium with 1,5% agarose, right chip induced. A) befor induction with 1&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 10th ==<br />
* SDS page of REACh constructs after Gibson <br />
* plasmid prep of Gal3 YFP<br />
** #3: 20&nbsp;ng/µl<br />
** #4: 21.5&nbsp;ng/µl<br />
** #6: 15.9&nbsp;ng/µl<br />
<br />
== 15th ==<br />
analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008. <br />
<br />
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.<br />
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations. <br />
<br />
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.<br />
<br />
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct. <br />
<br />
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.<br />
* over night cultures of K131026 in DH5α and NEB<br />
<br />
== 16th ==<br />
<br />
* made master plates of the transformation from the day before. <br />
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.<br />
* made chips with K131026 in DH5α and NEB. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_16_09_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agarose, right chip induced. A) 0.5&nbsp;h after induction with 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12) B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction E) 2.5&nbsp;h after induction F) 3&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 17th ==<br />
<br />
* prepped and autoclaved 33 500&nbsp;mL shake flasks.<br />
<br />
== 18th ==<br />
* SDS page of REACh constructs with TEV and IPTG<br />
* over night cultures of K131026, B0015, K1319013, K1319014, K1319013 + K1319008 and K1319014 + K1319008 all in BL21<br />
* tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5α cells and incubated at 37°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5α, are adequate for the kind of school experiment we are planning with the NEAnderLab.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}<br />
</center><br />
<br />
== 19th ==<br />
* made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.<br />
<br />
* did plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).<br />
<br />
* made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).<br />
<br />
* also inoculated 4 cultures for the further testing of the OD/F device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015. <br />
<br />
* Furthermore, did a growth experiment with DH5alpha for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. we concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}<br />
</center><br />
<br />
* made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. Images were taken every 30 minutes with our own device.<br />
<br />
* tested our OD/F device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F device (fluorescence) and platereader (fluorescence).<br />
<br />
* made two SDS gels. <br />
<br />
* inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)<br />
<br />
== 20th ==<br />
* SDS page of REACh constructs with TEV protease and induced by IPTG<br />
<br />
== 22nd ==<br />
<br />
* we poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.<br />
<br />
== 26th ==<br />
* We did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.<br />
<br />
* Gradient PCR to test new primer:<br />
did gradient PCR with these new primers:<br />
<br />
<center><br />
{| class="wikitable"<br />
! name !! sequence<br />
|-<br />
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC<br />
|-<br />
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG<br />
|-<br />
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG<br />
|-<br />
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG<br />
|}<br />
</center><br />
<br />
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.<br />
<br />
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:<br />
<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???<br />
|-<br />
| G00100_Alternative || G00101_Alternative || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65°C.|width=800px}}<br />
</center><br />
<br />
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???<br />
|-<br />
| G00100_Alternative || I746916_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65°C. Apparently the K1319008 template contained I746916.|width=800px}}<br />
</center><br />
<br />
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:<br />
<center><br />
{| class="wikitable"<br />
! primer_F !! primer_R !! template !! expected length !! best annealing temperature<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???<br />
|-<br />
| G00100_Alternative || K1319004_check_R || water || --- || ???<br />
|}<br />
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}<br />
</center><br />
<br />
The results of these three PCRs are:<br />
# KAPA2G Fast ReadyMix worked well<br />
# all three primers work well at >65°C annealing temperature<br />
# K1319008 template contained I746916 instead of the intended K1319004 ORF<br />
<br />
It was concluded that a similar check PCR with 65°C annealing temperature will be done on all plasmids and cryos of K1319008.<br />
<br />
== 27th ==<br />
* First we transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.<br />
<br />
* transformed several constructs into chemically competent BL21(DE3) cells.<br />
<br />
* we did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.<br />
<br />
* we also made check a PCR on galectin-constructs:<br />
<center><br />
{| class="wikitable"<br />
! label !! primer_F !! primer_R !! expected length !! result<br />
|-<br />
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???<br />
|-<br />
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???<br />
|-<br />
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???<br />
|-<br />
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???<br />
|}<br />
</center><br />
<br />
== 28th ==<br />
* made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then we ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.<br />
<br />
== 29th ==<br />
<br />
* made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. We determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.<br />
<br />
* prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.<br />
<br />
== 30th ==<br />
<br />
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3). <br />
<br />
* A plasmid prep of K1319013 and K1319014 was run.<br />
<br />
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells. <br />
<br />
* The pSB1C3 plasmid backbones were amplified via PCR and purified.<br />
<br />
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated. <br />
<br />
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.<br />
<br />
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.<br />
<br />
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-17T16:17:56Z<p>StefanReinhold: /* 6th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5α, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5α || 60<br />
|-<br />
| K131026 DH5α || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5α || 2029, 1780<br />
|-<br />
| K131026 DH5α || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The '''Quikchange''' mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
** forward primer EYFPtoREACh2_F: AGTACAACTGGAACAGCCGCAACGTCTATATCATG<br />
** rewerse primer EYFPtoREACh2_R: ATAGACGTTGCGGCTGTTCCAGTTGTACTCCAGCTTG<br />
<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
* REACh1 gets number K1319001 and REACh2 gets number K1319002.<br />
<br />
* PCR product was restricted with DpnI 60&nbsp;min at 37°C to destroy the methylated template. Then DpnI was deaktevated at 80°C during 20&nbsp;min.<br />
* PCR product was purifired and transformated in DH5α.<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10β and DH5α cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55°C, 57°C and 60°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quickchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/AugustTeam:Aachen/Notebook/Wetlab/August2014-10-17T16:17:35Z<p>StefanReinhold: /* 4th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= August =<br />
== 1st ==<br />
* made electrocompetent ''E.coli'' rosetta cells.<br />
* prepared cultures of K1319042 and K131026<br />
<br />
== 2nd ==<br />
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader. <br />
* tested K131026 and K1319042 for fluorescence in the plate reader<br />
* did a heat shock transformation of I746909 into NEB TOP 10 cells<br />
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta<br />
<br />
== 3rd ==<br />
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken. <br />
* cryo cultures of K131026 and K1319042 were prepared<br />
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures<br />
<br />
== 4th ==<br />
* made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5α, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.<br />
* made plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.<br />
<br />
<center><br />
{| class="wikitable"<br />
! combination !! concentration [ng/µl]<br />
|-<br />
| I746909 BL21 #1 || 73.5<br />
|-<br />
| I746909 BL21 #2 || 45<br />
|-<br />
| I746909 BL21 #3 || 49<br />
|-<br />
| K1319042 DH5α || 60<br />
|-<br />
| K131026 DH5α || 150<br />
|-<br />
| pET17-Gal3 #1 || 30.5<br />
|-<br />
| pET17-Gal3 #2 || 6.4<br />
|-<br />
| pET17-Gal3 #3 || 6.3<br />
|-<br />
| pET17-Gal3 #4 || 9.4<br />
|-<br />
| pET17-Gal3 #5 || 10.1<br />
|-<br />
| pET17-Gal3 #6 || 8.2<br />
|-<br />
| pET17-Gal3 #7 || 13.8<br />
|-<br />
| pET17-Gal3 #8 || 6.9<br />
|-<br />
| pET17-Gal3 #9 || 10.2<br />
|}<br />
</center><br />
<br />
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.<br />
<br />
<center><br />
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=400px}}<br />
<br />
{| class="wikitable"<br />
! combination !! cut products[bp]<br />
|-<br />
| I746909 BL21 #1 || 2029, 947<br />
|-<br />
| K1319042 DH5α || 2029, 1780<br />
|-<br />
| K131026 DH5α || 2029, 1848<br />
|-<br />
| pET17-Gal3 #1 || 3086, 923, 1262<br />
|}<br />
</center><br />
<br />
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.<br />
* prepared an over night cultur of K1319042 for chips<br />
<br />
== 5th ==<br />
* assembly of a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.<br />
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00<br />
* transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.<br />
* made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc<br />
* made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB<br />
<br />
* The '''Quikchange''' mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other.<br />
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC<br />
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG<br />
** forward primer EYFPtoREACh2_F: AGTACAACTGGAACAGCCGCAACGTCTATATCATG<br />
** rewerse primer EYFPtoREACh2_R: ATAGACGTTGCGGCTGTTCCAGTTGTACTCCAGCTTG<br />
<br />
'''1. Step''' with 3 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 30"<br />
|-<br />
| elongate || 72 || 30"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
'''2. Step''' with 14 cycles<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| denature || 98 || 30"<br />
|-<br />
| anneal || 55 || 60"<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| elongate || 72 || 3'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quichchange from K1319000 to K1319001 and K1319002 |width=400px}}<br />
</center><br />
<br />
* REACh1 gets number K1319001 and REACh2 gets number K1319002.<br />
<br />
* PCR product was restricted with DpnI 60&nbsp;min at 37°C to destroy the methylated template. Then DpnI was deaktevated at 80°C during 20&nbsp;min.<br />
* PCR product was purifired and transformated in DH5α.<br />
<br />
== 6th ==<br />
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.<br />
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.<br />
* made precultures of NEB10βand DH5 alpha cells<br />
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.<br />
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55°C, 57°C and 60°C. Then the agarose gel with PCR product samples was made.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-06_to_REACh2.png|title=Agarose gel with PCR products after Quickchange from K1319000 to K1319002 |width=400px}}<br />
</center><br />
<br />
== 7th ==<br />
* made media for ''Pseudomonas flourescens''<br />
** Nutrient Broth<br />
** Pseudomonas-F<br />
** Pseudomonas-P<br />
* made 2&nbsp;L LB<br />
<br />
== 8th ==<br />
* prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042<br />
* prepared 5&nbsp;ml K131026 and C0179<br />
* made SDS page<br />
<br />
== 9th ==<br />
* made a plate reader experiment with K131026 in LB and LB + HM<br />
<br />
== 11th ==<br />
* plated on LB + antibiotics<br />
** K131026<br />
** I746909<br />
** K13190042<br />
** I04450 in pSB1C3<br />
** I04450 in pSB1A3<br />
** I04450 in pSB1K3<br />
** pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)<br />
<br />
== 13th ==<br />
* Agarose chips were prepared:<br />
** ''E. coli'' DH5α K131026 and I746909 in LB and HM<br />
** K1319042 and the pSEVA two plasmid construct in HM<br />
* Images were taken every 30 min with the Geldoc<br />
<br />
==15th ==<br />
* A bioreactor containing 1&nbsp;L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.<br />
<br />
== 16th ==<br />
* The above mentioned Bioreactor was stopped after 20&nbsp;h and all cells were lysed.<br />
<br />
== 18th ==<br />
* Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made<br />
* 3x J23101.E0240 was plated<br />
* pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.<br />
<br />
== 19th ==<br />
* Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc<br />
* A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2% agarose gel<br />
* A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6&nbsp;mL. <br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-08-18_Gal3_purification_iVA.png|title=YFP-Gal3 protein purification|subtitle=|width=400px}}<br />
</center><br />
<br />
* Two samples with YFP-Gal3 were concentrated till 1&nbsp;mL <br />
* The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42&nbsp;mg/ml<br />
<br />
== 20th ==<br />
* repeat PCR for REACh1 and J23101.E0240 and run a gel<br />
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909<br />
<br />
== 24th ==<br />
* made 2.5&nbsp;L LB<br />
* made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device<br />
<center><br />
{{Team:Aachen/Figure|Aachen_24_08_2014_K131026_bl21_serie.png|title=Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in BL21 in LB medium with 1,5% agar, lower chip induced. A) befor induction with 2&nbsp;µl of 5000&nbsp;µg/ml HSL (3-oxo-C12) B) 0.5&nbsp;h after induction C) 1&nbsp;h after induction D) 1.5&nbsp;h after induction E) 2&nbsp;h after induction F) 2.5&nbsp;h after induction|width=900px}}<br />
</center><br />
<br />
== 25th ==<br />
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)<br />
* tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30°C at 250&nbsp;rpm.<br />
* prepared over night cultures of K131026 in DH5α and NEB for chips<br />
* prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep<br />
<br />
== 26th ==<br />
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.<br />
* plasmid prep of I20260, K516032 and B0034<br />
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI<br />
* gel with restricted the I20260, K516032 and B0034 was run<br />
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3<br />
* restriciton of synthesized TEV protease with EcoRI and PstI<br />
* qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.<br />
* made chips with K131026 in DH5α and NEB, in LB and LB + 10% glycerol. Images were taken with our own device every 10 min (illumination problems).<br />
<center><br />
{{Team:Aachen/Figure|Aachen_26_08_2014_K131026_neb_serie.png|title=Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device|subtitle=Sensor chips with K131026 in NEB in LB medium with 1,5% agar. Chip on the top induced with 0.5&nbsp;µl of 500&nbsp;µg/ml HSL and on the bottom with less than 0.2&nbsp;µl of 500&nbsp;µg/ml HSL (3-oxo-C12). A) befor induction B) 1&nbsp;h after induction C) 1.5&nbsp;h after induction D) 2&nbsp;h after induction |width=600px}}<br />
</center><br />
* plasmid prep of the back bones, restriction and gel purification<br />
<br />
== 27th ==<br />
* transformation of some BioBricks<br />
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3<br />
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively<br />
<br />
== 28th ==<br />
* transformation of some BioBricks<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/JulyTeam:Aachen/Notebook/Wetlab/July2014-10-17T16:16:49Z<p>StefanReinhold: /* 25th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= July =<br />
== 1st ==<br />
* transformation efficiency kit is broken<br />
&rarr; run an agarose gel with the kit plasmids to check for nuclease activity/ bands<br />
* inventory of the -80°C freezer was done<br />
<br />
== 2nd ==<br />
* overnight cultures (LB) of K731520 and K1319042 for chips were inoculated<br />
<br />
== 3rd ==<br />
* ODs of the overnight culture of <br />
** K731520: 2.3 <br />
** K1319042: 2.5<br />
* made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-03_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 first try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5% agar. A) befor induction with IPTG B) 1&nbsp;h after induction C) 4.5&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* print K1319042 Chip on LB plate<br />
* overnight culture of E0030 for plasmid prep<br />
<br />
== 4th ==<br />
* plasmid prep of E0030: 159.5 ng/µl (concentration)<br />
* print of K1319042 Chip on LB plate made 1 and 7 colonies<br />
<br />
== 7th ==<br />
* 13 Biobricks were transformed<br />
* overnight culture of K103006 for a plasmid prep was inoculated<br />
* colony PCR master mix was prepared<br />
<br />
== 8th ==<br />
* overnight culture of K1319042 for chips was inoculated<br />
<br />
== 9th ==<br />
* made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-07-09_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 second try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5% agar. A) befor induction with IPTG B) 1.5&nbsp;h after induction C) 3&nbsp;h after induction a) induced with 2x&nbsp;2&nbsp;µl 1&nbsp;mM IPTG b) induced with 2x&nbsp;2&nbsp;µl 10&nbsp;mM IPTG c) induced with 2x&nbsp;2&nbsp;µl 0.1&nbsp;mM IPTG d) induced with 2x&nbsp;2&nbsp;µl 100&nbsp;mM IPTG|width=900px}}<br />
</center><br />
* made OmpA-linker_iLOV 3A-Assambley<br />
* colony PCR<br />
* transformation for backbones<br />
<br />
== 10th ==<br />
* master plates of the strains for backbone isolation<br />
<br />
== 14th ==<br />
* built again J23115.E0240 for interlab study<br />
<br />
== 15th ==<br />
* made 500&nbsp;ml LB and LB plates<br />
* made the transformation of J23115.E0240<br />
* overnight culture of K1319042 for chips<br />
<br />
== 16th ==<br />
* did plasmid preps<br />
* transformation of different reporter strains<br />
** NEB <br />
***pSEVE641_BsFbFP<br />
***pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
**BL21<br />
***pSEVE641_BsFbFP pSEVA234_LasR<br />
***pSEVE641_BsFbFP pSB1C3_C0179<br />
* made chips with K1319042 in Hartman, Hartman + 20% glycerol, M9 medium images were taken every 30 min with the Geldoc<br />
* The PCR of Biobrick E0030 in vector pSB1C3 with primers for RFC 25 was made. The expected length is <br />
** forward primer EYFP_RFC25_F: ACGTTGAATTCGCGGCCGCTTCTAGATGGCCGGCGTGAGCAAGGGCGAGGAG<br />
** rewerse primer EYFP_RFC25_R: ATCCTGCAGCGGCCGCTACTAGTATTAACCGGTGTACAGCTCGTCCATGC<br />
* PCR product gets number K1319000 <br />
<br />
<br />
<center><br />
{| class="wikitable"<br />
! step !! temperature [°C] !! duration<br />
|-<br />
| denature || 94 || 60"<br />
|-<br />
| denature || 94 || 30"<br />
|-<br />
| anneal || 50/60,4/64,9 || 30"<br />
|-<br />
| elongate || 72 || 60"<br />
|-<br />
| elongate || 72 || 5'<br />
|-<br />
| store || 8 || indefinite<br />
|}<br />
</center><br />
<br />
* The agarose gel with PCR product was made. Expected length is 778 kb.<br />
<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-09-17_E0030_with_RFC25.png|title=Agarose gel with PCR products after PCR from E0030 to K1319000 |width=400px}}<br />
</center><br />
* as it can be seen on the picture PCR worked with all annealing temperatures, all samples were used for a transformation in DH5α after the restriction with DpnI.<br />
<br />
== 17th ==<br />
* the PCR product was purificated and the concentration was measured.<br />
* Restriktion of PCR product for the insert and E0030 for the vector with ''Eco''RI and PstI with following purification from agarose gel was made.<br />
<br />
== 21st ==<br />
* the ligation of PCR product (K1319000) and the vector that was purified from agarose (from E0030) was made.<br />
* ligated product was tranformed in DH5α.<br />
<br />
== 22nd ==<br />
* made 100x stocks for Hartmans minimal medium.<br />
* made about 25 HM+C plates without glucose.<br />
* K1319042 was plated on a HM+C plate<br />
<br />
== 23rd ==<br />
* made 25 new HM+C plates with 1% agar and 4&nbsp;g/L glucose<br />
* added 170&nbsp;µL of the glucose stock (500&nbsp;g/L) to the glucose-free HM+C-plates<br />
* 1&nbsp;L of sterile HM+glucose was prepared<br />
* K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5&nbsp;mL HM+C+Glucose precultures were inoculated (17:00)<br />
<br />
== 24th ==<br />
* K1319042 did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E.&nbsp;coli'' is missing some vitamins<br />
* Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20&nbsp;mL supplement stock solution that can be added to 1x HM media<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Component !! supplement for 1x HM [g/L] !! final 1x concentration<br />
|-<br />
| Casamino acids || 2 || 2 g/L<br />
|-<br />
| Thiamine hydrochloride || 0.3 || 300 mg/L<br />
|-<br />
| MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L<br />
|-<br />
| CaCl{{sub|2}} || 0.011 || 0.1 mmol/L<br />
|}<br />
</center><br />
<br />
The powders for 1&nbsp;L of 1x HM were dissolved in 20&nbsp;mL of a 10%&nbsp;w/v Casamino acid stock solution and filter-sterilized (.22&nbsp;µm PES). To make agar chips, we can add 1&nbsp;mL to the hot agar mixture, together with the three 500&nbsp;µL 100x stocks for the HM.<br />
<br />
We made 250&nbsp;mL of HM+C+Glucose+Supplements plates with 1.5% agar.<br />
<br />
Then we plated the following combinations:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! Construct !! HM+C+Glucose+Supplements !! LB+C<br />
|-<br />
| K1319042 || - || +<br />
|-<br />
| J23101.E0240 || + || +<br />
|}<br />
</center><br />
<br />
We also prepared a 150&nbsp;mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th.<br />
<br />
Six of last weeks J23115.E0240 clones were plated on LB+C, and 5&nbsp;mL LB+C precultures were inoculated for plasmid preparation.<br />
<br />
== 25th ==<br />
The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, we set up a colony PCR:<br />
<br />
<center><br />
{| class="wikitable"<br />
|-<br />
! ID !! Template !! Product Length !! Result<br />
|-<br />
| 1 || J23101.E0240 #5 || 1233 ||<br />
|-<br />
| 2 || J23101.E0240 #6 || 1233 ||<br />
|-<br />
| 3 || J23101.E0240 #5 plasmid || 1233 ||<br />
|-<br />
| 4 || K1319042 LB colony || 2053 ||<br />
|-<br />
| 5 || K1319042 plasmid || 2053 ||<br />
|-<br />
| 6 || K731520 GFP plasmid || 2437 ||<br />
|-<br />
| 7 || water || none ||<br />
|}<br />
</center><br />
<br />
Reaction volume per tube was 15&nbsp;µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:<br />
<br />
<center><br />
{| class="wikitable"<br />
! parameter !! duration !! temp [°C]<br />
|-<br />
| denature || 10:00 || 95<br />
|-<br />
| '''denature''' || 00:30 || 95<br />
|-<br />
| '''anneal''' || 00:30 || 49<br />
|-<br />
| '''elongate''' || 02:36 || 72<br />
|-<br />
| elongate || 05:00 || 72<br />
|-<br />
| store || forever|| 8<br />
|}<br />
</center><br />
<br />
We mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3&nbsp;mL instead of 1.5&nbsp;mL culture medium and eluted twice with 25&nbsp;µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].<br />
<br />
The resulting DNA concentrations are listed in this table:<br />
<br />
<center><br />
{| class="wikitable"<br />
! clone # !! concentration [ng/µl]<br />
|-<br />
| 1 || 73.5<br />
|-<br />
| 2 || 94.5<br />
|-<br />
| 3 || 100.5<br />
|-<br />
| 4 || 53<br />
|-<br />
| 5 || 82<br />
|-<br />
| 6 || 138<br />
|}<br />
</center><br />
<br />
In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, we re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)<br />
<br />
<center><br />
{| class="wikitable"<br />
! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements<br />
|-<br />
| J23101.E0240 || NEB10β || ++ || - || ++<br />
|-<br />
| K1319042 || DH5α || ++ || - || (+)<br />
|-<br />
| K131026 || NEB10β || ++ || - || -<br />
|-<br />
| K131026 || DH5α || ++ || - || +<br />
|}<br />
</center><br />
<br />
We inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.<br />
<br />
<!-- == 28th ==<br />
IMPORTANT: Look for customs documents and write ZHV lady!!!! --><br />
<br />
== 29th ==<br />
* inoculate 2x 150&nbsp;ml cultures HM+Glucose+C<br />
* prepared 200&nbsp;ml 1.5% agar<br />
* pre-cool centrifuge<br />
* centrifuge 1x 50, 1x 100 and 1x 150&nbsp;ml<br />
* make 3 kinds of chips - OOx1, ODx2, ODx3<br />
* pre cultures of K1319042 and K131026 in LB<br />
<br />
== 30th ==<br />
* made chips with K1319042 and K131026 in HM medium images were taken every 30 min with the Geldoc<br />
* print chips on LB and LB + Cam , count 2-10 colonies<br />
<br />
== 31th ==<br />
* transformation of K1319042 and K131026 in DH5α, BL21 and NEB<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/MayTeam:Aachen/Notebook/Wetlab/May2014-10-17T16:11:15Z<p>StefanReinhold: /* 21th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= May =<br />
== 1st ==<br />
* A gel with M - full -full - REACh1 SOE3.2 - REACH2 SOE3.2 - M was run<br />
*: &rarr; 120&nbsp;V, 30 min<br />
*: &rarr; cut out the bands<br />
<br />
== 5th ==<br />
<br />
* Chemical competent DH5α and BL21 cells were made<br />
<br />
== 8th ==<br />
* The efficiency of our competent cells was tested<br />
*: &rarr; BL21: 6.6 x 10<sup>4</sup> clones/µg DNA<br />
*: &rarr; DH5α: 2.59 x 10<sup>7</sup> clones/µg DNA<br />
* SOE-PCR step 2 like on 30.04. with the template of SOE1 from 30.04. was re-done<br />
* The SOE2 product was run on a gel for checking (5&nbsp;µL)<br />
*: &rarr; restriction, (dephosphorylation of vector)<br />
*: &rarr; purification on a gel with high pure kit<br />
<br />
== 14th ==<br />
* LB agar plates with chloramphenicol and some with ampicillin were made<br />
* REACh2 was purified on 1.2% agarose gel<br />
* A subsequent purification of the 778 bp fragment with High Pure PCR Product Purification Kit was done<br />
<br />
== 19th ==<br />
* K131026 (AHL inducible GFP) was transformed into DH5α and NEB<br />
* K731520 (IPTG inducible GFPmut3b) was transformed into DH5α<br />
<br />
== 20th ==<br />
* Master plates with chloramphenicol (cam) &rarr; at least 6 clones on each plate<br />
* 2x 5&nbsp;mL LB + cam were prepared<br />
* Sterile 50% glycerol was made<br />
<br />
== 21th ==<br />
* Cryo stocks of clones 1 & 2 of each BioBrick/ host were prepared<br />
* 15&nbsp;mL cultures in 250&nbsp;mL flasks, inoculated with 1.5&nbsp;mL preculture (3 cultures A B C from clones 1; 1 + 2; 2)<br />
* 250&nbsp;µl cam from a 35&nbsp;mg/mL stock was added<br />
* The cultures were grown until OD<sub>600</sub>= 0.6, then one was induced with IPTG<br />
<center><br />
{| class="wikitable"<br />
! time !! colspan="3" | info/ OD<br />
|-<br />
| '''11:10'''||A: inoculated ||B: inoculated ||C: inoculated <br />
|-<br />
| '''11:38'''||A: 0.482 ||B: 0.464 ||C: 0.466<br />
|-<br />
| '''12:28'''||A: 0.586; induced with 0.1&nbsp;mM IPTG ||B: 0.576 ||C: 0.568<br />
|-<br />
| '''14:11'''||A: 0.93 ||B: 0.91 ||C: 0.942<br />
|}<br />
</center><br />
&rarr; A negative control without plasmid was left out<br />
<br />
== 23rd ==<br />
* Some BioBricks were transformed<br />
* Colony PCR (s. picture below)<br />
*: &rarr; K131026: 1807&nbsp;bp<br />
*: &rarr; K731520: 2123&nbsp;bp<br />
*: &rarr; full length EYFP: 778&nbsp;bp<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-05-23_COLONY-PCR.jpg|title=Colony PCR |subtitle=todo|width=300px}}<br />
</center><br />
{{Team:Aachen/JumpUp}}<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/Team:Aachen/Notebook/Wetlab/MayTeam:Aachen/Notebook/Wetlab/May2014-10-17T16:11:04Z<p>StefanReinhold: /* 20th */</p>
<hr />
<div>__NOTOC__<br />
{{CSS/Main}}<br />
{{Team:Aachen/Stylesheet}}<br />
{{Team:Aachen/Header}}<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
<br />
= May =<br />
== 1st ==<br />
* A gel with M - full -full - REACh1 SOE3.2 - REACH2 SOE3.2 - M was run<br />
*: &rarr; 120&nbsp;V, 30 min<br />
*: &rarr; cut out the bands<br />
<br />
== 5th ==<br />
<br />
* Chemical competent DH5α and BL21 cells were made<br />
<br />
== 8th ==<br />
* The efficiency of our competent cells was tested<br />
*: &rarr; BL21: 6.6 x 10<sup>4</sup> clones/µg DNA<br />
*: &rarr; DH5α: 2.59 x 10<sup>7</sup> clones/µg DNA<br />
* SOE-PCR step 2 like on 30.04. with the template of SOE1 from 30.04. was re-done<br />
* The SOE2 product was run on a gel for checking (5&nbsp;µL)<br />
*: &rarr; restriction, (dephosphorylation of vector)<br />
*: &rarr; purification on a gel with high pure kit<br />
<br />
== 14th ==<br />
* LB agar plates with chloramphenicol and some with ampicillin were made<br />
* REACh2 was purified on 1.2% agarose gel<br />
* A subsequent purification of the 778 bp fragment with High Pure PCR Product Purification Kit was done<br />
<br />
== 19th ==<br />
* K131026 (AHL inducible GFP) was transformed into DH5α and NEB<br />
* K731520 (IPTG inducible GFPmut3b) was transformed into DH5α<br />
<br />
== 20th ==<br />
* Master plates with chloramphenicol (cam) &rarr; at least 6 clones on each plate<br />
* 2x 5&nbsp;mL LB + cam were prepared<br />
* Sterile 50% glycerol was made<br />
<br />
== 21th ==<br />
* Cryo stocks of clones 1 & 2 of each BioBrick/ host were prepared<br />
* 15&nbsp;mL cultures in 250&nbsp;mL flasks, inoculated with 1.5&nbsp;mL preculture (3 cultures A B C from clones 1; 1 + 2; 2)<br />
* 250&nbsp;µl Chloramphilicol from a 35&nbsp;mg/mL stock was added<br />
* The cultures were grown until OD<sub>600</sub>= 0.6, then one was induced with IPTG<br />
<center><br />
{| class="wikitable"<br />
! time !! colspan="3" | info/ OD<br />
|-<br />
| '''11:10'''||A: inoculated ||B: inoculated ||C: inoculated <br />
|-<br />
| '''11:38'''||A: 0.482 ||B: 0.464 ||C: 0.466<br />
|-<br />
| '''12:28'''||A: 0.586; induced with 0.1&nbsp;mM IPTG ||B: 0.576 ||C: 0.568<br />
|-<br />
| '''14:11'''||A: 0.93 ||B: 0.91 ||C: 0.942<br />
|}<br />
</center><br />
&rarr; A negative control without plasmid was left out<br />
<br />
== 23rd ==<br />
* Some BioBricks were transformed<br />
* Colony PCR (s. picture below)<br />
*: &rarr; K131026: 1807&nbsp;bp<br />
*: &rarr; K731520: 2123&nbsp;bp<br />
*: &rarr; full length EYFP: 778&nbsp;bp<br />
<center><br />
{{Team:Aachen/Figure|Aachen_14-05-23_COLONY-PCR.jpg|title=Colony PCR |subtitle=todo|width=300px}}<br />
</center><br />
{{Team:Aachen/JumpUp}}<br />
<br />
<br />
<html><br />
<center><br />
<ul class="menusmall-grid"><br />
<br />
<!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li> --><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
<li style="width:106px;margin-left: 12px;margin-right: 12px;" ><br />
<a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"><br />
<div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div><br />
<div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"><br />
</div><br />
</a><br />
</li><br />
<br />
</ul><br />
</center><br />
</html><br />
{{Team:Aachen/Footer}}</div>StefanReinholdhttp://2014.igem.org/File:Aachen_team_member_Arne_01.jpgFile:Aachen team member Arne 01.jpg2014-10-17T15:42:34Z<p>StefanReinhold: uploaded a new version of &quot;File:Aachen team member Arne 01.jpg&quot;</p>
<hr />
<div></div>StefanReinhold